Browse files

Avoid partial codons and new warning

  • Loading branch information...
1 parent d204c47 commit 668b9a41db4801aa3392d4ad7168c8ebfb553040 @peterjc peterjc committed Mar 23, 2013
Showing with 4 additions and 4 deletions.
  1. +4 −4 Tests/test_translate.py
View
8 Tests/test_translate.py
@@ -26,17 +26,17 @@
# use the standard table
# Do some simple tests first
-s = "T"
+s = ""
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate(to_stop=True)
assert str(protein)==""
-s = "TC"
+s = "TAA"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate(to_stop=True)
assert str(protein)==""
-s = "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATATT"
+s = "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCA"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate(to_stop=True)
assert str(protein)=='ENSFSLDFL'
@@ -51,7 +51,7 @@
protein = dna.translate('Vertebrate Mitochondrial', to_stop=True)
assert str(protein)=="M"
-s = "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATATT"
+s = "GAAAATTCATTTTCTTTGGACTTTCTCTGAAATCCGAGTCCTAGGAAAGATGCGTGAGATTCTTCATAT"
dna = Seq.Seq(s, IUPAC.unambiguous_dna)
protein = dna.translate('SGC8', to_stop=True)
assert str(protein)=='ENSFSLDFLWNPSPSNDAWDSSY'

0 comments on commit 668b9a4

Please sign in to comment.