Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Browse files

Scripts: Some more PEP8 whitespace cleanup.

  • Loading branch information...
commit ae8cc5aeb9888035038983985cc6ac2074bd3643 1 parent d74b89a
@cbrueffer cbrueffer authored peterjc committed
View
2  Scripts/GenBank/check_output.py
@@ -48,7 +48,7 @@ def do_comparison(good_record, test_record):
def write_format(file):
- record_parser = GenBank.RecordParser(debug_level = 2)
+ record_parser = GenBank.RecordParser(debug_level=2)
print "Testing GenBank writing for %s..." % os.path.basename(file)
# be able to handle gzipped files
View
2  Scripts/GenBank/check_output_simple.py
@@ -19,7 +19,7 @@
print "Usage ./check_output.py <GenBank file to parse>"
sys.exit()
-parser = GenBank.FeatureParser(debug_level = 2)
+parser = GenBank.FeatureParser(debug_level=2)
handle = open(sys.argv[1], 'r')
View
4 Scripts/GenBank/find_parser_problems.py
@@ -19,11 +19,11 @@
print "Usage ./find_parser_problems <GenBank file to parse>"
sys.exit()
-feature_parser = GenBank.FeatureParser(debug_level = 0)
+feature_parser = GenBank.FeatureParser(debug_level=0)
parser = GenBank.ErrorParser(feature_parser)
handle = open(sys.argv[1], 'r')
-iterator = GenBank.Iterator(handle, parser, has_header = 1)
+iterator = GenBank.Iterator(handle, parser, has_header=1)
while 1:
have_record = 0
View
4 Scripts/PDB/generate_three_to_one_dict.py
@@ -71,7 +71,7 @@
one = line.strip().split()[-1]
found_one = True
if line.startswith('_chem_comp.three_letter_code'):
- three = '%-3s' % (line.strip().split()[-1],) # make it three-letter
+ three = '%-3s' % (line.strip().split()[-1],) # make it three-letter
found_three = True
if found_one and found_three:
@@ -96,7 +96,7 @@
line = fh.readline()
if len(current_line) < 5:
- three_to_one_buf[-1] = three_to_one_buf[:-1] # remove the last comma
+ three_to_one_buf[-1] = three_to_one_buf[:-1] # remove the last comma
three_to_one_buf.append('}')
else:
three_to_one_buf.append('%s }' % (current_line[:-1]))
View
4 Scripts/Performance/biosql_performance_load.py
@@ -5,8 +5,8 @@
# set up the connection
from Bio import GenBank
from BioSQL import BioSeqDatabase
-server = BioSeqDatabase.open_database(host = "192.168.0.192", user = "root",
- passwd = "", db = "pythonloadtest")
+server = BioSeqDatabase.open_database(host="192.168.0.192", user="root",
+ passwd="", db="pythonloadtest")
# remove the database if it already exists
db_name = "testload"
View
4 Scripts/Performance/biosql_performance_read.py
@@ -4,8 +4,8 @@
import time
# set up the connection
from BioSQL import BioSeqDatabase
-server = BioSeqDatabase.open_database(host = "192.168.0.192", user = "root",
- passwd = "", db = "test_biosql")
+server = BioSeqDatabase.open_database(host="192.168.0.192", user="root",
+ passwd="", db="test_biosql")
db = server["embl_rod"]
# -- do the fasta-only timing part
View
8 Scripts/Restriction/ranacompiler.py
@@ -12,7 +12,7 @@
from Bio.Restriction._Update.RestrictionCompiler import DictionaryBuilder
-def standalone() :
+def standalone():
parser = optparse.OptionParser()
add = parser.add_option
@@ -37,12 +37,12 @@ def standalone() :
options, args = parser.parse_args()
return options, args
-if __name__ == '__main__' :
+if __name__ == '__main__':
options, args = standalone()
Builder = DictionaryBuilder(options.rebase_password, options.ftp_proxy)
Builder.build_dict()
- if options.i :
+ if options.i:
Builder.install_dict()
- else :
+ else:
Builder.no_install()
sys.exit()
View
2  Scripts/Restriction/rebase_update.py
@@ -11,7 +11,7 @@
import optparse
from Bio.Restriction._Update.Update import *
-if __name__ == '__main__' :
+if __name__ == '__main__':
parser = optparse.OptionParser()
add = parser.add_option
View
4 Scripts/query_pubmed.py
@@ -52,7 +52,7 @@ def print_usage():
if count_only:
handle = Entrez.esearch(db="pubmed", term=query)
- else :
+ else:
handle = Entrez.esearch(db="pubmed", term=query, usehistory="Y")
search_results = Entrez.read(handle)
ids = search_results["IdList"]
@@ -65,7 +65,7 @@ def print_usage():
webenv = search_results["WebEnv"]
query_key = search_results["QueryKey"]
batch_size = 3
- for start in range(0, count, batch_size) :
+ for start in range(0, count, batch_size):
end = min(count, start + batch_size)
#print "Going to download record %i to %i" % (start+1, end)
fetch_handle = Entrez.efetch(db="pubmed", rettype="medline",
View
2  Scripts/scop_pdb.py
@@ -113,7 +113,7 @@ def main():
sids = args[2:]
elif input == '-':
sids = sys.stdin.xreadlines()
- else :
+ else:
in_handle = open(input)
sids = in_handle.xreadlines()
View
8 Scripts/xbbtools/nextorf.py
@@ -80,7 +80,7 @@ def ReadFile(self):
CDS.extend(self.GetCDS(self.seq))
if minus:
self.rseq = self.seq.reverse_complement()
- CDS.extend(self.GetCDS(self.rseq, strand = -1))
+ CDS.extend(self.GetCDS(self.rseq, strand=-1))
self.Output(CDS)
def ToFasta(self, header, seq):
@@ -98,7 +98,7 @@ def Gc(self, seq):
def Gc2(self, seq):
l = len(seq)
- d= {}
+ d = {}
for nt in ['A', 'T', 'G', 'C']:
d[nt] = [0, 0, 0]
@@ -150,7 +150,7 @@ def GetOrfCoordinates(self, seq):
frame_coordinates.append(coordinates)
return frame_coordinates
- def GetCDS(self, seq, strand = 1):
+ def GetCDS(self, seq, strand=1):
frame_coordinates = self.GetOrfCoordinates(seq)
START, STOP = 1, 0
so = self.options
@@ -180,7 +180,7 @@ def GetCDS(self, seq, strand = 1):
start_site = start_site + f - 1
if codon == 'XXX':
stop = start_site + 3*((int((stop-1)-start_site)/3))
- s = seq[start_site -1 : stop]
+ s = seq[start_site-1:stop]
CDS.append((start_site, stop, length, s, strand*f))
start_site = 0
if nostart == '1':
View
38 Scripts/xbbtools/xbb_blast.py
@@ -18,7 +18,7 @@
class BlastIt:
- def __init__(self, seq, parent = None):
+ def __init__(self, seq, parent=None):
self.seq = seq
self.parent = parent
self.toplevel = Toplevel(parent)
@@ -46,29 +46,29 @@ def GetBlasts(self):
def Choices(self):
self.GetBlasts()
self.cf = Frame(self.toplevel)
- self.cf.pack(side = TOP, expand = 1, fill = X)
+ self.cf.pack(side=TOP, expand=1, fill=X)
self.dbs = Pmw.ComboBox(self.cf,
- label_text = 'Blast Databases:',
- labelpos = 'nw',
- scrolledlist_items = self.nin + self.pin,
- selectioncommand = self.Validate
+ label_text='Blast Databases:',
+ labelpos='nw',
+ scrolledlist_items=self.nin + self.pin,
+ selectioncommand=self.Validate
)
self.blasts = Pmw.ComboBox(self.cf,
- label_text = 'Blast Programs:',
- labelpos = 'nw',
- scrolledlist_items = ['blastn', 'blastp', 'blastx', 'tblastn', 'tblastx'],
- selectioncommand = self.Validate
+ label_text='Blast Programs:',
+ labelpos='nw',
+ scrolledlist_items=['blastn', 'blastp', 'blastx', 'tblastn', 'tblastx'],
+ selectioncommand=self.Validate
)
- self.dbs.pack(side = LEFT, expand = 1, fill = X)
- self.blasts.pack(side = LEFT, expand = 1, fill = X)
+ self.dbs.pack(side=LEFT, expand=1, fill=X)
+ self.blasts.pack(side=LEFT, expand=1, fill=X)
self.alternative_f = Frame(self.cf)
self.alternative = Entry(self.alternative_f)
- self.alternative_f.pack(side = TOP, fill = X, expand = 1)
- self.alternative.pack(side = LEFT, fill = X, expand = 1)
- self.ok = Button(self.alternative_f, text = 'Run',
- command = self._Run)
- self.ok.pack(side = RIGHT)
+ self.alternative_f.pack(side=TOP, fill=X, expand=1)
+ self.alternative.pack(side=LEFT, fill=X, expand=1)
+ self.ok = Button(self.alternative_f, text='Run',
+ command=self._Run)
+ self.ok.pack(side=RIGHT)
self.dbs.selectitem(0)
self.blasts.selectitem(0)
@@ -83,8 +83,8 @@ def Validate(self, *args):
elif (prog in ['blastp', 'blastx']) == (db in self.pin):
color = 'green'
- self.dbs.component('entry').configure(bg = color)
- self.blasts.component('entry').configure(bg = color)
+ self.dbs.component('entry').configure(bg=color)
+ self.blasts.component('entry').configure(bg=color)
def _Run(self):
alternative_command = self.alternative.get()
View
2  Scripts/xbbtools/xbb_blastbg.py
@@ -18,7 +18,7 @@
class BlastDisplayer:
- def __init__(self, command, text_id = None):
+ def __init__(self, command, text_id=None):
self.command = command
self.tid = text_id
View
16 Scripts/xbbtools/xbb_help.py
@@ -12,20 +12,20 @@ class xbbtools_help(Toplevel):
def __init__(self, *args):
Toplevel.__init__(self)
self.tid = ScrolledText(self)
- self.tid.pack(fill = BOTH, expand = 1)
+ self.tid.pack(fill=BOTH, expand=1)
self.Styles()
self.Show()
def Styles(self):
for c in ['red', 'blue', 'magenta', 'yellow', 'green', 'red4', 'green4', 'blue4']:
- self.tid.tag_configure(c, foreground = c)
+ self.tid.tag_configure(c, foreground=c)
- self.tid.tag_config('underline', underline =1)
- self.tid.tag_config('italic', font = ('Courier', 6, 'italic'))
- self.tid.tag_config('bold', font = ('Courier', 8, 'bold'))
- self.tid.tag_config('title', font = ('Courier', 12, 'bold'))
- self.tid.tag_config('small', font = ('Courier', 6, ''))
- self.tid.tag_config('highlight', background = 'gray')
+ self.tid.tag_config('underline', underline=1)
+ self.tid.tag_config('italic', font=('Courier', 6, 'italic'))
+ self.tid.tag_config('bold', font=('Courier', 8, 'bold'))
+ self.tid.tag_config('title', font=('Courier', 12, 'bold'))
+ self.tid.tag_config('small', font=('Courier', 6, ''))
+ self.tid.tag_config('highlight', background='gray')
def Show(self):
t = self.tid
View
40 Scripts/xbbtools/xbb_search.py
@@ -51,11 +51,11 @@ def IUPAC2regex(self, s):
rx += r
return rx
- def _Search(self, start = 0):
+ def _Search(self, start=0):
pos = self.rx.search(self.sequence, start)
return pos
- def Search(self, start = 0):
+ def Search(self, start=0):
pos = self.rx.search(self.sequence, start)
if pos:
return pos.start()
@@ -78,7 +78,7 @@ def SearchAll(self):
class XDNAsearch(Toplevel, DNAsearch):
- def __init__(self, seq= '', master= None, highlight = 0):
+ def __init__(self, seq='', master=None, highlight=0):
DNAsearch.__init__(self)
self.master = master
self.highlight = highlight
@@ -90,28 +90,28 @@ def __init__(self, seq= '', master= None, highlight = 0):
def init_graphics(self):
Toplevel.__init__(self, self.master)
self.frame = Frame(self)
- self.frame.pack(fill = BOTH, expand = 1)
+ self.frame.pack(fill=BOTH, expand=1)
self.search_entry = Entry(self.frame)
- self.search_entry.pack(fill = BOTH, expand = 1)
+ self.search_entry.pack(fill=BOTH, expand=1)
f2 = Frame(self.frame)
- f2.pack(side = TOP, fill = BOTH, expand = 1)
+ f2.pack(side=TOP, fill=BOTH, expand=1)
f = f2
- self.forward = Button(f, text = 'Search +', command = self.do_search)
- self.forward.pack(side = LEFT)
- self.forward = Button(f, text = 'Search -',
- command = lambda x=self.do_search: x(other_strand=1))
- self.forward.pack(side = LEFT)
- self.cancel = Button(f, text = 'Cancel', command = self.exit)
- self.cancel.pack(side = LEFT)
+ self.forward = Button(f, text='Search +', command=self.do_search)
+ self.forward.pack(side=LEFT)
+ self.forward = Button(f, text='Search -',
+ command=lambda x=self.do_search: x(other_strand=1))
+ self.forward.pack(side=LEFT)
+ self.cancel = Button(f, text='Cancel', command=self.exit)
+ self.cancel.pack(side=LEFT)
self.current_color = 'cyan'
- self.colorb = Button(f, text = 'Color', command = self.change_color, foreground = self.current_color)
- self.colorb.pack(side = LEFT)
+ self.colorb = Button(f, text='Color', command=self.change_color, foreground=self.current_color)
+ self.colorb.pack(side=LEFT)
self.config_color(self.current_color)
- def config_color(self, color = None):
+ def config_color(self, color=None):
if not self.highlight:
return
if not color:
@@ -122,19 +122,19 @@ def config_color(self, color = None):
self.current_color = color
self.current_tag = 'searched_%s' % self.current_color
self.master.tag_config(self.current_tag, background=self.current_color)
- self.master.tag_config(self.current_tag + 'R', background=self.current_color, underline = 1)
+ self.master.tag_config(self.current_tag + 'R', background=self.current_color, underline=1)
self.colors.append(color)
def change_color(self):
self.config_color()
- self.colorb.configure(foreground = self.current_color)
+ self.colorb.configure(foreground=self.current_color)
self.colorb.update()
def get_pattern(self):
pattern = self.search_entry.get()
return pattern
- def do_search(self, other_strand = 0):
+ def do_search(self, other_strand=0):
pattern = self.get_pattern()
if other_strand:
pattern = reverse_complement(pattern)
@@ -165,6 +165,6 @@ def showcolor(self):
if __name__ == '__main__':
seq = 'ATGGTGTGTGTGTACGATCGCCCCCCCCAGTCGATCGATGCATCGTA'
win = Tk()
- xtest = XDNAsearch(seq = seq, master = win)
+ xtest = XDNAsearch(seq=seq, master=win)
win.mainloop()
View
8 Scripts/xbbtools/xbb_translations.py
@@ -18,7 +18,7 @@ class xbb_translations:
def __init__(self):
""
- def frame1(self, seq, translation_table = 1):
+ def frame1(self, seq, translation_table=1):
return translate(seq, table=translation_table)
def complement(self, seq):
@@ -31,7 +31,7 @@ def reverse(self, seq):
def antiparallel(self, seq):
return reverse_complement(seq)
- def frame(self, seq, frame, translation_table = 1):
+ def frame(self, seq, frame, translation_table=1):
if not ((-3 <= frame <= -1) or (1 <= frame <= 3)):
frame = 1
if frame != 1:
@@ -59,7 +59,7 @@ def header_nice(self, txt, seq):
res += '\n\n'
return res
- def frame_nice(self, seq, frame, translation_table = 1):
+ def frame_nice(self, seq, frame, translation_table=1):
length = len(seq)
protein = self.frame(seq, frame, translation_table)
res = self.header_nice('Plus one frame translation', seq)
@@ -77,7 +77,7 @@ def gc(self, seq):
"""Returns a float between 0 and 100."""
return GC(seq)
- def gcframe(self, seq, translation_table = 1):
+ def gcframe(self, seq, translation_table=1):
# always use uppercase nt-sequence !!
comp = self.complement(seq)
anti = self.reverse(comp)
View
16 Scripts/xbbtools/xbb_utils.py
@@ -11,21 +11,21 @@
class NotePad(Toplevel):
- def __init__(self, master= None):
+ def __init__(self, master=None):
Toplevel.__init__(self, master)
self.menubar = Menu(self)
self.filemenu = Menu(self.menubar)
- self.filemenu.add_command(label = "Save", command = self.save)
+ self.filemenu.add_command(label="Save", command=self.save)
self.filemenu.add_separator()
- self.filemenu.add_command(label = "Dismiss", command = self.destroy)
+ self.filemenu.add_command(label="Dismiss", command=self.destroy)
self.menubar.add_cascade(label="File", menu=self.filemenu)
- self.configure(menu = self.menubar)
+ self.configure(menu=self.menubar)
self.yscroll = Scrollbar(self, orient=VERTICAL)
- self.tid = Text(self, yscrollcommand = self.yscroll.set)
- self.yscroll.configure(command = self.tid.yview)
- self.tid.pack(side = LEFT, fill = BOTH, expand = 1)
- self.yscroll.pack(side = RIGHT, fill = Y)
+ self.tid = Text(self, yscrollcommand=self.yscroll.set)
+ self.yscroll.configure(command=self.tid.yview)
+ self.tid.pack(side=LEFT, fill=BOTH, expand=1)
+ self.yscroll.pack(side=RIGHT, fill=Y)
def text_id(self):
return self.tid
View
122 Scripts/xbbtools/xbb_widget.py
@@ -27,7 +27,7 @@
class xbb_widget:
- def __init__(self, parent = None):
+ def __init__(self, parent=None):
self.is_a_master = (parent is None)
self.parent = parent
@@ -39,18 +39,18 @@ def __init__(self, parent = None):
self.init_optionsdb()
self.parent = self.main_frame.master
- self.main_frame.pack(fill = BOTH, expand = 1)
+ self.main_frame.pack(fill=BOTH, expand=1)
# sequence info (GC%, positins etc.)
self.info_frame = Frame(self.main_frame)
- self.info_frame.pack(fill = BOTH, expand = 1)
+ self.info_frame.pack(fill=BOTH, expand=1)
self.create_menu(self.info_frame)
self.create_seqinfo(self.info_frame)
# sequence field and fast buttons
self.seq_frame = Frame(self.main_frame)
- self.seq_frame.pack(fill = BOTH, expand = 1)
+ self.seq_frame.pack(fill=BOTH, expand=1)
self.create_buttons(self.seq_frame)
self.create_seqfield(self.seq_frame)
@@ -126,25 +126,25 @@ def create_menu(self, parent):
# File menu
self.file_menu = Menu(self.menubar)
menu = self.file_menu
- menu.add_command(label='Exit', command = self.exit)
+ menu.add_command(label='Exit', command=self.exit)
self.menubar.add_cascade(label="File", menu=self.file_menu)
# Edit menu
self.edit_menu = Menu(self.menubar)
menu = self.edit_menu
- menu.add_command(label='Complement', command = self.complement)
- menu.add_command(label='Antiparallel', command = self.antiparallel)
- menu.add_command(label='Reverse', command = self.reverse)
- menu.add_command(label='Fix sequence', command = self.fix_sequence)
- menu.add_command(label='Search', command = self.search)
+ menu.add_command(label='Complement', command=self.complement)
+ menu.add_command(label='Antiparallel', command=self.antiparallel)
+ menu.add_command(label='Reverse', command=self.reverse)
+ menu.add_command(label='Fix sequence', command=self.fix_sequence)
+ menu.add_command(label='Search', command=self.search)
self.menubar.add_cascade(label="Edit", menu=self.edit_menu)
# Translation menu
self.translation_menu = Menu(self.menubar)
menu = self.translation_menu
- menu.add_command(label='+1 Frame', command = self.translate)
- menu.add_command(label='6 Frames', command = self.gcframe)
- menu.add_command(label='Extract to FASTA', command = self.extract)
+ menu.add_command(label='+1 Frame', command=self.translate)
+ menu.add_command(label='6 Frames', command=self.gcframe)
+ menu.add_command(label='Extract to FASTA', command=self.extract)
self.current_codon_table = StringVar()
self.current_codon_table.set('Standard')
@@ -158,7 +158,7 @@ def create_menu(self, parent):
self.gencode_menu = Menu(self.translation_menu)
menu = self.gencode_menu
for table in keys:
- menu.add_radiobutton(label=table, command = self.set_codon_table, variable = self.current_codon_table)
+ menu.add_radiobutton(label=table, command=self.set_codon_table, variable=self.current_codon_table)
self.translation_menu.add_cascade(label="Genetic Codes", menu=self.gencode_menu)
self.menubar.add_cascade(label="Translations", menu=self.translation_menu)
@@ -166,17 +166,17 @@ def create_menu(self, parent):
# Tools menu
self.tools_menu = Menu(self.menubar)
menu = self.tools_menu
- menu.add_command(label='Blast', command = self.blast)
- menu.add_command(label='Stats', command = self.statistics)
+ menu.add_command(label='Blast', command=self.blast)
+ menu.add_command(label='Stats', command=self.statistics)
self.menubar.add_cascade(label="Tools", menu=self.tools_menu)
# Help menu
- self.help_menu = Menu(self.menubar, name = 'help')
+ self.help_menu = Menu(self.menubar, name='help')
menu = self.help_menu
- menu.add_command(label='Help', command = xbbtools_help)
+ menu.add_command(label='Help', command=xbbtools_help)
self.menubar.add_cascade(label="Help", menu=self.help_menu)
- self.parent.config(menu = self.menubar)
+ self.parent.config(menu=self.menubar)
def set_codon_table(self):
self.current_codon_table_id = self.translation_tables[self.current_codon_table.get()]
@@ -190,64 +190,64 @@ def exit(self, *args):
def create_seqinfo(self, parent):
# all the sequence information in the top labels
- self.seq_info1 = Frame(parent, relief = RIDGE,
- borderwidth = 5, height = 30)
- self.seq_info1.pack(fill = BOTH, expand = 1, side = TOP)
+ self.seq_info1 = Frame(parent, relief=RIDGE,
+ borderwidth=5, height=30)
+ self.seq_info1.pack(fill=BOTH, expand=1, side=TOP)
self.position_ids = {}
d = self.position_ids
- d['id'] = Label(self.seq_info1, width = 10)
- d['from_id'] = Label(self.seq_info1, width = 10)
- d['to_id'] = Label(self.seq_info1, width = 10)
- d['length_id'] = Label(self.seq_info1, width = 10)
- d['label'] = Label(self.seq_info1, width = 10)
+ d['id'] = Label(self.seq_info1, width=10)
+ d['from_id'] = Label(self.seq_info1, width=10)
+ d['to_id'] = Label(self.seq_info1, width=10)
+ d['length_id'] = Label(self.seq_info1, width=10)
+ d['label'] = Label(self.seq_info1, width=10)
for i in ['id', 'from_id', 'to_id', 'length_id', 'label']:
- d[i].pack(side = LEFT, fill = BOTH, expand = 1)
+ d[i].pack(side=LEFT, fill=BOTH, expand=1)
- self.seq_info2 = Frame(parent, relief = RIDGE,
- borderwidth = 5, height = 30)
- self.seq_info2.pack(fill = BOTH, expand = 1, side = TOP)
+ self.seq_info2 = Frame(parent, relief=RIDGE,
+ borderwidth=5, height=30)
+ self.seq_info2.pack(fill=BOTH, expand=1, side=TOP)
self.statistics_ids = {}
d = self.statistics_ids
- d['length_id'] = Label(self.seq_info2, width = 10)
- d['length_id'].pack(side = LEFT, fill = BOTH, expand = 1)
+ d['length_id'] = Label(self.seq_info2, width=10)
+ d['length_id'].pack(side=LEFT, fill=BOTH, expand=1)
for nt in ['A', 'C', 'G', 'T']:
- d[nt] = Label(self.seq_info2, width = 10, fg = self.colorsNT[nt])
- d[nt].pack(side = LEFT, fill = BOTH, expand = 1)
+ d[nt] = Label(self.seq_info2, width=10, fg=self.colorsNT[nt])
+ d[nt].pack(side=LEFT, fill=BOTH, expand=1)
def create_buttons(self, parent):
self.button_frame = Frame(parent)
- self.button_frame.pack(fill = Y, side = LEFT)
+ self.button_frame.pack(fill=Y, side=LEFT)
self.buttons = {}
for text, func in [('Open', self.open),
('Export', self.export),
('GC Frame', self.gcframe),
('Blast', self.blast),
('Exit', self.exit)]:
- b_id = Button(self.button_frame, text = text,
- command = func, width = 7)
- b_id.pack(side = TOP, pady = 5, padx = 10)
+ b_id = Button(self.button_frame, text=text,
+ command=func, width=7)
+ b_id.pack(side=TOP, pady=5, padx=10)
self.buttons[text] = b_id
f = Frame(self.button_frame)
- l = Label(f, text = 'Goto:', bg = self.colorsbg['frame'], fg = self.colorsfg['button'])
- l.pack(side = LEFT)
+ l = Label(f, text='Goto:', bg=self.colorsbg['frame'], fg=self.colorsfg['button'])
+ l.pack(side=LEFT)
l.bind('<Button-1>', self.goto)
- self.goto_entry = Entry(f, width = 5)
- self.goto_entry.pack(side = RIGHT, pady = 5, padx = 4)
+ self.goto_entry = Entry(f, width=5)
+ self.goto_entry.pack(side=RIGHT, pady=5, padx=4)
self.goto_entry.bind('<Return>', self.goto)
- f.pack(side = BOTTOM)
+ f.pack(side=BOTTOM)
def create_seqfield(self, parent):
- self.sequence_id = Text(parent, wrap = 'char',
- width = self.seqwidth)
- self.sequence_id.pack(fill = BOTH, expand = 1, side = RIGHT)
+ self.sequence_id = Text(parent, wrap='char',
+ width=self.seqwidth)
+ self.sequence_id.pack(fill=BOTH, expand=1, side=RIGHT)
def create_bindings(self):
self.sequence_id.bind('<Motion>', self.position)
- self.sequence_id.bind('<Leave>', lambda x, s = self:
- s.position_ids['id'].configure(text = ''))
+ self.sequence_id.bind('<Leave>', lambda x, s=self:
+ s.position_ids['id'].configure(text=''))
self.sequence_id.bind('<1>', self.zero)
self.sequence_id.bind('<B1-Motion>', self.count_selection)
self.sequence_id.bind('<Double-Button-1>', self.select_all)
@@ -255,7 +255,7 @@ def create_bindings(self):
def zero(self, event):
p = self.position_ids
for i in ['from_id', 'to_id', 'length_id']:
- self.position_ids[i].configure(text = '')
+ self.position_ids[i].configure(text='')
def get_length(self):
self.sequence_length = len(self.sequence_id.get(1.0, END))
@@ -308,15 +308,15 @@ def count_selection(self, event):
b = int(w.index('sel.last').split('.')[1])
length = b - a + 1
- self.position_ids['from_id'].configure(text = 'Start:%d' % a)
- self.position_ids['to_id'].configure(text = 'Stop:%d' % b)
- self.position_ids['length_id'].configure(text = '%d nt' % length)
+ self.position_ids['from_id'].configure(text='Start:%d' % a)
+ self.position_ids['to_id'].configure(text='Stop:%d' % b)
+ self.position_ids['length_id'].configure(text='%d nt' % length)
- self.statistics_ids['length_id'].configure(text = 'Length=%d' % length)
+ self.statistics_ids['length_id'].configure(text='Length=%d' % length)
seq = self.get_self_selection()
for nt in ['A', 'C', 'G', 'T']:
n = seq.count(nt)
- self.statistics_ids[nt].configure(text = '%s=%d' % (nt, n))
+ self.statistics_ids[nt].configure(text='%s=%d' % (nt, n))
except:
pass
@@ -325,9 +325,9 @@ def position(self, event):
y = event.y
pos = self.sequence_id.index('@%d,%d' % (x, y)).split('.')
pos = int(pos[1]) + 1
- self.position_ids['id'].configure(text = str(pos))
+ self.position_ids['id'].configure(text=str(pos))
- def open(self, file = None):
+ def open(self, file=None):
if not file:
file = askopenfilename()
if not file:
@@ -351,7 +351,7 @@ def fix_sequence(self):
def update_label(self, header):
name = header.split(' ')[0]
name = name.split(',')[0]
- self.position_ids['label'].configure(text = name)
+ self.position_ids['label'].configure(text=name)
def export(self):
seq = self.get_self_selection()
@@ -365,7 +365,7 @@ def gcframe(self):
tid = np.text_id()
tid.insert(END, self.translator.gcframe(seq, self.current_codon_table_id))
- def translate(self, frame = 1):
+ def translate(self, frame=1):
seq = self.get_selection_or_sequence()
if not seq:
return
@@ -373,7 +373,7 @@ def translate(self, frame = 1):
tid = np.text_id()
tid.insert(END, self.translator.frame_nice(seq, frame, self.current_codon_table_id))
- def extract(self, frame = 1):
+ def extract(self, frame=1):
seq = self.get_selection_or_sequence()
if not seq:
return
@@ -472,7 +472,7 @@ def antiparallel(self):
def search(self):
seq = self.get_selection_or_sequence()
- searcher = XDNAsearch(seq, master = self.sequence_id, highlight = 1)
+ searcher = XDNAsearch(seq, master=self.sequence_id, highlight=1)
def goto(self, *args):
pos = self.goto_entry.get()
Please sign in to comment.
Something went wrong with that request. Please try again.