Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Browse files

Removed test_MEME, which is no longer used

  • Loading branch information...
commit af7ae41efbd8690cf04e1a967fa7acbbc32e71b8 1 parent 9037e9e
Michiel de Hoon authored
Showing with 0 additions and 655 deletions.
  1. +0 −655 Tests/output/test_MEME
View
655 Tests/output/test_MEME
@@ -1,655 +0,0 @@
-test_MEME
-Testing MEME Scanner
-noevent : ***************************************************************
-noevent : MEME - Motif discovery tool
-noevent : ***************************************************************
-_version : MEME version 3.0 (Release date: 2004/08/18 09:07:01)
-noevent :
-noevent : For further information on how to interpret these results or to
-noevent : a copy of the MEME software please access http://meme.sdsc.edu.
-noevent :
-noevent : This file may be used as input to the MAST algorithm for search
-noevent : sequence databases for matches to groups of motifs. MAST is av
-noevent : for interactive use and downloading at http://meme.sdsc.edu.
-noevent : ***************************************************************
-noevent :
-noevent :
-noevent : ***************************************************************
-noevent : REFERENCE
-noevent : ***************************************************************
-noevent : If you use this program in your research, please cite:
-noevent :
-noevent : Timothy L. Bailey and Charles Elkan,
-noevent : "Fitting a mixture model by expectation maximization to discove
-noevent : motifs in biopolymers", Proceedings of the Second International
-noevent : Conference on Intelligent Systems for Molecular Biology, pp. 28
-noevent : AAAI Press, Menlo Park, California, 1994.
-noevent : ***************************************************************
-noevent :
-noevent :
-noevent : ***************************************************************
-noevent : TRAINING SET
-noevent : ***************************************************************
-_datafile : DATAFILE= INO_up800.s
-_alphabet : ALPHABET= ACGT
-noevent : Sequence name Weight Length Sequence name
-noevent : ------------- ------ ------ -------------
-_sequence_name : CHO1 1.0000 800 CHO2
-_sequence_name : FAS1 1.0000 800 FAS2
-_sequence_name : ACC1 1.0000 800 INO1
-_sequence_name : OPI3 1.0000 800
-noevent : ***************************************************************
-noevent :
-noevent : ***************************************************************
-noevent : COMMAND LINE SUMMARY
-noevent : ***************************************************************
-noevent : This information can also be useful in the event you wish to re
-noevent : problem with the MEME software.
-noevent :
-_commandline : command: meme -mod oops -dna -revcomp -nmotifs 2 -bfile yeast.n
-noevent :
-noevent : model: mod= oops nmotifs= 2 evt=
-noevent : object function= E-value of product of p-values
-noevent : width: minw= 8 maxw= 50 minic=
-noevent : width: wg= 11 ws= 1 endgaps=
-noevent : nsites: minsites= 7 maxsites= 7 wnsites=
-noevent : theta: prob= 1 spmap= uni spfuzz=
-noevent : em: prior= dirichlet b= 0.01 maxiter=
-noevent : distance= 1e-05
-noevent : data: n= 5600 N= 7
-noevent : strands: + -
-noevent : sample: seed= 0 seqfrac= 1
-noevent : Letter frequencies in dataset:
-noevent : A 0.304 C 0.196 G 0.196 T 0.304
-noevent : Background letter frequencies (from yeast.nc.6.freq):
-noevent : A 0.324 C 0.176 G 0.176 T 0.324
-noevent : ***************************************************************
-noevent :
-noevent :
-noevent : ***************************************************************
-_add_motif_with: MOTIF 1 width = 12 sites = 7 llr = 95 E-value = 2.0e
-noevent : ***************************************************************
-noevent : ---------------------------------------------------------------
-noevent : Motif 1 Description
-noevent : ---------------------------------------------------------------
-noevent : Simplified A :::9:a::::3:
-noevent : pos.-specific C ::a:9:11691a
-noevent : probability G ::::1::94:4:
-noevent : matrix T aa:1::9::11:
-noevent :
-noevent : bits 2.5 * *
-noevent : 2.3 * *
-noevent : 2.0 * * * *
-noevent : 1.8 * * * * *
-noevent : Information 1.5 *** ** *** *
-noevent : content 1.3 *** ****** *
-noevent : (19.5 bits) 1.0 ********** *
-noevent : 0.8 ********** *
-noevent : 0.5 ********** *
-noevent : 0.3 ************
-noevent : 0.0 ------------
-noevent :
-noevent : Multilevel TTCACATGCCGC
-noevent : consensus G A
-noevent : sequence
-noevent :
-noevent : ---------------------------------------------------------------
-noevent :
-noevent : ---------------------------------------------------------------
-motif_name : Motif 1 sites sorted by position p-value
-noevent : ---------------------------------------------------------------
-noevent : Sequence name Strand Start P-value
-noevent : ------------- ------ ----- --------- ---
-add_instance : INO1 - 620 1.85e-08 GACAATACTT TTCA
-add_instance : FAS1 + 95 1.85e-08 GGCCAAAAAC TTCA
-add_instance : ACC1 + 83 1.52e-07 CGTTAAAATC TTCA
-add_instance : CHO2 + 354 2.52e-07 TGCCACACTT TTCT
-add_instance : CHO1 + 611 4.23e-07 ACTTTGAACG TTCA
-add_instance : FAS2 + 567 9.43e-07 CTCCCGCGTT TTCA
-add_instance : OPI3 + 340 3.32e-06 CCAAGCCTCC TTCA
-noevent : ---------------------------------------------------------------
-noevent :
-noevent : ---------------------------------------------------------------
-noevent : Motif 1 block diagrams
-noevent : ---------------------------------------------------------------
-noevent : SEQUENCE NAME POSITION P-VALUE MOTIF DIAGRAM
-noevent : ------------- ---------------- -------------
-noevent : INO1 1.8e-08 619_[-1]_169
-noevent : FAS1 1.8e-08 94_[+1]_694
-noevent : ACC1 1.5e-07 82_[+1]_706
-noevent : CHO2 2.5e-07 353_[+1]_435
-noevent : CHO1 4.2e-07 610_[+1]_178
-noevent : FAS2 9.4e-07 566_[+1]_222
-noevent : OPI3 3.3e-06 339_[+1]_449
-noevent : ---------------------------------------------------------------
-noevent :
-noevent : ---------------------------------------------------------------
-noevent : Motif 1 in BLOCKS format
-noevent : ---------------------------------------------------------------
-noevent : BL MOTIF 1 width=12 seqs=7
-noevent : INO1 ( 620) TTCACATGCCGC 1
-noevent : FAS1 ( 95) TTCACATGCCGC 1
-noevent : ACC1 ( 83) TTCACATGGCCC 1
-noevent : CHO2 ( 354) TTCTCATGCCGC 1
-noevent : CHO1 ( 611) TTCACACGGCAC 1
-noevent : FAS2 ( 567) TTCACATGCTAC 1
-noevent : OPI3 ( 340) TTCAGATCGCTC 1
-noevent : //
-noevent :
-noevent : ---------------------------------------------------------------
-noevent :
-noevent : ---------------------------------------------------------------
-noevent : Motif 1 position-specific scoring matrix
-noevent : ---------------------------------------------------------------
-noevent : log-odds matrix: alength= 4 w= 12 n= 5523 bayes= 9.62205 E= 2.0
-add_to_logodds : -945 -945 -945 162
-add_to_logodds : -945 -945 -945 162
-add_to_logodds : -945 251 -945 -945
-add_to_logodds : 140 -945 -945 -118
-add_to_logodds : -945 229 -30 -945
-add_to_logodds : 162 -945 -945 -945
-add_to_logodds : -945 -30 -945 140
-add_to_logodds : -945 -30 229 -945
-add_to_logodds : -945 170 129 -945
-add_to_logodds : -945 229 -945 -118
-add_to_logodds : -18 -30 129 -118
-add_to_logodds : -945 251 -945 -945
-noevent : ---------------------------------------------------------------
-noevent :
-noevent : ---------------------------------------------------------------
-noevent : Motif 1 position-specific probability matrix
-noevent : ---------------------------------------------------------------
-noevent : letter-probability matrix: alength= 4 w= 12 nsites= 7 E= 2.0e-0
-add_to_pssm : 0.000000 0.000000 0.000000 1.000000
-add_to_pssm : 0.000000 0.000000 0.000000 1.000000
-add_to_pssm : 0.000000 1.000000 0.000000 0.000000
-add_to_pssm : 0.857143 0.000000 0.000000 0.142857
-add_to_pssm : 0.000000 0.857143 0.142857 0.000000
-add_to_pssm : 1.000000 0.000000 0.000000 0.000000
-add_to_pssm : 0.000000 0.142857 0.000000 0.857143
-add_to_pssm : 0.000000 0.142857 0.857143 0.000000
-add_to_pssm : 0.000000 0.571429 0.428571 0.000000
-add_to_pssm : 0.000000 0.857143 0.000000 0.142857
-add_to_pssm : 0.285714 0.142857 0.428571 0.142857
-add_to_pssm : 0.000000 1.000000 0.000000 0.000000
-noevent : ---------------------------------------------------------------
-noevent :
-noevent :
-noevent :
-noevent :
-noevent :
-noevent : Time 20.91 secs.
-noevent :
-noevent : ***************************************************************
-noevent :
-noevent :
-noevent : ***************************************************************
-_add_motif_with: MOTIF 2 width = 10 sites = 7 llr = 81 E-value = 1.1e
-noevent : ***************************************************************
-noevent : ---------------------------------------------------------------
-noevent : Motif 2 Description
-noevent : ---------------------------------------------------------------
-noevent : Simplified A ::1:::9:6:
-noevent : pos.-specific C :a:::a:911
-noevent : probability G 3:1aa:1:19
-noevent : matrix T 7:7::::11:
-noevent :
-noevent : bits 2.5 * ***
-noevent : 2.3 * ***
-noevent : 2.0 * *** *
-noevent : 1.8 * *** * *
-noevent : Information 1.5 * *** * *
-noevent : content 1.3 * ***** *
-noevent : (16.7 bits) 1.0 ** ***** *
-noevent : 0.8 ** ***** *
-noevent : 0.5 ******** *
-noevent : 0.3 **********
-noevent : 0.0 ----------
-noevent :
-noevent : Multilevel TCTGGCACAG
-noevent : consensus G
-noevent : sequence
-noevent :
-noevent : ---------------------------------------------------------------
-noevent :
-noevent : ---------------------------------------------------------------
-motif_name : Motif 2 sites sorted by position p-value
-noevent : ---------------------------------------------------------------
-noevent : Sequence name Strand Start P-value
-noevent : ------------- ------ ----- --------- ---
-add_instance : OPI3 - 186 3.24e-07 GAAAACCAGA TCTG
-add_instance : ACC1 + 232 3.24e-07 CCAGTCGTAT TCTG
-add_instance : CHO1 - 559 3.24e-07 ATATTCAGTG TCTG
-add_instance : INO1 - 283 5.29e-06 ACGGTCTACG GCGG
-add_instance : FAS1 + 44 6.25e-06 TACACGAGGT GCAG
-add_instance : FAS2 - 185 8.48e-06 TTCTTGCTTT TCTG
-add_instance : CHO2 - 413 8.48e-06 TTTTGCCGTT TCTG
-noevent : ---------------------------------------------------------------
-noevent :
-noevent : ---------------------------------------------------------------
-noevent : Motif 2 block diagrams
-noevent : ---------------------------------------------------------------
-noevent : SEQUENCE NAME POSITION P-VALUE MOTIF DIAGRAM
-noevent : ------------- ---------------- -------------
-noevent : OPI3 3.2e-07 185_[-2]_605
-noevent : ACC1 3.2e-07 231_[+2]_559
-noevent : CHO1 3.2e-07 558_[-2]_232
-noevent : INO1 5.3e-06 282_[-2]_508
-noevent : FAS1 6.3e-06 43_[+2]_747
-noevent : FAS2 8.5e-06 184_[-2]_606
-noevent : CHO2 8.5e-06 412_[-2]_378
-noevent : ---------------------------------------------------------------
-noevent :
-noevent : ---------------------------------------------------------------
-noevent : Motif 2 in BLOCKS format
-noevent : ---------------------------------------------------------------
-noevent : BL MOTIF 2 width=10 seqs=7
-noevent : OPI3 ( 186) TCTGGCACAG 1
-noevent : ACC1 ( 232) TCTGGCACAG 1
-noevent : CHO1 ( 559) TCTGGCACAG 1
-noevent : INO1 ( 283) GCGGGCGCAG 1
-noevent : FAS1 ( 44) GCAGGCACGG 1
-noevent : FAS2 ( 185) TCTGGCACTC 1
-noevent : CHO2 ( 413) TCTGGCATCG 1
-noevent : //
-noevent :
-noevent : ---------------------------------------------------------------
-noevent :
-noevent : ---------------------------------------------------------------
-noevent : Motif 2 position-specific scoring matrix
-noevent : ---------------------------------------------------------------
-noevent : log-odds matrix: alength= 4 w= 10 n= 5537 bayes= 9.62571 E= 1.1
-add_to_logodds : -945 -945 70 114
-add_to_logodds : -945 251 -945 -945
-add_to_logodds : -118 -945 -30 114
-add_to_logodds : -945 -945 251 -945
-add_to_logodds : -945 -945 251 -945
-add_to_logodds : -945 251 -945 -945
-add_to_logodds : 140 -945 -30 -945
-add_to_logodds : -945 229 -945 -118
-add_to_logodds : 82 -30 -30 -118
-add_to_logodds : -945 -30 229 -945
-noevent : ---------------------------------------------------------------
-noevent :
-noevent : ---------------------------------------------------------------
-noevent : Motif 2 position-specific probability matrix
-noevent : ---------------------------------------------------------------
-noevent : letter-probability matrix: alength= 4 w= 10 nsites= 7 E= 1.1e+0
-add_to_pssm : 0.000000 0.000000 0.285714 0.714286
-add_to_pssm : 0.000000 1.000000 0.000000 0.000000
-add_to_pssm : 0.142857 0.000000 0.142857 0.714286
-add_to_pssm : 0.000000 0.000000 1.000000 0.000000
-add_to_pssm : 0.000000 0.000000 1.000000 0.000000
-add_to_pssm : 0.000000 1.000000 0.000000 0.000000
-add_to_pssm : 0.857143 0.000000 0.142857 0.000000
-add_to_pssm : 0.000000 0.857143 0.000000 0.142857
-add_to_pssm : 0.571429 0.142857 0.142857 0.142857
-add_to_pssm : 0.000000 0.142857 0.857143 0.000000
-noevent : ---------------------------------------------------------------
-noevent :
-noevent :
-noevent :
-noevent :
-noevent :
-noevent : Time 41.19 secs.
-noevent :
-noevent : ***************************************************************
-noevent :
-noevent :
-noevent : ***************************************************************
-Running tests on MEME parser
-************************************************** TESTING meme.dna.oops.txt
-************************************************** TESTING meme.protein.oops.txt
-************************************************** TESTING meme.protein.tcm.txt
-Testing MEME Scanner
-noevent : ***************************************************************
-noevent : MAST - Motif Alignment and Search Tool
-noevent : ***************************************************************
-_version : MAST version 3.0 (Release date: 2004/08/18 09:07:01)
-noevent :
-noevent : For further information on how to interpret these results or t
-noevent : a copy of the MAST software please access http://meme.sdsc.edu
-noevent : ***************************************************************
-noevent :
-noevent :
-noevent : ***************************************************************
-noevent : REFERENCE
-noevent : ***************************************************************
-noevent : If you use this program in your research, please cite:
-noevent :
-noevent : Timothy L. Bailey and Michael Gribskov,
-noevent : "Combining evidence using p-values: application to sequence ho
-noevent : searches", Bioinformatics, 14(48-54), 1998.
-noevent : ***************************************************************
-noevent :
-noevent :
-noevent : ***************************************************************
-noevent : DATABASE AND MOTIFS
-noevent : ***************************************************************
-_database : DATABASE INO_up800.s (nucleotide)
-noevent : Last updated on Mon Aug 16 21:19:59 2004
-noevent : Database contains 7 sequences, 5600 residues
-noevent :
-noevent : Scores for positive and reverse complement strands are combine
-noevent :
-noevent : MOTIFS meme.INO_up800.oops.txt (nucleotide)
-noevent : MOTIF WIDTH BEST POSSIBLE MATCH
-noevent : ----- ----- -------------------
-_add_motif : 1 12 TTCACATGCCGC
-_add_motif : 2 10 TCTGGCACAG
-noevent :
-noevent : PAIRWISE MOTIF CORRELATIONS:
-noevent : MOTIF 1
-noevent : ----- -----
-noevent : 2 0.32
-noevent : No overly similar pairs (correlation > 0.60) found.
-noevent :
-noevent : Random model letter frequencies (from non-redundant database):
-noevent : A 0.281 C 0.222 G 0.229 T 0.267
-noevent : ***************************************************************
-noevent :
-noevent :
-noevent : ***************************************************************
-noevent : SECTION I: HIGH-SCORING SEQUENCES
-noevent : ***************************************************************
-noevent : - Each of the following 7 sequences has E-value less than 10.
-noevent : - The E-value of a sequence is the expected number of sequence
-noevent : in a random database of the same size that would match the m
-noevent : well as the sequence does and is equal to the combined p-val
-noevent : sequence times the number of sequences in the database.
-noevent : - The combined p-value of a sequence measures the strength of
-noevent : match of the sequence to all the motifs and is calculated by
-noevent : o finding the score of the single best match of each motif
-noevent : to the sequence (best matches may overlap),
-noevent : o calculating the sequence p-value of each score,
-noevent : o forming the product of the p-values,
-noevent : o taking the p-value of the product.
-noevent : - The sequence p-value of a score is defined as the
-noevent : probability of a random sequence of the same length containi
-noevent : some match with as good or better a score.
-noevent : - The score for the match of a position in a sequence to a mot
-noevent : is computed by by summing the appropriate entry from each co
-noevent : the position-dependent scoring matrix that represents the mo
-noevent : - Sequences shorter than one or more of the motifs are skipped
-noevent : - The table is sorted by increasing E-value.
-noevent : ***************************************************************
-noevent :
-noevent : SEQUENCE NAME DESCRIPTION
-noevent : ------------- -----------
-noevent : ACC1 sequence of the region up...
-noevent : CHO1 sequence of the region up...
-noevent : INO1 sequence of the region up...
-noevent : FAS1 sequence of the region up...
-noevent : OPI3 sequence of the region up...
-noevent : CHO2 sequence of the region up...
-noevent : FAS2 sequence of the region up...
-noevent :
-noevent : ***************************************************************
-noevent :
-noevent :
-noevent :
-noevent : ***************************************************************
-noevent : SECTION II: MOTIF DIAGRAMS
-noevent : ***************************************************************
-noevent : - The ordering and spacing of all non-overlapping motif occurr
-noevent : are shown for each high-scoring sequence listed in Section I
-noevent : - A motif occurrence is defined as a position in the sequence
-noevent : match to the motif has POSITION p-value less than 0.0001.
-noevent : - The POSITION p-value of a match is the probability of
-noevent : a single random subsequence of the length of the motif
-noevent : scoring at least as well as the observed match.
-noevent : - For each sequence, all motif occurrences are shown unless th
-noevent : are overlaps. In that case, a motif occurrence is shown onl
-noevent : p-value is less than the product of the p-values of the othe
-noevent : (lower-numbered) motif occurrences that it overlaps.
-noevent : - The table also shows the E-value of each sequence.
-noevent : - Spacers and motif occurences are indicated by
-noevent : o -d- `d' residues separate the end of the preceding mot
-noevent : occurrence and the start of the following motif occurrenc
-noevent : o [sn] occurrence of motif `n' with p-value less than 0.00
-noevent : A minus sign indicates that the occurrence is on the
-noevent : reverse complement strand.
-noevent : ***************************************************************
-noevent :
-noevent : SEQUENCE NAME E-VALUE MOTIF DIAGRAM
-noevent : ------------- -------- -------------
-noevent : ACC1 6.1e-05 82_[+1]_137_[+2]_5
-noevent : CHO1 0.00016 152_[+2]_396_[-2]_
-noevent : [+1]_149
-noevent : INO1 0.00019 282_[-2]_327_[-1]_
-noevent : FAS1 0.00022 43_[+2]_41_[+1]_69
-noevent : OPI3 0.00092 185_[-2]_144_[+1]_
-noevent : CHO2 0.0029 353_[+1]_47_[-2]_3
-noevent : FAS2 0.0093 184_[-2]_372_[+1]_
-noevent :
-noevent : ***************************************************************
-noevent :
-noevent :
-noevent :
-noevent : ***************************************************************
-noevent : SECTION III: ANNOTATED SEQUENCES
-noevent : ***************************************************************
-noevent : - The positions and p-values of the non-overlapping motif occu
-noevent : are shown above the actual sequence for each of the high-sco
-noevent : sequences from Section I.
-noevent : - A motif occurrence is defined as a position in the sequence
-noevent : match to the motif has POSITION p-value less than 0.0001 as
-noevent : defined in Section II.
-noevent : - For each sequence, the first line specifies the name of the
-noevent : - The second (and possibly more) lines give a description of t
-noevent : sequence.
-noevent : - Following the description line(s) is a line giving the lengt
-noevent : combined p-value, and E-value of the sequence as defined in
-noevent : - The next line reproduces the motif diagram from Section II.
-noevent : - The entire sequence is printed on the following lines.
-noevent : - Motif occurrences are indicated directly above their positio
-noevent : sequence on lines showing
-noevent : o the motif number of the occurrence (a minus sign indicate
-noevent : the occurrence is on the reverse complement strand),
-noevent : o the position p-value of the occurrence,
-noevent : o the best possible match to the motif (or its reverse comp
-noevent : o columns whose match to the motif has a positive score (in
-noevent : by a plus sign).
-noevent : ***************************************************************
-noevent :
-noevent :
-*************** _parse_buffer
-*************** _blank_buffer
-_set_current_se: ACC1
-noevent : sequence of the region upstream from YNR016C
-noevent : LENGTH = 800 COMBINED P-VALUE = 8.78e-06 E-VALUE = 6.1e-05
-_add_line_to_bu: DIAGRAM: 82_[+1]_137_[+2]_559
-*************** _add_diagram_from_buffer
-*************** _blank_buffer
-noevent :
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [+1]
-_add_line_to_bu: 3.1e-07
-_add_line_to_bu: TTCACATGCCGC
-_add_line_to_bu: ++++++++++ +
-_add_line_to_bu: 76 TAAAATCTTCACATGGCCCGGCCGCGCGCGCGTTGTGCCAACAAGTCGCAGTCGAAAT
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [+2]
-_add_line_to_bu: 7.4e-07
-_add_line_to_bu: TCTGGCACAG
-_add_line_to_bu: ++++++++++
-_add_line_to_bu: 226 TCGTATTCTGGCACAGTATAGCCTAGCACAATCACTGTCACAATTGTTATCGGTTCTA
-noevent :
-*************** _collapse_buffer
-noevent :
-*************** _parse_buffer
-*************** _blank_buffer
-_set_current_se: CHO1
-noevent : sequence of the region upstream from YER026C
-noevent : LENGTH = 800 COMBINED P-VALUE = 2.30e-05 E-VALUE = 0.00016
-_add_line_to_bu: DIAGRAM: 152_[+2]_396_[-2]_42_[+1]_17_[+1]_149
-*************** _add_diagram_from_buffer
-*************** _blank_buffer
-noevent :
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [+2]
-_add_line_to_bu: 3.9e-05
-_add_line_to_bu: TCTGGCACAG
-_add_line_to_bu: ++++++ +
-_add_line_to_bu: 151 CGTCTGGCGCCCTTCCCATTCCGAACCATGTTATATTGAACCATCTGGCGACAAGCAG
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [-2]
-_add_line_to_bu: 7.4e-07
-_add_line_to_bu: CTGTGCCAGA
-_add_line_to_bu: ++++++++++
-_add_line_to_bu: 526 CAATCCCCACTCCTTCTCAATGTGTGCAGACTTCTGTGCCAGACACTGAATATATATC
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [+1] [+1]
-_add_line_to_bu: 8.7e-07 2.2e-05
-_add_line_to_bu: TTCACATGCCGC TTCACATGCCGC
-_add_line_to_bu: ++++++ +++ + +++++++++ +
-_add_line_to_bu: 601 ACTTTGAACGTTCACACGGCACCCTCACGCCTTTGAGCTTTCACATGGACCCATCTAA
-noevent :
-*************** _collapse_buffer
-noevent :
-*************** _parse_buffer
-*************** _blank_buffer
-_set_current_se: INO1
-noevent : sequence of the region upstream from YJL153C
-noevent : LENGTH = 800 COMBINED P-VALUE = 2.71e-05 E-VALUE = 0.00019
-_add_line_to_bu: DIAGRAM: 282_[-2]_327_[-1]_55_[+1]_102
-*************** _add_diagram_from_buffer
-*************** _blank_buffer
-noevent :
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [
-_add_line_to_bu: 1
-_add_line_to_bu: C
-_add_line_to_bu: +
-_add_line_to_bu: 226 ACGTTGTATATGAAACGAGTAGTGAACGTTCGTACGATCTTTCACGCAGACATGCGAC
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [-1]
-_add_line_to_bu: 4.2e-08
-_add_line_to_bu: GCGGCATGTGAA
-_add_line_to_bu: ++++++++++++
-_add_line_to_bu: 601 TGCGCTTCGGCGGCTAAATGCGGCATGTGAAAAGTATTGTCTATTTTATCTTCATCCT
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [+1]
-_add_line_to_bu: 1.3e-05
-_add_line_to_bu: TTCACATGCCGC
-_add_line_to_bu: +++++++++ ++
-_add_line_to_bu: 676 AACTTATTTAATTCACATGGAGCAGAGAAAGCGCACCTCTGCGTTGGCGGCAATGTTA
-noevent :
-*************** _collapse_buffer
-noevent :
-*************** _parse_buffer
-*************** _blank_buffer
-_set_current_se: FAS1
-noevent : sequence of the region upstream from YKL182W
-noevent : LENGTH = 800 COMBINED P-VALUE = 3.19e-05 E-VALUE = 0.00022
-_add_line_to_bu: DIAGRAM: 43_[+2]_41_[+1]_694
-*************** _add_diagram_from_buffer
-*************** _blank_buffer
-noevent :
-_add_line_to_bu: [+2]
-_add_line_to_bu: 2.2e-05
-_add_line_to_bu: TCTGGCACAG
-_add_line_to_bu: ++ +++++ +
-_add_line_to_bu: 1 CCGGGTTATAGCAGCGTCTGCTCCGCATCACGATACACGAGGTGCAGGCACGGTTCAC
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [+1]
-_add_line_to_bu: 4.2e-08
-_add_line_to_bu: TTCACATGCCGC
-_add_line_to_bu: ++++++++++++
-_add_line_to_bu: 76 ACAAACGACGGCCAAAAACTTCACATGCCGCCCAGCCAAGCATAATTACGCAACAGCG
-noevent :
-*************** _collapse_buffer
-noevent :
-*************** _parse_buffer
-*************** _blank_buffer
-_set_current_se: OPI3
-noevent : sequence of the region upstream from YJR073C
-noevent : LENGTH = 800 COMBINED P-VALUE = 1.32e-04 E-VALUE = 0.00092
-_add_line_to_bu: DIAGRAM: 185_[-2]_144_[+1]_449
-*************** _add_diagram_from_buffer
-*************** _blank_buffer
-noevent :
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [-2]
-_add_line_to_bu: 7.4e-07
-_add_line_to_bu: CTGTGCCAGA
-_add_line_to_bu: ++++++++++
-_add_line_to_bu: 151 GTTAATCTGATCAACGCTACGCCGATGACAACGGTCTGTGCCAGATCTGGTTTTCCCC
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [+1]
-_add_line_to_bu: 5.8e-06
-_add_line_to_bu: TTCACATGCCGC
-_add_line_to_bu: ++++ ++ ++ +
-_add_line_to_bu: 301 AACTCCGTCAGGTCTTCCACGTGGAACTGCCAAGCCTCCTTCAGATCGCTCTTGTCGA
-noevent :
-*************** _collapse_buffer
-noevent :
-*************** _parse_buffer
-*************** _blank_buffer
-_set_current_se: CHO2
-noevent : sequence of the region upstream from YGR157W
-noevent : LENGTH = 800 COMBINED P-VALUE = 4.18e-04 E-VALUE = 0.0029
-_add_line_to_bu: DIAGRAM: 353_[+1]_47_[-2]_378
-*************** _add_diagram_from_buffer
-*************** _blank_buffer
-noevent :
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [+1]
-_add_line_to_bu: 5.2e-
-_add_line_to_bu: TTCAC
-_add_line_to_bu: +++ +
-_add_line_to_bu: 301 ATATATATTTTTGCCTTGGTTTAAATTGGTCAAGACAGTCAATTGCCACACTTTTCTC
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [-2]
-_add_line_to_bu: 2.9e-05
-_add_line_to_bu: CTGTGCCAGA
-_add_line_to_bu: + +++++++
-_add_line_to_bu: 376 CGCGAAGTTTTCCACACAAAACTGTGAAAATGAACGGCGATGCCAGAAACGGCAAAAC
-noevent :
-*************** _collapse_buffer
-noevent :
-*************** _parse_buffer
-*************** _blank_buffer
-_set_current_se: FAS2
-noevent : sequence of the region upstream from YPL231W
-noevent : LENGTH = 800 COMBINED P-VALUE = 1.33e-03 E-VALUE = 0.0093
-_add_line_to_bu: DIAGRAM: 184_[-2]_372_[+1]_222
-*************** _add_diagram_from_buffer
-*************** _blank_buffer
-noevent :
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [-2]
-_add_line_to_bu: 2.9e-05
-_add_line_to_bu: CTGTGCCAGA
-_add_line_to_bu: ++++++++
-_add_line_to_bu: 151 AACAGGGTGTCGGTCATACCGATAAAGCCGTCAAGAGTGCCAGAAAAGCAAGAAAGAA
-noevent :
-*************** _collapse_buffer
-_add_line_to_bu: [+1]
-_add_line_to_bu: 1.9e-06
-_add_line_to_bu: TTCACATGCCGC
-_add_line_to_bu: +++++++++ +
-_add_line_to_bu: 526 GCTTAGCAAAATCCAACCATTTTTTTTTTATCTCCCGCGTTTTCACATGCTACCTCAT
-noevent :
-*************** _collapse_buffer
-noevent : ***************************************************************
-*************** _parse_buffer
-*************** _blank_buffer
-Running tests on MAST parser
-************************************************** TESTING mast.dna.oops.txt
-************************************************** TESTING mast.protein.oops.txt
-************************************************** TESTING mast.protein.tcm.txt
Please sign in to comment.
Something went wrong with that request. Please try again.