Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Browse files

Test case where eprimer3 reports oligo without sequence

  • Loading branch information...
commit c83811935b218618217d94be962f891251928f8d 1 parent 76d13cd
@widdowquinn widdowquinn authored peterjc committed
Showing with 165 additions and 0 deletions.
  1. +164 −0 Tests/Emboss/no_oligo.primer3
  2. +1 −0  Tests/test_EmbossPrimer.py
View
164 Tests/Emboss/no_oligo.primer3
@@ -0,0 +1,164 @@
+# EPRIMER3 PRIMERS classify/specific_primers.eprimer3
+# Start Len Tm GC% Sequence
+
+
+# primer_0377 sequences/draft_stitched.fasta
+1 PRODUCT SIZE: 102
+ FORWARD PRIMER 1749301 20 59.88 45.00 AAACCTCGCATTTGCTGACT
+ REVERSE PRIMER 1749383 20 59.88 45.00 TTCAGGTTGTGCTTGAAACG
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0274 sequences/draft_stitched.fasta
+2 PRODUCT SIZE: 103
+ FORWARD PRIMER 2463143 20 59.98 50.00 AGCTGACCTATGCCGAAGAA
+ REVERSE PRIMER 2463226 20 59.87 50.00 GCAGTGTCAATGCGACCTAA
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0579 sequences/draft_stitched.fasta
+3 PRODUCT SIZE: 102
+ FORWARD PRIMER 2463144 20 59.84 55.00 GCTGACCTATGCCGAAGAAC
+ REVERSE PRIMER 2463226 20 59.87 50.00 GCAGTGTCAATGCGACCTAA
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0681 sequences/draft_stitched.fasta
+4 PRODUCT SIZE: 105
+ FORWARD PRIMER 1716620 20 59.98 50.00 AGATCTGAGCGGTAGGCAAA
+ REVERSE PRIMER 1716705 20 59.86 50.00 CAGTGAATCCGTTCGTAGCA
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0244 sequences/draft_stitched.fasta
+5 PRODUCT SIZE: 101
+ FORWARD PRIMER 1749302 20 59.88 45.00 AACCTCGCATTTGCTGACTT
+ REVERSE PRIMER 1749383 20 59.88 45.00 TTCAGGTTGTGCTTGAAACG
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0099 sequences/draft_stitched.fasta
+6 PRODUCT SIZE: 99
+ FORWARD PRIMER 2451789 20 59.92 45.00 CATCAATGCCGATGTATTGC
+ REVERSE PRIMER 2451868 20 59.91 50.00 TCGAAACACGACAACTACGC
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0095 sequences/draft_stitched.fasta
+7 PRODUCT SIZE: 96
+ FORWARD PRIMER 1743206 20 59.99 50.00 GAATCAGCAGGCACAGACAA
+ REVERSE PRIMER 1743282 20 59.99 50.00 CTTGTTCCCTTCAGCAAAGC
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0399 sequences/draft_stitched.fasta
+8 PRODUCT SIZE: 98
+ FORWARD PRIMER 2469970 20 59.83 45.00 GTCCGGCATTTATTGTTCGT
+ REVERSE PRIMER 2470048 20 59.93 45.00 GAAACCGCGATTATCCGTTA
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0022 sequences/draft_stitched.fasta
+9 PRODUCT SIZE: 98
+ FORWARD PRIMER 1743206 20 59.99 50.00 GAATCAGCAGGCACAGACAA
+ REVERSE PRIMER 1743284 20 59.99 45.00 AGCTTGTTCCCTTCAGCAAA
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0354 sequences/draft_stitched.fasta
+10 PRODUCT SIZE: 103
+ FORWARD PRIMER 1764327 20 59.85 45.00 ATCACTGGCCGCTTTAAGAA
+ REVERSE PRIMER 1764410 20 59.98 45.00 CTTTCGAATACAGCGCATCA
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0075 sequences/draft_stitched.fasta
+11 PRODUCT SIZE: 100
+ FORWARD PRIMER 1755369 20 59.84 50.00 GACAACGTCAATGCAGGAGA
+ REVERSE PRIMER 1755449 20 59.96 50.00 GCCCGGTTAACGTCTCAATA
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0610 sequences/draft_stitched.fasta
+12 PRODUCT SIZE: 98
+ FORWARD PRIMER 1733877 20 59.87 50.00 AGAATGTCCGTGAGCGAGTT
+ REVERSE PRIMER 1733955 20 59.83 45.00 TTGATATGCACCGAGCTTTG
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0442 sequences/draft_stitched.fasta
+13 PRODUCT SIZE: 100
+ FORWARD PRIMER 1747595 20 59.83 50.00 GCACGGACAGATAATGCAGA
+ REVERSE PRIMER 1747675 20 59.82 45.00 GGCATCTTTCGCGAATTTAG
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0223 sequences/draft_stitched.fasta
+14 PRODUCT SIZE: 102
+ FORWARD PRIMER 1764327 20 59.85 45.00 ATCACTGGCCGCTTTAAGAA
+ REVERSE PRIMER 1764409 20 59.98 45.00 TTTCGAATACAGCGCATCAG
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0049 sequences/draft_stitched.fasta
+15 PRODUCT SIZE: 97
+ FORWARD PRIMER 1743206 20 59.99 50.00 GAATCAGCAGGCACAGACAA
+ REVERSE PRIMER 1743283 20 59.99 50.00 GCTTGTTCCCTTCAGCAAAG
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0547 sequences/draft_stitched.fasta
+16 PRODUCT SIZE: 99
+ FORWARD PRIMER 2463143 20 59.98 50.00 AGCTGACCTATGCCGAAGAA
+ REVERSE PRIMER 2463222 20 59.69 45.00 TGTCAATGCGACCTAATTGC
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0712 sequences/draft_stitched.fasta
+17 PRODUCT SIZE: 100
+ FORWARD PRIMER 2450861 20 59.72 45.00 CAGTAACGCCGAATGCAATA
+ REVERSE PRIMER 2450941 20 59.86 50.00 GTTTCAACCCGGCAGTGTAT
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0576 sequences/draft_stitched.fasta
+18 PRODUCT SIZE: 101
+ FORWARD PRIMER 4323538 20 59.92 45.00 TCACCCATGGCTTCACATTA
+ REVERSE PRIMER 4323619 20 59.74 55.00 AACCCACACACCGGCTATAC
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0676 sequences/draft_stitched.fasta
+19 PRODUCT SIZE: 93
+ FORWARD PRIMER 1740378 20 59.96 50.00 CTGGGATTTGCTCCGTATGT
+ REVERSE PRIMER 1740451 20 59.99 50.00 ATATACGCAACCCGCAGAAC
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
+# primer_0408 sequences/draft_stitched.fasta
+20 PRODUCT SIZE: 104
+ FORWARD PRIMER 1757556 20 59.99 50.00 AACTCCAGTGGCGTATTTGG
+ REVERSE PRIMER 1757640 20 59.86 50.00 ATCTGCGAATGTGTCTGACG
+ INTERNAL OLIGO 0 0 0.00 0.00
+
+
+
View
1  Tests/test_EmbossPrimer.py
@@ -17,6 +17,7 @@ def setUp(self):
os.path.join("Emboss", "cds_reverse.primer3"),
os.path.join("Emboss", "short.primer3"),
os.path.join("Emboss", "internal_oligo.primer3"),
+ os.path.join("Emboss", "no_oligo.primer3"),
]
def test_simple_parse(self):
Please sign in to comment.
Something went wrong with that request. Please try again.