Permalink
Browse files

Fix bug in which strains were being matched between FASTA, HI and source

I discovered this with noticing that "B/PHUKET/3073/2013" had no matches in live site. This was because the "reference" strain (with sequence in ref.json) had the name PHUKET, while the HI titer file listed this as "B/Phuket/3073/2013". Resolving this across strains has resulted in many hundreds of additional measurements being brought into the live build.
  • Loading branch information...
1 parent 88e7349 commit 4ab29f3f0ecbece7a0374c8631004312ca6823a6 @trvrb trvrb committed Jan 7, 2017
@@ -24,7 +24,7 @@ REFERENCE 2 (bases 1 to 1701)
Linden Drive West, Madison, WI 53706, USA
FEATURES Location/Qualifiers
source 1..1701
- /strain="A/Swine/Indiana/P12439/00"
+ /strain="A/Swine/Indiana/P12439/2000"
/mol_type="genomic RNA"
/organism="Influenza A virus (A/Swine/Indiana/P12439/00
(H1N2))"
Oops, something went wrong.
Oops, something went wrong.
@@ -31,10 +31,10 @@ FEATURES Location/Qualifiers
/db_xref="taxon:416687"
/collection_date="15-Feb-1993"
/segment="4"
- /strain="Influenza B virus (B/Hong Kong/02/1993)"
+ /strain="B/HongKong/2/1993"
/host="Human"
/country="Hong Kong: Hong Kong"
- /organism="Influenza B virus (B/Hong Kong/02/1993)"
+ /organism="Influenza B virus (B/HongKong/2/1993)"
gene 12..1769
/gene="HA"
CDS 12..1769
Oops, something went wrong.
@@ -32,7 +32,7 @@ FEATURES Location/Qualifiers
/collection_date="10-May-1994"
/segment="4"
/isolation_source="gender:M"
- /strain="Influenza B virus (B/Singapore/11/1994)"
+ /strain="B/Singapore/11/1994"
/host="Human"
/country="Singapore: Singapore"
/organism="Influenza B virus (B/Singapore/11/1994)"
Oops, something went wrong.
@@ -34,7 +34,7 @@
# data source and sequence parsing/cleaning/processing
'virus':'H1N1pdm',
'alignment_file':'data/h1n1pdm.fasta',
- 'outgroup':'A/Swine/Indiana/P12439/00',
+ 'outgroup':'A/Swine/Indiana/P12439/2000',
'force_include':'data/h1n1pdm_hi_strains.tsv',
'force_include_all':False,
'date_spec':'year',
@@ -75,7 +75,7 @@ def __init__(self,min_length = 987, **kwargs):
flu_filter.__init__(self, **kwargs)
self.min_length = min_length
self.vaccine_strains =[{
- 'strain': 'A/California/07/2009',
+ 'strain': 'A/California/7/2009',
'isolate_id': 'EPI_ISL_31553',
'date': '2009-04-09',
'lab': 'Naval Health Research Center',
@@ -98,7 +98,7 @@ def __init__(self,min_length = 987, **kwargs):
if 'gene' in x.qualifiers and x.type=='CDS' and
x.qualifiers['gene'][0] in ['SigPep', 'HA1', 'HA2']}
self.outgroup = {
- 'strain': 'A/Swine/Indiana/P12439/00',
+ 'strain': 'A/Swine/Indiana/P12439/2000',
'db': 'IRD',
'accession': 'AF455680',
'date': '2002-03-14',
@@ -29,7 +29,7 @@
# data source and sequence parsing/cleaning/processing
'virus':'Vic',
'alignment_file':'data/vic.fasta',
- 'outgroup':'B/HongKong/02/1993',
+ 'outgroup':'B/HongKong/2/1993',
'force_include':'data/vic_hi_strains.tsv',
'force_include_all':False,
'date_spec':'year',
@@ -60,7 +60,7 @@ def __init__(self,min_length = 987, **kwargs):
self.min_length = min_length
self.vaccine_strains =[
{
- 'strain': 'B/Shangdong/7/97',
+ 'strain': 'B/Shangdong/7/1997',
'isolate_id': 'EPI_ISL_1790',
'date': '1997-07-01', #(Month and day unknown)
'region': 'china',
@@ -99,7 +99,7 @@ def __init__(self,min_length = 987, **kwargs):
if 'gene' in x.qualifiers and x.type=='CDS' and
x.qualifiers['gene'][0] in ['SigPep', 'HA1', 'HA2']}
self.outgroup = {
- 'strain':'B/HongKong/02/1993',
+ 'strain':'B/HongKong/2/1993',
'region':'China',
'isolate_id':'EPI_ISL_6617',
'date':'1993-02-15', #(Month and day unknown)
@@ -29,7 +29,7 @@
# data source and sequence parsing/cleaning/processing
'virus':'Yam',
'alignment_file':'data/yam.fasta',
- 'outgroup':'B/Singapore/11/94',
+ 'outgroup':'B/Singapore/11/1994',
'force_include':'data/yam_hi_strains.tsv',
'force_include_all':False,
'date_spec':'year',
@@ -62,15 +62,15 @@ def __init__(self,min_length = 987, **kwargs):
self.min_length = min_length
self.vaccine_strains =[
{
- 'strain': 'B/Beijing/184/93',
+ 'strain': 'B/Beijing/184/1993',
'isolate_id': 'EPI_ISL_969',
'date': '1993-07-01', #(Month and day unknown)
'region': 'china',
'country': 'china',
'seq': 'GATCGAATCTGTACTGGGATAACATCTTCAAACTCACCTCATGTGGTCAAAACAGCTACTCAAGGGGAGGTCAATGTGACTGGTGTGATACCACTGACAACAACACCAACAAAATCTCATTTTGGAAATCTCAAAGGAACAAAGACCAGAGGGAAACTATGCCCAAACTGTCTCAACTGCACAGATCTGGATGTGGCCTTGGGCAGACCAATGTGTGTGGGGACCACACCTTCGGCAAAAGCTTCAATACTCCACGAAGTCAGACCTGTTACATCCGGGTGCTTTCCTATAATGCACGACAGAACAAAAATCAGACAGCTACCCAATCTTCTCAGAGGATATGAAAATATCAGATTATCAACCCAAAACGTTATCAACGCAGAAAAGGCACCAGGAGGACCCTACAGGCTTGGAACCTCAGGATCTTGCCCTAACGCTACCAGTAGAAGCGGATTTTTCGCAACAATGGCTTGGGCTGTCCCAAGGGACAACAACAAAACAGCAACAAATCCACTAACAGTAGAAGTACCATACATTTGTACAAAAGGAGAAGACCAAATTACTGTTTGGGGGTTCCATTCTGATAACAAAATCCAAATGAAAAACCTCTATGGAGACTCAAATCCTCAAAAGTTCACCTCATCTGCTAATGGAGTAACCACACATTATGTTTCTCAGATTGGCGGCTTCCCAGATCAAACAGAAGACGGAGGGCTACCACAAAGCGGCAGAATTGTTGTTGATTACATGGTGCAAAAACCTGGGAAAACAGGAACAATTGTCTATCAAAGAGGTGTTTTGTTGCCTCAAAAGGTGTGGTGCGCGAGTGGCAGGAGCAAAGTAATAAAAGGGTCCTTGCCTTTAATTGGTGAAGCAGATTGCCTTCACGAAAAATACGGTGGATTAAACAAAAGCAAGCCTTACTACACAGGAGAACATGCAAAAGCCATAGGAAATTGCCCAATATGGGTGAAAACACCTTTGAAGCTTGCCAATGGAACCAAATATAGACCTCCTGCAAAACTATTAAAGGAAAGG',
},
{
- 'strain': 'B/Sichuan/379/99',
+ 'strain': 'B/Sichuan/379/1999',
'isolate_id': 'EPI_ISL_21113',
'date': '1999-07-01', # (Month and day unknown)
'region': 'china',
@@ -94,23 +94,23 @@ def __init__(self,min_length = 987, **kwargs):
'seq': 'ATGAAGGCAATAATTGTACTACTCATGGTAGTAACATCCAATGCAGATCGAATCTGCACTGGAATAACATCTTCAAACTCACCTCATGTGGTCAAAACAGCCACTCAAGGGGAGGTCAATGTGACTGGTGTGATACCACTAACAACAACACCAACAAAATCTTATTTTGCAAATCTCAAAGGAACAAGGACCAGAGGGAAACTATGCCCAGACTGTCTCAACTGCACAGATCTGGATGTGGCTTTGGGCAGACCAATGTGTGTGGGGACCACACCTTCGGCGAAAGCTTCAATACTCCACGAAGTCAAACCTGTTACATCCGGGTGCTTTCCTATAATGCACGACAGAACAAAAATCAGGCAACTACCCAATCTTCTCAGAGGATATGAAAATATCAGGCTATCAACCCAAAACGTCATCGATGCGGAAAAGGCACCAGGAGGACCCTACAGACTTGGAACCTCAGGATCTTGCCCTAACGCTACCAGTAAGAGCGGATTTTTCGCAACAATGGCTTGGGCTGTCCCAAAGGACAACAACAAAAATGCAACGAACCCACTAACAGTAGAAGTACCATACATTTGTACAGAAGGGGAAGACCAAATCACTGTTTGGGGGTTCCATTCAGATGACAAAACCCAAATGAAGAACCTCTATGGAGACTCAAATCCTCAAAAGTTCACCTCATCTGCTAATGGAGTAACCACACACTATGTTTCTCAGATTGGCAGCTTCCCAGATCAAACAGAAGACGGAGGACTACCACAAAGCGGCAGGATTGTTGTTGATTACATGATGCAAAAACCTGGGAAAACAGGAACAATTGTCTACCAAAGAGGTGTTTTGTTGCCTCAAAAGGTGTGGTGCGCGAGTGGCAGGAGCAAAGTAATAAAAGGGTCCTTGCCTTTAATTGGTGAAGCAGATTGCCTTCATGAAAAATACGGTGGATTAAACAAAAGCAAGCCTTACTACACAGGAGAACATGCAAAAGCCATAGGAAATTGCCCAATATGGGTGAAAACACCTTTGAAGCTTGCCAATGGAACCAAATATAGACCTCCTGCAAAACTATTAAAGGAAAGGGGTTTCTTCGGAGCTATTGCTGGTTTCCTAGAAGGAGGATGGGAAGGAATGATTGCAGGCTGGCACGGATACACATCTCACGGAGCACATGGAGTGGCAGTGGCGGCGGACCTTAAGAGTACGCAAGAAGCTATAAACAAGATAACAAAAAATCTCAATTCTTTGAGTGAGCTAGAAGTAAAGAATCTTCAAAGACTAAGTGGTGCCATGGATGAACTCCACAACGAAATACTCGAGCTGGATGAGAAAGTGGATGATCTCAGAGCTGACACTATAAGCTCGCAAATAGAACTTGCAGTCTTGCTTTCCAACGAAGGAATAATAAACAGTGAAGATGAGCATCTATTGGCACTTGAGAGAAAACTAAAGAAAATGCTGGGTCCCTCTGCTGTAGAGATAGGAAATGGATGCTTCGAAACCAAACACAAGTGCAACCAGACCTGCTTAGACAGGATAGCTGCTGGCACCTTTAATGCAGGAGAATTTTCTCTCCCCACTTTTGATTCACTGAACATTACTGCTGCATCTTTAAATGATGATGGATTGGATAACCATACTATACTGCTCTATTACTCAACTGCTGCTTCTAGTTTGGCTGTAACATTGATGCTAGCTATTTTTATTGTTTATATGGTCTCCAGAGACAACGTTTCATGCTCCATCTGTCTATAA'
},
{
- 'strain': 'B/Wisconsin/01/2010',
+ 'strain': 'B/Wisconsin/1/2010',
'isolate_id': 'EPI_ISL_76940',
'date': '2010-02-20',
'region': 'north_america',
'country': 'usa',
'seq': 'ATGAAGGCAATAATTGTACTACTCATGGTAGTAACATCCAATGCAGATCGAATCTGCACTGGGATAACATCTTCAAACTCACCTCATGTGGTCAAAACAGCTACTCAAGGGGAGGTCAATGTGACTGGCGTGATACCACTGACAACAACACCAACAAAATCTTATTTTGCAAATCTCAAAGGAACAAGGACCAGAGGGAAACTATGCCCGGACTGTCTCAACTGTACAGATCTGGATGTGGCCTTGGGCAGGCCAATGTGTGTGGGGACCACACCTTCTGCTAAAGCTTCAATACTCCACGAGGTCAGACCTGTTACATCCGGGTGCTTTCCTATAATGCACGACAGAACAAAAATCAGGCAACTACCCAATCTTCTCAGAGGATATGAAAATATCAGGTTATCAACCCAAAACGTTATCGATGCAGAAAAAGCACCAGGAGGACCCTACAGACTTGGAACCTCAGGATCTTGCCCTAACGCTACCAGTAAAATCGGATTTTTTGCAACAATGGCTTGGGCTGTCCCAAAGGACAACTACAAAAATGCAACGAACCCACTAACAGTAGAAGTACCATACATTTGTACAGAAGGGGAAGACCAAATTACTGTTTGGGGGTTCCATTCAGATAACAAAACCCAAATGAAGAGCCTCTATGGAGACTCAAATCCTCAAAAGTTCACCTCATCTGCTAATGGAGTAACCACACATTATGTTTCTCAGATTGGCGACTTCCCAGATCAAACAGAAGACGGAGGACTACCACAAAGCGGCAGAATTGTTGTTGATTACATGATGCAAAAACCTGGGAAAACAGGAACAATTGTCTATCAAAGAGGTGTTTTGTTGCCTCAAAAGGTGTGGTGCGCGAGTGGCAGGAGCAAAGTAATAAAAGGGTCATTGCCTTTAATTGGTGAAGCAGATTGCCTTCATGAAAAATACGGTGGATTAAACAAAAGCAAGCCTTACTACACAGGAGAACATGCAAAAGCCATAGGAAATTGCCCAATATGGGTAAAAACACCTTTGAAGCTTGCCAATGGAACCAAATATAGACCTCCTGCAAAACTATTGAAGGAAAGGGGTTTCTTCGGAGCTATTGCTGGTTTCCTAGAAGGAGGATGGGAAGGAATGATTGCAGGTTGGCACGGATACACATCTCACGGAGCACATGGAGTGGCAGTGGCGGCAGACCTTAAGAGTACACAAGAAGCTATAAATAAGATAACAAAAAATCTCAATTCTTTGAGTGAGCTAGAAGTAAAGAACCTTCAAAGACTAAGTGGTGCCATGGATGAACTCCACAACGAAATACTCGAGCTGGATGAGAAAGTGGATGATCTCAGAGCTGACACTATAAGCTCACAAATAGAACTTGCAGTCTTGCTTTCCAACGAAGGAATAATAAACAGTGAAGACGAGCATCTATTGGCACTTGAGAGAAAACTAAAGAAAATGCTGGGTCCCTCTGCTGTAGACATAGGAAACGGATGCTTCGAAACCAAACACAAATGCAACCAGACCTGCTTAGACAGGATAGCTGCTGGCACCTTTAATGCAGGAGAATTTTCTCTCCCCACTTTTGATTCATTGAACATTACTGCTGCATCTTTAAATGATGATGGATTGGATAACCATACTATACTGCTCTATTACTCAACTGCTGCTTCTAGTTTGGCTGTAACATTAATGCTAGCTATTTTTATTGTTTATATGGTCTCCAGAGACAACGTTTCATGCTCCATCTGTCTATAA'
},
{
- 'strain': 'B/Massachusetts/02/2012',
+ 'strain': 'B/Massachusetts/2/2012',
'isolate_id': 'EPI_ISL_121434',
'date': '2012-03-13',
'region': 'north_america',
'country': 'usa',
'seq': 'ATGAAGGCAATAATTGTACTACTAATGGTAGTAACATCCAATGCAGATCGAATCTGCACTGGGATAACATCTTCAAACTCACCTCATGTGGTCAAAACAGCTACTCAAGGGGAGGTCAATGTGACTGGTGTGATACCACTAACAACAACACCAACAAAATCTTATTTTGCAAATCTCAAAGGAACAAAGACCAGAGGGAAACTATGCCCAGACTGTCTCAACTGTACAGATCTGGATGTGGCCCTGGGCAGGCCAATGTGTGTGGGAACTACACCTTCTGCGAAAGCTTCAATACTTCACGAAGTCAGACCTGTTACATCCGGGTGCTTCCCTATAATGCACGACAGAACAAAAATCAGGCAACTAGCCAATCTTCTCAGAGGATATGAAAATATCAGGTTATCAACCCAAAACGTTATCGATGCAGAAAAGGCACCAGGAGGACCCTACAGACTTGGAACCTCAGGATCTTGCCCTAACGCTACCAGTAAAAGCGGATTTTTCGCAACAATGGCTTGGGCTGTCCCAAAGGACAACAACAAAAATGCAACGAACCCATTAACAGTAGAAGTACCATACATTTGTGCAGAAGGGGAAGACCAAATTACTGTTTGGGGGTTCCATTCAGATAACAAAACCCAAATGAAGAACCTCTATGGAGACTCAAATCCTCAAAAGTTCACCTCATCTGCTAATGGAGTAACCACACATTATGTTTCTCAGATTGGCGGCTTCCCAGATCAAACAGAAGACGGAGGACTACCACAAAGCGGCAGAATTGTCGTTGATTACATGATGCAAAAACCTGGGAAAACAGGAACAATTGTCTATCAAAGAGGTGTTTTGTTGCCTCAAAAGGTGTGGTGCGCGAGTGGCAGGAGCAAAGTAATAAAAGGGTCCTTGCCTTTAATTGGTGAAGCAGATTGCCTTCATGAAAAATACGGTGGATTAAACAAAAGCAAGCCTTACTACACAGGAGAACATGCAAAAGCCATAGGAAATTGCCCAATATGGGTGAAAACACCTTTGAAGCTTGCCAATGGAACCAAATATAGACCTCCTGCAAAACTATTAAAGGAAAGGGGTTTCTTCGGAGCTATTGCTGGTTTCCTAGAAGGAGGATGGGAAGGAATGATTGCAGGTTGGCACGGATACACATCTCACGGAGCACATGGAGTGGCAGTTGCTGCAGACCTTAAGAGCACACAAGAAGCTATAAACAAGATAACAAAAAATCTCAACTCTTTGAGTGAGCTAGAAGTAAAGAATCTTCAAAGGCTAAGTGGTGCCATGGATGAACTCCACAACGAAATACTCGAGCTGGATGAGAAAGTGGATGACCTCAGAGCTGACACTATAAGTTCACAAATAGAACTTGCAGTCTTGCTTTCCAACGAAGGAATAATAAACAGTGAAGACGAGCATCTATTGGCACTTGAGAGAAAACTAAAGAAAATGCTGGGTCCCTCTGCTGTAGACATAGGAAATGGATGCTTCGAAACCAAACACAAATGCAACCAGACCTGCTTAGACAGGATAGCTGCTGGCACCTTTAATGCAGGAGAGTTTTCTCTCCCCACTTTTGATTCATTGAACATTACTGCTGCATCTTTAAATGATGATGGATTGGATAACCATACTATACTGCTCTATTACTCAACTGCTGCTTCTAGTTTGGCTGTAACATTGATGCTAGCTATTTTTATTGTTTATATGGTCTCCAGAGACAACGTTTCATGCTCCATCTGTCTATAA'
},
{
- 'strain': 'B/PHUKET/3073/2013',
+ 'strain': 'B/Phuket/3073/2013',
'isolate_id': 'EPI_ISL_161843',
'date': '2013-11-21',
'region': 'southeast_asia',
@@ -124,7 +124,7 @@ def __init__(self,min_length = 987, **kwargs):
if 'gene' in x.qualifiers and x.type=='CDS' and
x.qualifiers['gene'][0] in ['SigPep', 'HA1', 'HA2']}
self.outgroup = {
- 'strain':'B/Singapore/11/94',
+ 'strain':'B/Singapore/11/1994',
'isolate_id':'EPI_ISL_20980',
'date':'1994-05-10',
'region':'China',
@@ -289,7 +289,6 @@ def export_to_auspice(self, tree_fields = [], tree_pop_list = [], annotations =
meta["virus_stats"] = [ [str(y)+'-'+str(m)] + [self.date_region_count[(y,m)][reg] for reg in self.regions]
for y,m in sorted(self.date_region_count.keys()) ]
write_json(meta, self.auspice_meta_fname, indent=None)
- self.export_accession_numbers()
def export_fasta_alignment(self):
print "Writing alignment"
@@ -1,6 +1,6 @@
var time_window = 1.0;
var full_data_time_window = 2.0;
-var time_ticks=[2013.0, 2013.5, 2014.0, 2014.5, 2015.0, 2015.5, 2016.0, 2016.5];
+var time_ticks=[2014.0, 2014.5, 2015.0, 2015.5, 2016.0, 2016.5, 2017.0];
var dfreq_dn = 2;
var LBItime_window = 0.5;
var LBItau = 0.0005;
@@ -1,6 +1,6 @@
var time_window = 1.0;
var full_data_time_window = 3.0;
-var time_ticks=[2013.0, 2013.5, 2014.0, 2014.5, 2015.0, 2015.5, 2016.0, 2016.5];
+var time_ticks=[2013.0, 2013.5, 2014.0, 2014.5, 2015.0, 2015.5, 2016.0, 2016.5, 2017.0];
var dfreq_dn = 2;
var LBItime_window = 0.5;
var LBItau = 0.0005;
@@ -1,6 +1,6 @@
var time_window = 2.0;
var full_data_time_window = 6.0;
-var time_ticks=[2010.0, 2011.0, 2012.0, 2013.0, 2014.0, 2015.0, 2016.0];
+var time_ticks=[2010.0, 2011.0, 2012.0, 2013.0, 2014.0, 2015.0, 2016.0, 2017.0];
var dfreq_dn = 2;
var LBItime_window = 0.5;
var LBItau = 0.0005;
@@ -1,5 +1,5 @@
var vaccineChoice = {};
-vaccineChoice['A/California/07/2009'] = "2009-09-25";
+vaccineChoice['A/California/7/2009'] = "2009-09-25";
vaccineChoice['A/Michigan/45/2015'] = "2016-09-29";
var vaccineStrains = Object.keys(vaccineChoice);
@@ -27,7 +27,7 @@ reference_viruses["A/NewYork/55/2004"] = '2004-12-01';
reference_viruses["A/Philippines/825/2003"] = '2003-07-29';
reference_viruses["A/Netherlands/555/2012"] = '2012-12-17';
reference_viruses["A/Netherlands/118/2001"] = '2001-03-14';
-reference_viruses["A/CANADA/578/2004"] = '2004-05-09';
+reference_viruses["A/Canada/578/2004"] = '2004-05-09';
reference_viruses["A/Netherlands/5/1998"] = '1998-01-14';
reference_viruses["A/Louisiana/4/2003"] = '2003-08-01';
reference_viruses["A/Lyon/2279/1995"] = '1995-11-20';
@@ -46,30 +46,30 @@ reference_viruses["A/Poland/1702/2014"] = '2014-04-08';
reference_viruses["A/Toulouse/878/2001"] = '2001-04-25';
reference_viruses["A/Victoria/523/2004"] = '2004-02-01';
reference_viruses["A/NewYork/39/2012"] = '2012-10-20';
-reference_viruses["A/LYON/1331/2006"] = '2006-12-22';
+reference_viruses["A/Lyon/1331/2006"] = '2006-12-22';
reference_viruses["A/Palau/6759/2014"] = '2014-03-26';
-reference_viruses["A/SOUTHAUSTRALIA/3/2011"] = '2011-06-10';
+reference_viruses["A/SouthAustralia/3/2011"] = '2011-06-10';
reference_viruses["A/Victoria/361/2011"] = '2011-10-24';
reference_viruses["A/Serres/77/2007"] = '2007-11-01';
reference_viruses["A/Wyoming/2/2003"] = '2003-02-01';
reference_viruses["A/Samara/73/2013"] = '2013-03-12';
-reference_viruses["A/FUKUOKA/15/2002"] = '2002-02-23';
+reference_viruses["A/Fukuoka/15/2002"] = '2002-02-23';
reference_viruses["A/HongKong/734/2001"] = '2001-06-01';
reference_viruses["A/Glasgow/407664/2012"] = '2012-04-03';
reference_viruses["A/Berlin/93/2011"] = '2011-07-03';
-reference_viruses["A/TASMANIA/11/2014"] = '2014-03-16';
+reference_viruses["A/Tasmania/11/2014"] = '2014-03-16';
reference_viruses["A/NorthCarolina/13/2014"] = '2014-04-15';
reference_viruses["A/HongKong/34430/2009"] = '2009-11-22';
reference_viruses["A/Hiroshima/52/2005"] = '2005-10-24';
-reference_viruses["A/PHILIPPINES/472/2002"] = '2002-10-01';
-reference_viruses["A/PERU/1296/2004"] = '2004-01-22';
+reference_viruses["A/Philippines/472/2002"] = '2002-10-01';
+reference_viruses["A/Peru/1296/2004"] = '2004-01-22';
reference_viruses["A/Guadeloupe/202/2010"] = '2010-11-30';
reference_viruses["A/Uruguay/716/2007"] = '2007-07-01';
reference_viruses["A/Stockholm/18/2011"] = '2011-02-21';
reference_viruses["A/Moscow/10/1999"] = '1999-06-01';
reference_viruses["A/Victoria/110/2004"] = '2004-10-01';
reference_viruses["A/Christchurch/28/2003"] = '2003-09-01';
-reference_viruses["A/VICTORIA/208/2009"] = '2009-06-02';
+reference_viruses["A/Victoria/208/2009"] = '2009-06-02';
reference_viruses["A/Wisconsin/67/2005"] = '2005-08-31';
reference_viruses["A/Norway/1789/2011"] = '2011-08-02';
reference_viruses["A/HongKong/3969/2011"] = '2011-05-19';
@@ -88,22 +88,22 @@ reference_viruses["A/Singapore/15/2001"] = '2001-01-08';
reference_viruses["A/HongKong/26560/2009"] = '2009-09-18';
reference_viruses["A/California/7/2004"] = '2004-10-01';
reference_viruses["A/Tennessee/6/2004"] = '2004-08-17';
-reference_viruses["A/TAIWAN/1529/2003"] = '2003-09-07';
-reference_viruses["A/PERTH/10/2010"] = '2010-05-25';
+reference_viruses["A/Taiwan/1529/2003"] = '2003-09-07';
+reference_viruses["A/Perth/10/2010"] = '2010-05-25';
reference_viruses["A/HongKong/1550/2002"] = '2002-01-19';
reference_viruses["A/Fujian/411/2002"] = '2002-01-01';
reference_viruses["A/Hawaii/22/2012"] = '2012-07-09';
-reference_viruses["A/BRISBANE/3/2005"] = '2005-11-01';
+reference_viruses["A/Brisbane/3/2005"] = '2005-11-01';
reference_viruses["A/Panama/2007/1999"] = '1999-07-01';
-reference_viruses["A/TAIWAN/8/2002"] = '2002-09-25';
+reference_viruses["A/Taiwan/8/2002"] = '2002-09-25';
reference_viruses["A/HongKong/1985/2009"] = '2009-04-04';
reference_viruses["A/Netherlands/22/2003"] = '2003-02-23';
reference_viruses["A/Stockholm/1/2013"] = '2013-01-13';
reference_viruses["A/SouthAfrica/4655/2013"] = '2013-06-25';
-reference_viruses["A/UKRAINE/13/2006"] = '2006-03-20';
-reference_viruses["A/NEPAL/1646/2004"] = '2004-07-01';
+reference_viruses["A/Ukraine/13/2006"] = '2006-03-20';
+reference_viruses["A/Nepal/1646/2004"] = '2004-07-01';
reference_viruses["A/Serbia/NS-210/2013"] = '2013-01-18';
-reference_viruses["A/BRISBANE/5/2002"] = '2002-03-01';
+reference_viruses["A/Brisbane/5/2002"] = '2002-03-01';
reference_viruses["A/England/259/2011"] = '2011-11-16';
reference_viruses["A/Wellington/1/2004"] = '2004-01-26';
reference_viruses["A/Almaty/2958/2013"] = '2013-01-27';
@@ -23,7 +23,7 @@ var reference_viruses = {
"B/Beijing/243/1997":'1997-01-01',
"B/Akita/5/2001":'2001-08-01',
"B/HongKong/514/2009":'2009-10-11',
-"B/CAMBODIA/30/2011":'2011-01-04',
+"B/Cambodia/30/2011":'2011-01-04',
"B/Aichi/3/1998":'1998-11-01',
"B/HongKong/45/2005":'2005-02-07',
"B/Malaysia/2506/2004":'2004-07-01',
@@ -41,4 +41,4 @@ var reference_viruses = {
"B/Shandong/7/1997":'1997-12-01',
"B/Brisbane/33/2008":'2008-07-13',
"B/NewCaledonia/5/2006":'2006-04-24'
-};
+};
@@ -1,11 +1,11 @@
var vaccineChoice = {};
-vaccineChoice['B/Beijing/184/93'] = "1998-11-01";
-vaccineChoice['B/Sichuan/379/99'] = "2001-09-25";
+vaccineChoice['B/Beijing/184/1993'] = "1998-11-01";
+vaccineChoice['B/Sichuan/379/1999'] = "2001-09-25";
vaccineChoice['B/Shanghai/361/2002'] = "2004-09-25";
vaccineChoice['B/Florida/4/2006'] = "2008-09-25";
-vaccineChoice['B/Wisconsin/01/2010'] = "2012-02-25";
-vaccineChoice['B/Massachusetts/02/2012'] = "2013-02-25";
-vaccineChoice['B/PHUKET/3073/2013'] = "2014-09-25";
+vaccineChoice['B/Wisconsin/1/2010'] = "2012-02-25";
+vaccineChoice['B/Massachusetts/2/2012'] = "2013-02-25";
+vaccineChoice['B/Phuket/3073/2013'] = "2014-09-25";
var vaccineStrains = Object.keys(vaccineChoice);
var restrictTo = {"region":"all"};
@@ -25,12 +25,11 @@ var reference_viruses = {
"B/Algeria/G486/2010":'2010-06-06',
"B/Stockholm/12/2011":'2011-02-28',
"B/Niedersachsen/1/2010":'2010-10-18',
-"B/Utah/09/2014":'2014-05-29',
-"B/Massachusetts/02/2012":'2012-03-13',
+"B/Utah/9/2014":'2014-05-29',
+"B/Massachusetts/2/2012":'2012-03-13',
"B/HongKong/3577/2012":'2012-06-13',
-"B/PHUKET/3073/2013":'2013-11-21',
+"B/Phuket/3073/2013":'2013-11-21',
"B/Florida/4/2006":'2006-11-01',
"B/Estonia/55669/2011":'2011-03-14',
-"B/ENGLAND/145/2008":'2008-05-01'
+"B/England/145/2008":'2008-05-01'
};
-

0 comments on commit 4ab29f3

Please sign in to comment.