Skip to content
Browse files

fix table

  • Loading branch information
bretonics committed Mar 24, 2017
1 parent 763385d commit c3ca75155b9aefcd3c9d7f5d5e76f03676530505
Showing with 2 additions and 2 deletions.
  1. +2 −2
@@ -68,8 +68,8 @@ Report with each gRNA sequence's details.

CHOMP will report how many occurrences of this sequence are present in the target sequence (off-target sites), along with the number of base pair matches (identities) for each. You can use this to determine which gRNA sequence is best to use for target.

| Name | Sequence | Strand | Palindrome | Subject | Start | Occurrences | Identities
| :------------- | :------------- | :------------- | :------------- | :------------- | :------------- | :------------- |
| Name | Sequence | Strand | Palindrome | Subject | Start | Occurrences | Identities |
| :------------- | :------------- | :------------- | :------------- | :------------- | :------------- | :------------- | :------------- |
| gRNA_13 | TCGTCATGCATGCTCGCTCCGGG | reverse | No | test | 173 | 1 | 8
| gRNA_12 | TTCGTCATGCATGCTCGCTCCGG | reverse | No | test | 174 | 1 | 8
| gRNA_3 | TGTGATCACGTACTATTATGCGG | plus | No | test | 116 | 2 | 8

0 comments on commit c3ca751

Please sign in to comment.