Permalink
Browse files

adding split libraries test files

  • Loading branch information...
1 parent ed2fa80 commit 1aefefdb447ba5379acd368d11a5a88b12f0f288 @walterst walterst committed Oct 16, 2012
Showing with 501 additions and 0 deletions.
  1. +24 −0 split_libraries/1.TCA.454Reads.fna
  2. +24 −0 split_libraries/1.TCA.454Reads.qual
  3. +24 −0 split_libraries/2.TCA.454Reads.fna
  4. +24 −0 split_libraries/2.TCA.454Reads.qual
  5. +16 −0 split_libraries/Combined_seqs.fna
  6. +11 −0 split_libraries/Mapping_File.txt
  7. +11 −0 split_libraries/Mapping_File1.txt
  8. +11 −0 split_libraries/Mapping_File2.txt
  9. +11 −0 split_libraries/Mapping_File_8bp_barcodes.txt
  10. +11 −0 split_libraries/Mapping_File_reverse_primer.txt
  11. +9 −0 split_libraries/Split_Library_Output/histograms.txt
  12. +8 −0 split_libraries/Split_Library_Output/seqs.fna
  13. +36 −0 split_libraries/Split_Library_Output/split_library_log.txt
  14. +9 −0 split_libraries/Split_Library_Output_comma_separated/histograms.txt
  15. +16 −0 split_libraries/Split_Library_Output_comma_separated/seqs.fna
  16. +36 −0 split_libraries/Split_Library_Output_comma_separated/split_library_log.txt
  17. +9 −0 split_libraries/Split_Library_Run1_Output/histograms.txt
  18. +8 −0 split_libraries/Split_Library_Run1_Output/seqs.fna
  19. +36 −0 split_libraries/Split_Library_Run1_Output/split_library_log.txt
  20. +9 −0 split_libraries/Split_Library_Run2_Output/histograms.txt
  21. +8 −0 split_libraries/Split_Library_Run2_Output/seqs.fna
  22. +36 −0 split_libraries/Split_Library_Run2_Output/split_library_log.txt
  23. +9 −0 split_libraries/split_Library_output_8bp/histograms.txt
  24. +8 −0 split_libraries/split_Library_output_8bp/seqs.fna
  25. +36 −0 split_libraries/split_Library_output_8bp/split_library_log.txt
  26. +13 −0 split_libraries/split_libraries_output_revprimer/histograms.txt
  27. +8 −0 split_libraries/split_libraries_output_revprimer/seqs.fna
  28. +40 −0 split_libraries/split_libraries_output_revprimer/split_library_log.txt
@@ -0,0 +1,24 @@
+>FLP3FBN01ELBSX length=250 xy=1766_0111 region=1 run=R_2008_12_09_13_51_01_
+ACAGAGTCGGCTCATGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAATGTGG
+CCGTTTACCCTCTCAGGCCGGCTACGCATCATCGCCTTGGTGGGCCGTTACCTCACCAAC
+TAGCTAATGCGCCGCAGGTCCATCCATGTTCACGCCTTGATGGGCGCTTTAATATACTGA
+GCATGCGCTCTGTATACCTATCCGGTTTTAGCTACCGTTTCCAGCAGTTATCCCGGACAC
+ATGGGCTAGG
+>FLP3FBN01EG8AX length=276 xy=1719_1463 region=1 run=R_2008_12_09_13_51_01_
+ACAGAGTCGGCTCATGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGG
+GGGCCTTCCTCTCAGAACCCCTATCCATCGAAGGCTTGGTGGGCCGTTACCCCGCCAACA
+ACCTAATGGAACGCATCCCCATCGATGACCGAAGTTCTTTAATAGTTCTACCATGCGGAA
+GAACTATGCCATCGGGTATTAATCTTTCTTTCGAAAGGCTATCCCCGAGTCATCGGCAGG
+TTGGATACGTGTTACTCACCCGTGCGCCGGTCGCCA
+>FLP3FBN01EEWKD length=244 xy=1692_3531 region=1 run=R_2008_12_09_13_51_01_
+AGCACGAGCCTACATGCTGCCTCCCGTAGGAGTTTGGGCCGTGTCTCAGTCCCAATGTGG
+CCGATCAGTCTCTTAACTCGGCTATGCATCATTGCCTTGGTAAGCCGTTACCTTACCAAC
+TAGCTAATGCACCGCAGGTCCATCCAAGAGTGATAGCAGAACCATCTTTCAAACTCTAGA
+CATGCGTCTAGTGTTGTTATCCGGTATTAGCATCTGTTTCCAGGTGTTATCCCAGTCTCT
+TGGG
+>FLP3FBN01DEHK3 length=252 xy=1278_0245 region=1 run=R_2008_12_09_13_51_01_
+ACCAGCGACTAGCATGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAATGTGG
+CCGTTCAACCTCTCAGTCCGGCTACTGATCGTCGACTTGGTGAGCCGTTACCTCACCAAC
+TATCTAATCAGACGCGAGCCCATCTTTCAGCGGATTGCTCCTTTGGTATTCCGGCGATGC
+CGCCAAAATCATTATGCGGTATTAGCAGTCGTTTCCAACTGTTGTCCCCCTCTGAAAGGC
+AGGTTGCTCACG
@@ -0,0 +1,24 @@
+>FLP3FBN01ELBSX length=250 xy=1766_0111 region=1 run=R_2008_12_09_13_51_01_
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 33 33 33 36 37 37 37 37 37 37 40 40 40 39 39 38 40 40 40 40 40 40 40 37 37 37 37 37 35 35 35 37 37 37 35 37 35 35
+35 31 31 23 23 23 31 21 21 21 35 35 37 37 37 36 36 36 36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 28 28 28 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 35 32 32 32 32 35 37 37 37 37
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 32 32 32 36 37 35 32 32 32 32 32 32 32 32 36 37 37 37 37 36 36 31 31 32 32 36 36 36 36 36 36 36 36 36 36 36 28 27 27 27 26 26 26 30 29
+30 29 24 24 24 21 15 15 13 13
+>FLP3FBN01EG8AX length=276 xy=1719_1463 region=1 run=R_2008_12_09_13_51_01_
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 38 37 33 33 21 21 21 26 33 37 36 36 40 33 24 24 29 33 33 39 39 39 40 39 39 39 40 37 37 37 37 37 37 37 37 37 37 37 32 32 20 20
+20 20 20 35 35 37 37 37 37 37 37 37 36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 36 36 36 36 37 37 37 37 37 36 36 36 36 37 37
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 33 28 28 28 28 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 33 33 33 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37
+37 36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 28 28 28 37 28 28 28 37 37 37 37 37 36 36 36 36 36 28 26 26 26 26 28 36 36 36 36 36 36 36 37 38 38 38 38 38
+37 37 37 37 37 31 31 31 31 31 31 31 31 31 31 31 31 30 22 22 22 25 25 31 31 31 31 31 31 31 25 25 25 25 25 28
+>FLP3FBN01EEWKD length=244 xy=1692_3531 region=1 run=R_2008_12_09_13_51_01_
+36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 33 33 26 21 21 31 36 37 37 37 36 36 33 34 34 36 37 36 37 37 37 37 37 37 37 37 37 37 37 36 28 28 28 36 36 37 37 35 35 35
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 32 32 32 35 35 37 35 32 32 32 37 37 37 37 37 37 36 36 36 36 36
+36 36 36 37 37 37 37 37 37 37 35 35 35 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 35 35 35 37 37 37 37 37 37 37 37 37 37 36 36 36 37 36 35 35 35 37 28 28 28 32 35 37 37 37 36 36
+36 37 37 37 37 37 37 35 35 35 35 35 37 37 37 37 36 36 36 37 28 28 28 28 35 36 37 37 37 37 37 37 37 37 37 37 36 33 33 32 31 36 36 33 33 27 27 27 36 31 25 25 25 32 36 36 36 36 36 36
+36 36 36 36
+>FLP3FBN01DEHK3 length=252 xy=1278_0245 region=1 run=R_2008_12_09_13_51_01_
+36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 40 40 40 40 40 40 40 40 40 40 38 38 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 37 37 37 37 37 33 33 33 36 36 37 37 37 37 37
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 33 33 33 33 37 37 37 37 37 37 37 37 37 37 37 37
+37 37 36 36 28 28 28 28 33 33 33 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 36 36 36 36 31 31 27 27 28 28 28 27 21 31 31 36 36 36 36 36 36
+36 36 36 36 36 31 31 31 31 31 31 31
@@ -0,0 +1,24 @@
+>FLP3FBN01ELBSX1 length=250 xy=1766_0111 region=1 run=R_2008_12_09_13_51_01_
+ACAGAGTCGGCTCATGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAATGTGG
+CCGTTTACCCTCTCAGGCCGGCTACGCATCATCGCCTTGGTGGGCCGTTACCTCACCAAC
+TAGCTAATGCGCCGCAGGTCCATCCATGTTCACGCCTTGATGGGCGCTTTAATATACTGA
+GCATGCGCTCTGTATACCTATCCGGTTTTAGCTACCGTTTCCAGCAGTTATCCCGGACAC
+ATGGGCTAGG
+>FLP3FBN01EG8AX2 length=276 xy=1719_1463 region=1 run=R_2008_12_09_13_51_01_
+ACAGAGTCGGCTCATGCTGCCTCCCGTAGGAGTTTGGACCGTGTCTCAGTTCCAATGTGG
+GGGCCTTCCTCTCAGAACCCCTATCCATCGAAGGCTTGGTGGGCCGTTACCCCGCCAACA
+ACCTAATGGAACGCATCCCCATCGATGACCGAAGTTCTTTAATAGTTCTACCATGCGGAA
+GAACTATGCCATCGGGTATTAATCTTTCTTTCGAAAGGCTATCCCCGAGTCATCGGCAGG
+TTGGATACGTGTTACTCACCCGTGCGCCGGTCGCCA
+>FLP3FBN01EEWKD3 length=244 xy=1692_3531 region=1 run=R_2008_12_09_13_51_01_
+AGCACGAGCCTACATGCTGCCTCCCGTAGGAGTTTGGGCCGTGTCTCAGTCCCAATGTGG
+CCGATCAGTCTCTTAACTCGGCTATGCATCATTGCCTTGGTAAGCCGTTACCTTACCAAC
+TAGCTAATGCACCGCAGGTCCATCCAAGAGTGATAGCAGAACCATCTTTCAAACTCTAGA
+CATGCGTCTAGTGTTGTTATCCGGTATTAGCATCTGTTTCCAGGTGTTATCCCAGTCTCT
+TGGG
+>FLP3FBN01DEHK34 length=252 xy=1278_0245 region=1 run=R_2008_12_09_13_51_01_
+ACCAGCGACTAGCATGCTGCCTCCCGTAGGAGTCTGGGCCGTGTCTCAGTCCCAATGTGG
+CCGTTCAACCTCTCAGTCCGGCTACTGATCGTCGACTTGGTGAGCCGTTACCTCACCAAC
+TATCTAATCAGACGCGAGCCCATCTTTCAGCGGATTGCTCCTTTGGTATTCCGGCGATGC
+CGCCAAAATCATTATGCGGTATTAGCAGTCGTTTCCAACTGTTGTCCCCCTCTGAAAGGC
+AGGTTGCTCACG
@@ -0,0 +1,24 @@
+>FLP3FBN01ELBSX1 length=250 xy=1766_0111 region=1 run=R_2008_12_09_13_51_01_
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 33 33 33 36 37 37 37 37 37 37 40 40 40 39 39 38 40 40 40 40 40 40 40 37 37 37 37 37 35 35 35 37 37 37 35 37 35 35
+35 31 31 23 23 23 31 21 21 21 35 35 37 37 37 36 36 36 36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 28 28 28 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 35 32 32 32 32 35 37 37 37 37
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 32 32 32 36 37 35 32 32 32 32 32 32 32 32 36 37 37 37 37 36 36 31 31 32 32 36 36 36 36 36 36 36 36 36 36 36 28 27 27 27 26 26 26 30 29
+30 29 24 24 24 21 15 15 13 13
+>FLP3FBN01EG8AX2 length=276 xy=1719_1463 region=1 run=R_2008_12_09_13_51_01_
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 38 37 33 33 21 21 21 26 33 37 36 36 40 33 24 24 29 33 33 39 39 39 40 39 39 39 40 37 37 37 37 37 37 37 37 37 37 37 32 32 20 20
+20 20 20 35 35 37 37 37 37 37 37 37 36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 36 36 36 36 37 37 37 37 37 36 36 36 36 37 37
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 33 28 28 28 28 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 33 33 33 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37
+37 36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 28 28 28 37 28 28 28 37 37 37 37 37 36 36 36 36 36 28 26 26 26 26 28 36 36 36 36 36 36 36 37 38 38 38 38 38
+37 37 37 37 37 31 31 31 31 31 31 31 31 31 31 31 31 30 22 22 22 25 25 31 31 31 31 31 31 31 25 25 25 25 25 28
+>FLP3FBN01EEWKD3 length=244 xy=1692_3531 region=1 run=R_2008_12_09_13_51_01_
+36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 33 33 26 21 21 31 36 37 37 37 36 36 33 34 34 36 37 36 37 37 37 37 37 37 37 37 37 37 37 36 28 28 28 36 36 37 37 35 35 35
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 32 32 32 35 35 37 35 32 32 32 37 37 37 37 37 37 36 36 36 36 36
+36 36 36 37 37 37 37 37 37 37 35 35 35 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 35 35 35 37 37 37 37 37 37 37 37 37 37 36 36 36 37 36 35 35 35 37 28 28 28 32 35 37 37 37 36 36
+36 37 37 37 37 37 37 35 35 35 35 35 37 37 37 37 36 36 36 37 28 28 28 28 35 36 37 37 37 37 37 37 37 37 37 37 36 33 33 32 31 36 36 33 33 27 27 27 36 31 25 25 25 32 36 36 36 36 36 36
+36 36 36 36
+>FLP3FBN01DEHK34 length=252 xy=1278_0245 region=1 run=R_2008_12_09_13_51_01_
+36 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 40 40 40 40 40 40 40 40 40 40 38 38 39 40 40 40 40 40 40 40 40 40 40 40 40 40 40 37 37 37 37 37 33 33 33 36 36 37 37 37 37 37
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37
+37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 33 33 33 33 37 37 37 37 37 37 37 37 37 37 37 37
+37 37 36 36 28 28 28 28 33 33 33 36 36 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 37 36 36 36 36 36 36 31 31 27 27 28 28 28 27 21 31 31 36 36 36 36 36 36
+36 36 36 36 36 31 31 31 31 31 31 31
@@ -0,0 +1,16 @@
+>PC.634_1000000 FLP3FBN01ELBSX orig_bc=ACAGAGTCGGCT new_bc=ACAGAGTCGGCT bc_diffs=0
+CTGGGCCGTGTCTCAGTCCCAATGTGGCCGTTTACCCTCTCAGGCCGGCTACGCATCATCGCCTTGGTGGGCCGTTACCTCACCAACTAGCTAATGCGCCGCAGGTCCATCCATGTTCACGCCTTGATGGGCGCTTTAATATACTGAGCATGCGCTCTGTATACCTATCCGGTTTTAGCTACCGTTTCCAGCAGTTATCCCGGACACATGGGCTAGG
+>PC.634_1000001 FLP3FBN01EG8AX orig_bc=ACAGAGTCGGCT new_bc=ACAGAGTCGGCT bc_diffs=0
+TTGGACCGTGTCTCAGTTCCAATGTGGGGGCCTTCCTCTCAGAACCCCTATCCATCGAAGGCTTGGTGGGCCGTTACCCCGCCAACAACCTAATGGAACGCATCCCCATCGATGACCGAAGTTCTTTAATAGTTCTACCATGCGGAAGAACTATGCCATCGGGTATTAATCTTTCTTTCGAAAGGCTATCCCCGAGTCATCGGCAGGTTGGATACGTGTTACTCACCCGTGCGCCGGTCGCCA
+>PC.354_1000002 FLP3FBN01EEWKD orig_bc=AGCACGAGCCTA new_bc=AGCACGAGCCTA bc_diffs=0
+TTGGGCCGTGTCTCAGTCCCAATGTGGCCGATCAGTCTCTTAACTCGGCTATGCATCATTGCCTTGGTAAGCCGTTACCTTACCAACTAGCTAATGCACCGCAGGTCCATCCAAGAGTGATAGCAGAACCATCTTTCAAACTCTAGACATGCGTCTAGTGTTGTTATCCGGTATTAGCATCTGTTTCCAGGTGTTATCCCAGTCTCTTGGG
+>PC.481_1000003 FLP3FBN01DEHK3 orig_bc=ACCAGCGACTAG new_bc=ACCAGCGACTAG bc_diffs=0
+CTGGGCCGTGTCTCAGTCCCAATGTGGCCGTTCAACCTCTCAGTCCGGCTACTGATCGTCGACTTGGTGAGCCGTTACCTCACCAACTATCTAATCAGACGCGAGCCCATCTTTCAGCGGATTGCTCCTTTGGTATTCCGGCGATGCCGCCAAAATCATTATGCGGTATTAGCAGTCGTTTCCAACTGTTGTCCCCCTCTGAAAGGCAGGTTGCTCACG
+>PC.634_2000000 FLP3FBN01ELBSX1 orig_bc=ACAGAGTCGGCT new_bc=ACAGAGTCGGCT bc_diffs=0
+CTGGGCCGTGTCTCAGTCCCAATGTGGCCGTTTACCCTCTCAGGCCGGCTACGCATCATCGCCTTGGTGGGCCGTTACCTCACCAACTAGCTAATGCGCCGCAGGTCCATCCATGTTCACGCCTTGATGGGCGCTTTAATATACTGAGCATGCGCTCTGTATACCTATCCGGTTTTAGCTACCGTTTCCAGCAGTTATCCCGGACACATGGGCTAGG
+>PC.634_2000001 FLP3FBN01EG8AX2 orig_bc=ACAGAGTCGGCT new_bc=ACAGAGTCGGCT bc_diffs=0
+TTGGACCGTGTCTCAGTTCCAATGTGGGGGCCTTCCTCTCAGAACCCCTATCCATCGAAGGCTTGGTGGGCCGTTACCCCGCCAACAACCTAATGGAACGCATCCCCATCGATGACCGAAGTTCTTTAATAGTTCTACCATGCGGAAGAACTATGCCATCGGGTATTAATCTTTCTTTCGAAAGGCTATCCCCGAGTCATCGGCAGGTTGGATACGTGTTACTCACCCGTGCGCCGGTCGCCA
+>PC.354_2000002 FLP3FBN01EEWKD3 orig_bc=AGCACGAGCCTA new_bc=AGCACGAGCCTA bc_diffs=0
+TTGGGCCGTGTCTCAGTCCCAATGTGGCCGATCAGTCTCTTAACTCGGCTATGCATCATTGCCTTGGTAAGCCGTTACCTTACCAACTAGCTAATGCACCGCAGGTCCATCCAAGAGTGATAGCAGAACCATCTTTCAAACTCTAGACATGCGTCTAGTGTTGTTATCCGGTATTAGCATCTGTTTCCAGGTGTTATCCCAGTCTCTTGGG
+>PC.481_2000003 FLP3FBN01DEHK34 orig_bc=ACCAGCGACTAG new_bc=ACCAGCGACTAG bc_diffs=0
+CTGGGCCGTGTCTCAGTCCCAATGTGGCCGTTCAACCTCTCAGTCCGGCTACTGATCGTCGACTTGGTGAGCCGTTACCTCACCAACTATCTAATCAGACGCGAGCCCATCTTTCAGCGGATTGCTCCTTTGGTATTCCGGCGATGCCGCCAAAATCATTATGCGGTATTAGCAGTCGTTTCCAACTGTTGTCCCCCTCTGAAAGGCAGGTTGCTCACG
@@ -0,0 +1,11 @@
+#SampleID BarcodeSequence LinkerPrimerSequence Treatment DOB Description
+#Example mapping file for the QIIME analysis package. These 9 samples are from a study of the effects of exercise and diet on mouse cardiac physiology (Crawford, et al, PNAS, 2009).
+PC.354 AGCACGAGCCTA YATGCTGCCTCCCGTAGGAGT Control 20061218 Control_mouse_I.D._354
+PC.355 AACTCGTCGATG YATGCTGCCTCCCGTAGGAGT Control 20061218 Control_mouse_I.D._355
+PC.356 ACAGACCACTCA YATGCTGCCTCCCGTAGGAGT Control 20061126 Control_mouse_I.D._356
+PC.481 ACCAGCGACTAG YATGCTGCCTCCCGTAGGAGT Control 20070314 Control_mouse_I.D._481
+PC.593 AGCAGCACTTGT YATGCTGCCTCCCGTAGGAGT Control 20071210 Control_mouse_I.D._593
+PC.607 AACTGTGCGTAC YATGCTGCCTCCCGTAGGAGT Fast 20071112 Fasting_mouse_I.D._607
+PC.634 ACAGAGTCGGCT YATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._634
+PC.635 ACCGCAGAGTCA YATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._635
+PC.636 ACGGTGAGTGTC YATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._636
@@ -0,0 +1,11 @@
+#SampleID BarcodeSequence LinkerPrimerSequence Treatment DOB Description
+#Example mapping file for the QIIME analysis package. These 9 samples are from a study of the effects of exercise and diet on mouse cardiac physiology (Crawford, et al, PNAS, 2009).
+PC.354 AGCACGAGCCTA YATGCTGCCTCCCGTAGGAGT Control 20061218 Control_mouse_I.D._354
+PC.355 AACTCGTCGATG YATGCTGCCTCCCGTAGGAGT Control 20061218 Control_mouse_I.D._355
+PC.356 ACAGACCACTCA YATGCTGCCTCCCGTAGGAGT Control 20061126 Control_mouse_I.D._356
+PC.481 ACCAGCGACTAG YATGCTGCCTCCCGTAGGAGT Control 20070314 Control_mouse_I.D._481
+PC.593 AGCAGCACTTGT YATGCTGCCTCCCGTAGGAGT Control 20071210 Control_mouse_I.D._593
+PC.607 AACTGTGCGTAC YATGCTGCCTCCCGTAGGAGT Fast 20071112 Fasting_mouse_I.D._607
+PC.634 ACAGAGTCGGCT YATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._634
+PC.635 ACCGCAGAGTCA YATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._635
+PC.636 ACGGTGAGTGTC YATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._636
@@ -0,0 +1,11 @@
+#SampleID BarcodeSequence LinkerPrimerSequence Treatment DOB Description
+#Example mapping file for the QIIME analysis package. These 9 samples are from a study of the effects of exercise and diet on mouse cardiac physiology (Crawford, et al, PNAS, 2009).
+PC.354 AGCACGAGCCTA YATGCTGCCTCCCGTAGGAGT Control 20061218 Control_mouse_I.D._354
+PC.355 AACTCGTCGATG YATGCTGCCTCCCGTAGGAGT Control 20061218 Control_mouse_I.D._355
+PC.356 ACAGACCACTCA YATGCTGCCTCCCGTAGGAGT Control 20061126 Control_mouse_I.D._356
+PC.481 ACCAGCGACTAG YATGCTGCCTCCCGTAGGAGT Control 20070314 Control_mouse_I.D._481
+PC.593 AGCAGCACTTGT YATGCTGCCTCCCGTAGGAGT Control 20071210 Control_mouse_I.D._593
+PC.607 AACTGTGCGTAC YATGCTGCCTCCCGTAGGAGT Fast 20071112 Fasting_mouse_I.D._607
+PC.634 ACAGAGTCGGCT YATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._634
+PC.635 ACCGCAGAGTCA YATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._635
+PC.636 ACGGTGAGTGTC YATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._636
@@ -0,0 +1,11 @@
+#SampleID BarcodeSequence LinkerPrimerSequence Treatment DOB Description
+#Example mapping file for the QIIME analysis package. These 9 samples are from a study of the effects of exercise and diet on mouse cardiac physiology (Crawford, et al, PNAS, 2009).
+PC.354 AGCACGAG CCTAYATGCTGCCTCCCGTAGGAGT Control 20061218 Control_mouse_I.D._354
+PC.355 AACTCGTC GGCTYATGCTGCCTCCCGTAGGAGT Control 20061218 Control_mouse_I.D._355
+PC.356 ACAGACCA GGCTYATGCTGCCTCCCGTAGGAGT Control 20061126 Control_mouse_I.D._356
+PC.481 ACCAGCGA CTAGYATGCTGCCTCCCGTAGGAGT Control 20070314 Control_mouse_I.D._481
+PC.593 AGCAGCAC GGCTYATGCTGCCTCCCGTAGGAGT Control 20071210 Control_mouse_I.D._593
+PC.607 AACTGTGC GGCTYATGCTGCCTCCCGTAGGAGT Fast 20071112 Fasting_mouse_I.D._607
+PC.634 ACAGAGTC GGCTYATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._634
+PC.635 ACCGCAGA GGCTYATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._635
+PC.636 ACGGTGAG GGCTYATGCTGCCTCCCGTAGGAGT Fast 20080116 Fasting_mouse_I.D._636
@@ -0,0 +1,11 @@
+#SampleID BarcodeSequence LinkerPrimerSequence Treatment DOB ReversePrimer Description
+#Example mapping file for the QIIME analysis package. These 9 samples are from a study of the effects of exercise and diet on mouse cardiac physiology (Crawford, et al, PNAS, 2009).
+PC.354 AGCACGAGCCTA YATGCTGCCTCCCGTAGGAGT Control 20061218 GCTGGAAA Control_mouse_I.D._354
+PC.355 AACTCGTCGATG YATGCTGCCTCCCGTAGGAGT Control 20061218 GCTGGAAA Control_mouse_I.D._355
+PC.356 ACAGACCACTCA YATGCTGCCTCCCGTAGGAGT Control 20061126 GCTGGAAA Control_mouse_I.D._356
+PC.481 ACCAGCGACTAG YATGCTGCCTCCCGTAGGAGT Control 20070314 GCTGGAAA Control_mouse_I.D._481
+PC.593 AGCAGCACTTGT YATGCTGCCTCCCGTAGGAGT Control 20071210 GCTGGAAA Control_mouse_I.D._593
+PC.607 AACTGTGCGTAC YATGCTGCCTCCCGTAGGAGT Fast 20071112 GCTGGAAA Fasting_mouse_I.D._607
+PC.634 ACAGAGTCGGCT YATGCTGCCTCCCGTAGGAGT Fast 20080116 GCTGGAAA Fasting_mouse_I.D._634
+PC.635 ACCGCAGAGTCA YATGCTGCCTCCCGTAGGAGT Fast 20080116 GCTGGAAA Fasting_mouse_I.D._635
+PC.636 ACGGTGAGTGTC YATGCTGCCTCCCGTAGGAGT Fast 20080116 GCTGGAAA Fasting_mouse_I.D._636
@@ -0,0 +1,9 @@
+# bins raw sequence lengths, length of sequences that pass quality filters before processing, and lengths of sequences that pass quality filters post processing.
+Length Raw Before After
+210 0 0 3
+220 0 0 0
+230 0 0 0
+240 1 1 1
+250 2 2 0
+260 0 0 0
+270 1 1 0
@@ -0,0 +1,8 @@
+>PC.634_1 FLP3FBN01ELBSX orig_bc=ACAGAGTCGGCT new_bc=ACAGAGTCGGCT bc_diffs=0
+CTGGGCCGTGTCTCAGTCCCAATGTGGCCGTTTACCCTCTCAGGCCGGCTACGCATCATCGCCTTGGTGGGCCGTTACCTCACCAACTAGCTAATGCGCCGCAGGTCCATCCATGTTCACGCCTTGATGGGCGCTTTAATATACTGAGCATGCGCTCTGTATACCTATCCGGTTTTAGCTACCGTTTCCAGCAGTTATCCCGGACACATGGGCTAGG
+>PC.634_2 FLP3FBN01EG8AX orig_bc=ACAGAGTCGGCT new_bc=ACAGAGTCGGCT bc_diffs=0
+TTGGACCGTGTCTCAGTTCCAATGTGGGGGCCTTCCTCTCAGAACCCCTATCCATCGAAGGCTTGGTGGGCCGTTACCCCGCCAACAACCTAATGGAACGCATCCCCATCGATGACCGAAGTTCTTTAATAGTTCTACCATGCGGAAGAACTATGCCATCGGGTATTAATCTTTCTTTCGAAAGGCTATCCCCGAGTCATCGGCAGGTTGGATACGTGTTACTCACCCGTGCGCCGGTCGCCA
+>PC.354_3 FLP3FBN01EEWKD orig_bc=AGCACGAGCCTA new_bc=AGCACGAGCCTA bc_diffs=0
+TTGGGCCGTGTCTCAGTCCCAATGTGGCCGATCAGTCTCTTAACTCGGCTATGCATCATTGCCTTGGTAAGCCGTTACCTTACCAACTAGCTAATGCACCGCAGGTCCATCCAAGAGTGATAGCAGAACCATCTTTCAAACTCTAGACATGCGTCTAGTGTTGTTATCCGGTATTAGCATCTGTTTCCAGGTGTTATCCCAGTCTCTTGGG
+>PC.481_4 FLP3FBN01DEHK3 orig_bc=ACCAGCGACTAG new_bc=ACCAGCGACTAG bc_diffs=0
+CTGGGCCGTGTCTCAGTCCCAATGTGGCCGTTCAACCTCTCAGTCCGGCTACTGATCGTCGACTTGGTGAGCCGTTACCTCACCAACTATCTAATCAGACGCGAGCCCATCTTTCAGCGGATTGCTCCTTTGGTATTCCGGCGATGCCGCCAAAATCATTATGCGGTATTAGCAGTCGTTTCCAACTGTTGTCCCCCTCTGAAAGGCAGGTTGCTCACG
@@ -0,0 +1,36 @@
+Number raw input seqs 4
+
+Length outside bounds of 200 and 1000 0
+Num ambiguous bases exceeds limit of 6 0
+Missing Qual Score 0
+Mean qual score below minimum of 25 0
+Max homopolymer run exceeds limit of 6 0
+Num mismatches in primer exceeds limit of 0: 0
+
+Sequence length details for all sequences passing quality filters:
+Raw len min/max/avg 244.0/276.0/255.5
+Wrote len min/max/avg 211.0/243.0/222.5
+
+Barcodes corrected/not 0/0
+Uncorrected barcodes will not be written to the output fasta file.
+Corrected barcodes will be written with the appropriate barcode category.
+Corrected but unassigned sequences will not be written unless --retain_unassigned_reads is enabled.
+
+Total valid barcodes that are not in mapping file 0
+Sequences associated with valid barcodes that are not in the mapping file will not be written.
+
+Barcodes in mapping file
+Num Samples 3
+Sample ct min/max/mean: 1 / 2 / 1.33
+Sample Sequence Count Barcode
+PC.634 2 ACAGAGTCGGCT
+PC.354 1 AGCACGAGCCTA
+PC.481 1 ACCAGCGACTAG
+PC.593 0 AGCAGCACTTGT
+PC.636 0 ACGGTGAGTGTC
+PC.635 0 ACCGCAGAGTCA
+PC.356 0 ACAGACCACTCA
+PC.607 0 AACTGTGCGTAC
+PC.355 0 AACTCGTCGATG
+
+Total number seqs written 4
@@ -0,0 +1,9 @@
+# bins raw sequence lengths, length of sequences that pass quality filters before processing, and lengths of sequences that pass quality filters post processing.
+Length Raw Before After
+210 0 0 6
+220 0 0 0
+230 0 0 0
+240 2 2 2
+250 4 4 0
+260 0 0 0
+270 2 2 0
Oops, something went wrong.

0 comments on commit 1aefefd

Please sign in to comment.