Permalink
Browse files

added test input and output for parallel_blast

  • Loading branch information...
1 parent b10383d commit 8ab40d874e1a27f5662b41f722707b95cf8ecd01 @gregcaporaso gregcaporaso committed May 2, 2012
@@ -0,0 +1,42 @@
+# BLASTN 2.2.22 [Sep-27-2009]
+# Query: 11472286
+# Database: /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta
+# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score
+11472286 EU883771 92.73 55 4 0 1066 1120 627 681 3e-17 77.8
+# BLASTN 2.2.22 [Sep-27-2009]
+# Query: 11472384
+# Database: /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta
+# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score
+# BLASTN 2.2.22 [Sep-27-2009]
+# Query: 11468680
+# Database: /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta
+# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score
+# BLASTN 2.2.22 [Sep-27-2009]
+# Query: 11458037
+# Database: /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta
+# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score
+# BLASTN 2.2.22 [Sep-27-2009]
+# Query: 11469739
+# Database: /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta
+# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score
+# BLASTN 2.2.22 [Sep-27-2009]
+# Query: 11469752
+# Database: /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta
+# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score
+11469752 EU883771 95.45 44 2 0 886 929 627 670 2e-15 71.9
+# BLASTN 2.2.22 [Sep-27-2009]
+# Query: 11460523
+# Database: /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta
+# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score
+# BLASTN 2.2.22 [Sep-27-2009]
+# Query: 11460543
+# Database: /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta
+# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score
+# BLASTN 2.2.22 [Sep-27-2009]
+# Query: 11480235
+# Database: /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta
+# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score
+# BLASTN 2.2.22 [Sep-27-2009]
+# Query: 11480408
+# Database: /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta
+# Fields: Query id, Subject id, % identity, alignment length, mismatches, gap openings, q. start, q. end, s. start, s. end, e-value, bit score

Large diffs are not rendered by default.

Oops, something went wrong.
@@ -0,0 +1,3 @@
+ export BLASTMAT=/Applications/blast-2.2.22/data/
+ blastall -p blastn -m 9 -e 1e-30 -F T -W 30 -b 1 -i /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out/BLAST_bxw_.0.fasta -d /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta > /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_bxw_/BLAST_bxw_.0_blast_out.txt
+ mv /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_bxw_/BLAST_bxw_.0_blast_out.txt /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_bxw_.0_blast_out.txt
@@ -0,0 +1,3 @@
+ export BLASTMAT=/Applications/blast-2.2.22/data/
+ blastall -p blastn -m 9 -e 1e-30 -F T -W 30 -b 1 -i /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out/BLAST_bxw_.1.fasta -d /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta > /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_bxw_/BLAST_bxw_.1_blast_out.txt
+ mv /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_bxw_/BLAST_bxw_.1_blast_out.txt /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_bxw_.1_blast_out.txt
@@ -0,0 +1 @@
+ python /Users/caporaso/code/Qiime/scripts/poller.py -f /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_bxw_/expected_out_files.txt -m /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_bxw_/merge_map.txt -d /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_bxw_/deletion_list.txt -t 1
@@ -0,0 +1,3 @@
+ export BLASTMAT=/Applications/blast-2.2.22/data/
+ blastall -p blastn -m 9 -e 1.0 -F T -W 30 -b 1 -i /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out/BLAST_fCy_.0.fasta -d /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta > /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_fCy_/BLAST_fCy_.0_blast_out.txt
+ mv /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_fCy_/BLAST_fCy_.0_blast_out.txt /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_fCy_.0_blast_out.txt
@@ -0,0 +1,3 @@
+ export BLASTMAT=/Applications/blast-2.2.22/data/
+ blastall -p blastn -m 9 -e 1.0 -F T -W 30 -b 1 -i /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out/BLAST_fCy_.1.fasta -d /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta > /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_fCy_/BLAST_fCy_.1_blast_out.txt
+ mv /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_fCy_/BLAST_fCy_.1_blast_out.txt /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_fCy_.1_blast_out.txt
@@ -0,0 +1 @@
+ python /Users/caporaso/code/Qiime/scripts/poller.py -f /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_fCy_/expected_out_files.txt -m /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_fCy_/merge_map.txt -d /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_fCy_/deletion_list.txt -t 1
@@ -0,0 +1,3 @@
+ export BLASTMAT=/Applications/blast-2.2.22/data/
+ blastall -p blastn -m 9 -e 0.001 -F T -W 30 -b 1 -i /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out/BLAST_pru_.0.fasta -d /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta > /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_pru_/BLAST_pru_.0_blast_out.txt
+ mv /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_pru_/BLAST_pru_.0_blast_out.txt /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_pru_.0_blast_out.txt
@@ -0,0 +1,3 @@
+ export BLASTMAT=/Applications/blast-2.2.22/data/
+ blastall -p blastn -m 9 -e 0.001 -F T -W 30 -b 1 -i /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out/BLAST_pru_.1.fasta -d /Users/caporaso/code/qiime_test_data/parallel_blast/refseqs.fasta > /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_pru_/BLAST_pru_.1_blast_out.txt
+ mv /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_pru_/BLAST_pru_.1_blast_out.txt /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_pru_.1_blast_out.txt
@@ -0,0 +1 @@
+ python /Users/caporaso/code/Qiime/scripts/poller.py -f /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_pru_/expected_out_files.txt -m /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_pru_/merge_map.txt -d /Users/caporaso/code/qiime_test_data/parallel_blast/blast_out//BLAST_pru_/deletion_list.txt -t 1
@@ -0,0 +1,10 @@
+>AY800210
+TTCCGGTTGATCCTGCCGGACCCGACTGCTATCCGGATGCGACTAAGCCATGCTAGTCTAACGGATCTTCGGATCCGTGGCATACCGCTCTGTAACACGTAGATAACCTACCCTGAGGTCGGGGAAACTCCCGGGAAACTGGGCCTAATCCCCGATAGATAATTTGTACTGGAATGTCTTTTTATTGAAACCTCCGAGGCCTCAGGATGGGTCTGCGCCAGATTATGGTCGTAGGTGGGGTAACGGCCCACCTAGCCTTTGATCTGTACCGGACATGAGAGTGTGTGCCGGGAGATGGCCACTGAGACAAGGGGCCAGGCCCTACGGGGCGCAGCAGGCGCGAAAACTTCACAATGCCCGCAAGGGTGATGAGGGTATCCGAGTGCTACCTTAGCCGGTAGCTTTTATTCAGTGTAAATAGCTAGATGAATAAGGGGAGGGCAAGGCTGGTGCCAGCCGCCGCGGTAAAACCAGCTCCCGAGTGGTCGGGATTTTTATTGGGCCTAAAGCGTCCGTAGCCGGGCGTGCAAGTCATTGGTTAAATATCGGGTCTTAAGCCCGAACCTGCTAGTGATACTACACGCCTTGGGACCGGAAGAGGCAAATGGTACGTTGAGGGTAGGGGTGAAATCCTGTAATCCCCAACGGACCACCGGTGGCGAAGCTTGTTCAGTCATGAACAACTCTACACAAGGCGATTTGCTGGGACGGATCCGACGGTGAGGGACGAAACCCAGGGGAGCGAGCGGGATTAGATACCCCGGTAGTCCTGGGCGTAAACGATGCGAACTAGGTGTTGGCGGAGCCACGAGCTCTGTCGGTGCCGAAGCGAAGGCGTTAAGTTCGCCGCCAGGGGAGTACGGCCGCAAGGCTGAAACTTAAAGGAATTGGCGGGGGAGCAC
+>EU883771
+TGGCGTACGGCTCAGTAACACGTGGATAACTTACCCTTAGGACTGGGATAACTCTGGGAAACTGGGGATAATACTGGATATTAGGCTATGCCTGGAATGGTTTGCCTTTGAAATGTTTTTTTTCGCCTAAGGATAGGTCTGCGGCTGATTAGGTCGTTGGTGGGGTAATGGCCCACCAAGCCGATGATCGGTACGGGTTGTGAGAGCAAGGGCCCGGAGATGGAACCTGAGACAAGGTTCCAGACCCTACGGGGTGCAGCAGGCGCGAAACCTCCGCAATGTACGAAAGTGCGACGGGGGGATCCCAAGTGTTATGCTTTTTTGTATGACTTTTCATTAGTGTAAAAAGCTTTTAGAATAAGAGCTGGGCAAGACCGGTGCCAGCCGCCGCGGTAACACCGGCAGCTCGAGTGGTGACCACTTTTATTGGGCTTAAAGCGTTCGTAGCTTGATTTTTAAGTCTCTTGGGAAATCTCACGGCTTAACTGTGAGGCGTCTAAGAGATACTGGGAATCTAGGGACCGGGAGAGGTAAGAGGTACTTCAGGGGTAGAAGTGAAATTCTGTAATCCTTGAGGGACCACCGATGGCGAAGGCATCTTACCAGAACGGCTTCGACAGTGAGGAACGAAAGCTGGGGGAGCGAACGGGATTAGATACCCCGGTAGTCCCAGCCGTAAACTATGCGCGTTAGGTGTGCCTGTAACTACGAGTTACCGGGGTGCCGAAGTGAAAACGTGAAACGTGCCGCCTGGGAAGTACGGTCGCAAGGCTGAAACTTAAAGGAATTGGCGGGGGAGCACCACAACGGGTGGAGCCTGCGGTTTAATTGGACTCAACGCCGGGCAGCTCACCGGATAGGACAGCGGAATGATAGCCGGGCTGAAGACCTTGCTTGACCAGCTGAGA
+>EF503699
+AAGAATGGGGATAGCATGCGAGTCACGCCGCAATGTGTGGCATACGGCTCAGTAACACGTAGTCAACATGCCCAGAGGACGTGGACACCTCGGGAAACTGAGGATAAACCGCGATAGGCCACTACTTCTGGAATGAGCCATGACCCAAATCTATATGGCCTTTGGATTGGACTGCGGCCGATCAGGCTGTTGGTGAGGTAATGGCCCACCAAACCTGTAACCGGTACGGGCTTTGAGAGAAGGAGCCCGGAGATGGGCACTGAGACAAGGGCCCAGGCCCTATGGGGCGCAGCAGGCACGAAACCTCTGCAATAGGCGAAAGCTTGACAGGGTTACTCTGAGTGATGCCCGCTAAGGGTATCTTTTGGCACCTCTAAAAATGGTGCAGAATAAGGGGTGGGCAAGTCTGGTGTCAGCCGCCGCGGTAATACCAGCACCCCGAGTTGTCGGGACGATTATTGGGCCTAAAGCATCCGTAGCCTGTTCTGCAAGTCCTCCGTTAAATCCACCCGCTTAACGGATGGGCTGCGGAGGATACTGCAGAGCTAGGAGGCGGGAGAGGCAAACGGTACTCAGTGGGTAGGGGTAAAATCCTTTGATCTACTGAAGACCACCAGTGGTGAAGGCGGTTCGCCAGAACGCGCTCGAACGGTGAGGATGAAAGCTGGGGGAGCAAACCGGAATAGATACCCGAGTAATCCCAACTGTAAACGATGGCAACTCGGGGATGGGTTGGCCTCCAACCAACCCCATGGCCGCAGGGAAGCCGTTTAGCTCTCCCGCCTGGGGAATACGGTCCGCAGAATTGAACCTTAAAGGAATTTGGCGGGGAACCCCCACAAGGGGGAAAACCGTGCGGTTCAATTGGAATCCACCCCCCGGAAACTTTACCCGGGCGCG
+>DQ260310
+GATACCCCCGGAAACTGGGGATTATACCGGATATGTGGGGCTGCCTGGAATGGTACCTCATTGAAATGCTCCCGCGCCTAAAGATGGATCTGCCGCAGAATAAGTAGTTTGCGGGGTAAATGGCCACCCAGCCAGTAATCCGTACCGGTTGTGAAAACCAGAACCCCGAGATGGAAACTGAAACAAAGGTTCAAGGCCTACCGGGCACAACAAGCGCCAAAACTCCGCCATGCGAGCCATCGCGACGGGGGAAAACCAAGTACCACTCCTAACGGGGTGGTTTTTCCGAAGTGGAAAAAGCCTCCAGGAATAAGAACCTGGGCCAGAACCGTGGCCAGCCGCCGCCGTTACACCCGCCAGCTCGAGTTGTTGGCCGGTTTTATTGGGGCCTAAAGCCGGTCCGTAGCCCGTTTTGATAAGGTCTCTCTGGTGAAATTCTACAGCTTAACCTGTGGGAATTGCTGGAGGATACTATTCAAGCTTGAAGCCGGGAGAAGCCTGGAAGTACTCCCGGGGGTAAGGGGTGAAATTCTATTATCCCCGGAAGACCAACTGGTGCCGAAGCGGTCCAGCCTGGAACCGAACTTGACCGTGAGTTACGAAAAGCCAAGGGGCGCGGACCGGAATAAAATAACCAGGGTAGTCCTGGCCGTAAACGATGTGAACTTGGTGGTGGGAATGGCTTCGAACTGCCCAATTGCCGAAAGGAAGCTGTAAATTCACCCGCCTTGGAAGTACGGTCGCAAGACTGGAACCTAAAAGGAATTGGCGGGGGGACACCACAACGCGTGGAGCCTGGCGGTTTTATTGGGATTCCACGCAGACATCTCACTCAGGGGCGACAGCAGAAATGATGGGCAGGTTGATGACCTTGCTTGACAAGCTGAAAAGGAGGTGCAT
+>EF503697
+TAAAATGACTAGCCTGCGAGTCACGCCGTAAGGCGTGGCATACAGGCTCAGTAACACGTAGTCAACATGCCCAAAGGACGTGGATAACCTCGGGAAACTGAGGATAAACCGCGATAGGCCAAGGTTTCTGGAATGAGCTATGGCCGAAATCTATATGGCCTTTGGATTGGACTGCGGCCGATCAGGCTGTTGGTGAGGTAATGGCCCACCAAACCTGTAACCGGTACGGGCTTTGAGAGAAGTAGCCCGGAGATGGGCACTGAGACAAGGGCCCAGGCCCTATGGGGCGCAGCAGGCGCGAAACCTCTGCAATAGGCGAAAGCCTGACAGGGTTACTCTGAGTGATGCCCGCTAAGGGTATCTTTTGGCACCTCTAAAAATGGTGCAGAATAAGGGGTGGGCAAGTCTGGTGTCAGCCGCCGCGGTAATACCAGCACCCCGAGTTGTCGGGACGATTATTGGGCCTAAAGCATCCGTAGCCTGTTCTGCAAGTCCTCCGTTAAATCCACCTGCTCAACGGATGGGCTGCGGAGGATACCGCAGAGCTAGGAGGCGGGAGAGGCAAACGGTACTCAGTGGGTAGGGGTAAAATCCATTGATCTACTGAAGACCACCAGTGGCGAAGGCGGTTTGCCAGAACGCGCTCGACGGTGAGGGATGAAAGCTGGGGGAGCAAACCGGATTAGATACCCGGGGTAGTCCCAGCTGTAAACGGATGCAGACTCGGGTGATGGGGTTGGCTTCCGGCCCAACCCCAATTGCCCCCAGGCGAAGCCCGTTAAGATCTTGCCGCCCTGTCAGATGTCAGGGCCGCCAATACTCGAAACCTTAAAAGGAAATTGGGCGCGGGAAAAGTCACCAAAAGGGGGTTGAAACCCTGCGGGTTATATATTGTAAACC

0 comments on commit 8ab40d8

Please sign in to comment.