Scripts for design of PCR-based Marker Assays from DNA sequence variant data, plus Galaxy xml files
Python Shell Perl
Switch branches/tags
Nothing to show
Latest commit 2921359 Mar 22, 2017 @cfljam committed on GitHub Update README.md
added link to new repo
Permalink
Failed to load latest commit information.
test-data Merge pull request #31 from hymmikong/iss30 Aug 4, 2015
CAPS2gff.sh usage update Aug 21, 2012
CAPS2gff.xml first commit of tools and xml wrappers Aug 8, 2012
GVF_Features_Extracter.xml first commit of tools and xml wrappers Aug 8, 2012
README.md Update README.md Mar 22, 2017
convert_gsMapper_gff3.xml first commit of tools and xml wrappers Aug 8, 2012
design_primers.py Merge pull request #31 from hymmikong/iss30 Aug 4, 2015
design_primers.xml edit: send umelt errors to STDERR. Prevent STDERR messages from causi… Jun 23, 2014
find_CAPS.py minor edit find_caps.py Jul 20, 2015
find_CAPS.xml added test and test data output for find_CAPS.py/xml Mar 27, 2014
gsmapper2gff.sh Update gsmapper2gff.sh Aug 13, 2012
ipcress.xml edit: tool take primer file as input now (3 cols: id p1 p2). Test inp… Apr 30, 2014
ipcress_gff.xml edit: uses tabs for seperation May 6, 2014
parse_primersearch.pl Update parse_primersearch.pl Aug 22, 2012
parse_primersearch.xml first commit of tools and xml wrappers Aug 8, 2012
patman.xml first commit of tools and xml wrappers Aug 8, 2012
patman2gff.xml first commit of tools and xml wrappers Aug 8, 2012
run_p3.py converted to use of primer3-py Jul 8, 2015
umelt_service.py edit: send umelt errors to STDERR. Prevent STDERR messages from causi… Jun 23, 2014
uniq.xml restrored uniq Jul 12, 2013
vcf2gvf.py Modified vcf2gcf.py to ignore LEN field and infer reference loction b… May 21, 2014
vcf2gvf.sh Update vcf2gvf.sh Sep 11, 2012
vcf2gvf.xml Update vcf2gvf.xml May 21, 2014
vcf_gff.py Merge pull request #1 from cfljam/master Aug 7, 2015
vcf_gff.xml add/edit: added tests and test data for vcf_gff.xml tool Apr 11, 2014

README.md

Stories in Ready galaxy-pcr-markers

Scripts for design of PCR-based Marker Assays from DNA sequence variant data and optimised design of high-resolution melting PCR assays using the uMelt web service provided by the Wittwer Lab at University of Utah https://www.dna.utah.edu/umelt/umelt.html

Xml wrappers for use in the Galaxy workflow environment are deprecated and not maintained. See older versions

We are currently (2017) refactoring to enable use with VCF and BED formats on genome-scale data. See https://github.com/PlantandFoodResearch/pcr_marker_design

The primer design tool design_primers.py now uses the excellent primer3-py See http://benpruitt.github.io/primer3-py/index.html

Dependencies

Recommended

  • ipython or jupyter

Installation

We recommend running inside a Conda environment

  • install Miniconda
  • create a fresh environment and activate it
conda create -y -n Py2PCR python=2.7
source activate Py2PCR

Install the dependencies using pip

pip install numpy scipy
pip install biopython
pip install bcbio-gff primer3-py
pip install ipython==4.2

N.B. Primer3 install is NOT required now since design is handled by primer3-py

Clone or download the repo and move into it

git clone https://github.com/cfljam/galaxy-pcr-markers
cd galaxy-pcr-markers

Check all is well by running on small test data, specifying one primer set and melt prediction for HRM

python design_primers.py -i ./test-data/targets.fasta -g ./test-data/targets.gff -T ./test-data/targets -n 1 -u

It should return:

SNP_Target_ID Position Ref_base Variant_base Amplicon_bp PRIMER_LEFT_SEQUENCE PRIMER_RIGHT_SEQUENCE ref_melt_Tm var_melt_Tm Tm_difference
k69_93535:SAMTOOLS:SNP:1147 1147 C G 285 CTCTTCAGTTGCTTCCTGCC CTTCACTCCTTCTCGCGTTC 87.35 87.7 0.35
k69_93535:SAMTOOLS:SNP:1336 1336 G A 149 GAACGCGAGAAGGAGTGAAG GCAACCCAGGTTTCAACTCC 88.75 88.7 0.05
k69_98089:SAMTOOLS:SNP:550 550 G A 227 GGAGAAGGTCGAGGTCAGC ACGGCCGAATATACATACAACG 85.75 86.2 0.45
k69_98089:SAMTOOLS:SNP:625 625 A G 227 GGAGAAGGTCGAGGTCAGC ACGGCCGAATATACATACAACG 85.75 86.25 0.5

------------------------------

**CITATION**
A Toolkit For Bulk PCR-Based Marker Design From Next-Generation Sequence Data: Application For Development Of A Framework Linkage Map In Bulb Onion (Allium cepa L.) (2012)

Samantha Baldwin, Roopashree Revanna, Susan Thomson, Meeghan Pither-Joyce, Kathryn Wright, Ross Crowhurst, Mark Fiers, Leshi Chen, Richard MacKnight, John A. McCallum

BMC Genomics 2012, 13:637  http://www.biomedcentral.com/1471-2164/13/637/abstract

uMELT: prediction of high-resolution melting curves and dynamic melting profiles of PCR products in a rich web application.
Zachary Dwight1, Robert Palais and Carl T. Wittwer http://bioinformatics.oxfordjournals.org/content/27/7/1019

**Acknowledgements**
Development of these tools was funded by the New Zealand Ministry for Business, Innovation & Employment project 'Virtual Institute of Statistical Genetics' (VISG)
See http://www.visg.co.nz