Scripts for design of PCR-based Marker Assays from DNA sequence variant data, plus Galaxy xml files
Python Shell Perl
Switch branches/tags
Nothing to show
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Failed to load latest commit information.
test-data
CAPS2gff.sh
CAPS2gff.xml
GVF_Features_Extracter.xml
README.md
convert_gsMapper_gff3.xml
design_primers.py
design_primers.xml
find_CAPS.py
find_CAPS.xml
gsmapper2gff.sh
ipcress.xml
ipcress_gff.xml
parse_primersearch.pl
parse_primersearch.xml
patman.xml
patman2gff.xml
run_p3.py
umelt_service.py
uniq.xml
vcf2gvf.py
vcf2gvf.sh
vcf2gvf.xml
vcf_gff.py
vcf_gff.xml

README.md

Stories in Ready galaxy-pcr-markers

Scripts for design of PCR-based Marker Assays from DNA sequence variant data and optimised design of high-resolution melting PCR assays using the uMelt web service provided by the Wittwer Lab at University of Utah https://www.dna.utah.edu/umelt/umelt.html

Xml wrappers for use in the Galaxy workflow environment are deprecated and not maintained. See older versions

We are currently (2017) refactoring to enable use with VCF and BED formats on genome-scale data. See https://github.com/PlantandFoodResearch/pcr_marker_design

The primer design tool design_primers.py now uses the excellent primer3-py See http://benpruitt.github.io/primer3-py/index.html

Dependencies

Recommended

  • ipython or jupyter

Installation

We recommend running inside a Conda environment

  • install Miniconda
  • create a fresh environment and activate it
conda create -y -n Py2PCR python=2.7
source activate Py2PCR

Install the dependencies using pip

pip install numpy scipy
pip install biopython
pip install bcbio-gff primer3-py
pip install ipython==4.2

N.B. Primer3 install is NOT required now since design is handled by primer3-py

Clone or download the repo and move into it

git clone https://github.com/cfljam/galaxy-pcr-markers
cd galaxy-pcr-markers

Check all is well by running on small test data, specifying one primer set and melt prediction for HRM

python design_primers.py -i ./test-data/targets.fasta -g ./test-data/targets.gff -T ./test-data/targets -n 1 -u

It should return:

SNP_Target_ID Position Ref_base Variant_base Amplicon_bp PRIMER_LEFT_SEQUENCE PRIMER_RIGHT_SEQUENCE ref_melt_Tm var_melt_Tm Tm_difference
k69_93535:SAMTOOLS:SNP:1147 1147 C G 285 CTCTTCAGTTGCTTCCTGCC CTTCACTCCTTCTCGCGTTC 87.35 87.7 0.35
k69_93535:SAMTOOLS:SNP:1336 1336 G A 149 GAACGCGAGAAGGAGTGAAG GCAACCCAGGTTTCAACTCC 88.75 88.7 0.05
k69_98089:SAMTOOLS:SNP:550 550 G A 227 GGAGAAGGTCGAGGTCAGC ACGGCCGAATATACATACAACG 85.75 86.2 0.45
k69_98089:SAMTOOLS:SNP:625 625 A G 227 GGAGAAGGTCGAGGTCAGC ACGGCCGAATATACATACAACG 85.75 86.25 0.5

------------------------------

**CITATION**
A Toolkit For Bulk PCR-Based Marker Design From Next-Generation Sequence Data: Application For Development Of A Framework Linkage Map In Bulb Onion (Allium cepa L.) (2012)

Samantha Baldwin, Roopashree Revanna, Susan Thomson, Meeghan Pither-Joyce, Kathryn Wright, Ross Crowhurst, Mark Fiers, Leshi Chen, Richard MacKnight, John A. McCallum

BMC Genomics 2012, 13:637  http://www.biomedcentral.com/1471-2164/13/637/abstract

uMELT: prediction of high-resolution melting curves and dynamic melting profiles of PCR products in a rich web application.
Zachary Dwight1, Robert Palais and Carl T. Wittwer http://bioinformatics.oxfordjournals.org/content/27/7/1019

**Acknowledgements**
Development of these tools was funded by the New Zealand Ministry for Business, Innovation & Employment project 'Virtual Institute of Statistical Genetics' (VISG)
See http://www.visg.co.nz