Permalink
Browse files

added tests for Contig#seq and Read#seq

  • Loading branch information...
fstrozzi committed Jan 12, 2011
1 parent f0e7cab commit 1ab89170e125fe07e51708b38b662effc3a9a0bb
Showing with 4 additions and 2 deletions.
  1. +4 −2 test/test_bio-assembly-ace.rb
@@ -38,12 +38,14 @@ def test_contig_num_reads
def test_contig_seq
seq = "TTTCCGTCAGATGTAAAGGTTGCAGAACCGGACCATTCTTGCGTCTGATCTTTCAGGATCGGATCGTTGGCGTCGAACTTATCGCTGTCTTTAAAGACACGGCCCGCGTTTTTCCAGCTGTCGATTGAGTTGTCGCCGACCTTTTGATAAAACATGTAGATTGATGTGTCATCAGCGTCTTTCGGGCTTCCCGCAAGAGCAAACACAACGTGATAGCCGTTGTATTCAGCTACTGTTCCGTCAGCGTTTTGCAGCGGCCAGCTGTCCCACACATCAAGTCCTTTTGCAGACTCAATATTTTTAATCGTTGATTGATCGAATTGAGGCACTTGGTATTTTTCGTTTTGCTGCTGTTTAGGGATCTGCAGCATATCATGGCGTGTAATATGAGAGACGCCGTACGTTTCTTTGTATGCTTTTTGGTTATTTTCTTTCGCGAAGGCTTGAGTCGCTCCTCCTGCCAGAAGTGCAGTCGTAAAAGTCAGAACTGTGGCTTGTTTTACAATTTTTTTGATGTTCATGTTCATGTCTCCTTCTGTATGTACTGTTTTTTGCGATCTGCCGTTTCGATCCTCCCGAATTGACTAGTGGGTAGGCCTGGCGGCCGCCTGGCCGTCGACATTTAGGTGACACTATAGAAGGATCCGCGGAATTCCTTTTTAGATTGAGATAATGACTTTGTTTGGAAGGATGTA*TTTTCATTTAATTAAAGCAAATTCGTAATAAT*AAAGTTAAACAATTTAATTTCAAGATGATTCACAGGTTTGTTGCCTCAAAAGAAAACTTATATTAATGGCAAGTTGTGAATAATTTATGCAACTCTTGTGGACAAGTTGACTCAACTTTTCAC*TTTATGTTATATTGTAAGGATGTGACTTTGTTTTGGAAAATTATATTTAATTTGATAATTAACCAATATAAAAAAGATAAACCAAAAGCTATAAGTCGTAAATAAGGACATTGGAAACAAGAAATATTCTCTCCTGAACATTATTTTAAATTATGCGCAATATGCAAATTTATAAGTGTTAAGTTAAAAAGATTGTTAATGGTTCTGTTTATTACCCAAAGACTTTTTTAAAGTTTAAGTCGTTGCTAAGAGTGCAGCGTTTAGACAAATAAAAATGCAATAATCTTCTCGCTCGGGAGCTATGTCCCTCGCATAATATTCTTCAAAGTGTACAGTAAATATTCTAGAAAAGTGAAGTGTGAAAAAGATATATTGCTTGTTTTTATATTTTGTTAATACAACAAAACTTCAAAAACCTGCGGTGGGGGGGGGGGGATAGTCACTTCCGTCACCTTCACCCCTCTCGTTCACTATACTCCCTCGCCCTGGCGTAATGATGGGGGGATTGGGGGTAGTTGCCCCTTAATAAAGTTCAAACTTGATTTATTTCTAACTCGATACCAGTGATTTACAAATGTTTCTGAAATGGCATGGTTTTCCCTAATAAATGCCTAAAAACCCTGAGCTGAGCCCACGCCAATT"
- assert_equal(seq, @contig.seq.to_s)
+ assert_equal(seq, @contig.seq.to_s.upcase)
+ assert_instance_of(Bio::Sequence::NA,@contig.seq)
end
def test_read_seq
read_seq = 'GAAAAAAAAAGGCAGAAGTTTAATCAAAACGGATTTTTCCGTCAGATGTAAAGGTTGCAGAACCGGACCATTCTTGCGTCTGATCTTTCAGGATCGGATCGTTGGCGTCGAACTTATCGCTGTCTTTAAAGACACGGCCCGCGTTTTTCCAGCTGTCGATTGAGTTGTCGCCGACCTTTTGATAAAACATGTAGATTGATGTGTCATCAGCGTCTTTCGGGCTTCCCGCAAGAGCAAACACAACGTGATAGCCGTTGTATTCAGCTACTGTTCCGTCAGCGTTTTGCAGCGGCCAGCTGTCCCACACATCAAGTCCTTTTGCAGACTCAATATTTTTAATCGTTGATTGATCGAATTGAGGCACTTGGTATTTTTCGTTTTGCTGCTGTTTAGGGATCTGCAGCATATCATGGCGTGTAATATGAGAGACGCCGTACGTTTCTTTGTATGCTTTTTGGTTATTTTCTTTCGCGAAGGCTTGAGTCGCTCCTCCTGCCAGAAGTGCAGTCGTAAAAGTCAGAACTGTGGCTTGTTTTACAATTTTTTTGATGTTCATGTTCATGTCTCCTTCTGTATGTACTGTTTTTTGCGATCTGCCGTTTCGATCCTCCCGAATTGACTAGTGGGTAGGCCTGGCGGCCGCCTGGCCGTCGACATTTAGGTGACACTATAGAAGGATCCGCGGAATTCCTTTTTAGATTGAGATAATGACTTTGTTTGGAAGGATGTATTTTTCATTTAATTAAAGCAAATTCGTAATAAT*AAAGTTAAACAATTT*ATTTC*AGATGATTCACAGGTTTGTTGCCTCAAAAG*AAACTTATATTAATGGCAAGTTGTGAATAATTTATGCAACTCTTGTGGGACAAGTTGACTTCACCT'
- assert_equal(read_seq, @read.seq.to_s)
+ assert_equal(read_seq, @read.seq.to_s.upcase)
+ assert_instance_of(Bio::Sequence::NA,@read.seq)
end
def test_read_range

0 comments on commit 1ab8917

Please sign in to comment.