Permalink
Browse files

added tests to verify Contigs and Reads class type

  • Loading branch information...
1 parent 95cdd8d commit 453b0f8c39712850ce0cb4828371000446858393 @fstrozzi fstrozzi committed Jan 12, 2011
Showing with 4 additions and 0 deletions.
  1. +2 −0 test/test_bio-assembly-ace.rb
  2. +2 −0 test/test_bio-assembly-caf.rb
@@ -40,12 +40,14 @@ def test_contig_seq
seq = "TTTCCGTCAGATGTAAAGGTTGCAGAACCGGACCATTCTTGCGTCTGATCTTTCAGGATCGGATCGTTGGCGTCGAACTTATCGCTGTCTTTAAAGACACGGCCCGCGTTTTTCCAGCTGTCGATTGAGTTGTCGCCGACCTTTTGATAAAACATGTAGATTGATGTGTCATCAGCGTCTTTCGGGCTTCCCGCAAGAGCAAACACAACGTGATAGCCGTTGTATTCAGCTACTGTTCCGTCAGCGTTTTGCAGCGGCCAGCTGTCCCACACATCAAGTCCTTTTGCAGACTCAATATTTTTAATCGTTGATTGATCGAATTGAGGCACTTGGTATTTTTCGTTTTGCTGCTGTTTAGGGATCTGCAGCATATCATGGCGTGTAATATGAGAGACGCCGTACGTTTCTTTGTATGCTTTTTGGTTATTTTCTTTCGCGAAGGCTTGAGTCGCTCCTCCTGCCAGAAGTGCAGTCGTAAAAGTCAGAACTGTGGCTTGTTTTACAATTTTTTTGATGTTCATGTTCATGTCTCCTTCTGTATGTACTGTTTTTTGCGATCTGCCGTTTCGATCCTCCCGAATTGACTAGTGGGTAGGCCTGGCGGCCGCCTGGCCGTCGACATTTAGGTGACACTATAGAAGGATCCGCGGAATTCCTTTTTAGATTGAGATAATGACTTTGTTTGGAAGGATGTA*TTTTCATTTAATTAAAGCAAATTCGTAATAAT*AAAGTTAAACAATTTAATTTCAAGATGATTCACAGGTTTGTTGCCTCAAAAGAAAACTTATATTAATGGCAAGTTGTGAATAATTTATGCAACTCTTGTGGACAAGTTGACTCAACTTTTCAC*TTTATGTTATATTGTAAGGATGTGACTTTGTTTTGGAAAATTATATTTAATTTGATAATTAACCAATATAAAAAAGATAAACCAAAAGCTATAAGTCGTAAATAAGGACATTGGAAACAAGAAATATTCTCTCCTGAACATTATTTTAAATTATGCGCAATATGCAAATTTATAAGTGTTAAGTTAAAAAGATTGTTAATGGTTCTGTTTATTACCCAAAGACTTTTTTAAAGTTTAAGTCGTTGCTAAGAGTGCAGCGTTTAGACAAATAAAAATGCAATAATCTTCTCGCTCGGGAGCTATGTCCCTCGCATAATATTCTTCAAAGTGTACAGTAAATATTCTAGAAAAGTGAAGTGTGAAAAAGATATATTGCTTGTTTTTATATTTTGTTAATACAACAAAACTTCAAAAACCTGCGGTGGGGGGGGGGGGATAGTCACTTCCGTCACCTTCACCCCTCTCGTTCACTATACTCCCTCGCCCTGGCGTAATGATGGGGGGATTGGGGGTAGTTGCCCCTTAATAAAGTTCAAACTTGATTTATTTCTAACTCGATACCAGTGATTTACAAATGTTTCTGAAATGGCATGGTTTTCCCTAATAAATGCCTAAAAACCCTGAGCTGAGCCCACGCCAATT"
assert_equal(seq, @contig.seq.to_s.upcase)
assert_instance_of(Bio::Sequence::NA,@contig.seq)
+ assert_instance_of(Bio::Assembly::Ace::Contig,@contig)
end
def test_read_seq
read_seq = 'GAAAAAAAAAGGCAGAAGTTTAATCAAAACGGATTTTTCCGTCAGATGTAAAGGTTGCAGAACCGGACCATTCTTGCGTCTGATCTTTCAGGATCGGATCGTTGGCGTCGAACTTATCGCTGTCTTTAAAGACACGGCCCGCGTTTTTCCAGCTGTCGATTGAGTTGTCGCCGACCTTTTGATAAAACATGTAGATTGATGTGTCATCAGCGTCTTTCGGGCTTCCCGCAAGAGCAAACACAACGTGATAGCCGTTGTATTCAGCTACTGTTCCGTCAGCGTTTTGCAGCGGCCAGCTGTCCCACACATCAAGTCCTTTTGCAGACTCAATATTTTTAATCGTTGATTGATCGAATTGAGGCACTTGGTATTTTTCGTTTTGCTGCTGTTTAGGGATCTGCAGCATATCATGGCGTGTAATATGAGAGACGCCGTACGTTTCTTTGTATGCTTTTTGGTTATTTTCTTTCGCGAAGGCTTGAGTCGCTCCTCCTGCCAGAAGTGCAGTCGTAAAAGTCAGAACTGTGGCTTGTTTTACAATTTTTTTGATGTTCATGTTCATGTCTCCTTCTGTATGTACTGTTTTTTGCGATCTGCCGTTTCGATCCTCCCGAATTGACTAGTGGGTAGGCCTGGCGGCCGCCTGGCCGTCGACATTTAGGTGACACTATAGAAGGATCCGCGGAATTCCTTTTTAGATTGAGATAATGACTTTGTTTGGAAGGATGTATTTTTCATTTAATTAAAGCAAATTCGTAATAAT*AAAGTTAAACAATTT*ATTTC*AGATGATTCACAGGTTTGTTGCCTCAAAAG*AAACTTATATTAATGGCAAGTTGTGAATAATTTATGCAACTCTTGTGGGACAAGTTGACTTCACCT'
assert_equal(read_seq, @read.seq.to_s.upcase)
assert_instance_of(Bio::Sequence::NA,@read.seq)
+ assert_instance_of(Bio::Assembly::Ace::Read,@read)
end
def test_read_range
@@ -13,6 +13,7 @@ def test_contigs
assert_equal(2,@contigs.size)
assert_equal('Contig1',@contigs[0].name)
assert_equal('Contig2',@contigs[1].name)
+ assert_instance_of(Bio::Assembly::Caf::Contig,@contigs[0])
end
def test_read_per_contig
@@ -46,6 +47,7 @@ def test_read
assert_equal(1,read.from)
assert_equal(293,read.to)
assert_equal("Reverse",read.orientation)
+ assert_instance_of(Bio::Assembly::Caf::Read,read)
end

0 comments on commit 453b0f8

Please sign in to comment.