Skip to content
Go to file
1 contributor

Users who have contributed to this file

170 lines (155 sloc) 11.9 KB
# This file contains a list of potential contaminants which are
# frequently found in high throughput sequencing reactions. These
# are mostly sequences of adapters / primers used in the various
# sequencing chemistries.
# Please DO NOT rely on these sequences to design your own oligos, some
# of them are truncated at ambiguous positions, and none of them are
# definitive sequences from the manufacturers so don't blame us if you
# try to use them and they don't work.
# You can add more sequences to the file by putting one line per entry
# and specifying a name[tab]sequence. If the contaminant you add is
# likely to be of use to others please consider sending it to the FastQ
# authors, either via a bug report at
# or by directly emailing so other users of
# the program can benefit.
Illumina DpnII expression Adapter 1 ACAGGTTCAGAGTTCTACAGTCCGAC
Illumina DpnII expression Adapter 2 CAAGCAGAAGACGGCATACGA
Illumina DpnII expression PCR Primer 1 CAAGCAGAAGACGGCATACGA
Illumina DpnII expression Sequencing Primer CGACAGGTTCAGAGTTCTACAGTCCGACGATC
Illumina NlaIII expression Adapter 2 CAAGCAGAAGACGGCATACGA
Illumina NlaIII expression PCR Primer 1 CAAGCAGAAGACGGCATACGA
Illumina Multiplexing Adapter 1 GATCGGAAGAGCACACGTCT
Illumina Multiplexing Read1 Sequencing Primer ACACTCTTTCCCTACACGACGCTCTTCCGATCT
Illumina Multiplexing Index Sequencing Primer GATCGGAAGAGCACACGTCTGAACTCCAGTCAC
Illumina Multiplexing Read2 Sequencing Primer GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT
ABI Solid3 EF1 alpha Antisense Primer GAAAACCAAAGTGGTCCAC
You can’t perform that action at this time.