diff --git a/src/encoded/schemas/variant_sample.json b/src/encoded/schemas/variant_sample.json
index 47021620e6..030a94628c 100644
--- a/src/encoded/schemas/variant_sample.json
+++ b/src/encoded/schemas/variant_sample.json
@@ -509,31 +509,41 @@
         },
         "variant.genes.genes_ensg.display_title": {
             "title": "Gene Transcript",
-            "order": 25
+            "order": 25,
+            "sort_fields": [
+                { "field": "variant.genes.genes_ensg.display_title", "title": "Gene" },
+                { "field": "variant.genes.genes_most_severe_transcript", "title": "Most Severe Transcript" }
+            ]
         },
         "variant.genes.genes_most_severe_hgvsc": {
             "title": "Variant",
-            "order": 27,
-            "sort_fields": [
-                { "field": "variant.genes.genes.most_severe_hgvsc", "title": "Most Severe HGVSC" }
-            ]
+            "order": 27
         },
         "variant.genes.genes_most_severe_consequence.coding_effect": {
             "title": "Coding Effect",
             "order": 28,
             "sort_fields": [
-                { "fields": "variant.genes.genes_most_severe_consequence.coding_effect", "title": "Coding Effect" }
+                { "field": "variant.genes.genes_most_severe_consequence.coding_effect", "title": "Coding Effect" }
             ]
         },
         "variant.gnomad_af": {
             "title": "GnomAD",
             "aggregation_type": "stats",
             "number_step": "any",
-            "order": 60
+            "order": 60,
+            "sort_fields": [
+                { "field": "variant.gnomad_af", "title": "Gnomad AF" },
+                { "field": "variant.max_pop_af_af_popmax", "title": "Gnomad AF Population Max" }
+            ]
         },
         "variant.cadd_phred": {
             "title": "Predictors",
-            "order": 61
+            "order": 61,
+            "sort_fields": [
+                { "field": "variant.cadd_phred", "title": "Cadd Phred Score" },
+                { "field": "variant.spliceai_maxds", "title": "SpliceAI Max DS"},
+                { "field": "variant.conservation_phylop100", "title": "PhyloP 100 Score"}
+            ]
         },
         "bam_snapshot": {
             "title": "Genome Snapshot",
diff --git a/src/encoded/static/components/browse/columnExtensionMap.js b/src/encoded/static/components/browse/columnExtensionMap.js
index 46eca6e197..c617343e8c 100644
--- a/src/encoded/static/components/browse/columnExtensionMap.js
+++ b/src/encoded/static/components/browse/columnExtensionMap.js
@@ -315,7 +315,7 @@ export const columnExtensionMap = {
     /** "Bioinformatics" column title */
     'sample_processing.analysis_type': {
         'render' : function renderBioinformaticsColumn(result, parentProps){
-            const { '@id' : resultHrefPath, sample = null, sample_processing = null } = result;
+            const { '@id' : resultHrefPath, sample = null, sample_processing = null, vcf_file = null } = result;
             if (!sample_processing) return null; // Unsure if possible, but fallback to null / '-' in case so (not showing datetitle etc)
             const {
                 analysis_type: mainTitle = null,
@@ -323,7 +323,7 @@ export const columnExtensionMap = {
             } = sample_processing;
             const {
                 files = [],
-                processed_files = []
+                // processed_files = []
             } = sample || {};
 
             let status = null;
@@ -343,23 +343,17 @@ export const columnExtensionMap = {
                 }
             }
 
-            // If fastQs are present...
+            // If fastQs are present... check if ingested
             if (status === "in progress") {
-                // Check if VCFs have been ingested & if QCs passed
-                for (let j = 0; j < processed_files.length; j++) {
-                    const procFile = processed_files[j];
-                    const { file_ingestion_status: ingestionStatus = null, file_format = null } = procFile || {};
-                    const { file_format: fileType } = file_format || {};
-                    if ((fileType === "vcf_gz" || fileType === "gvcf_gz")
-                        && ingestionStatus === "Ingested") {
-                        statusTip = "Variants are ingested";
-                        status = "complete";
-
-                        // TODO: Add QC status from overall QC status once implemented
-                    } // Else, not VCF or not yet ingested, ignore
+                const { file_ingestion_status: ingestionStatus = null } = vcf_file || {};
+                if (ingestionStatus && ingestionStatus === "Ingested") {
+                    statusTip = "Variants are ingested";
+                    status = "complete";
                 }
             }
 
+            // Check if overall QCs passed (not yet implemented) -- to add later
+
             // Unlikely to show in non-Case item results, so didn't add Case filter
             return (
                 <a href={resultHrefPath + "#case-info.bioinformatics"} className="adv-block-link">
@@ -467,11 +461,12 @@ export const columnExtensionMap = {
         }
     },
     'bam_snapshot': {
+        'noSort' : true,
         'render' : function(result, props) {
             const { bam_snapshot = null, uuid = null } = result;
             if (bam_snapshot) {
                 return (
-                    <div className="mx-auto">
+                    <div className="mx-auto text-truncate">
                         <a target="_blank" rel="noreferrer" href={`/${uuid}/@@download`}>
                             View BAM Snapshot
                         </a>
diff --git a/src/encoded/static/components/item-pages/CaseView/FilteringTab.js b/src/encoded/static/components/item-pages/CaseView/FilteringTab.js
index 93f4f9a891..2cabb79ea7 100644
--- a/src/encoded/static/components/item-pages/CaseView/FilteringTab.js
+++ b/src/encoded/static/components/item-pages/CaseView/FilteringTab.js
@@ -18,8 +18,8 @@ const GenesMostSevereHGVSCColumn = React.memo(function GenesMostSevereHGVSCColum
     const hgvscSplit = hgvsc.split(":");
     const pSplit = hgvscSplit[1].split(".");
     // Will add hgvsp when added in data/backend
-    const rows = [<div key="genes_severe_transcript"><span className="text-600">{ pSplit[0] }.</span><span>{ pSplit[1] }</span></div>];
-    return <StackedRowColumn rowKey="genes_hgvsc" className="align-items-center" {...{ rows }} />;
+    const rows = [<div className="text-truncate d-block" key="genes_severe_transcript"><span className="text-600">{ pSplit[0] }.</span><span>{ pSplit[1] }</span></div>];
+    return <StackedRowColumn rowKey="genes_hgvsc" className="text-center" {...{ rows }} />;
 });
 
 function CaseViewEmbeddedVariantSampleSearchTable(props){
@@ -40,6 +40,7 @@ function CaseViewEmbeddedVariantSampleSearchTable(props){
             ...originalColExtMap, // Copy in existing vals but overwrite display_title.render
             "display_title" : {
                 ...originalColExtMap.display_title,
+                widthMap: { 'lg' : 250, 'md' : 220, 'sm' : 200 },
                 render: function(result, parentProps){
                     const { href, context, rowNumber, detailOpen, toggleDetailOpen } = parentProps;
                     return (
@@ -51,50 +52,58 @@ function CaseViewEmbeddedVariantSampleSearchTable(props){
             },
             // TODO? We could potentially move some of these definitions into EmbeddedItemSearchTable.defaultProps.columnExtensionMap
             "DP" : { // Coverage, VAF column
+                widthMap: { 'lg' : 140, 'md' : 120, 'sm' : 70 },
                 render: function(result, props) {
                     const { DP = null, AF = null } = result;
                     const rows = [
-                        <span key="DP">{DP || "-"}</span>,
-                        <span key="AF">{AF || "-"}</span>
+                        <span key="DP" data-tip="Coverage" className="d-block text-truncate">{DP || "-"}</span>,
+                        <span key="AF" data-tip="VAF" className="d-block text-truncate">{AF || "-"}</span>
                     ];
-                    return <StackedRowColumn rowKey="Coverage, AF Row" className="align-items-center" {...{ rows }}/>;
+                    return <StackedRowColumn rowKey="Coverage, AF Row" className="text-center" {...{ rows }}/>;
                 }
             },
             "associated_genotype_labels.proband_genotype_label" : { // Genotype column
-                widthMap: { 'lg' : 280, 'md' : 250, 'sm' : 200 },
+                widthMap: { 'lg' : 240, 'md' : 230, 'sm' : 200 },
                 render: function(result, props) {
                     const { associated_genotype_labels : { proband_genotype_label = null, mother_genotype_label = null, father_genotype_label = null } = {} } = result;
                     const rows = [];
                     if (proband_genotype_label) {
-                        rows.push(<div key="proband_gt"><span className="font-italic">Proband: </span>{proband_genotype_label}</div>);
+                        rows.push(<div key="proband_gt" className="d-block text-truncate"><span className="font-italic">Proband: </span>{proband_genotype_label}</div>);
                     } else {
                         return null;
                     }
                     if (mother_genotype_label) {
-                        rows.push(<div key="mother_gt"><span className="font-italic">Mother: </span>{mother_genotype_label || "-"}</div>);
+                        rows.push(<div key="mother_gt" className="d-block text-truncate"><span className="font-italic">Mother: </span>{mother_genotype_label || "-"}</div>);
                     }
                     if (father_genotype_label) {
-                        rows.push(<div key="father_gt"><span className="font-italic">Father: </span>{father_genotype_label || "-"}</div>);
+                        rows.push(<div key="father_gt" className="d-block text-truncate"><span className="font-italic">Father: </span>{father_genotype_label || "-"}</div>);
                     }
-                    return <StackedRowColumn rowKey="genotype" className="align-items-center" {...{ rows }}/>;
+                    return <StackedRowColumn rowKey="genotype" className="text-center" {...{ rows }}/>;
                 }
             },
             "variant.genes.genes_ensg.display_title": { // Gene Transcript column
+                widthMap: { 'lg' : 155, 'md' : 140, 'sm' : 130 },
                 render: function(result, props) {
-                    const { variant : { genes : [firstGene = null] = [] } = {} } = result;
-                    const { genes_ensg: { display_title = null } = {}, genes_most_severe_transcript = null } = firstGene || {};
+                    const { variant : { genes = [] } = {} } = result;
 
-                    if (firstGene) {
+                    const geneTitles = genes.map((geneItem) => {
+                        const { genes_ensg: { display_title = null } = {} } = geneItem || {};
+                        return display_title;
+                    });
+                    if (genes.length > 0) {
+                        const { genes_most_severe_transcript = null } = genes[0] || {};
                         const rows = [
-                            <span key="genes_ensg" className="font-italic">{ display_title} </span>,
-                            <span key="genes_severe_transcript" className="font-italic">{ genes_most_severe_transcript}</span>
+                            <span key="genes_ensg" className="font-italic d-block text-truncate">{ geneTitles.length > 1 ? geneTitles.join() : geneTitles } </span>,
+                            <span data-tip="Most Severe Transcript" key="genes_severe_transcript" className="font-italic d-block text-truncate">{ genes_most_severe_transcript}</span>
                         ];
-                        return <StackedRowColumn rowKey="genes_data" className="align-items-center" {...{ rows }} />;
+                        return <StackedRowColumn rowKey="genes_data" className="text-center" {...{ rows }} />;
                     }
                     return null;
                 }
             },
             "variant.genes.genes_most_severe_hgvsc": { // Variant column
+                noSort: true,
+                widthMap: { 'lg' : 120, 'md' : 110, 'sm' : 95 },
                 render: function(result, props) {
                     const { variant : { genes : [firstGene = null] = [] } = {} } = result;
                     const { genes_most_severe_hgvsc = null } = firstGene || {};
@@ -106,17 +115,19 @@ function CaseViewEmbeddedVariantSampleSearchTable(props){
                 }
             },
             "variant.genes.genes_most_severe_consequence.coding_effect": { // Coding Effect column
+                widthMap: { 'lg' : 140, 'md' : 130, 'sm' : 120 },
                 render: function(result, props) {
                     const { variant : { genes : [firstGene = null] = [] } = {} } = result;
                     const { genes_most_severe_consequence : { coding_effect = null } = {} } = firstGene || {};
 
                     if (firstGene && coding_effect) {
-                        return <StackedRowColumn rowKey="genes_codingeffect" className="align-items-center" rows={[coding_effect]} />;
+                        return <StackedRowColumn rowKey="genes_codingeffect" className="text-center text-truncate" rows={[coding_effect]} />;
                     }
                     return null;
                 }
             },
             "variant.gnomad_af": { // Gnomad column
+                widthMap: { 'lg' : 140, 'md' : 130, 'sm' : 120 },
                 render: function(result, props){
                     const { variant : { gnomad_af = null, max_pop_af_af_popmax = null } = {} } = result;
                     const rows = [];
@@ -125,12 +136,14 @@ function CaseViewEmbeddedVariantSampleSearchTable(props){
                         return null;
                     }
                     if (gnomad_af) {
-                        rows.push(<div key="gnomad_af"><span className="text-600">ALL: </span>{gnomad_af || "-"}</div>);
+                        const gnomad_af_exp = gnomad_af ? gnomad_af.toExponential(3): null;
+                        rows.push(<div key="gnomad_af" className="d-block text-truncate"><span className="text-600">ALL: </span>{gnomad_af_exp || gnomad_af || "-"}</div>);
                     }
                     if (max_pop_af_af_popmax){
-                        rows.push(<div key="gnomad_af_popmax"><span className="text-600">MAX: </span>{max_pop_af_af_popmax || "-"}</div>);
+                        const max_pop_af_af_popmax_exp = max_pop_af_af_popmax ? max_pop_af_af_popmax.toExponential(3): null;
+                        rows.push(<div key="gnomad_af_popmax" className="d-block text-truncate"><span className="text-600">MAX: </span>{max_pop_af_af_popmax_exp || max_pop_af_af_popmax || "-"}</div>);
                     }
-                    return <StackedRowColumn rowKey="genes_gnomad" className="align-items-center" {...{ rows }}/>;
+                    return <StackedRowColumn rowKey="genes_gnomad" className="text-center" {...{ rows }}/>;
                 }
             },
             "variant.cadd_phred": { // Predictors column (cadd_phred, spliceai, phylop100)
@@ -142,15 +155,15 @@ function CaseViewEmbeddedVariantSampleSearchTable(props){
                         return null;
                     }
                     if (cadd_phred) {
-                        rows.push(<div key="cadd_phred"><span className="text-600">Cadd Phred: </span>{cadd_phred || "-"}</div>);
+                        rows.push(<div key="cadd_phred" className="d-block text-truncate"><span className="text-600">Cadd Phred: </span>{cadd_phred || "-"}</div>);
                     }
                     if (spliceai_maxds) {
-                        rows.push(<div key="spliceai_maxds"><span className="text-600">SpliceAI MaxDS: </span>{spliceai_maxds || "-"}</div>);
+                        rows.push(<div key="spliceai_maxds" className="d-block text-truncate"><span className="text-600">SpliceAI MaxDS: </span>{spliceai_maxds || "-"}</div>);
                     }
                     if (conservation_phylop100) {
-                        rows.push(<div key="phylop"><span className="text-600">PhyloP 100: </span>{conservation_phylop100 || "-"}</div>);
+                        rows.push(<div key="phylop" className="d-block text-truncate"><span className="text-600">PhyloP 100: </span>{conservation_phylop100 || "-"}</div>);
                     }
-                    return <StackedRowColumn rowKey="genes_predictors" className="align-items-center" {...{ rows }}/>;
+                    return <StackedRowColumn rowKey="genes_predictors" className="text-center" {...{ rows }}/>;
                 }
             }
         };
@@ -160,7 +173,7 @@ function CaseViewEmbeddedVariantSampleSearchTable(props){
 
 function StackedRowColumn(props) {
     const { rowKey = null, rows = [], className = null } = props;
-    const cls = ("w-100 d-flex flex-column text-ellipsis-container" + (className ? " " + className : ""));
+    const cls = ("w-100" + (className ? " " + className : ""));
     return (
         <div key={rowKey} className={cls} data-delay-dhow={750}>
             { rows }
@@ -177,9 +190,9 @@ const VSDisplayTitleColumnDefault = React.memo(function VSDisplayTitleColumnDefa
     const { variant = null } = result || {};
     const { display_title = null, dbsnp_rs_number = null } = variant;
 
-    const cls = ("title-block text-ellipsis-container" + (className ? " " + className : ""));
+    const cls = ("title-block" + (className ? " " + className : ""));
     const rows = [
-        <span key="variant-title" className="text-600">{display_title}</span>
+        <span key="variant-title" className="d-block text-600 text-truncate">{display_title}</span>
     ];
 
     if (dbsnp_rs_number) {
@@ -187,7 +200,7 @@ const VSDisplayTitleColumnDefault = React.memo(function VSDisplayTitleColumnDefa
     }
 
     return (
-        <a key="title" href={link || '#'} onClick={onClick}>
+        <a key="title" href={link || '#'} onClick={onClick} className="d-block text-truncate">
             <StackedRowColumn rowKey="title-container" {...{ rows, cls }}  />
         </a>
     );
diff --git a/src/encoded/static/components/item-pages/CaseView/index.js b/src/encoded/static/components/item-pages/CaseView/index.js
index a7383df329..5c1624f424 100644
--- a/src/encoded/static/components/item-pages/CaseView/index.js
+++ b/src/encoded/static/components/item-pages/CaseView/index.js
@@ -7,6 +7,7 @@ import url from 'url';
 
 import { console, layout, navigate, ajax } from '@hms-dbmi-bgm/shared-portal-components/es/components/util';
 import { PartialList } from '@hms-dbmi-bgm/shared-portal-components/es/components/ui/PartialList';
+import { decorateNumberWithCommas } from '@hms-dbmi-bgm/shared-portal-components/es/components/util/value-transforms';
 
 import { PedigreeVizView } from './../../viz/PedigreeViz';
 import DefaultItemView from './../DefaultItemView';
@@ -612,7 +613,7 @@ const BioinfoStats = React.memo(function BioinfoStats(props) {
                         : null }
                 </div>
                 <div className="col-sm-4">{/* 4,769,578 */}
-                    { (msaStats.totalVariants && msaStats.totalVariants.value) || "" }
+                    { (msaStats.totalVariants && msaStats.totalVariants.value) ? decorateNumberWithCommas(msaStats.totalVariants.value): "" }
                 </div>
             </div>
             <div className="row qc-summary">
@@ -660,7 +661,7 @@ const BioinfoStats = React.memo(function BioinfoStats(props) {
                         : null }
                 </div>
                 <div className="col-sm-4"> {/* Ex. 1,273 */}
-                    { (msaStats.filteredVariants && msaStats.filteredVariants.value) || "" }
+                    { (msaStats.filteredVariants && msaStats.filteredVariants.value) ? decorateNumberWithCommas(msaStats.filteredVariants.value) : "" }
                 </div>
             </div>
         </>
diff --git a/src/encoded/static/components/item-pages/VariantSampleView/SampleTabBody.js b/src/encoded/static/components/item-pages/VariantSampleView/SampleTabBody.js
index 6c47785671..66940dd295 100644
--- a/src/encoded/static/components/item-pages/VariantSampleView/SampleTabBody.js
+++ b/src/encoded/static/components/item-pages/VariantSampleView/SampleTabBody.js
@@ -98,6 +98,36 @@ export function SampleTabBody(props){
     );
 }
 
+/**
+ * Returns an object with shortened genotypes: one with number of base pairs, one without
+ * @param {*} fullGT Full genotype (ex. AGAGAATTCCACTCACATCG)
+ * @param {*} n Number of base pairs to show on either side of the shortening (if "n=2", shortGT would look like "AG...TC")
+ */
+function shortenGT(fullGT, n) {
+    let gtObj = {};
+
+    // Only calculate shortened values if fullGT is longer than 10 characters
+    if (fullGT.length > 10) {
+        // Calculate shortened versions of GTs
+        const firstN = fullGT.substring(0, n);
+        const middle = fullGT.substring(n, fullGT.length - n);
+        const lastN = fullGT.substring(fullGT.length - n, fullGT.length);
+        const shortGT = `${firstN}...${lastN}`;
+        const bpGT = `${firstN}...${middle.length}bp...${lastN}`;
+
+        // // Determine if to use ...BP... shortened version or normal shortened version
+        // if (!shortGTDupTester[shortGT]) {
+        //     shortGTDupTester[shortGT] = true;
+        // } else {
+        //     shortGTDupPresent = true;
+        // }
+
+        gtObj = { fullGT, shortGT, bpGT };
+    } else {
+        gtObj = { fullGT };
+    }
+    return gtObj;
+}
 
 function CoverageTableRow(props) {
     const {
@@ -143,6 +173,10 @@ const CoverageTable = React.memo(function CoverageTable({ samplegeno = [], genot
     const mapGTToShortenedTitles = {};
     const shortGTDupTester = {};
 
+    // Add shortened ref to titlemap
+    const refShortened = shortenGT(varRef, 2);
+    mapGTToShortenedTitles[varRef] = refShortened;
+
     let samplegenolen;
 
     // Populate ID->Coverage map with genotype label information
@@ -183,26 +217,14 @@ const CoverageTable = React.memo(function CoverageTable({ samplegeno = [], genot
 
                     // Populate mapGTToShortenedTitles mapping
                     if (!mapGTToShortenedTitles.hasOwnProperty(fullGT)) {
-                        let gtObj;
-                        const n = 2; // Number of bp to show on either end when shortened
-        
-                        if (fullGT.length > 10) { // Calculate shortened versions of GTs
-                            const firstN = fullGT.substring(0, n);
-                            const middle = fullGT.substring(n, fullGT.length - n);
-                            const lastN = fullGT.substring(fullGT.length - n, fullGT.length);
-                            const shortGT = `${firstN}...${lastN}`;
-                            const bpGT = `${firstN}...${middle.length}bp...${lastN}`;
-        
-                            // Determine if to use ...BP... shortened version or normal shortened version
-                            if (!shortGTDupTester[shortGT]) {
-                                shortGTDupTester[shortGT] = true;
-                            } else {
-                                shortGTDupPresent = true;
-                            }
-        
-                            gtObj = { fullGT, shortGT, bpGT };
+                        const gtObj = shortenGT(fullGT, 2);
+                        const { shortGT = null } = gtObj;
+
+                        // Determine if to use ...BP... shortened version or normal shortened version
+                        if (!shortGTDupTester[shortGT]) {
+                            shortGTDupTester[shortGT] = true;
                         } else {
-                            gtObj = { fullGT };
+                            shortGTDupPresent = true;
                         }
 
                         mapGTToShortenedTitles[fullGT] = gtObj;
@@ -257,7 +279,8 @@ const CoverageTable = React.memo(function CoverageTable({ samplegeno = [], genot
             if (!mapNumgtToGT[i]) {
                 // if it's ref, just use ref placeholder to replace
                 if (i === 0) {
-                    refAndAltCols.push(<th key={i} className="text-left">Ref ({varRef})</th>);
+                    const { bpGT = null, shortGT = null } = shortenGT(varRef, 2);
+                    refAndAltCols.push(<th key={i} data-Tip={varRef} className="text-left">Ref ({bpGT || shortGT || varRef})</th>);
                 } else { // apply placeholder name to empty alt column
                     refAndAltCols.push(<th key={i} className="text-left">Alt (#{emptyColCount})</th>);
                     emptyColCount++;
diff --git a/src/encoded/types/case.py b/src/encoded/types/case.py
index b98474973c..b18451933e 100644
--- a/src/encoded/types/case.py
+++ b/src/encoded/types/case.py
@@ -169,7 +169,6 @@ class Case(Item):
         "sample.files.status",
         "sample.completed_processes",
         "sample.processed_files.file_format.file_format",
-        "sample.processed_files.file_ingestion_status",
         "sample.processed_files.quality_metric.quality_metric_summary.sample",
         "sample.processed_files.quality_metric.quality_metric_summary.title",
         "sample.processed_files.quality_metric.quality_metric_summary.value",
@@ -219,7 +218,8 @@ class Case(Item):
         "active_filterset.filter_blocks.flags_applied",
         "active_filterset.flags",
         "cohort.filter_set.*",
-        "project.name"
+        "project.name",
+        "vcf_file.file_ingestion_status"
     ]
 
     @calculated_property(schema={