Switch branches/tags
Nothing to show
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Type Name Latest commit message Commit time
Failed to load latest commit information.
R
data
docs
inst/primer3
man
rawdata
tests
vignettes
.Rbuildignore
.gitignore
.travis.yml
CONDUCT.md
DESCRIPTION
LICENSE
NAMESPACE
NEWS.md
README.Rmd
README.md
_pkgdown.yml
primex.Rproj

README.md

Build Status codecov

primex

An R package to ease primer design using Primer3.

Installation

You can install primex from github with:

# install.packages("devtools")
devtools::install_github("dieterich-lab/primex")

Quick start

library(primex)

exonSeqs <- c(
  exon1 = paste0(
    "CTCACCATGGATGATGATATCGCCGCGCTCGTCGTCGACAACGGCTCCGGCATGTGCAAG",
    "GCCGGCTTCGCGGGCGACGATGCCCCCCGGGCCGTCTTCCCCTCCATCGTGGC",
    "AGGCACCAG"
    ), 
  exon2 = paste0(
    "GGCGTGATGGTGGGCATGGGTCAGAAGGATTCCTATGTGGGCGACGAGGCCCAGAGCAAG",
    "AGAGGCATCCTCACCCTGAAGTACCCCATCGAGCACGGCATCGTCACCAACTGGGACGAC",
    "ATGGAGAAAATCTGGCACCACACCTTCTACAATGAGCTGCGTGTGGCTCCCGAGGAGCAC",
    "CCCGTGCTGCTGACCGAGGCCCCCCTGAACCCCAAGGCCAACCGCGAGAAGATGACCCAG"
  )
)

seqOpts <- seqSettings(seqId = "transcript2", seq = exonSeqs) 

p3Opts  <- p3Settings() %>%  
  primerTm(min = 58, optimal = 63, max = 67)

primers <- design(seqOpts, p3Opts)

First two candidate pairs:

first second
PRIMER_PAIR_PENALTY 4.488355 4.494866
PRIMER_LEFT_PENALTY 4.462257 0.032609
PRIMER_RIGHT_PENALTY 0.026098 4.462257
PRIMER_LEFT_SEQUENCE ACCAGGGCGTGATGGTGG ATGGATGATGATATCGCCGC
PRIMER_RIGHT_SEQUENCE CATGTCGTCCCAGTTGGTGA CCACCATCACGCCCTGGT
PRIMER_LEFT 117,18 6,20
PRIMER_RIGHT 244,20 134,18
PRIMER_LEFT_TM 65.462 63.033
PRIMER_RIGHT_TM 63.026 65.462
PRIMER_LEFT_GC_PERCENT 66.667 50.000
PRIMER_RIGHT_GC_PERCENT 55.000 66.667
PRIMER_LEFT_SELF_ANY_TH 6.11 0.00
PRIMER_RIGHT_SELF_ANY_TH 0.00 0.00
PRIMER_LEFT_SELF_END_TH 0.00 0.00
PRIMER_RIGHT_SELF_END_TH 0.00 0.00
PRIMER_LEFT_HAIRPIN_TH 43.01 27.69
PRIMER_RIGHT_HAIRPIN_TH 32.56 43.06
PRIMER_LEFT_END_STABILITY 9.4000 12.9000
PRIMER_RIGHT_END_STABILITY 7.9000 7.9000
PRIMER_PAIR_COMPL_ANY_TH 0.00 0.62
PRIMER_PAIR_COMPL_END_TH 5.31 0.00
PRIMER_PAIR_PRODUCT_SIZE 128 129