# Primer FASTA Format

insilicoPCR primer definitions must be provided as a FASTA file.

Each FASTA record ID must end with a role suffix.

| Suffix | Meaning |
|---|---|
| `-F` | Forward primer |
| `-R` | Reverse primer |
| `-P` | Probe |

The text before the final suffix is treated as the assay, gene, or target name.

For example:

```text
targetA-F
targetA-R
targetA-P
```

all belong to the same target, `targetA`.

Primer files in this convention can also be generated rather than written by hand: [primer-finder](https://github.com/duceppemo/primer-finder) designs selective (q)PCR assays against a group of genomes and writes them as `assays_qpcr.fasta` (the probe assays, with their `-P` entries) and `assays_pcr.fasta` (every assay, primers only), ready to pass to `-p`.

## Standard PCR mode

Use standard PCR mode when every assay has only a forward and reverse primer.

```fasta
>toxA-F
ATGCGTACGTTAGCTAGCTA
>toxA-R
TCGATCGATACGCGTACGTA

>toxB-F
GCTAGCTAGGATCGATCGAA
>toxB-R
TTCGATCGATCCTAGCTAGC
```

In standard PCR mode, a target is reported when the forward and reverse primers produce a valid amplicon.

## qPCR / probe mode

Use qPCR mode when every assay includes a probe.

```fasta
>toxA-F
ATGCGTACGTTAGCTAGCTA
>toxA-R
TCGATCGATACGCGTACGTA
>toxA-P
ACGTTAGCTAGCTACGTA

>toxB-F
GCTAGCTAGGATCGATCGAA
>toxB-R
TTCGATCGATCCTAGCTAGC
>toxB-P
CGATCGATCCTAGCTAGC
```

In qPCR mode, a target is reported as positive only when the forward primer, reverse primer, and probe are detected in the expected amplicon.

## Mixing PCR and qPCR assays

Standard PCR assays and qPCR/probe assays can be mixed in the same primer FASTA file (since version 0.8.0). The probe requirement is decided per assay:

- an assay **with** a `-P` probe is reported only when the probe is also found inside the amplicon;
- an assay **without** a probe is reported on its primer pair alone.

When at least one assay defines a probe, the consolidated report includes the probe columns; they are left empty on rows of probe-less assays.

## Degenerate bases

Primer sequences may contain standard IUPAC degenerate bases.

Supported bases include:

| Code | Bases |
|---|---|
| `R` | A or G |
| `Y` | C or T |
| `S` | C or G |
| `W` | A or T |
| `K` | G or T |
| `M` | A or C |
| `B` | C, G, or T |
| `D` | A, G, or T |
| `H` | A, C, or T |
| `V` | A, C, or G |
| `N` | A, C, G, or T |

Sequences should not include spaces, fluorophore names, quencher names, or non-IUPAC sequence characters. If a probe has labels such as FAM or BHQ1, remove those labels and keep only the nucleotide sequence.

## Recommended naming

Use simple names that make the assay clear:

```fasta
>geneName-F
ACTG...
>geneName-R
CAGT...
```

Avoid spaces in FASTA IDs. If needed, use underscores or hyphens inside the assay name, but keep the final role suffix as the last part of the ID.

Good:

```text
>speciesA_toxA-F
>speciesA_toxA-R
```

Avoid:

```text
>speciesA toxA forward
>speciesA-toxA-forward
```