Skip to content
Find file
Fetching contributors…
Cannot retrieve contributors at this time
39 lines (33 sloc) 540 Bytes
use v6;
use Test;
is do {
my %c;
for 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'\
.split('') { %c{$_}++ }
%c< A C G T > }
, < 20 12 17 21 >
, 'DNA';
{ $_ = 'GATGGAACTTGACTACGTAAATT';
s:g/T/U/;
is $_
, 'GAUGGAACUUGACUACGUAAAUU'
, 'RNA' };
is do {
my %comp = <
A T
T A
G C
C G
>;
'AAAACCCGGT'.split('')\
.reverse.map( { %comp{$_} })\
.join('')
}
, 'ACCGGGTTTT'
, 'RECV';
is do {
1
}
, 0
,'GC';
done;
Something went wrong with that request. Please try again.