Skip to content

Loading…

Inconsistent ALT column, INFO and GT fields #31

Open
kyasuno opened this Issue · 4 comments

2 participants

@kyasuno

Hi,

I got calls that contain inconsistent description of variants given below.
Even though number of ALT alleles is 1 according to ALT field, AF (for instance) demonstrate that there are 2 ALT alleles and GT was assigned to be 1/2 using "missing" allele. Some incompatibilities between REF/ALT and TYPE field can also be seen.

Thanks

7 151552404 . TCCCACACACCGCCCTCCACACACACCATGCTCC T 50000 . AB=0.168484,0.814668;ABP=966.208,870.792;AC=2,2;AF=0.5,0.5;AN=4;AO=170,822;CIGAR=34M,1M1D;DP=1009;DPRA=0,0;EPP=4.28764,173.442;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=5.5,5.5;MQM=56.5294,59.9635;MQMR=0;NS=2;NUMALT=2;ODDS=272.642;PAIRED=0.823529,0.972019;PAIREDR=0;REPEAT=C:3;RO=0;RPP=267.879,11.2947;RPPR=0;RUN=1,1;SAP=3.8278,92.4475;SRP=0;TYPE=del;XAI=0.0164645,0.00101542;XAM=0.0376921,0.0152932;XAS=0.0212277,0.0142778;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:678:0:0:120,545:4165,52257:-4771.58,-133.319,-442.72 1/2:50000:331:0:0:50,277:1746,27270:-2472.74,-56.8534,-174.959
6 160868701 . GGCCCAGCTGTGTCTTC AGCCCAGCTGTGTCTTC 50000 . AB=0.486726,0.513274;ABP=3.3562,3.3562;AC=2,2;AF=0.5,0.5;AN=4;AO=110,116;CIGAR=17M,1X;DP=226;DPRA=0,0;EPP=111.11,12.0706;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.2182,60.3362;MQMR=0;NS=2;NUMALT=2;ODDS=255.397;PAIRED=1,1;PAIREDR=0;REPEAT=G:3;RO=0;RPP=208.392,36.0317;RPPR=0;RUN=1,1;SAP=135.746,147.975;SRP=0;TYPE=snp;XAI=0.00863394,0.000139043;XAM=0.0189943,0.00108513;XAS=0.0103604,0.000946087;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:151:0:0:77,74:2714,2378:-214.341,-1.20113,-244.612 1/2:50000:75:0:0:33,42:1239,1368:-123.446,-1.269,-111.885
10 71649083 . AGGGGGCAGGGAGGAGCATGAAGGACAGAGGGTGGAACTTCTGGGCTGCGAACAGTGCACCTGGTACTCACCCT GGGGGGCAGGGAGGAGCATGAAGGACAGAGGGTGGAACTTCTGGGCTGCGAACAGTGCACCTGGTACTCACCCT 50000 . AB=0.6375,0.3625;ABP=16.1477,16.1477;AC=2,2;AF=0.5,0.5;AN=4;AO=51,29;CIGAR=74M,1X;DP=80;DPRA=0,0;EPP=18.3809,15.6647;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=59.098,61.1034;MQMR=0;NS=2;NUMALT=2;ODDS=43.8963;PAIRED=1,1;PAIREDR=0;RO=0;RPP=105.24,65.983;RPPR=0;RUN=1,1;SAP=21.7871,15.6647;SRP=0;TYPE=snp;XAI=0,0;XAM=0.000537201,0.0052643;XAS=0.000537201,0.0052643;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:57:0:0:35,22:1173,741:-67.0268,-1.61597,-105.905 1/2:50000:23:0:0:16,7:504,222:-20.2971,-1.53425,-45.675
15 51675932 . ATTTTTTTTTTTTTTTTGGTTAATGTCCCTGTTTCTGTGTTTTGATGCAGGACCTC A 50000 . AB=0.756757,0.108108;ABP=24.1968,52.3673;AC=3,1;AF=0.75,0.25;AN=4;AO=38,4;CIGAR=56M,1M2D;DP=47;DPRA=0,3.7;EPP=54.4399,11.6962;EPPR=0;HWE=-6.53213;LEN=1,2;MEANALT=2.5,4;MQM=61.1053,60;MQMR=0;NS=2;NUMALT=2;ODDS=6.23832;PAIRED=1,1;PAIREDR=0;REPEAT=A:2;RO=0;RPP=69.0688,11.6962;RPPR=0;RUN=1,1;SAP=69.0688,11.6962;SRP=0;TYPE=del;XAI=0.00475303,0;XAM=0.0115667,0.00352113;XAS=0.00681365,0.00352113;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:93.8485:37:0:0:28,4:931,342:-56.0333,-30.1931,-108.725 1/1:27.0968:10:0:0:10,0:328,0:0,-3.0103,-29.848
5 60790037 . TTGTGTTTTCGTTTTGAACAATTTTCTAAAGGTCTGTTTTTCCCCATTAGGTGCGGGAGATGTTA CTGTGTTTTCGTTTTGAACAATTTTCTAAAGGTCTGTTTTTCCCCATTAGGTGCGGGAGATGTTA 50000 . AB=0.565217,0.434783;ABP=8.10854,8.10854;AC=2,2;AF=0.5,0.5;AN=4;AO=78,60;CIGAR=65M,1X;DP=138;DPRA=0,0;EPP=31.5178,3.15506;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.4103,60;MQMR=0;NS=2;NUMALT=2;ODDS=162.338;PAIRED=1,1;PAIREDR=0;REPEAT=T:2|TTG:2;RO=0;RPP=172.385,27.4756;RPPR=0;RUN=1,1;SAP=31.5178,40.0701;SRP=0;TYPE=snp;XAI=0.00052931,0.000228311;XAM=0.00278156,0.00112921;XAS=0.00225225,0.000900901;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:80:0:0:42,38:1391,1392:-125.646,-1.09387,-125.521 1/2:50000:58:0:0:36,22:1164,795:-71.9114,-1.70987,-105.083
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCC GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCC 50000 . AB=0.481132,0.518868;ABP=3.33807,3.33807;AC=2,2;AF=0.5,0.5;AN=4;AO=51,55;CIGAR=50M,1X;DP=106;DPRA=0,0;EPP=74.5837,27.6861;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.6275,58.1636;MQMR=0;NS=2;NUMALT=2;ODDS=90.5747;PAIRED=1,1;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=97.0649,46.0055;RPPR=0;RUN=1,1;SAP=74.5837,90.2245;SRP=0;TYPE=snp;XAI=0.000268601,0.00329528;XAM=0.00353417,0.00354435;XAS=0.00326556,0.000249066;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:73:0:0:31,42:1026,1465:-132.199,-1.38757,-92.671 1/2:50000:33:0:0:20,13:654,443:-40.2108,-1.17571,-59.187
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA 50000 . AB=0.415584,0.584416;ABP=7.77626,7.77626;AC=2,2;AF=0.5,0.5;AN=4;AO=32,45;CIGAR=74M,1X;DP=77;DPRA=0,0;EPP=56.2114,49.3833;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=63.0625,65.2;MQMR=0;NS=2;NUMALT=2;ODDS=48.8243;PAIRED=1,0.977778;PAIREDR=0;REPEAT=T:3;RO=0;RPP=72.4974,49.3833;RPPR=0;RUN=1,1;SAP=56.2114,84.1269;SRP=0;TYPE=snp;XAI=0.000856164,0.00185271;XAM=0.00285572,0.00245331;XAS=0.00199956,0.000600601;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:57:0:0:25,32:916,945:-85.3453,-1.16178,-82.8064 1/2:50000:20:0:0:7,13:241,403:-36.58,-1.13119,-22.0343
15 51675932 . ATTTTTTTTTTTTTTTTGGTTAATGTCCCTGTTTCTGTGTTTTGATGCAGGAC A 50000 . AB=0.759259,0.12963;ABP=34.5369,67.3502;AC=2,2;AF=0.5,0.5;AN=4;AO=41,7;CIGAR=53M,1M2D;DP=54;DPRA=0,0;EPP=60.6867,3.32051;EPPR=0;HWE=4.77121;LEN=1,2;MEANALT=3.5,3.5;MQM=60,60;MQMR=0;NS=2;NUMALT=2;ODDS=25.7613;PAIRED=1,1;PAIREDR=0;REPEAT=A:2;RO=0;RPP=92.0407,3.32051;RPPR=0;RUN=1,1;SAP=60.6867,10.7656;SRP=0;TYPE=del;XAI=0.00167056,0;XAM=0.00483175,0.00394107;XAS=0.00316119,0.00394107;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:111.88:37:0:0:28,4:939,339:-56.9444,-31.3891,-110.621 1/2:50000:17:0:0:13,3:418,233:-27.1025,-8.06829,-43.3614
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA 50000 . AB=0.475177,0.524823;ABP=3.76493,3.76493;AC=2,2;AF=0.5,0.5;AN=4;AO=67,74;CIGAR=74M,1X;DP=141;DPRA=0,0;EPP=108.311,41.0404;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=61.3134,62.7432;MQMR=0;NS=2;NUMALT=2;ODDS=108.609;PAIRED=1,1;PAIREDR=0;REPEAT=T:3;RO=0;RPP=148.499,49.9611;RPPR=0;RUN=1,1;SAP=108.311,130.834;SRP=0;TYPE=snp;XAI=0.000204457,0.000928154;XAM=0.00146218,0.00240231;XAS=0.00125773,0.00147415;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:100:0:0:49,51:1479,1314:-118.518,-1.10775,-133.412 1/2:50000:41:0:0:18,23:529,566:-51.1861,-1.03664,-47.9039
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA 50000 . AB=0.681818,0.318182;ABP=28.2783,28.2783;AC=2,2;AF=0.5,0.5;AN=4;AO=60,28;CIGAR=74M,1X;DP=88;DPRA=0,0;EPP=116.506,28.1373;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=62.1167,64.1786;MQMR=0;NS=2;NUMALT=2;ODDS=35.9969;PAIRED=1,1;PAIREDR=0;REPEAT=T:3;RO=0;RPP=133.299,28.1373;RPPR=0;RUN=1,1;SAP=116.506,63.8115;SRP=0;TYPE=snp;XAI=0.000497128,0.00146771;XAM=0.00145529,0.00146771;XAS=0.000958162,0;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:156.337:62:0:0:53,9:1852,260:-23.6889,-8.35665,-167.029 1/2:50000:26:0:0:7,19:251,581:-52.5958,-2.00869,-22.9486
15 51675932 . ATTTTTTTTTTTTTTTTGGTTAATGTCCCTGTTTCTGTG A 50000 . AB=0.619469,0.247788;ABP=17.0192,65.4449;AC=2,2;AF=0.5,0.5;AN=4;AO=70,28;CIGAR=39M,1M1D;DP=113;DPRA=0,0;EPP=107.365,55.4358;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=4,4;MQM=61.4143,60;MQMR=0;NS=2;NUMALT=2;ODDS=45.5621;PAIRED=1,1;PAIREDR=0;REPEAT=A:2;RO=0;RPP=146.452,63.8115;RPPR=0;RUN=1,1;SAP=114.686,55.4358;SRP=0;TYPE=del;XAI=0.00444718,0.0167559;XAM=0.00733719,0.020701;XAS=0.00289001,0.00394514;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:79:0:0:49,20:1612,1200:-169.917,-65.679,-206.759 1/2:50000:34:0:0:21,8:694,480:-74.34,-33.2852,-93.3673
15 95019874 . TAGATAGACAGACAGACAGATAAAGAGATCTCCTGTGTTT CAGATAGACAGACAGACAGATAAAGAGATCTCCTGTGTTT 50000 . AB=0.8,0.1;ABP=34.2795,58.6;AC=3,1;AF=0.75,0.25;AN=4;AO=89,5;CIGAR=40M,1X;DP=100;DPRA=0,0;EPP=106.094,13.8677;EPPR=0;HWE=-6.53213;LEN=1,1;MEANALT=3.5,3.5;MQM=62.7079,60;MQMR=0;NS=2;NUMALT=2;ODDS=8.52413;PAIRED=0.988764,1;PAIREDR=0;REPEAT=TAGA:11;RO=0;RPP=171.092,13.8677;RPPR=0;RUN=1,1;SAP=99.8482,13.8677;SRP=0;TYPE=snp;XAI=0.00259821,0;XAM=0.00491433,0.00853041;XAS=0.00231612,0.00853041;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/1:124.92:60:0:0:57,1:1779,32:-7.65333,-20.4463,-164.92 1/2:37.0207:40:0:0:32,4:990,145:-34.1275,-27.2494,-110.049
3 116163674 . CACACACACGTGTAGACGCGCGCA C 50000 . AB=0.972789,0.0272109;ABP=288.419,288.419;AC=3,1;AF=0.75,0.25;AN=4;AO=211,4;CIGAR=24M,1M8D;DP=215;DPRA=0,2.16176;EPP=88.2329,5.18177;EPPR=0;HWE=-6.53213;LEN=1,8;MEANALT=1.5,2;MQM=82.0237,83.5;MQMR=0;NS=2;NUMALT=2;ODDS=10.4104;PAIRED=0.981043,1;PAIREDR=0;REPEAT=CA:11;RO=0;RPP=435.504,3.0103;RPPR=0;RUN=1,1;SAP=92.0201,5.18177;SRP=0;TYPE=del;XAI=0.00989964,0;XAM=0.0224026,0.00710113;XAS=0.012503,0.00710113;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:45.212:147:0:0:143,4:4982,483:-44.6775,-36.9802,-448.728 1/1:50000:68:0:0:68,0:2312,0:0,-20.47,-208.42
15 51675932 . ATTTTTTTTTTTTTTTTGGTTAATGTCCCTGTTTCTGTGTTTTGATGCAGGACCTCCGGG A 50000 . AB=0.833333,0.119048;ABP=43.5445,55.9529;AC=2,2;AF=0.5,0.5;AN=4;AO=35,5;CIGAR=60M,1M2D;DP=42;DPRA=0,0;EPP=70.5741,3.44459;EPPR=0;HWE=4.77121;LEN=1,2;MEANALT=3,3;MQM=61.3714,60;MQMR=0;NS=2;NUMALT=2;ODDS=9.00947;PAIRED=1,1;PAIREDR=0;REPEAT=A:2;RO=0;RPP=70.5741,3.44459;RPPR=0;RUN=1,1;SAP=79.0118,6.91895;SRP=0;TYPE=del;XAI=0.00391933,0;XAM=0.00560576,0.0028169;XAS=0.00168643,0.0028169;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:39.1282:19:0:0:17,1:559,85:-13.775,-10.1633,-56.0539 1/2:50000:23:0:0:18,4:592,302:-33.304,-8.75845,-59.0232
5 60790037 . TTGTGTTTTCGTTTTGAACAATTTTCTAAAGGTCTGTTTTTCCCCATTAGGTGCGGGAGATGTTAAAGATGAGG CTGTGTTTTCGTTTTGAACAATTTTCTAAAGGTCTGTTTTTCCCCATTAGGTGCGGGAGATGTTAAAGATGAGG 50000 . AB=0.519435,0.480565;ABP=3.93874,3.93874;AC=2,2;AF=0.5,0.5;AN=4;AO=147,136;CIGAR=74M,1X;DP=283;DPRA=0,0;EPP=44.5046,19.3602;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.0952,60.0956;MQMR=0;NS=2;NUMALT=2;ODDS=220.359;PAIRED=0.993197,1;PAIREDR=0;REPEAT=T:2|TTG:2;RO=0;RPP=313.59,19.3602;RPPR=0;RUN=1,1;SAP=41.4321,53.0819;SRP=0;TYPE=snp;XAI=0.000415335,0.000604351;XAM=0.00199211,0.00193248;XAS=0.00157678,0.00132813;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:213:0:0:113,100:3600,3663:-330.036,-1.43435,-324.319 1/2:50000:70:0:0:34,36:1068,1330:-120.069,-1.03439,-96.4341
6 32634226 . GAGCCTGTTCCCAGAGTGGCGGCT ATGCCTGTTCCCAGAGTGGCGGCT 50000 . AB=0.5,0.5;ABP=3.0103,3.0103;AC=2,2;AF=0.5,0.5;AN=4;AO=6,6;CIGAR=24M,2X;DP=12;DPRA=0,0;EPP=3.0103,4.45795;EPPR=0;HWE=4.77121;LEN=1,2;MEANALT=2,2;MQM=79,71.3333;MQMR=0;NS=2;NUMALT=2;ODDS=13.712;PAIRED=1,1;PAIREDR=0;REPEAT=GA:2;RO=0;RPP=3.0103,4.45795;RPPR=0;RUN=1,1;SAP=4.45795,4.45795;SRP=0;TYPE=mnp;XAI=0.00347222,0.0143162;XAM=0.0222148,0.0222842;XAS=0.0187426,0.007968;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:116.65:8:0:0:4,4:151,129:-11.9325,-0.563142,-13.9675 1/2:59.3049:4:0:0:2,2:77,64:-6.08,-0.425969,-7.315
15 51675932 . ATTTTTTTTTTTTTTTTGGTTAATGTCCCTGTTTCTGTGTTTTGATGCAGGACCTCCGGGAGCCGGCGGGTTGC A 50000 . AB=0.80597,0.179104;ABP=57.4916,62.9365;AC=2,2;AF=0.5,0.5;AN=4;AO=54,12;CIGAR=74M,1M1D;DP=67;DPRA=0,0;EPP=103.541,14.5915;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2.5,2.5;MQM=60.1852,60;MQMR=0;NS=2;NUMALT=2;ODDS=11.4247;PAIRED=1,1;PAIREDR=0;REPEAT=A:2;RO=0;RPP=111.745,21.1059;RPPR=0;RUN=1,1;SAP=95.6598,21.1059;SRP=0;TYPE=del;XAI=0.002812,0.00141243;XAM=0.00709205,0.00371139;XAS=0.00428005,0.00229896;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:52:0:0:40,11:1330,993:-93.1042,-7.87469,-122.912 1/2:49.6168:15:0:0:14,1:471,80:-8,-3.33936,-42.7264
6 160868701 . GGCCCAGCTGTGT AGCCCAGCTGTGT 50000 . AB=0.5,0.5;ABP=3.0103,3.0103;AC=2,2;AF=0.5,0.5;AN=4;AO=86,86;CIGAR=13M,1X;DP=172;DPRA=0,0;EPP=100.07,20.0791;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=61.1628,60.3256;MQMR=0;NS=2;NUMALT=2;ODDS=172.277;PAIRED=1,0.988372;PAIREDR=0;REPEAT=G:3;RO=0;RPP=156.629,43.4098;RPPR=0;RUN=1,1;SAP=112.998,119.765;SRP=0;TYPE=snp;XAI=0.00898023,0;XAM=0.0145866,0.00158273;XAS=0.00560636,0.00158273;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:116:0:0:63,53:2224,1690:-152.419,-1.31704,-200.513 1/2:50000:56:0:0:23,33:839,1062:-95.9018,-1.35699,-75.8748
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTT GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTT 50000 . AB=0.542553,0.457447;ABP=4.48875,4.48875;AC=2,2;AF=0.5,0.5;AN=4;AO=51,43;CIGAR=57M,1X;DP=94;DPRA=0,0;EPP=105.24,25.2805;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=68.6471,60;MQMR=0;NS=2;NUMALT=2;ODDS=107.206;PAIRED=1,1;PAIREDR=0;REPEAT=T:3;RO=0;RPP=113.755,29.7245;RPPR=0;RUN=1,1;SAP=105.24,87.8997;SRP=0;TYPE=snp;XAI=0.00268601,0.000637146;XAM=0.00374589,0.00224658;XAS=0.00105988,0.00160943;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:61:0:0:34,27:1185,821:-74.1941,-1.16447,-106.999 1/2:50000:33:0:0:17,16:574,520:-47.125,-0.866992,-51.9976
16 70708159 . CATAAGGCTGCTGCACCCCACCCTGACTGATCCTCCTAACGCCCCCTCACCTGGC TATAAGGCTGCTGCACCCCACCCTGACTGATCCTCCTAACGCCCCCTCACCTGGC 50000 . AB=0.357143,0.642857;ABP=7.97367,7.97367;AC=3,1;AF=0.75,0.25;AN=4;AO=35,19;CIGAR=1X,55M;DP=54;DPRA=0,0;EPP=20.9405,44.2683;EPPR=0;HWE=-6.53213;LEN=1,1;MEANALT=2,2;MQM=65.5714,60;MQMR=0;NS=2;NUMALT=2;ODDS=8.77464;PAIRED=1,1;PAIREDR=0;RO=0;RPP=10.5174,44.2683;RPPR=0;RUN=1,1;SAP=41.7866,44.2683;SRP=0;TYPE=snp;XAI=0.00157099,0;XAM=0.00320253,0.00692378;XAS=0.00163154,0.00692378;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/1:38.1084:26:0:0:25,1:749,23:-2.3,-6.41181,-67.7096 1/2:50000:28:0:0:10,18:282,621:-56.235,-1.3108,-25.662
3 116163674 . CACACACACGTGTAGA C 50000 . AB=0.934426,0.0601093;ABP=302.994,310.588;AC=2,2;AF=0.5,0.5;AN=4;AO=171,11;CIGAR=16M,1M8D;DP=183;DPRA=0,0;EPP=67.0243,26.8965;EPPR=0;HWE=4.77121;LEN=1,8;MEANALT=2.5,2.5;MQM=79.6901,76.3636;MQMR=0;NS=2;NUMALT=2;ODDS=75.515;PAIRED=0.982456,0.909091;PAIREDR=0;REPEAT=CA:11;RO=0;RPP=365.697,3.20771;RPPR=0;RUN=1,1;SAP=70.6815,3.20771;SRP=0;TYPE=del;XAI=0.00974759,0;XAM=0.0232181,0.00792613;XAS=0.0134705,0.00792613;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:122:0:0:114,7:3765,789:-74.825,-28.7243,-341.97 1/2:50000:61:0:0:57,4:1960,488:-45.14,-12.6453,-176.744
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA 50000 . AB=0.497238,0.497238;ABP=3.0223,3.0223;AC=2,2;AF=0.5,0.5;AN=4;AO=90,90;CIGAR=74M,1X;DP=181;DPRA=0,0;EPP=114.576,34.2795;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2.5,2.5;MQM=60.1556,61.6;MQMR=0;NS=2;NUMALT=2;ODDS=172.411;PAIRED=0.988889,0.988889;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=181.457,84.1751;RPPR=0;RUN=1,1;SAP=128.087,114.576;SRP=0;TYPE=snp;XAI=0.000975547,0.00352352;XAM=0.00375719,0.00535228;XAS=0.00278164,0.00182876;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:128:0:0:62,65:2003,2136:-195.358,-4.26609,-183.383 1/2:50000:53:0:0:28,25:912,836:-75.5744,-0.998452,-82.4057
8 2967631 . GAATTGTTGATCACAATTACAGATATTTTGACTTGAGAGGTTCTCATACCAAACAGCAATGTAATCGTT CAATTGTTGATCACAATTACAGATATTTTGACTTGAGAGGTTCTCATACCAAACAGCAATGTAATCGTT 50000 . AB=0.519481,0.480519;ABP=3.77173,3.77173;AC=2,2;AF=0.5,0.5;AN=4;AO=120,111;CIGAR=69M,1X;DP=231;DPRA=0,0;EPP=63.8839,26.9747;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,60.7027;MQMR=0;NS=2;NUMALT=2;ODDS=234.564;PAIRED=1,1;PAIREDR=0;RO=0;RPP=34.9309,66.5699;RPPR=0;RUN=1,1;SAP=169.779,157.967;SRP=0;TYPE=snp;XAI=0.000382617,0.000378999;XAM=0.015046,0.0203813;XAS=0.0146633,0.0200023;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:161:0:0:89,72:3091,2467:-222.373,-1.59024,-278.537 1/2:50000:70:0:0:31,39:1138,1367:-123.381,-1.2183,-102.787
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCA GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCA 50000 . AB=0.513274,0.486726;ABP=3.18325,3.18325;AC=2,2;AF=0.5,0.5;AN=4;AO=58,55;CIGAR=65M,1X;DP=113;DPRA=0,0;EPP=120.42,46.0055;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.6724,63.3818;MQMR=0;NS=2;NUMALT=2;ODDS=107.005;PAIRED=1,1;PAIREDR=0;REPEAT=T:3;RO=0;RPP=128.956,51.3749;RPPR=0;RUN=1,1;SAP=120.42,113.913;SRP=0;TYPE=snp;XAI=0.000292227,0.000747198;XAM=0.00251536,0.00224187;XAS=0.00222313,0.00149468;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:80:0:0:43,37:1448,1101:-99.3876,-1.14756,-130.657 1/2:50000:33:0:0:15,18:527,520:-47.0889,-0.918145,-47.7813
2 242594622 . CGTGCCACCAGAGGTCAGGGCTGGGGGCGGGTGTGTGTTGCTAATGTGTATCTGTTCCCTGCAGCGCAAATGG TGTGCCACCAGAGGTCAGGGCTGGGGGCGGGTGTGTGTTGCTAATGTGTATCTGTTCCCTGCAGCGCAAATGG 50000 . AB=0.509579,0.490421;ABP=3.2183,3.2183;AC=2,2;AF=0.5,0.5;AN=4;AO=133,128;CIGAR=73M,1X;DP=261;DPRA=0,0;EPP=94.8489,5.45321;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,60.1094;MQMR=0;NS=2;NUMALT=2;ODDS=345.187;PAIRED=1,1;PAIREDR=0;RO=0;RPP=291.816,64.083;RPPR=0;RUN=1,1;SAP=94.8489,81.4547;SRP=0;TYPE=snp;XAI=0.000105899,0.000225392;XAM=0.00149795,0.00106999;XAS=0.00139205,0.000844595;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:148:0:0:72,76:2472,2506:-225.87,-1.20724,-222.823 1/2:50000:113:0:0:61,52:2191,1673:-150.892,-1.28001,-197.549
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA 50000 . AB=0.495238,0.504762;ABP=3.03098,3.03098;AC=2,2;AF=0.5,0.5;AN=4;AO=52,53;CIGAR=1X,74M;DP=105;DPRA=0,0;EPP=16.5402,93.5156;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=61.2115,61.9811;MQMR=0;NS=2;NUMALT=2;ODDS=119.564;PAIRED=1,0.981132;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=45.7716,118.098;RPPR=0;RUN=1,1;SAP=63.3104,93.5156;SRP=0;TYPE=snp;XAI=0.00343595,0.000535934;XAM=0.00474986,0.00104937;XAS=0.00131392,0.000513437;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:68:0:0:36,32:1250,1056:-95.37,-1.06629,-112.847 1/2:50000:37:0:0:16,21:581,671:-60.7095,-1.02834,-52.6531
8 26484064 . TTTCTTATCCCTTA GTTCTTATCCCTTA 50000 . AB=0.526786,0.473214;ABP=3.70827,3.70827;AC=2,2;AF=0.5,0.5;AN=4;AO=59,53;CIGAR=14M,1X;DP=112;DPRA=0,0;EPP=106.394,65.3275;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=62.1525,60;MQMR=0;NS=2;NUMALT=2;ODDS=79.2301;PAIRED=1,1;PAIREDR=0;REPEAT=T:3;RO=0;RPP=131.127,71.8828;RPPR=0;RUN=1,1;SAP=106.394,109.576;SRP=0;TYPE=snp;XAI=0.000235405,0;XAM=0.00253219,0.00101989;XAS=0.00229679,0.00101989;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:69:0:0:29,40:983,1178:-106.315,-1.39595,-88.809 1/2:50000:43:0:0:30,13:1068,402:-36.4892,-2.38108,-96.476
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA 50000 . AB=0.338129,0.661871;ABP=34.6451,34.6451;AC=2,2;AF=0.5,0.5;AN=4;AO=47,92;CIGAR=74M,1X;DP=139;DPRA=0,0;EPP=59.6072,93.7401;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=59.1915,62.75;MQMR=0;NS=2;NUMALT=2;ODDS=70.9087;PAIRED=1,0.98913;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=73.2828,118.665;RPPR=0;RUN=1,1;SAP=73.2828,169.553;SRP=0;TYPE=snp;XAI=0.000725545,0.000958273;XAM=0.00217103,0.00469928;XAS=0.00144549,0.003741;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:105:0:0:36,69:1180,2390:-215.446,-3.37801,-106.528 1/2:50000:34:0:0:11,23:355,813:-73.5235,-1.77851,-32.2727
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA 50000 . AB=0.585586,0.414414;ABP=10.0725,10.0725;AC=2,2;AF=0.5,0.5;AN=4;AO=65,46;CIGAR=74M,1X;DP=111;DPRA=0,0;EPP=111.551,51.3492;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=61.2,59.2174;MQMR=0;NS=2;NUMALT=2;ODDS=107.693;PAIRED=1,1;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=135.604,71.1757;RPPR=0;RUN=1,1;SAP=119.301,78.5398;SRP=0;TYPE=snp;XAI=0.000449401,0.00157742;XAM=0.00130476,0.00498269;XAS=0.000855361,0.00340527;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:76:0:0:49,27:1593,926:-83.683,-2.42394,-143.695 1/2:50000:35:0:0:16,19:523,639:-57.8463,-0.927531,-47.3969
10 71649083 . AGGGGGCAGGGAGGAGCATGAAGGACAGAGGGTGGAACTTCTGGGCTGCGAACAGTGCACCTGGTACTCACCCT GGGGGGCAGGGAGGAGCATGAAGGACAGAGGGTGGAACTTCTGGGCTGCGAACAGTGCACCTGGTACTCACCCT 50000 . AB=0.678363,0.321637;ABP=50.262,50.262;AC=2,2;AF=0.5,0.5;AN=4;AO=116,55;CIGAR=74M,1X;DP=171;DPRA=0,0;EPP=42.621,6.20829;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,60.7091;MQMR=0;NS=2;NUMALT=2;ODDS=155.905;PAIRED=1,1;PAIREDR=0;RO=0;RPP=237.829,122.441;RPPR=0;RUN=1,1;SAP=42.621,6.20829;SRP=0;TYPE=snp;XAI=0,0;XAM=0.00249449,0.00721128;XAS=0.00249449,0.00721128;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:87:0:0:57,30:1847,978:-88.346,-2.89719,-166.554 1/2:50000:84:0:0:59,25:1862,791:-71.5064,-4.0988,-167.896
15 41272371 . TCAGGACTCTAGCCCTGGTTTGGTTGAAGGAAGTCGGAGGGCCCAGATGGTTACCGTCCTCCAGAGGGGTTGGT GCAGGACTCTAGCCCTGGTTTGGTTGAAGGAAGTCGGAGGGCCCAGATGGTTACCGTCCTCCAGAGGGGTTGGT 50000 . AB=0.828947,0.171053;ABP=145.87,145.87;AC=2,2;AF=0.5,0.5;AN=4;AO=126,26;CIGAR=74M,1X;DP=152;DPRA=0,0;EPP=53.2644,43.4331;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,60;MQMR=0;NS=2;NUMALT=2;ODDS=38.5134;PAIRED=1,1;PAIREDR=0;RO=0;RPP=251.179,43.4331;RPPR=0;RUN=1,1;SAP=65.0524,59.4686;SRP=0;TYPE=snp;XAI=0.00116319,0.0127484;XAM=0.0027345,0.0156197;XAS=0.00157132,0.00287124;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:167.608:76:0:0:65,11:1920,292:-26.5455,-10.1203,-173.095 1/2:50000:76:0:0:61,15:1802,407:-36.9013,-7.42486,-162.475
6 32551831 . C A 50000 . AB=0.666667,0.333333;ABP=5.18177,5.18177;AC=3,1;AF=0.75,0.25;AN=4;AO=12,3;CIGAR=1X,1M;DP=15;DPRA=0,1.5;EPP=29.068,9.52472;EPPR=0;HWE=-6.53213;LEN=1,1;MEANALT=1.5,2;MQM=73.1667,52.3333;MQMR=0;NS=2;NUMALT=2;ODDS=3.46574;PAIRED=1,1;PAIREDR=0;REPEAT=CA:20;RO=0;RPP=29.068,9.52472;RPPR=0;RUN=1,1;SAP=29.068,9.52472;SRP=0;TYPE=snp;XAI=0.0353802,0.0133129;XAM=0.0603255,0.0388804;XAS=0.0249454,0.0255675;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:59.4562:9:0:0:6,3:177,106:-9.89333,-0.784991,-16.225 1/1:15.1851:6:0:0:6,0:189,0:0,-1.80618,-17.325
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGT GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGT 50000 . AB=0.4375,0.5625;ABP=7.35324,7.35324;AC=2,2;AF=0.5,0.5;AN=4;AO=56,72;CIGAR=70M,1X;DP=128;DPRA=0,0;EPP=99.951,33.8935;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,58.3889;MQMR=0;NS=2;NUMALT=2;ODDS=148.217;PAIRED=1,1;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=116.082,90.9549;RPPR=0;RUN=1,1;SAP=107.861,78.4086;SRP=0;TYPE=snp;XAI=0,0.00252589;XAM=0.00122405,0.00327664;XAS=0.00122405,0.000750751;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:80:0:0:32,48:1006,1794:-161.834,-1.74175,-90.8544 1/2:50000:48:0:0:24,24:719,838:-75.7692,-0.940942,-65.0096
15 41272371 . TCAGGACTCTAGCCCTGGTTTGGTTGAAGGAAGTCGGAGGGCCCAGATGGTTACCGTCCTCCAGAGGGGTTGGT GCAGGACTCTAGCCCTGGTTTGGTTGAAGGAAGTCGGAGGGCCCAGATGGTTACCGTCCTCCAGAGGGGTTGGT 50000 . AB=0.834286,0.16;ABP=172.869,178.726;AC=2,2;AF=0.5,0.5;AN=4;AO=146,28;CIGAR=74M,1X;DP=175;DPRA=0,0;EPP=75.8885,47.6806;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2.5,2.5;MQM=60.137,60;MQMR=0;NS=2;NUMALT=2;ODDS=44.9424;PAIRED=1,1;PAIREDR=0;RO=0;RPP=286.254,47.6806;RPPR=0;RUN=1,1;SAP=84.4554,63.8115;SRP=0;TYPE=snp;XAI=0.000581415,0.0115443;XAM=0.00201064,0.0148685;XAS=0.00142923,0.00332418;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:99:0:0:85,13:2598,366:-35.2879,-16.0707,-236.195 1/2:50000:76:0:0:61,15:1802,407:-36.9013,-7.42486,-162.475
6 32551831 . CACACTCAGATTCCCAGCTCACGGGGACTCAGGCCCCGCCCGCGGCC AACACTCAGATTCCCAGCTCACGGGGACTCAGGCCCCGCCCGCGGCC 50000 . AB=0.5,0.5;ABP=3.0103,3.0103;AC=3,1;AF=0.75,0.25;AN=4;AO=11,5;CIGAR=1X,47M;DP=16;DPRA=0,1.66667;EPP=12.6832,6.91895;EPPR=0;HWE=-6.53213;LEN=1,1;MEANALT=1.5,2;MQM=72.9091,60.2;MQMR=0;NS=2;NUMALT=2;ODDS=3.46574;PAIRED=1,1;PAIREDR=0;REPEAT=CA:20;RO=0;RPP=12.6832,6.91895;RPPR=0;RUN=1,1;SAP=26.8965,13.8677;SRP=0;TYPE=snp;XAI=0.0341694,0.029926;XAM=0.0637302,0.0495888;XAS=0.0295609,0.0196628;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:116.801:10:0:0:5,5:152,168:-15.456,-0.608899,-13.984 1/1:15.1851:6:0:0:6,0:189,0:0,-1.80618,-17.325
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGT GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGT 50000 . AB=0.407692,0.592308;ABP=12.6316,12.6316;AC=2,2;AF=0.5,0.5;AN=4;AO=53,77;CIGAR=70M,1X;DP=130;DPRA=0,0;EPP=101.382,37.5565;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,59.0649;MQMR=0;NS=2;NUMALT=2;ODDS=148.217;PAIRED=1,1;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=109.576,76.3609;RPPR=0;RUN=1,1;SAP=109.576,107.946;SRP=0;TYPE=snp;XAI=0,0.0036225;XAM=0.00237805,0.0043245;XAS=0.00237805,0.000702001;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:82:0:0:29,53:909,1968:-177.491,-2.5849,-82.1234 1/2:50000:48:0:0:24,24:719,838:-75.7692,-0.940942,-65.0096
16 70708159 . CATAAGGCTGCTGCACCCCACCCTGACTGATCCTCCTAACGCCCCCTCACCTGGCTGGTGATGTCTGAAGGCAT TATAAGGCTGCTGCACCCCACCCTGACTGATCCTCCTAACGCCCCCTCACCTGGCTGGTGATGTCTGAAGGCAT 50000 . AB=0.688889,0.311111;ABP=16.956,16.956;AC=2,2;AF=0.5,0.5;AN=4;AO=31,14;CIGAR=74M,1X;DP=45;DPRA=0,0;EPP=61.9202,3.0103;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,63.5;MQMR=0;NS=2;NUMALT=2;ODDS=31.6348;PAIRED=1,1;PAIREDR=0;RO=0;RPP=70.3259,8.59409;RPPR=0;RUN=1,1;SAP=61.9202,12.937;SRP=0;TYPE=snp;XAI=0,0.000978474;XAM=0.00349624,0.00303493;XAS=0.00349624,0.00205646;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:32:0:0:24,8:819,229:-20.8963,-2.61101,-74.0513 1/2:137.388:13:0:0:7,6:243,154:-14.1167,-0.678873,-22.2171
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTT GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTT 50000 . AB=0.516484,0.483516;ABP=3.22506,3.22506;AC=2,2;AF=0.5,0.5;AN=4;AO=47,44;CIGAR=57M,1X;DP=91;DPRA=0,0;EPP=96.5684,60.0608;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=67,60.6818;MQMR=0;NS=2;NUMALT=2;ODDS=81.9436;PAIRED=1,0.977273;PAIREDR=0;REPEAT=T:3;RO=0;RPP=105.07,66.97;RPPR=0;RUN=1,1;SAP=96.5684,74.2741;SRP=0;TYPE=snp;XAI=0.00180323,0.000311333;XAM=0.00266974,0.000618458;XAS=0.000866503,0.000307125;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:60:0:0:30,30:1044,924:-83.468,-0.988945,-94.308 1/2:50000:31:0:0:17,14:596,399:-36.195,-0.908385,-53.9906
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA 50000 . AB=0.503597,0.496403;ABP=3.02592,3.02592;AC=2,2;AF=0.5,0.5;AN=4;AO=70,69;CIGAR=74M,1X;DP=139;DPRA=0,0;EPP=114.686,29.4771;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.4714,60.5942;MQMR=0;NS=2;NUMALT=2;ODDS=107.783;PAIRED=0.985714,0.985507;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=138.138,55.9124;RPPR=0;RUN=1,1;SAP=130.072,105.258;SRP=0;TYPE=snp;XAI=0.000609773,0.00337232;XAM=0.00315101,0.00498556;XAS=0.00254124,0.00161324;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:103:0:0:49,54:1593,1919:-173.065,-1.15775,-143.695 1/2:50000:36:0:0:21,15:667,525:-47.6,-1.09139,-60.3476

@kyasuno

It seems that, in the above examples, REF allele has been regarded as one of the ALT alleles.

@ekg
Owner

Does the current freebayes git HEAD still exhibit this issue?

@kyasuno
@ekg
Owner

Hi, have you found that the current freebayes version still has this issue?

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Something went wrong with that request. Please try again.