Inconsistent ALT column, INFO and GT fields #31

Open
kyasuno opened this Issue Mar 28, 2012 · 4 comments

Comments

Projects
None yet
2 participants
@kyasuno

kyasuno commented Mar 28, 2012

Hi,

I got calls that contain inconsistent description of variants given below.
Even though number of ALT alleles is 1 according to ALT field, AF (for instance) demonstrate that there are 2 ALT alleles and GT was assigned to be 1/2 using "missing" allele. Some incompatibilities between REF/ALT and TYPE field can also be seen.

Thanks

7 151552404 . TCCCACACACCGCCCTCCACACACACCATGCTCC T 50000 . AB=0.168484,0.814668;ABP=966.208,870.792;AC=2,2;AF=0.5,0.5;AN=4;AO=170,822;CIGAR=34M,1M1D;DP=1009;DPRA=0,0;EPP=4.28764,173.442;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=5.5,5.5;MQM=56.5294,59.9635;MQMR=0;NS=2;NUMALT=2;ODDS=272.642;PAIRED=0.823529,0.972019;PAIREDR=0;REPEAT=C:3;RO=0;RPP=267.879,11.2947;RPPR=0;RUN=1,1;SAP=3.8278,92.4475;SRP=0;TYPE=del;XAI=0.0164645,0.00101542;XAM=0.0376921,0.0152932;XAS=0.0212277,0.0142778;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:678:0:0:120,545:4165,52257:-4771.58,-133.319,-442.72 1/2:50000:331:0:0:50,277:1746,27270:-2472.74,-56.8534,-174.959
6 160868701 . GGCCCAGCTGTGTCTTC AGCCCAGCTGTGTCTTC 50000 . AB=0.486726,0.513274;ABP=3.3562,3.3562;AC=2,2;AF=0.5,0.5;AN=4;AO=110,116;CIGAR=17M,1X;DP=226;DPRA=0,0;EPP=111.11,12.0706;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.2182,60.3362;MQMR=0;NS=2;NUMALT=2;ODDS=255.397;PAIRED=1,1;PAIREDR=0;REPEAT=G:3;RO=0;RPP=208.392,36.0317;RPPR=0;RUN=1,1;SAP=135.746,147.975;SRP=0;TYPE=snp;XAI=0.00863394,0.000139043;XAM=0.0189943,0.00108513;XAS=0.0103604,0.000946087;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:151:0:0:77,74:2714,2378:-214.341,-1.20113,-244.612 1/2:50000:75:0:0:33,42:1239,1368:-123.446,-1.269,-111.885
10 71649083 . AGGGGGCAGGGAGGAGCATGAAGGACAGAGGGTGGAACTTCTGGGCTGCGAACAGTGCACCTGGTACTCACCCT GGGGGGCAGGGAGGAGCATGAAGGACAGAGGGTGGAACTTCTGGGCTGCGAACAGTGCACCTGGTACTCACCCT 50000 . AB=0.6375,0.3625;ABP=16.1477,16.1477;AC=2,2;AF=0.5,0.5;AN=4;AO=51,29;CIGAR=74M,1X;DP=80;DPRA=0,0;EPP=18.3809,15.6647;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=59.098,61.1034;MQMR=0;NS=2;NUMALT=2;ODDS=43.8963;PAIRED=1,1;PAIREDR=0;RO=0;RPP=105.24,65.983;RPPR=0;RUN=1,1;SAP=21.7871,15.6647;SRP=0;TYPE=snp;XAI=0,0;XAM=0.000537201,0.0052643;XAS=0.000537201,0.0052643;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:57:0:0:35,22:1173,741:-67.0268,-1.61597,-105.905 1/2:50000:23:0:0:16,7:504,222:-20.2971,-1.53425,-45.675
15 51675932 . ATTTTTTTTTTTTTTTTGGTTAATGTCCCTGTTTCTGTGTTTTGATGCAGGACCTC A 50000 . AB=0.756757,0.108108;ABP=24.1968,52.3673;AC=3,1;AF=0.75,0.25;AN=4;AO=38,4;CIGAR=56M,1M2D;DP=47;DPRA=0,3.7;EPP=54.4399,11.6962;EPPR=0;HWE=-6.53213;LEN=1,2;MEANALT=2.5,4;MQM=61.1053,60;MQMR=0;NS=2;NUMALT=2;ODDS=6.23832;PAIRED=1,1;PAIREDR=0;REPEAT=A:2;RO=0;RPP=69.0688,11.6962;RPPR=0;RUN=1,1;SAP=69.0688,11.6962;SRP=0;TYPE=del;XAI=0.00475303,0;XAM=0.0115667,0.00352113;XAS=0.00681365,0.00352113;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:93.8485:37:0:0:28,4:931,342:-56.0333,-30.1931,-108.725 1/1:27.0968:10:0:0:10,0:328,0:0,-3.0103,-29.848
5 60790037 . TTGTGTTTTCGTTTTGAACAATTTTCTAAAGGTCTGTTTTTCCCCATTAGGTGCGGGAGATGTTA CTGTGTTTTCGTTTTGAACAATTTTCTAAAGGTCTGTTTTTCCCCATTAGGTGCGGGAGATGTTA 50000 . AB=0.565217,0.434783;ABP=8.10854,8.10854;AC=2,2;AF=0.5,0.5;AN=4;AO=78,60;CIGAR=65M,1X;DP=138;DPRA=0,0;EPP=31.5178,3.15506;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.4103,60;MQMR=0;NS=2;NUMALT=2;ODDS=162.338;PAIRED=1,1;PAIREDR=0;REPEAT=T:2|TTG:2;RO=0;RPP=172.385,27.4756;RPPR=0;RUN=1,1;SAP=31.5178,40.0701;SRP=0;TYPE=snp;XAI=0.00052931,0.000228311;XAM=0.00278156,0.00112921;XAS=0.00225225,0.000900901;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:80:0:0:42,38:1391,1392:-125.646,-1.09387,-125.521 1/2:50000:58:0:0:36,22:1164,795:-71.9114,-1.70987,-105.083
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCC GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCC 50000 . AB=0.481132,0.518868;ABP=3.33807,3.33807;AC=2,2;AF=0.5,0.5;AN=4;AO=51,55;CIGAR=50M,1X;DP=106;DPRA=0,0;EPP=74.5837,27.6861;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.6275,58.1636;MQMR=0;NS=2;NUMALT=2;ODDS=90.5747;PAIRED=1,1;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=97.0649,46.0055;RPPR=0;RUN=1,1;SAP=74.5837,90.2245;SRP=0;TYPE=snp;XAI=0.000268601,0.00329528;XAM=0.00353417,0.00354435;XAS=0.00326556,0.000249066;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:73:0:0:31,42:1026,1465:-132.199,-1.38757,-92.671 1/2:50000:33:0:0:20,13:654,443:-40.2108,-1.17571,-59.187
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA 50000 . AB=0.415584,0.584416;ABP=7.77626,7.77626;AC=2,2;AF=0.5,0.5;AN=4;AO=32,45;CIGAR=74M,1X;DP=77;DPRA=0,0;EPP=56.2114,49.3833;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=63.0625,65.2;MQMR=0;NS=2;NUMALT=2;ODDS=48.8243;PAIRED=1,0.977778;PAIREDR=0;REPEAT=T:3;RO=0;RPP=72.4974,49.3833;RPPR=0;RUN=1,1;SAP=56.2114,84.1269;SRP=0;TYPE=snp;XAI=0.000856164,0.00185271;XAM=0.00285572,0.00245331;XAS=0.00199956,0.000600601;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:57:0:0:25,32:916,945:-85.3453,-1.16178,-82.8064 1/2:50000:20:0:0:7,13:241,403:-36.58,-1.13119,-22.0343
15 51675932 . ATTTTTTTTTTTTTTTTGGTTAATGTCCCTGTTTCTGTGTTTTGATGCAGGAC A 50000 . AB=0.759259,0.12963;ABP=34.5369,67.3502;AC=2,2;AF=0.5,0.5;AN=4;AO=41,7;CIGAR=53M,1M2D;DP=54;DPRA=0,0;EPP=60.6867,3.32051;EPPR=0;HWE=4.77121;LEN=1,2;MEANALT=3.5,3.5;MQM=60,60;MQMR=0;NS=2;NUMALT=2;ODDS=25.7613;PAIRED=1,1;PAIREDR=0;REPEAT=A:2;RO=0;RPP=92.0407,3.32051;RPPR=0;RUN=1,1;SAP=60.6867,10.7656;SRP=0;TYPE=del;XAI=0.00167056,0;XAM=0.00483175,0.00394107;XAS=0.00316119,0.00394107;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:111.88:37:0:0:28,4:939,339:-56.9444,-31.3891,-110.621 1/2:50000:17:0:0:13,3:418,233:-27.1025,-8.06829,-43.3614
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA 50000 . AB=0.475177,0.524823;ABP=3.76493,3.76493;AC=2,2;AF=0.5,0.5;AN=4;AO=67,74;CIGAR=74M,1X;DP=141;DPRA=0,0;EPP=108.311,41.0404;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=61.3134,62.7432;MQMR=0;NS=2;NUMALT=2;ODDS=108.609;PAIRED=1,1;PAIREDR=0;REPEAT=T:3;RO=0;RPP=148.499,49.9611;RPPR=0;RUN=1,1;SAP=108.311,130.834;SRP=0;TYPE=snp;XAI=0.000204457,0.000928154;XAM=0.00146218,0.00240231;XAS=0.00125773,0.00147415;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000💯0:0:49,51:1479,1314:-118.518,-1.10775,-133.412 1/2:50000:41:0:0:18,23:529,566:-51.1861,-1.03664,-47.9039
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCACTAGGGGTA 50000 . AB=0.681818,0.318182;ABP=28.2783,28.2783;AC=2,2;AF=0.5,0.5;AN=4;AO=60,28;CIGAR=74M,1X;DP=88;DPRA=0,0;EPP=116.506,28.1373;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=62.1167,64.1786;MQMR=0;NS=2;NUMALT=2;ODDS=35.9969;PAIRED=1,1;PAIREDR=0;REPEAT=T:3;RO=0;RPP=133.299,28.1373;RPPR=0;RUN=1,1;SAP=116.506,63.8115;SRP=0;TYPE=snp;XAI=0.000497128,0.00146771;XAM=0.00145529,0.00146771;XAS=0.000958162,0;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:156.337:62:0:0:53,9:1852,260:-23.6889,-8.35665,-167.029 1/2:50000:26:0:0:7,19:251,581:-52.5958,-2.00869,-22.9486
15 51675932 . ATTTTTTTTTTTTTTTTGGTTAATGTCCCTGTTTCTGTG A 50000 . AB=0.619469,0.247788;ABP=17.0192,65.4449;AC=2,2;AF=0.5,0.5;AN=4;AO=70,28;CIGAR=39M,1M1D;DP=113;DPRA=0,0;EPP=107.365,55.4358;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=4,4;MQM=61.4143,60;MQMR=0;NS=2;NUMALT=2;ODDS=45.5621;PAIRED=1,1;PAIREDR=0;REPEAT=A:2;RO=0;RPP=146.452,63.8115;RPPR=0;RUN=1,1;SAP=114.686,55.4358;SRP=0;TYPE=del;XAI=0.00444718,0.0167559;XAM=0.00733719,0.020701;XAS=0.00289001,0.00394514;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:79:0:0:49,20:1612,1200:-169.917,-65.679,-206.759 1/2:50000:34:0:0:21,8:694,480:-74.34,-33.2852,-93.3673
15 95019874 . TAGATAGACAGACAGACAGATAAAGAGATCTCCTGTGTTT CAGATAGACAGACAGACAGATAAAGAGATCTCCTGTGTTT 50000 . AB=0.8,0.1;ABP=34.2795,58.6;AC=3,1;AF=0.75,0.25;AN=4;AO=89,5;CIGAR=40M,1X;DP=100;DPRA=0,0;EPP=106.094,13.8677;EPPR=0;HWE=-6.53213;LEN=1,1;MEANALT=3.5,3.5;MQM=62.7079,60;MQMR=0;NS=2;NUMALT=2;ODDS=8.52413;PAIRED=0.988764,1;PAIREDR=0;REPEAT=TAGA:11;RO=0;RPP=171.092,13.8677;RPPR=0;RUN=1,1;SAP=99.8482,13.8677;SRP=0;TYPE=snp;XAI=0.00259821,0;XAM=0.00491433,0.00853041;XAS=0.00231612,0.00853041;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/1:124.92:60:0:0:57,1:1779,32:-7.65333,-20.4463,-164.92 1/2:37.0207:40:0:0:32,4:990,145:-34.1275,-27.2494,-110.049
3 116163674 . CACACACACGTGTAGACGCGCGCA C 50000 . AB=0.972789,0.0272109;ABP=288.419,288.419;AC=3,1;AF=0.75,0.25;AN=4;AO=211,4;CIGAR=24M,1M8D;DP=215;DPRA=0,2.16176;EPP=88.2329,5.18177;EPPR=0;HWE=-6.53213;LEN=1,8;MEANALT=1.5,2;MQM=82.0237,83.5;MQMR=0;NS=2;NUMALT=2;ODDS=10.4104;PAIRED=0.981043,1;PAIREDR=0;REPEAT=CA:11;RO=0;RPP=435.504,3.0103;RPPR=0;RUN=1,1;SAP=92.0201,5.18177;SRP=0;TYPE=del;XAI=0.00989964,0;XAM=0.0224026,0.00710113;XAS=0.012503,0.00710113;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:45.212:147:0:0:143,4:4982,483:-44.6775,-36.9802,-448.728 1/1:50000:68:0:0:68,0:2312,0:0,-20.47,-208.42
15 51675932 . ATTTTTTTTTTTTTTTTGGTTAATGTCCCTGTTTCTGTGTTTTGATGCAGGACCTCCGGG A 50000 . AB=0.833333,0.119048;ABP=43.5445,55.9529;AC=2,2;AF=0.5,0.5;AN=4;AO=35,5;CIGAR=60M,1M2D;DP=42;DPRA=0,0;EPP=70.5741,3.44459;EPPR=0;HWE=4.77121;LEN=1,2;MEANALT=3,3;MQM=61.3714,60;MQMR=0;NS=2;NUMALT=2;ODDS=9.00947;PAIRED=1,1;PAIREDR=0;REPEAT=A:2;RO=0;RPP=70.5741,3.44459;RPPR=0;RUN=1,1;SAP=79.0118,6.91895;SRP=0;TYPE=del;XAI=0.00391933,0;XAM=0.00560576,0.0028169;XAS=0.00168643,0.0028169;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:39.1282:19:0:0:17,1:559,85:-13.775,-10.1633,-56.0539 1/2:50000:23:0:0:18,4:592,302:-33.304,-8.75845,-59.0232
5 60790037 . TTGTGTTTTCGTTTTGAACAATTTTCTAAAGGTCTGTTTTTCCCCATTAGGTGCGGGAGATGTTAAAGATGAGG CTGTGTTTTCGTTTTGAACAATTTTCTAAAGGTCTGTTTTTCCCCATTAGGTGCGGGAGATGTTAAAGATGAGG 50000 . AB=0.519435,0.480565;ABP=3.93874,3.93874;AC=2,2;AF=0.5,0.5;AN=4;AO=147,136;CIGAR=74M,1X;DP=283;DPRA=0,0;EPP=44.5046,19.3602;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.0952,60.0956;MQMR=0;NS=2;NUMALT=2;ODDS=220.359;PAIRED=0.993197,1;PAIREDR=0;REPEAT=T:2|TTG:2;RO=0;RPP=313.59,19.3602;RPPR=0;RUN=1,1;SAP=41.4321,53.0819;SRP=0;TYPE=snp;XAI=0.000415335,0.000604351;XAM=0.00199211,0.00193248;XAS=0.00157678,0.00132813;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:213:0:0:113,100:3600,3663:-330.036,-1.43435,-324.319 1/2:50000:70:0:0:34,36:1068,1330:-120.069,-1.03439,-96.4341
6 32634226 . GAGCCTGTTCCCAGAGTGGCGGCT ATGCCTGTTCCCAGAGTGGCGGCT 50000 . AB=0.5,0.5;ABP=3.0103,3.0103;AC=2,2;AF=0.5,0.5;AN=4;AO=6,6;CIGAR=24M,2X;DP=12;DPRA=0,0;EPP=3.0103,4.45795;EPPR=0;HWE=4.77121;LEN=1,2;MEANALT=2,2;MQM=79,71.3333;MQMR=0;NS=2;NUMALT=2;ODDS=13.712;PAIRED=1,1;PAIREDR=0;REPEAT=GA:2;RO=0;RPP=3.0103,4.45795;RPPR=0;RUN=1,1;SAP=4.45795,4.45795;SRP=0;TYPE=mnp;XAI=0.00347222,0.0143162;XAM=0.0222148,0.0222842;XAS=0.0187426,0.007968;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:116.65:8:0:0:4,4:151,129:-11.9325,-0.563142,-13.9675 1/2:59.3049:4:0:0:2,2:77,64:-6.08,-0.425969,-7.315
15 51675932 . ATTTTTTTTTTTTTTTTGGTTAATGTCCCTGTTTCTGTGTTTTGATGCAGGACCTCCGGGAGCCGGCGGGTTGC A 50000 . AB=0.80597,0.179104;ABP=57.4916,62.9365;AC=2,2;AF=0.5,0.5;AN=4;AO=54,12;CIGAR=74M,1M1D;DP=67;DPRA=0,0;EPP=103.541,14.5915;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2.5,2.5;MQM=60.1852,60;MQMR=0;NS=2;NUMALT=2;ODDS=11.4247;PAIRED=1,1;PAIREDR=0;REPEAT=A:2;RO=0;RPP=111.745,21.1059;RPPR=0;RUN=1,1;SAP=95.6598,21.1059;SRP=0;TYPE=del;XAI=0.002812,0.00141243;XAM=0.00709205,0.00371139;XAS=0.00428005,0.00229896;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:52:0:0:40,11:1330,993:-93.1042,-7.87469,-122.912 1/2:49.6168:15:0:0:14,1:471,80:-8,-3.33936,-42.7264
6 160868701 . GGCCCAGCTGTGT AGCCCAGCTGTGT 50000 . AB=0.5,0.5;ABP=3.0103,3.0103;AC=2,2;AF=0.5,0.5;AN=4;AO=86,86;CIGAR=13M,1X;DP=172;DPRA=0,0;EPP=100.07,20.0791;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=61.1628,60.3256;MQMR=0;NS=2;NUMALT=2;ODDS=172.277;PAIRED=1,0.988372;PAIREDR=0;REPEAT=G:3;RO=0;RPP=156.629,43.4098;RPPR=0;RUN=1,1;SAP=112.998,119.765;SRP=0;TYPE=snp;XAI=0.00898023,0;XAM=0.0145866,0.00158273;XAS=0.00560636,0.00158273;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:116:0:0:63,53:2224,1690:-152.419,-1.31704,-200.513 1/2:50000:56:0:0:23,33:839,1062:-95.9018,-1.35699,-75.8748
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTT GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTT 50000 . AB=0.542553,0.457447;ABP=4.48875,4.48875;AC=2,2;AF=0.5,0.5;AN=4;AO=51,43;CIGAR=57M,1X;DP=94;DPRA=0,0;EPP=105.24,25.2805;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=68.6471,60;MQMR=0;NS=2;NUMALT=2;ODDS=107.206;PAIRED=1,1;PAIREDR=0;REPEAT=T:3;RO=0;RPP=113.755,29.7245;RPPR=0;RUN=1,1;SAP=105.24,87.8997;SRP=0;TYPE=snp;XAI=0.00268601,0.000637146;XAM=0.00374589,0.00224658;XAS=0.00105988,0.00160943;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:61:0:0:34,27:1185,821:-74.1941,-1.16447,-106.999 1/2:50000:33:0:0:17,16:574,520:-47.125,-0.866992,-51.9976
16 70708159 . CATAAGGCTGCTGCACCCCACCCTGACTGATCCTCCTAACGCCCCCTCACCTGGC TATAAGGCTGCTGCACCCCACCCTGACTGATCCTCCTAACGCCCCCTCACCTGGC 50000 . AB=0.357143,0.642857;ABP=7.97367,7.97367;AC=3,1;AF=0.75,0.25;AN=4;AO=35,19;CIGAR=1X,55M;DP=54;DPRA=0,0;EPP=20.9405,44.2683;EPPR=0;HWE=-6.53213;LEN=1,1;MEANALT=2,2;MQM=65.5714,60;MQMR=0;NS=2;NUMALT=2;ODDS=8.77464;PAIRED=1,1;PAIREDR=0;RO=0;RPP=10.5174,44.2683;RPPR=0;RUN=1,1;SAP=41.7866,44.2683;SRP=0;TYPE=snp;XAI=0.00157099,0;XAM=0.00320253,0.00692378;XAS=0.00163154,0.00692378;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/1:38.1084:26:0:0:25,1:749,23:-2.3,-6.41181,-67.7096 1/2:50000:28:0:0:10,18:282,621:-56.235,-1.3108,-25.662
3 116163674 . CACACACACGTGTAGA C 50000 . AB=0.934426,0.0601093;ABP=302.994,310.588;AC=2,2;AF=0.5,0.5;AN=4;AO=171,11;CIGAR=16M,1M8D;DP=183;DPRA=0,0;EPP=67.0243,26.8965;EPPR=0;HWE=4.77121;LEN=1,8;MEANALT=2.5,2.5;MQM=79.6901,76.3636;MQMR=0;NS=2;NUMALT=2;ODDS=75.515;PAIRED=0.982456,0.909091;PAIREDR=0;REPEAT=CA:11;RO=0;RPP=365.697,3.20771;RPPR=0;RUN=1,1;SAP=70.6815,3.20771;SRP=0;TYPE=del;XAI=0.00974759,0;XAM=0.0232181,0.00792613;XAS=0.0134705,0.00792613;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:122:0:0:114,7:3765,789:-74.825,-28.7243,-341.97 1/2:50000:61:0:0:57,4:1960,488:-45.14,-12.6453,-176.744
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA 50000 . AB=0.497238,0.497238;ABP=3.0223,3.0223;AC=2,2;AF=0.5,0.5;AN=4;AO=90,90;CIGAR=74M,1X;DP=181;DPRA=0,0;EPP=114.576,34.2795;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2.5,2.5;MQM=60.1556,61.6;MQMR=0;NS=2;NUMALT=2;ODDS=172.411;PAIRED=0.988889,0.988889;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=181.457,84.1751;RPPR=0;RUN=1,1;SAP=128.087,114.576;SRP=0;TYPE=snp;XAI=0.000975547,0.00352352;XAM=0.00375719,0.00535228;XAS=0.00278164,0.00182876;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:128:0:0:62,65:2003,2136:-195.358,-4.26609,-183.383 1/2:50000:53:0:0:28,25:912,836:-75.5744,-0.998452,-82.4057
8 2967631 . GAATTGTTGATCACAATTACAGATATTTTGACTTGAGAGGTTCTCATACCAAACAGCAATGTAATCGTT CAATTGTTGATCACAATTACAGATATTTTGACTTGAGAGGTTCTCATACCAAACAGCAATGTAATCGTT 50000 . AB=0.519481,0.480519;ABP=3.77173,3.77173;AC=2,2;AF=0.5,0.5;AN=4;AO=120,111;CIGAR=69M,1X;DP=231;DPRA=0,0;EPP=63.8839,26.9747;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,60.7027;MQMR=0;NS=2;NUMALT=2;ODDS=234.564;PAIRED=1,1;PAIREDR=0;RO=0;RPP=34.9309,66.5699;RPPR=0;RUN=1,1;SAP=169.779,157.967;SRP=0;TYPE=snp;XAI=0.000382617,0.000378999;XAM=0.015046,0.0203813;XAS=0.0146633,0.0200023;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:161:0:0:89,72:3091,2467:-222.373,-1.59024,-278.537 1/2:50000:70:0:0:31,39:1138,1367:-123.381,-1.2183,-102.787
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCA GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTTTGTCCGCA 50000 . AB=0.513274,0.486726;ABP=3.18325,3.18325;AC=2,2;AF=0.5,0.5;AN=4;AO=58,55;CIGAR=65M,1X;DP=113;DPRA=0,0;EPP=120.42,46.0055;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.6724,63.3818;MQMR=0;NS=2;NUMALT=2;ODDS=107.005;PAIRED=1,1;PAIREDR=0;REPEAT=T:3;RO=0;RPP=128.956,51.3749;RPPR=0;RUN=1,1;SAP=120.42,113.913;SRP=0;TYPE=snp;XAI=0.000292227,0.000747198;XAM=0.00251536,0.00224187;XAS=0.00222313,0.00149468;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:80:0:0:43,37:1448,1101:-99.3876,-1.14756,-130.657 1/2:50000:33:0:0:15,18:527,520:-47.0889,-0.918145,-47.7813
2 242594622 . CGTGCCACCAGAGGTCAGGGCTGGGGGCGGGTGTGTGTTGCTAATGTGTATCTGTTCCCTGCAGCGCAAATGG TGTGCCACCAGAGGTCAGGGCTGGGGGCGGGTGTGTGTTGCTAATGTGTATCTGTTCCCTGCAGCGCAAATGG 50000 . AB=0.509579,0.490421;ABP=3.2183,3.2183;AC=2,2;AF=0.5,0.5;AN=4;AO=133,128;CIGAR=73M,1X;DP=261;DPRA=0,0;EPP=94.8489,5.45321;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,60.1094;MQMR=0;NS=2;NUMALT=2;ODDS=345.187;PAIRED=1,1;PAIREDR=0;RO=0;RPP=291.816,64.083;RPPR=0;RUN=1,1;SAP=94.8489,81.4547;SRP=0;TYPE=snp;XAI=0.000105899,0.000225392;XAM=0.00149795,0.00106999;XAS=0.00139205,0.000844595;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:148:0:0:72,76:2472,2506:-225.87,-1.20724,-222.823 1/2:50000:113:0:0:61,52:2191,1673:-150.892,-1.28001,-197.549
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA 50000 . AB=0.495238,0.504762;ABP=3.03098,3.03098;AC=2,2;AF=0.5,0.5;AN=4;AO=52,53;CIGAR=1X,74M;DP=105;DPRA=0,0;EPP=16.5402,93.5156;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=61.2115,61.9811;MQMR=0;NS=2;NUMALT=2;ODDS=119.564;PAIRED=1,0.981132;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=45.7716,118.098;RPPR=0;RUN=1,1;SAP=63.3104,93.5156;SRP=0;TYPE=snp;XAI=0.00343595,0.000535934;XAM=0.00474986,0.00104937;XAS=0.00131392,0.000513437;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:68:0:0:36,32:1250,1056:-95.37,-1.06629,-112.847 1/2:50000:37:0:0:16,21:581,671:-60.7095,-1.02834,-52.6531
8 26484064 . TTTCTTATCCCTTA GTTCTTATCCCTTA 50000 . AB=0.526786,0.473214;ABP=3.70827,3.70827;AC=2,2;AF=0.5,0.5;AN=4;AO=59,53;CIGAR=14M,1X;DP=112;DPRA=0,0;EPP=106.394,65.3275;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=62.1525,60;MQMR=0;NS=2;NUMALT=2;ODDS=79.2301;PAIRED=1,1;PAIREDR=0;REPEAT=T:3;RO=0;RPP=131.127,71.8828;RPPR=0;RUN=1,1;SAP=106.394,109.576;SRP=0;TYPE=snp;XAI=0.000235405,0;XAM=0.00253219,0.00101989;XAS=0.00229679,0.00101989;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:69:0:0:29,40:983,1178:-106.315,-1.39595,-88.809 1/2:50000:43:0:0:30,13:1068,402:-36.4892,-2.38108,-96.476
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA 50000 . AB=0.338129,0.661871;ABP=34.6451,34.6451;AC=2,2;AF=0.5,0.5;AN=4;AO=47,92;CIGAR=74M,1X;DP=139;DPRA=0,0;EPP=59.6072,93.7401;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=59.1915,62.75;MQMR=0;NS=2;NUMALT=2;ODDS=70.9087;PAIRED=1,0.98913;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=73.2828,118.665;RPPR=0;RUN=1,1;SAP=73.2828,169.553;SRP=0;TYPE=snp;XAI=0.000725545,0.000958273;XAM=0.00217103,0.00469928;XAS=0.00144549,0.003741;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:105:0:0:36,69:1180,2390:-215.446,-3.37801,-106.528 1/2:50000:34:0:0:11,23:355,813:-73.5235,-1.77851,-32.2727
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA 50000 . AB=0.585586,0.414414;ABP=10.0725,10.0725;AC=2,2;AF=0.5,0.5;AN=4;AO=65,46;CIGAR=74M,1X;DP=111;DPRA=0,0;EPP=111.551,51.3492;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=61.2,59.2174;MQMR=0;NS=2;NUMALT=2;ODDS=107.693;PAIRED=1,1;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=135.604,71.1757;RPPR=0;RUN=1,1;SAP=119.301,78.5398;SRP=0;TYPE=snp;XAI=0.000449401,0.00157742;XAM=0.00130476,0.00498269;XAS=0.000855361,0.00340527;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:76:0:0:49,27:1593,926:-83.683,-2.42394,-143.695 1/2:50000:35:0:0:16,19:523,639:-57.8463,-0.927531,-47.3969
10 71649083 . AGGGGGCAGGGAGGAGCATGAAGGACAGAGGGTGGAACTTCTGGGCTGCGAACAGTGCACCTGGTACTCACCCT GGGGGGCAGGGAGGAGCATGAAGGACAGAGGGTGGAACTTCTGGGCTGCGAACAGTGCACCTGGTACTCACCCT 50000 . AB=0.678363,0.321637;ABP=50.262,50.262;AC=2,2;AF=0.5,0.5;AN=4;AO=116,55;CIGAR=74M,1X;DP=171;DPRA=0,0;EPP=42.621,6.20829;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,60.7091;MQMR=0;NS=2;NUMALT=2;ODDS=155.905;PAIRED=1,1;PAIREDR=0;RO=0;RPP=237.829,122.441;RPPR=0;RUN=1,1;SAP=42.621,6.20829;SRP=0;TYPE=snp;XAI=0,0;XAM=0.00249449,0.00721128;XAS=0.00249449,0.00721128;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:87:0:0:57,30:1847,978:-88.346,-2.89719,-166.554 1/2:50000:84:0:0:59,25:1862,791:-71.5064,-4.0988,-167.896
15 41272371 . TCAGGACTCTAGCCCTGGTTTGGTTGAAGGAAGTCGGAGGGCCCAGATGGTTACCGTCCTCCAGAGGGGTTGGT GCAGGACTCTAGCCCTGGTTTGGTTGAAGGAAGTCGGAGGGCCCAGATGGTTACCGTCCTCCAGAGGGGTTGGT 50000 . AB=0.828947,0.171053;ABP=145.87,145.87;AC=2,2;AF=0.5,0.5;AN=4;AO=126,26;CIGAR=74M,1X;DP=152;DPRA=0,0;EPP=53.2644,43.4331;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,60;MQMR=0;NS=2;NUMALT=2;ODDS=38.5134;PAIRED=1,1;PAIREDR=0;RO=0;RPP=251.179,43.4331;RPPR=0;RUN=1,1;SAP=65.0524,59.4686;SRP=0;TYPE=snp;XAI=0.00116319,0.0127484;XAM=0.0027345,0.0156197;XAS=0.00157132,0.00287124;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:167.608:76:0:0:65,11:1920,292:-26.5455,-10.1203,-173.095 1/2:50000:76:0:0:61,15:1802,407:-36.9013,-7.42486,-162.475
6 32551831 . C A 50000 . AB=0.666667,0.333333;ABP=5.18177,5.18177;AC=3,1;AF=0.75,0.25;AN=4;AO=12,3;CIGAR=1X,1M;DP=15;DPRA=0,1.5;EPP=29.068,9.52472;EPPR=0;HWE=-6.53213;LEN=1,1;MEANALT=1.5,2;MQM=73.1667,52.3333;MQMR=0;NS=2;NUMALT=2;ODDS=3.46574;PAIRED=1,1;PAIREDR=0;REPEAT=CA:20;RO=0;RPP=29.068,9.52472;RPPR=0;RUN=1,1;SAP=29.068,9.52472;SRP=0;TYPE=snp;XAI=0.0353802,0.0133129;XAM=0.0603255,0.0388804;XAS=0.0249454,0.0255675;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:59.4562:9:0:0:6,3:177,106:-9.89333,-0.784991,-16.225 1/1:15.1851:6:0:0:6,0:189,0:0,-1.80618,-17.325
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGT GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGT 50000 . AB=0.4375,0.5625;ABP=7.35324,7.35324;AC=2,2;AF=0.5,0.5;AN=4;AO=56,72;CIGAR=70M,1X;DP=128;DPRA=0,0;EPP=99.951,33.8935;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,58.3889;MQMR=0;NS=2;NUMALT=2;ODDS=148.217;PAIRED=1,1;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=116.082,90.9549;RPPR=0;RUN=1,1;SAP=107.861,78.4086;SRP=0;TYPE=snp;XAI=0,0.00252589;XAM=0.00122405,0.00327664;XAS=0.00122405,0.000750751;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:80:0:0:32,48:1006,1794:-161.834,-1.74175,-90.8544 1/2:50000:48:0:0:24,24:719,838:-75.7692,-0.940942,-65.0096
15 41272371 . TCAGGACTCTAGCCCTGGTTTGGTTGAAGGAAGTCGGAGGGCCCAGATGGTTACCGTCCTCCAGAGGGGTTGGT GCAGGACTCTAGCCCTGGTTTGGTTGAAGGAAGTCGGAGGGCCCAGATGGTTACCGTCCTCCAGAGGGGTTGGT 50000 . AB=0.834286,0.16;ABP=172.869,178.726;AC=2,2;AF=0.5,0.5;AN=4;AO=146,28;CIGAR=74M,1X;DP=175;DPRA=0,0;EPP=75.8885,47.6806;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2.5,2.5;MQM=60.137,60;MQMR=0;NS=2;NUMALT=2;ODDS=44.9424;PAIRED=1,1;PAIREDR=0;RO=0;RPP=286.254,47.6806;RPPR=0;RUN=1,1;SAP=84.4554,63.8115;SRP=0;TYPE=snp;XAI=0.000581415,0.0115443;XAM=0.00201064,0.0148685;XAS=0.00142923,0.00332418;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:99:0:0:85,13:2598,366:-35.2879,-16.0707,-236.195 1/2:50000:76:0:0:61,15:1802,407:-36.9013,-7.42486,-162.475
6 32551831 . CACACTCAGATTCCCAGCTCACGGGGACTCAGGCCCCGCCCGCGGCC AACACTCAGATTCCCAGCTCACGGGGACTCAGGCCCCGCCCGCGGCC 50000 . AB=0.5,0.5;ABP=3.0103,3.0103;AC=3,1;AF=0.75,0.25;AN=4;AO=11,5;CIGAR=1X,47M;DP=16;DPRA=0,1.66667;EPP=12.6832,6.91895;EPPR=0;HWE=-6.53213;LEN=1,1;MEANALT=1.5,2;MQM=72.9091,60.2;MQMR=0;NS=2;NUMALT=2;ODDS=3.46574;PAIRED=1,1;PAIREDR=0;REPEAT=CA:20;RO=0;RPP=12.6832,6.91895;RPPR=0;RUN=1,1;SAP=26.8965,13.8677;SRP=0;TYPE=snp;XAI=0.0341694,0.029926;XAM=0.0637302,0.0495888;XAS=0.0295609,0.0196628;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:116.801:10:0:0:5,5:152,168:-15.456,-0.608899,-13.984 1/1:15.1851:6:0:0:6,0:189,0:0,-1.80618,-17.325
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGT GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGT 50000 . AB=0.407692,0.592308;ABP=12.6316,12.6316;AC=2,2;AF=0.5,0.5;AN=4;AO=53,77;CIGAR=70M,1X;DP=130;DPRA=0,0;EPP=101.382,37.5565;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,59.0649;MQMR=0;NS=2;NUMALT=2;ODDS=148.217;PAIRED=1,1;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=109.576,76.3609;RPPR=0;RUN=1,1;SAP=109.576,107.946;SRP=0;TYPE=snp;XAI=0,0.0036225;XAM=0.00237805,0.0043245;XAS=0.00237805,0.000702001;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:82:0:0:29,53:909,1968:-177.491,-2.5849,-82.1234 1/2:50000:48:0:0:24,24:719,838:-75.7692,-0.940942,-65.0096
16 70708159 . CATAAGGCTGCTGCACCCCACCCTGACTGATCCTCCTAACGCCCCCTCACCTGGCTGGTGATGTCTGAAGGCAT TATAAGGCTGCTGCACCCCACCCTGACTGATCCTCCTAACGCCCCCTCACCTGGCTGGTGATGTCTGAAGGCAT 50000 . AB=0.688889,0.311111;ABP=16.956,16.956;AC=2,2;AF=0.5,0.5;AN=4;AO=31,14;CIGAR=74M,1X;DP=45;DPRA=0,0;EPP=61.9202,3.0103;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60,63.5;MQMR=0;NS=2;NUMALT=2;ODDS=31.6348;PAIRED=1,1;PAIREDR=0;RO=0;RPP=70.3259,8.59409;RPPR=0;RUN=1,1;SAP=61.9202,12.937;SRP=0;TYPE=snp;XAI=0,0.000978474;XAM=0.00349624,0.00303493;XAS=0.00349624,0.00205646;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:32:0:0:24,8:819,229:-20.8963,-2.61101,-74.0513 1/2:137.388:13:0:0:7,6:243,154:-14.1167,-0.678873,-22.2171
8 26484064 . TTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTT GTTCTTATCCCTTATTTGGTTATTTGGTTTATCTATTAAAAGTCCACTTCTCTATTT 50000 . AB=0.516484,0.483516;ABP=3.22506,3.22506;AC=2,2;AF=0.5,0.5;AN=4;AO=47,44;CIGAR=57M,1X;DP=91;DPRA=0,0;EPP=96.5684,60.0608;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=67,60.6818;MQMR=0;NS=2;NUMALT=2;ODDS=81.9436;PAIRED=1,0.977273;PAIREDR=0;REPEAT=T:3;RO=0;RPP=105.07,66.97;RPPR=0;RUN=1,1;SAP=96.5684,74.2741;SRP=0;TYPE=snp;XAI=0.00180323,0.000311333;XAM=0.00266974,0.000618458;XAS=0.000866503,0.000307125;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:60:0:0:30,30:1044,924:-83.468,-0.988945,-94.308 1/2:50000:31:0:0:17,14:596,399:-36.195,-0.908385,-53.9906
7 121943642 . AGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA GGGAAGGAAGGGAGGGAAGGAAAGGATCTCCGTTTTGCATTGTACTTGCCTTTCCACACACTTCGCAAGTGAAA 50000 . AB=0.503597,0.496403;ABP=3.02592,3.02592;AC=2,2;AF=0.5,0.5;AN=4;AO=70,69;CIGAR=74M,1X;DP=139;DPRA=0,0;EPP=114.686,29.4771;EPPR=0;HWE=4.77121;LEN=1,1;MEANALT=2,2;MQM=60.4714,60.5942;MQMR=0;NS=2;NUMALT=2;ODDS=107.783;PAIRED=0.985714,0.985507;PAIREDR=0;REPEAT=A:2|AGGA:4;RO=0;RPP=138.138,55.9124;RPPR=0;RUN=1,1;SAP=130.072,105.258;SRP=0;TYPE=snp;XAI=0.000609773,0.00337232;XAM=0.00315101,0.00498556;XAS=0.00254124,0.00161324;XRI=0;XRM=0;XRS=0;technology.ILLUMINA=1,1;BVAR GT:GQ:DP:RO:QR:AO:QA:GL 1/2:50000:103:0:0:49,54:1593,1919:-173.065,-1.15775,-143.695 1/2:50000:36:0:0:21,15:667,525:-47.6,-1.09139,-60.3476

@kyasuno

This comment has been minimized.

Show comment
Hide comment
@kyasuno

kyasuno Mar 28, 2012

It seems that, in the above examples, REF allele has been regarded as one of the ALT alleles.

kyasuno commented Mar 28, 2012

It seems that, in the above examples, REF allele has been regarded as one of the ALT alleles.

@ekg

This comment has been minimized.

Show comment
Hide comment
@ekg

ekg May 16, 2012

Owner

Does the current freebayes git HEAD still exhibit this issue?

Owner

ekg commented May 16, 2012

Does the current freebayes git HEAD still exhibit this issue?

@kyasuno

This comment has been minimized.

Show comment
Hide comment
@kyasuno

kyasuno May 16, 2012

Dear Erik,

Let me try, thank you for remembering about it!

I have a question regarding --no-filters recommendation.
I have similar experience regarding the mapping quality.
Does the same principle also apply to filtering reads based on the number of mismatches/indel events?
(Is it better to avoid filtering higher number of mismatches and/or indel events for freebayes?)
Thanks again.

Best,
Katsuhito

Katsuhito Yasuno, PhD
Research Scientist
Department of Neurosurgery and Neurobiology
Yale University School of Medicine
1 Gilbert Street TAC S330
New Haven, CT 06510
Phone: (203) 737-1344
Fax: (203) 785-7560
E-mail: katsuhito.yasuno@yale.edu

On May 16, 2012, at 3:39 PM, Erik Garrison wrote:

Does the current freebayes git HEAD still exhibit this issue?


Reply to this email directly or view it on GitHub:
#31 (comment)

kyasuno commented May 16, 2012

Dear Erik,

Let me try, thank you for remembering about it!

I have a question regarding --no-filters recommendation.
I have similar experience regarding the mapping quality.
Does the same principle also apply to filtering reads based on the number of mismatches/indel events?
(Is it better to avoid filtering higher number of mismatches and/or indel events for freebayes?)
Thanks again.

Best,
Katsuhito

Katsuhito Yasuno, PhD
Research Scientist
Department of Neurosurgery and Neurobiology
Yale University School of Medicine
1 Gilbert Street TAC S330
New Haven, CT 06510
Phone: (203) 737-1344
Fax: (203) 785-7560
E-mail: katsuhito.yasuno@yale.edu

On May 16, 2012, at 3:39 PM, Erik Garrison wrote:

Does the current freebayes git HEAD still exhibit this issue?


Reply to this email directly or view it on GitHub:
#31 (comment)

@ekg

This comment has been minimized.

Show comment
Hide comment
@ekg

ekg Aug 16, 2012

Owner

Hi, have you found that the current freebayes version still has this issue?

Owner

ekg commented Aug 16, 2012

Hi, have you found that the current freebayes version still has this issue?

Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment