Permalink
Switch branches/tags
Nothing to show
Find file
Fetching contributors…
Cannot retrieve contributors at this time
1 lines (1 sloc) 139 KB
<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d1 20130915//EN" "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1d1" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="hwp">eLife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">01197</article-id><article-id pub-id-type="doi">10.7554/eLife.01197</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research article</subject></subj-group><subj-group subj-group-type="heading"><subject>Developmental biology and stem cells</subject></subj-group></article-categories><title-group><article-title>Bone morphogenic protein signalling suppresses differentiation of pluripotent cells by maintaining expression of E-Cadherin</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-6460"><name><surname>Malaguti</surname><given-names>Mattias</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-6461"><name><surname>Nistor</surname><given-names>Paul A</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-6462"><name><surname>Blin</surname><given-names>Guillaume</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="other" rid="par-3"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-6463"><name><surname>Pegg</surname><given-names>Amy</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-6464"><name><surname>Zhou</surname><given-names>Xinzhi</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-5996"><name><surname>Lowell</surname><given-names>Sally</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="corresp" rid="cor1">*</xref><xref ref-type="other" rid="par-1"/><xref ref-type="other" rid="par-2"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><institution content-type="dept">MRC Centre for Regenerative Medicine, Institute for Stem Cell Research, School of Biological Sciences</institution>, <institution>University of Edinburgh</institution>, <addr-line><named-content content-type="city">Edinburgh</named-content></addr-line>, <country>United Kingdom</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Miller</surname><given-names>Freda</given-names></name><role>Reviewing editor</role><aff><institution>The Hospital for Sick Children Research Institute, University of Toronto</institution>, <country>Canada</country></aff></contrib></contrib-group><author-notes><corresp id="cor1"><label>*</label>For correspondence: <email>sally.lowell@ed.ac.uk</email></corresp></author-notes><pub-date date-type="pub" publication-format="electronic"><day>17</day><month>12</month><year>2013</year></pub-date><pub-date pub-type="collection"><year>2013</year></pub-date><volume>2</volume><elocation-id>e01197</elocation-id><history><date date-type="received"><day>07</day><month>07</month><year>2013</year></date><date date-type="accepted"><day>29</day><month>10</month><year>2013</year></date></history><permissions><copyright-statement>© 2013, Malaguti et al</copyright-statement><copyright-year>2013</copyright-year><copyright-holder>Malaguti et al</copyright-holder><license xlink:href="http://creativecommons.org/licenses/by/3.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/3.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife01197.pdf"/><related-article ext-link-type="doi" id="ra1" related-article-type="commentary" xlink:href="10.7554/eLife.01839"/><abstract><object-id pub-id-type="doi">10.7554/eLife.01197.001</object-id><p>Bone morphogenic protein (BMP) signalling contributes towards maintenance of pluripotency and favours mesodermal over neural fates upon differentiation, but the mechanisms by which BMP controls differentiation are not well understood. We report that BMP regulates differentiation by blocking downregulation of Cdh1, an event that accompanies the earliest stages of neural and mesodermal differentiation. We find that loss of Cdh1 is a limiting requirement for differentiation of pluripotent cells, and that experimental suppression of Cdh1 activity rescues the BMP-imposed block to differentiation. We further show that BMP acts prior to and independently of Cdh1 to prime pluripotent cells for mesoderm differentiation, thus helping to reinforce the block to neural differentiation. We conclude that differentiation depends not only on exposure to appropriate extrinsic cues but also on morphogenetic events that control receptivity to those differentiation cues, and we explain how a key pluripotency signal, BMP, feeds into this control mechanism.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.001">http://dx.doi.org/10.7554/eLife.01197.001</ext-link></p></abstract><abstract abstract-type="executive-summary"><object-id pub-id-type="doi">10.7554/eLife.01197.002</object-id><title>eLife digest</title><p>The human body is made up of about 200 different types of cell, all of which are descended from a single fertilised egg. As an embryo develops, its cells divide and specialise into distinct lineages. Cells in each lineage go on to form a restricted number of cell types that are required to make a specific tissue. As such, during early development, cells switch from being ‘pluripotent’, with the potential to become the many different cell types, to committing to one particular cell lineage.</p><p>Controlling this process involves a huge number of signalling proteins and pathways. One such protein is bone morphogenetic protein, or BMP for short, which has a number of different roles in embryo development: for example, it stops pluripotent cells turning into nerve tissue, and it also encourages embryonic stem cells to contribute to the ‘mesoderm’ of the early embryo (which goes on to form the muscles, connective tissues and some blood cells). How these two actions are linked, and whether they depend on similar signalling pathways, was unknown.</p><p>BMP is also known to trigger the production of proteins known as ‘Id factors’—which stands for ‘inhibitor of differentiation’. Now, Malaguti et al. have investigated the roles of BMP and Id factors in controlling mouse embryo development and found, somewhat surprisingly, that these proteins needed help from a third protein to stop pluripotent cells turning into nerve tissue. This third protein, which is called E-Cadherin, normally helps cells to adhere to other cells. Malaguti et al. showed that losing this protein encourages cells to become either nerve or mesoderm tissues, and that a drop in E-Cadherin levels must occur before nerve tissue can form.</p><p>Malaguti et al. also showed that encouraging cells to become part of the mesoderm requires BMP to activate another pathway, which does not require E-Cadherin. The two effects of BMP can be uncoupled by adjusting the levels of this protein. At low concentrations, BMP can keep cells pluripotent, but it cannot encourage cells to commit to a mesoderm fate. At higher doses, however, BMP ‘primes’ cells to respond to the signals that trigger their development into mesoderm tissue.</p><p>The findings of Malaguti et al. suggest that manipulating both E-Cadherin and BMP signalling could improve our ability to generate useful cell types, such as neurons, from stem cells grown in laboratory cultures.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.002">http://dx.doi.org/10.7554/eLife.01197.002</ext-link></p></abstract><kwd-group kwd-group-type="author-keywords"><title>Author keywords</title><kwd>BMP</kwd><kwd>Id1</kwd><kwd>Pluripotent stem cells</kwd><kwd>Cdh1</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>Mouse</kwd></kwd-group><funding-group><award-group id="par-1"><funding-source><institution-wrap><institution>Wellcome Trust</institution></institution-wrap></funding-source><award-id>WT082232AIA</award-id><principal-award-recipient><name><surname>Lowell</surname><given-names>Sally</given-names></name></principal-award-recipient></award-group><award-group id="par-2"><funding-source><institution-wrap><institution>Biotechnology and Biological Sciences Research Council</institution></institution-wrap></funding-source><award-id>BB/I006680/1</award-id><principal-award-recipient><name><surname>Lowell</surname><given-names>Sally</given-names></name></principal-award-recipient></award-group><award-group id="par-3"><funding-source><institution-wrap><institution>Wellcome Trust</institution></institution-wrap></funding-source><award-id>WT100133</award-id><principal-award-recipient><name><surname>Blin</surname><given-names>Guillaume</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name><meta-value>2</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>The differentiation decisions made by pluripotent cells depend on their exposure to appropriate extrinsic signals and also on morphogenetic events that control receptivity to those differentiation cues.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>The events that drive the transition from pluripotency to lineage commitment remain poorly understood. It has been known for many years that BMP signalling protects pluripotency and suppresses neural specification (<xref ref-type="bibr" rid="bib46">Ying et al., 2003a</xref>; <xref ref-type="bibr" rid="bib40">Stern, 2006</xref>; <xref ref-type="bibr" rid="bib11">Di-Gregorio et al., 2007</xref>), but the underlying mechanisms remain unclear. BMP signalling is also required for the formation of mesoderm <italic>in vivo</italic> (<xref ref-type="bibr" rid="bib27">Mishina et al., 1995</xref>; <xref ref-type="bibr" rid="bib44">Winnier et al., 1995</xref>; <xref ref-type="bibr" rid="bib22">Lawson et al., 1999</xref>; <xref ref-type="bibr" rid="bib4">Beppu et al., 2000</xref>; <xref ref-type="bibr" rid="bib9">Davis et al., 2004</xref>), and BMP is commonly used to induce mesoderm from embryonic stem (ES) cells (<xref ref-type="bibr" rid="bib29">Murry and Keller, 2008</xref>). However, it is not clear how the effects of BMP on mesoderm differentiation relate to its pro-pluripotency and anti-neural effects: are these separable independent events or do they represent the outcomes of one common mechanism? This question underlines our poor understanding of the mechanisms by which BMP influences neural and mesodermal specification.</p><p>BMP acts through transcriptional upregulation of Inhibitor of Differentiation (Id) factors (<xref ref-type="bibr" rid="bib46">Ying et al., 2003a</xref>; <xref ref-type="bibr" rid="bib49">Zhang et al., 2010</xref>) in order to prevent neural differentiation. Id factors generally act as dominant negative inhibitors of the bHLH family of transcription factors (<xref ref-type="bibr" rid="bib32">Norton, 2000</xref>), but the mechanism by which Id proteins block neural induction is not known. Furthermore, it is not clear to what extent the pro-mesoderm effect of BMP within the epiblast is mediated by Id or by other BMP target genes: redundancy between the four Id family members may mask gastrulation phenotypes in Id mutants.</p><p>We set out to examine more closely the effects of BMP and Id1 on neural and mesoderm differentiation by taking advantage of an ES cell differentiation system, which allows differentiation to be carefully monitored in a well-defined environment (<xref ref-type="bibr" rid="bib47">Ying and Smith, 2003</xref>), and by using a reporter strategy to ask which cells usually express Id1 during early development.</p><p>We find an unanticipated ability of BMP/Id to block differentiation by maintaining the expression of the cell adhesion molecule E-Cadherin (Cdh1). We find that loss of Cdh1 is tightly associated with neural as well as mesodermal differentiation and that this change in Cdh1 is a limiting requirement for neural differentiation. A number of recent reports (<xref ref-type="bibr" rid="bib13">Chou et al., 2008</xref>; <xref ref-type="bibr" rid="bib38">Soncin et al., 2009</xref>; <xref ref-type="bibr" rid="bib23">Li et al., 2010</xref>; <xref ref-type="bibr" rid="bib35">Redmer et al., 2011</xref>; <xref ref-type="bibr" rid="bib10">del Valle et al., 2013</xref>; <xref ref-type="bibr" rid="bib12">Faunes et al., 2013</xref>) suggest that Cdh1 helps protect pluripotency. Despite this emerging appreciation of Cdh1 as a regulator of the pluripotent state, the upstream regulators of Cdh1 in pluripotent cells have not been reported. BMP favours mesenchymal to epithelial transitions in other contexts (<xref ref-type="bibr" rid="bib20">Kondo et al., 2004</xref>; <xref ref-type="bibr" rid="bib56">Samavarchi-Tehrani et al., 2010</xref>), but its ability to control Cdh1 activity during early fate specification has not previously been appreciated.</p><p>We also find that BMP acts through Id1 to impose a proximal posterior identity on epiblast cells, priming them for mesodermal fates whilst transiently restraining them from overt mesoderm differentiation. Id1 may therefore play an early role in anterior-posterior (AP) patterning and mesoderm priming, independent from any effect on overt mesoderm differentiation. This helps to reconcile why BMP is required both for mesoderm differentiation and for the maintenance of pluripotency.</p><p>Taken together, our data help to unify the distinct effects of BMP signalling during differentiation of pluripotent cells. BMP maintains high levels of Cdh1, which help to protect the pluripotent state, whilst imposing a posterior identity that ultimately favours mesodermal over neural differentiation.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>The BMP target gene <italic>Id1</italic> is expressed in the post-implantation pluripotent epiblast</title><p>The BMP target gene <italic>Id1</italic> has been reported to inhibit neural induction and instead favour either pluripotency or mesoderm differentiation from pluripotent cells (<xref ref-type="bibr" rid="bib46">Ying et al., 2003a</xref>; <xref ref-type="bibr" rid="bib49">Zhang et al., 2010</xref>), but the precise events controlled by Id1, and the mechanism by which it acts, are not known. In order to address these questions, we first asked where <italic>Id1</italic> is expressed in the early post-implantation embryo.</p><p>It has been reported (<xref ref-type="bibr" rid="bib17">Jen et al., 1997</xref>) that <italic>Id1</italic> is expressed around the embryonic-anembryonic boundary and around the primitive streak of gastrulating mouse embryos, but it is not clear whether <italic>Id1</italic> is expressed within pluripotent epiblast cells prior to their commitment to neural or mesodermal fate, or whether it is restricted to migrating mesodermal cells and to extraembryonic tissues during gastrulation. We decided to use a reporter strategy to examine the expression pattern of <italic>Id1</italic> and its relationship to markers of pluripotency and differentiation during early development.</p><p>We generated Id1-Venus (Id1V) reporter cells using a targeting construct designed to express a fusion between Id1 and Venus from the endogenous <italic>Id1</italic> locus (<xref ref-type="bibr" rid="bib30">Nam and Benezra, 2009</xref>) (<xref ref-type="fig" rid="fig1">Figure 1A</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A–E</xref>). This strategy has previously been demonstrated to faithfully report Id1 expression (<xref ref-type="bibr" rid="bib30">Nam and Benezra, 2009</xref>). We used Id1V reporter cells to generate high-contribution chimeras in order to analyse and quantify Id1 expression specifically within the epiblast and its derivatives (ES cells do not contribute to extraembryonic ectoderm in chimeras).<fig-group><fig id="fig1" position="float"><object-id pub-id-type="doi">10.7554/eLife.01197.003</object-id><label>Figure 1.</label><caption><title>The BMP target gene <italic>Id1</italic> is expressed in the pluripotent epiblast.</title><p>(<bold>A</bold>) Schematic illustrating the genotype of ES cells used for morula aggregation experiments. The coding sequence for an Id1-Venus fusion protein was targeted into one allele of the <italic>Id1</italic> locus. (<bold>B</bold>) Proximal expression of Id1-Venus in E6.5 embryos generated using Id1-Venus ES cells marked with a constitutively expressed red mKate2-NLS lineage label. Scale bar = 30 μm. (<bold>C</bold>) Transverse section of mid-streak stage embryo (E6.5) stained for DAPI, Id1-Venus, Nanog, T. Anterior (‘A’) and posterior (‘P’) regions of interest are defined based on expression of Nanog. Scale bar = 30 μm. (<bold>D</bold>–<bold>I</bold>) Quantification of antibody staining on sections of embryo shown in <bold>C</bold>. Staining of extraembryonic tissue was used as a negative control to define the gates in the dot plots. (<bold>D</bold>) Dot plots representing expression of Id1-Venus and Nanog in single cells in E6.5 epiblast and in the anterior and posterior regions of interest. (<bold>E</bold>) % Nanog-positive cells within the Id1-Venus-positive compartment in E6.5 epiblast. (<bold>F</bold>) Dot plots representing expression of Id1-Venus and T in single cells in E6.5 epiblast. (<bold>G</bold>) % T-positive cells within the Id1-Venus-positive compartment in E6.5 epiblast. (<bold>H</bold>) Dot plots representing expression of T and Nanog in single cells in E6.5 epiblast. (<bold>I</bold>) % Nanog-positive cells within the T-positive compartment in E6.5 epiblast. See <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref> for design and validation of Id1-Venus cells.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.003">http://dx.doi.org/10.7554/eLife.01197.003</ext-link></p></caption><graphic xlink:href="elife01197f001"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01197.004</object-id><label>Figure 1—figure supplement 1.</label><caption><title>Design and validation of Id1V reporter ES cells.</title><p>(<bold>A</bold>–<bold>D</bold>) Southern blotting strategy and confirmation of successful targeting in clone 47, marked with asterisk (see ‘Materials and methods’ for details). (<bold>E</bold>) Validation by qRT-PCR that <italic>Id1</italic> mRNA is enriched in Venus+ subpopulations of ES cells after separation by FACS. (<bold>F</bold>) E7.5 chimera containing Id1V ES cells labelled with red mKate2-NLS lineage label. Scale bar = 100 μm. (<bold>G</bold>) In situ hybridisation for <italic>Id1</italic> in a wild type E7.5 embryo.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.004">http://dx.doi.org/10.7554/eLife.01197.004</ext-link></p></caption><graphic xlink:href="elife01197fs001"/></fig></fig-group></p><p>We first examined chimeras made with Id1V ES cells that were constitutively labelled with a fluorescent red mKate2-NLS protein, in order to examine the distribution of Id1V in the early post-implantation embryo. The expression pattern of Venus faithfully recapitulates the expression of <italic>Id1</italic> mRNA in these chimeric embryos (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1F,G</xref>). Id1V is readily detectable at E6.5 throughout the proximal epiblast with expression declining more distally (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). The highest levels of Id1V therefore mark regions of the epiblast fated for mesoderm and surface ectoderm but not neural fates (<xref ref-type="bibr" rid="bib7">Cajal et al., 2012</xref>; <xref ref-type="bibr" rid="bib24">Li et al., 2013</xref>).</p><p>We next generated chimeras using a line of Id1V ES cells that lack the red fluorescent lineage label in order to allow us to use antibody staining to quantify expression of both Nanog and T within individual Id1V+ cells at E6.5 (<xref ref-type="fig" rid="fig1">Figure 1C–G</xref>). T was used to identify the posterior-most region of the epiblast and the primitive streak (<xref ref-type="bibr" rid="bib36">Rivera-Pérez and Magnuson, 2005</xref>) and Nanog was used to identify pluripotent cells within the posterior half of the epiblast (<xref ref-type="bibr" rid="bib33">Osorno et al., 2012</xref>). The majority (&gt;65%) of Id1V+ cells in the proximal epiblast co-express Nanog, with this proportion increasing to &gt;80% within the posterior regions of the proximal epiblast (<xref ref-type="fig" rid="fig1">Figure 1D,E</xref>). In contrast, the majority (&gt;80%) of Id1V+ cells do not express T, indicating that they are neither specified nor committed to a mesodermal fate at this stage of development (<xref ref-type="fig" rid="fig1">Figure 1F,G</xref>). These data indicate that Id1V is expressed within pluripotent epiblast and is not restricted to the primitive streak or to differentiating mesoderm.</p><p>We also confirmed that most (&gt;80%) of the T+ cells at this stage co-express Nanog (<xref ref-type="fig" rid="fig1">Figure 1H,I</xref>), confirming that T marks not only differentiating mesoderm but also pluripotent epiblast cells with a proximal posterior positional identity (<xref ref-type="bibr" rid="bib33">Osorno et al., 2012</xref>).</p><p>We conclude that the direct BMP target gene <italic>Id1</italic> is expressed in a subpopulation of Nanog+ epiblast cells prior to overt mesoderm differentiation, in addition to its previously described expression in migrating mesoderm (<xref ref-type="bibr" rid="bib17">Jen et al., 1997</xref>).</p></sec><sec id="s2-2"><title>BMP signalling maintains expression of Cdh1 during differentiation of pluripotent cells</title><p>We next asked what events are regulated by BMP/Id1 during differentiation of pluripotent cells (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). We examined the effect of BMP4 on cells cultured in serum-free conditions in the absence of any other exogenous growth factors. This system allows us to monitor the kinetics as well as the direction of differentiation.<fig id="fig2" position="float"><object-id pub-id-type="doi">10.7554/eLife.01197.005</object-id><label>Figure 2.</label><caption><title>BMP signalling maintains Cdh1 expression during differentiation of pluripotent cells.</title><p>(<bold>A</bold>) BMP blocks neural differentiation, maintains pluripotency and has both positive and negative effects on mesoderm differentiation, but the mechanisms by which BMP acts in each case are not well understood. (<bold>B</bold>) Sox1-GFP ES cells were placed under neural differentiation conditions for 4 days in the presence or absence of 5 ng/ml BMP and stained for markers as shown. Scale bar = 30 μm. (<bold>C</bold>) E14tg2α ES cells were placed under neural differentiation conditions for 4 days in the presence of 5 ng/ml BMP and stained for markers as shown. Scale bar = 30 μm. (<bold>D</bold>) qRT-PCR analysis of ES cells placed under neural differentiation conditions in the presence or absence of 5 ng/ml BMP, or under directed mesoderm differentiation conditions. (<bold>E</bold>) We propose that BMP imposes a posterior positional identity whilst delaying both EMT and overt mesoderm differentiation but permitting surface ectoderm differentiation. qRT-PCR data are represented as mean +/− standard deviation and * indicates p&lt;0.05 relative to no-BMP4 control.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.005">http://dx.doi.org/10.7554/eLife.01197.005</ext-link></p></caption><graphic xlink:href="elife01197f002"/></fig></p><p>We used Sox1-GFP reporter ES cells (<xref ref-type="bibr" rid="bib48">Ying et al., 2003b</xref>) to confirm that BMP4 blocks the upregulation of the early neural marker Sox1 (<xref ref-type="fig" rid="fig2">Figure 2B</xref>) and permits expression of the primitive streak/early mesoderm marker T (<xref ref-type="fig" rid="fig2">Figure 2C,D</xref>), as expected (<xref ref-type="bibr" rid="bib46">Ying et al., 2003a</xref>). However, despite expressing T, BMP-treated cells do not progress to overt mesoderm differentiation. Differentiation of epiblast to mesoderm is characterised by the loss of Oct4 and Cdh1, whereas BMP4-treated cells remain uniformly Cdh1+ at least for the first 5 days of BMP treatment (<xref ref-type="fig" rid="fig2">Figure 2B–D</xref>). Furthermore, in the presence of BMP4, downregulation of <italic>Oct4</italic> is delayed, and markers that characterise EMT and overt mesoderm differentiation are not upregulated within the 5-day time frame of this experiment (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). As a positive control, we checked that these markers were upregulated within 4 days in control cells that were put through a directed mesodermal differentiation protocol based on monolayer culture on collagen IV in the presence of serum (<xref ref-type="bibr" rid="bib31">Nishikawa et al., 1998</xref>) (<xref ref-type="fig" rid="fig2">Figure 2D</xref>).</p><p>T is first expressed in the posterior proximal epiblast prior to overt mesoderm differentiation (<xref ref-type="bibr" rid="bib36">Rivera-Pérez and Magnuson, 2005</xref>) (see also <xref ref-type="fig" rid="fig1">Figure 1H,I</xref>) and marks a mesoderm-primed pluripotent state (<xref ref-type="bibr" rid="bib21">Kubo et al., 2004</xref>; <xref ref-type="bibr" rid="bib5">Bernemann et al., 2011</xref>). We therefore considered whether the ability of BMP4 to upregulate T may represent an effect on positional identity within the epiblast rather than a direct effect to drive mesoderm commitment. In support of this idea, we found that in the presence of BMP4, T is coexpressed with Cdh1 (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). Not all cells persist in a T+ Cdh1+ state: a subpopulation of cells (typically between 10 and 25%) are able to differentiate into a Cdh1+ Tcfap2a (AP2α)+ epithelial cell type similar to early surface ectoderm (<xref ref-type="bibr" rid="bib28">Mitchell et al., 1991</xref>) (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). This is consistent with the recent finding that exogenous BMP4 promotes surface ectoderm differentiation when added to explants from the E7.0 mouse epiblast (<xref ref-type="bibr" rid="bib24">Li et al., 2013</xref>).</p><p>We conclude that BMP4, in the absence of other exogenous signals, imposes a T+ mesoderm-primed posterior positional identity but prevents cells from downregulating Cdh1. BMP-treated cells are delayed in their differentiation and either persist in a Cdh1+ posterior-epiblast like state or ultimately differentiate into Cdh1+ surface-ectoderm-like cells (<xref ref-type="fig" rid="fig2">Figure 2E</xref>).</p></sec><sec id="s2-3"><title>Id1 maintains Cdh1 expression and imposes a mesoderm-primed positional identity</title><p>We next asked whether the BMP target gene <italic>Id1</italic> mediates the effects of BMP to maintain Cdh1 expression during differentiation of pluripotent cells.</p><p>We generated ES cells in which a Flag-tagged <italic>Id1</italic> transgene is expressed in the presence of doxycyline (dox). We first confirmed that dox-mediated induction of <italic>Id1</italic> is able to block neural induction as expected (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). We next tested the effect of Id1 on EMT markers. Under serum-free monolayer conditions in the absence of exogenous growth factors, Id1 delays the loss of <italic>Cdh1</italic> and suppresses the upregulation of EMT markers <italic>Cdh2, Zeb1</italic> and <italic>Zeb2</italic> (<xref ref-type="bibr" rid="bib42">Thiery et al., 2009</xref>) (<xref ref-type="fig" rid="fig3">Figure 3A</xref>).<fig-group><fig id="fig3" position="float"><object-id pub-id-type="doi">10.7554/eLife.01197.006</object-id><label>Figure 3.</label><caption><title>Id1maintains Cdh1 expression and imposes a mesoderm-primed positional identity.</title><p>(<bold>A</bold> and <bold>B</bold>) qRT-PCR analysis of dox-inducible Id1 ES cells placed under neural differentiation conditions (N2B27 alone) in the presence or absence of dox. (<bold>C</bold>) Dox-inducible Id1 ES cells placed under neural differentiation conditions (N2B27 alone) in the presence or absence of dox and stained for markers as shown. Scale bar = 50 μm. (<bold>D</bold>) Dox-inducible Id1 ES cells on day 4 under neural differentiation conditions (N2B27 alone): T is coexpressed with Cdh1 and Oct4. Scale bar = 50 μm. (<bold>E</bold>) Quantification of antibody staining of dox-inducible Id1 ES cells in the presence or absence of dox on day 0 and day 4 under neural differentiation conditions (N2B27 only). A minimum of 750 nuclei were scored for d0 samples and a minimum of 7000 nuclei were scored for d4 samples. (<bold>F</bold>) We propose that the BMP target gene <italic>Id1</italic> imposes a posterior positional identity whilst delaying both EMT and overt mesoderm differentiation. qRT-PCR data are represented as mean +/− standard deviation and * indicates p&lt;0.05 relative to no-dox control. See <xref ref-type="fig" rid="fig3s2">Figure 3—figure supplements 1 and 2</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.006">http://dx.doi.org/10.7554/eLife.01197.006</ext-link></p></caption><graphic xlink:href="elife01197f003"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01197.007</object-id><label>Figure 3—figure supplement 1.</label><caption><title>Characterisation of Id1 overexpressing lines.</title><p>(<bold>A</bold> and <bold>B</bold>) qRT-PCR analysis of dox-inducible Id1 ES cells placed under neural differentiation conditions (N2B27 alone) in the presence or absence of dox. (<bold>C</bold>) Dox-inducible Id1 ES cells placed under neural differentiation conditions for 5 days in the presence or absence of dox and stained for markers as shown. Scale bar = 100 μm. (<bold>D</bold>) Quantification of Flag staining of dox-inducible Id1 ES cells in the presence or absence of dox after 5 days of neural differentiation. A minimum of 2400 nuclei were scored for each condition. Parental E14tg2α ES cells were stained for Flag as a negative control. (<bold>E</bold> and <bold>F</bold>) qRT-PCR analysis of cell lines stably transfected with <italic>loxP</italic> flanked <italic>Id1</italic> transgene (Id1) or after Cre-mediated removal of the <italic>Id1</italic> transgene (Id1 reverted) undergoing neural differentiation in N2B27. (<bold>G</bold>) Antibody staining after 5 days of neural differentiation of cell lines stably transfected with <italic>loxP</italic> flanked <italic>Id1</italic> transgene (Id1) or after Cre-mediated removal of the<italic>Id1</italic> transgene (Id1 reverted). Scale bar = 100 μm. (<bold>H</bold>) Schematic diagram of <italic>loxP</italic> flanked <italic>Id1</italic> transgene ('Id1'). <italic>GFP</italic> becomes expressed after Cre-mediated removal of the <italic>Id1</italic> transgene ('Id1 reverted'). qRT-PCR data are represented as mean +/− standard deviation and * indicates p&lt;0.05 relative to no-dox or Id1-reverted controls.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.007">http://dx.doi.org/10.7554/eLife.01197.007</ext-link></p></caption><graphic xlink:href="elife01197fs002"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01197.008</object-id><label>Figure 3—figure supplement 2.</label><caption><title>Id1 overexpressing cells differentiate preferentially into mesoderm rather than neuroectoderm or endoderm.</title><p>qRT-PCR analysis of cell lines stably transfected with <italic>loxP</italic> flanked <italic>Id1</italic> transgene (Id1) or after Cre-mediated removal of the <italic>Id1</italic> transgene (Id1 reverted) undergoing neural differentiation in N2B27. qRT-PCR data are represented as mean +/− standard deviation and * indicates p&lt;0.05 relative to Id1-reverted controls.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.008">http://dx.doi.org/10.7554/eLife.01197.008</ext-link></p></caption><graphic xlink:href="elife01197fs003"/></fig></fig-group></p><p>We then examined the effect of Id1 on the rate and direction of differentiation. Id1 promotes the upregulation of <italic>T</italic>, a marker of posterior epiblast and primitive streak (<xref ref-type="bibr" rid="bib6">Blum et al., 1992</xref>; <xref ref-type="bibr" rid="bib36">Rivera-Pérez and Magnuson, 2005</xref>), but delays the downregulation of the epiblast markers <italic>Oct4, Fgf5</italic> and <italic>Otx2</italic> (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). These data are consistent with the idea that Id1, like BMP, favours a posterior proximal epiblast identity whilst delaying overt differentiation. In keeping with this idea, Id1 favours the re-expression of <italic>Nanog</italic>, which marks posterior pluripotent epiblast, and Id1 also reduces expression of <italic>Sox2,</italic> which marks anterior pluripotent epiblast (<xref ref-type="bibr" rid="bib33">Osorno et al., 2012</xref>) (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). We confirmed that <italic>Nanog</italic> in this context is likely to be marking a posterior epiblast-like cell rather than an earlier naïve pluripotent state because other markers of naïve pluripotency, <italic>Klf4</italic>, <italic>Rex1</italic> and <italic>Esrrb</italic>, are rapidly lost in Id1 overexpressing cells, as they are in control cells (<xref ref-type="fig" rid="fig3">Figure 3B,C</xref>).</p><p>In further support of the idea that Id1 delays differentiation, we used quantitative immunofluorescence to demonstrate that in the presence of exogenous Id1, T+ cells remain predominantly Cdh1+ and &gt;90% of them coexpress Oct4 (<xref ref-type="fig" rid="fig3">Figure 3D,E</xref>). These T+ cells are therefore unlikely to be differentiated mesoderm cells and are more likely to be equivalent to the T+ cells in the proximal epiblast of the early embryo that have not yet entered the primitive streak (<xref ref-type="bibr" rid="bib36">Rivera-Pérez and Magnuson, 2005</xref>).</p><p>Dox treatment does not entirely block differentiation (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1C</xref>). Neurons begin to emerge in the dox-treated cultures after 5 days. However, these neurons do not express the Flag-tagged Id1 transgenic protein. Indeed, around 50% of cells are negative for Flag on day 5 (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1D</xref>). Therefore, in order to address whether Id1 is sufficient to block differentiation, we turned to a constitutive expression system. We generated clonal lines of ES cells stably overexpressing <italic>Id1</italic> under the control of the ubiquitously expressed (<xref ref-type="bibr" rid="bib54">Niwa et al., 1991</xref>) CAGS promoter. In these cell lines, <italic>loxP</italic> sites flank the coding sequence for <italic>Id1</italic> and upon Cre-mediated excision a downstream <italic>GFP</italic> cassette is expressed. We first confirmed that Id1 is able to block neural induction as expected, and that this phenotype can be reverted by Cre-mediated excision of the <italic>Id1</italic> transgene (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1E–H</xref>). Unlike the dox-inducible system, this constitutive expression system is sufficient to completely block neurogenesis throughout the culture (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1G</xref>).</p><p>Constitutive Id1 expression is sufficient to delay the downregulation of <italic>Oct4</italic> (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>) and to block neurogenesis (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1G</xref>). However, it is not sufficient to completely block differentiation. Id1-overexpressing cells eventually differentiate predominantly into mesoderm rather than neurectoderm or endoderm, even under neural differentiation conditions (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). In this regard, exogenous Id1 does not recapitulate the effect of exogenous BMP4 described in <xref ref-type="fig" rid="fig2">Figure 2</xref>. The ability of Id1-overexpressing cells to generate mesoderm at later time points under these conditions may reflect the progressive downregulation of the <italic>Id1</italic> transgene (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>), or it may reflect an Id1-independent effect of BMP4 on the later stages of differentiation.</p><p>Taken together, these data suggest that the BMP target gene <italic>Id1</italic> does not drive overt mesoderm differentiation but rather maintains Cdh1 and helps to maintain a primed pluripotent state similar to that of the post-implantation epiblast, whilst imposing a proximal posterior (T+ Nanog+) epiblast identity that is primed for mesoderm differentiation.</p></sec><sec id="s2-4"><title>Cdh1 is downregulated in synchrony with Oct4 during neural differentiation</title><p>The data described above reveal an unexpected ability of BMP to maintain Cdh1 expression. We wondered how this may relate to the ability of BMP to block neural induction, given that Cdh1 is downregulated during the early stages of neural tube formation <italic>in vivo</italic> (<xref ref-type="bibr" rid="bib15">Hatta and Takeichi, 1986</xref>; <xref ref-type="bibr" rid="bib1">Aaku-Saraste et al., 1996</xref>; <xref ref-type="bibr" rid="bib18">Karpowicz et al., 2007</xref>) and during neural differentiation of ES cells (<xref ref-type="bibr" rid="bib41">Sterneckert et al., 2010</xref>; <xref ref-type="bibr" rid="bib19">Kamiya et al., 2011</xref>).</p><p>We first asked whether the loss of Cdh1 occurs subsequently to neural differentiation or whether it is tightly associated with the differentiation process itself. Since the rate of neural differentiation varies considerably between individual cells, it was important to perform this analysis at the single cell level. We therefore performed single cell quantitative RT-PCR in order to monitor the transcriptional downregulation of <italic>Cdh1</italic>, as cells proceed from pluripotency towards neural differentiation. We confirmed that <italic>Cdh1</italic> is largely absent from cells that have upregulated early neural markers (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). Strikingly, we also observed a close correlation between the expression of <italic>Cdh1</italic> and <italic>Oct4</italic> at all stages of the differentiation process (<xref ref-type="fig" rid="fig4">Figure 4B</xref>), consistent with the idea that <italic>Cdh1</italic> is downregulated at precisely the time that cells transit from Oct4+ epiblast towards neurectodermal differentiation. We confirmed a similar correlation between loss of Oct4 and downregulation of Cdh1 in vivo: Cdh1 and Oct4 protein expression decline in synchrony within the developing neuroepithelium (<xref ref-type="fig" rid="fig4">Figure 4C,D</xref>).<fig id="fig4" position="float"><object-id pub-id-type="doi">10.7554/eLife.01197.009</object-id><label>Figure 4.</label><caption><title>Cdh1 is downregulated in synchrony with Oct4 during neural differentiation.</title><p>(<bold>A</bold> and <bold>B</bold>) ES cells were placed under neural differentiation conditions. 40–80 single cells were analysed by qRT-PCR from the starting population (Day 0) or at daily time points during differentiation. A shows expression levels of <italic>Cdh1</italic>, <italic>Cdh2</italic>, <italic>Oct4</italic> and <italic>Sox1</italic> in single cells analysed at day 3 of differentiation. The expression values for each factor are normalised to the maximum expression level found in this set of cells. The samples are sorted in ascending order of <italic>Cdh1</italic> expression. B shows the Spearman’s rank correlation coefficients (ρ) between the named genes and <italic>Cdh1</italic> at each time point. * indicates asymptotic p value &lt;0.05. (<bold>C</bold>) Oct4 and Cdh1 staining in 7 µm sections of embryos at E7.5 (late streak stage) or staged according to number of somite pairs (s) as indicated. Top row shows bright field images of embryos before sectioning with a white line indicating the location of the section shown in the bottom row. Scale bars = 100 μm. NT: Neural tube (Yellow region in later stage embryos), SE: Surface ectoderm (red region in later embryos). (<bold>D</bold>) Quantification of the average intensities of Oct4 and Cdh1 in different structures of the embryo at each stage. EPI: Epiblast (yellow region and red region in LS embryo), Error bars represent the standard deviation of intensities in three different sections. Abbreviations are as described for <bold>C</bold>. (<bold>E</bold>) Sox1-GFP ES cells after 4 days in neural differentiation conditions stained for Cdh1 (red) and DAPI (blue) with Sox1-GFP in green. Scale bar = 30 μm. (<bold>F</bold>) E14tg2α ES cells after 4 days under neural differentiation conditions stained for Cdh1 (red) Keratin8 (blue) and Oct4 (green).Scale bar = 30 μm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.009">http://dx.doi.org/10.7554/eLife.01197.009</ext-link></p></caption><graphic xlink:href="elife01197f004"/></fig></p><p>We confirmed these results using Sox1-GFP neural reporter ES cells (<xref ref-type="bibr" rid="bib48">Ying et al., 2003b</xref>) to monitor early neural differentiation under uniform monolayer differentiation conditions. Under these conditions, around 20–40% of cells fail to become Sox1-GFP+ after 4 days; around half of these persist as undifferentiated ES cells whilst the other half differentiate into non-neural (Sox1-negative) cell types (<xref ref-type="bibr" rid="bib47">Ying and Smith, 2003</xref>; <xref ref-type="bibr" rid="bib25">Lowell et al., 2006</xref>). The reasons for this heterogeneity in differentiation capacity are not fully understood. We observed that the subpopulation of cells that fail to respond appropriately to a neural environment by upregulating Sox1-GFP also fail to downregulate Cdh1, either remaining as Oct4+ Cdh1+ undifferentiated cells or differentiating into Cdh1+ Krt8+ epithelial cells (<xref ref-type="fig" rid="fig4">Figure 4E,F</xref>).</p><p>We conclude that Cdh1 is downregulated in synchrony with Oct4 during neural differentiation, and that heterogeneity in neural differentiation capacity within populations of ES cells is associated with a failure to downregulate Cdh1 in a subpopulation of those cells.</p></sec><sec id="s2-5"><title>Downregulation of Cdh1 is a limiting requirement for neural differentiation</title><p>The data above confirm that the earliest stages of neural differentiation are accompanied by the downregulation of Cdh1. We next asked whether this is simply a passive accompaniment to neural differentiation, or whether it is a limiting requirement, playing an active role in allowing cells to progress towards neural differentiation.</p><p>Having confirmed that a subpopulation of cells fail to downregulate Cdh1 under neural differentiation conditions, and that these cells also fail to differentiate into neural cells (<xref ref-type="fig" rid="fig4">Figure 4E,F</xref>), we next asked whether it is possible to rescue neural differentiation in this recalcitrant subpopulation by experimentally suppressing Cdh1 activity.</p><p>We used function blocking antibodies (<xref ref-type="bibr" rid="bib58">Yoshida-Noro et al., 1984</xref>) in order to abolish the adhesive abilities of Cdh1. Blocking antibodies were added to Sox1-GFP reporter cells for the first 48 hr of neural differentiation and then removed, whereupon the cells rapidly regain normal cell-cell contacts. 1 day later, a minority of control cells are just starting to express Sox1-GFP, whereas the antibody-treated cells show strong Sox1-GFP expression throughout the culture. By the fourth day of differentiation, the antibody-treated cultures are almost uniformly Sox1-GFP+ (<xref ref-type="fig" rid="fig5">Figure 5A,B</xref>). Flattened non-neural differentiated cells are readily apparent in control cultures, but these are absent from antibody-treated cultures (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). qRT-PCR analysis confirmed that early transient exposure to the blocking antibody accelerates the loss of the pluripotency marker <italic>Oct4</italic> and the gain of the neural marker <italic>Sox1</italic> (<xref ref-type="fig" rid="fig5">Figure 5C</xref>)<italic>.</italic> This indicates that transient loss of Cdh1 activity at the very start of the differentiation process is sufficient to drive ES cells efficiently towards neural differentiation.<fig-group><fig id="fig5" position="float"><object-id pub-id-type="doi">10.7554/eLife.01197.010</object-id><label>Figure 5.</label><caption><title>Loss of Cdh1 activity is a limiting requirement for neural differentiation.</title><p>(<bold>A</bold>–<bold>C</bold>) FACS (<bold>A</bold> and <bold>B</bold>) and qRT-PCR (<bold>C</bold>) analysis of Sox1-GFP ES cells undergoing neural differentiation after exposure to Cdh1 blocking antibody ECCD1 for the first 48 hr of differentiation. Control indicates sister dishes not exposed to ECCD1. (<bold>D</bold>) qRT-PCR analysis of <italic>Cdh1</italic> null or parental D3 ES cells undergoing neural differentiation. (<bold>E</bold> and <bold>F</bold>) Dox-inducible TwistE cells during neural differentiation in the presence or absence of dox. Scale bar = 30 μm. (<bold>F</bold>) shows neurite frequency scored from the experiment illustrated in <bold>E</bold>. Neurites were scored as described in ‘Materials and methods’. (<bold>G</bold>) qRT-PCR analysis of dox-inducible TwistE cells placed under neural differentiation conditions in the presence or absence of dox. (<bold>H</bold>) qRT-PCR analysis of dox-inducible TwistE cells on day 2 of neural differentiation in the absence of dox, the presence of dox throughout the experiment, or after removing dox 24 hr after initiating neural differentiation. qRT-PCR data are represented as mean +/− standard deviation and * indicates p&lt;0.05 relative to no-antibody control, parental control, or no-dox controls. See also <xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.010">http://dx.doi.org/10.7554/eLife.01197.010</ext-link></p></caption><graphic xlink:href="elife01197f005"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01197.011</object-id><label>Figure 5—figure supplement 1.</label><caption><title>Design and validation of TwE cell lines.</title><p>(<bold>A</bold> and <bold>B</bold>) ES cells 5 days after episomal transduction (CAGS promoter) with empty vector, monomeric Twist1, or Twist1-E47 tethered dimers. Cells are stained for DAPI and Vimentin (<bold>A</bold>) or analysed by qRT-PCR for EMT markers (<bold>B</bold>). (<bold>C</bold>) Stable ES cell line TwistE ('TwE') expressing a dox-inducible Twist1-E47 tethered dimer or control parental cell line. Twist1 is upregulated approximately 25-fold when dox is added to ES cells for 48 hr under normal ES cell culture conditions. (<bold>D</bold>) The Flag-tagged Twist1-E47 fusion protein is induced within 12 hr of adding dox and is lost within 24 hr of removing dox from dox-inducible TwistE cells.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.011">http://dx.doi.org/10.7554/eLife.01197.011</ext-link></p></caption><graphic xlink:href="elife01197fs004"/></fig></fig-group></p><p>As an alternative loss-of-function approach, we made use of C<italic>dh1</italic> null ES cells (<xref ref-type="bibr" rid="bib53">Larue et al., 1996</xref>). These cells do not form adherens junctions but do self-renew and retain multilineage differentiation potency. <italic>Cdh1</italic> null ES cells differentiate into neural cells more rapidly and efficiently in comparison with parental controls (<xref ref-type="fig" rid="fig5">Figure 5D</xref>).</p><p>We sought to confirm these data using an alternative robust and regulatable system for suppressing Cdh1 activity. The transcription factor Twist1 is able to downregulate Cdh1 when bound to its heterodimerisation partner E47 (<xref ref-type="bibr" rid="bib42">Thiery et al., 2009</xref>). We engineered a construct designed to express Twist1 tethered by a flexible linker to E47: we refer to this heterodimeric fusion protein as TwistE. We confirmed that TwistE efficiently downregulates <italic>Cdh1</italic> when expressed in ES cells by episomal transfection (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1A,B</xref>). We next generated ES cells lines that allowed dox-inducible expression of TwistE (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1C,D</xref>) and made use of these dox inducible TwistE cell lines to suppress Cdh1 expression during neural differentiation.</p><p>We reasoned that if downregulation of Cdh1 is a limiting requirement for neural induction, activation of TwistE should be able to enhance the efficiency of this process. This is indeed the case: activation of TwistE has a striking ability to accelerate neural differentiation. Cells that are treated with dox generate extensive networks of neurons after only 3 days of exposure to neural conditions, whilst untreated control sister dishes do not start to generate significant numbers of neurons until day 5 (<xref ref-type="fig" rid="fig5">Figure 5E,F</xref>). Neural markers <italic>Sox1, Zfp521, Zeb2, Blbp, Sox9, Mash1 and Math1</italic>are upregulated prematurely and <italic>Oct4</italic> is lost more quickly in dox-treated cultures (<xref ref-type="fig" rid="fig5">Figure 5G</xref>). Activating TwistE only for the first day of differentiation is sufficient to accelerate the early neural programme (<xref ref-type="fig" rid="fig5">Figure 5H</xref>), indicating that Cdh1 activity is normally a limiting factor at an early stage in the differentiation process.</p><p>Taken together, these observations suggest that downregulation of Cdh1 is a limiting requirement for pluripotent cells to differentiate into neural cells.</p></sec><sec id="s2-6"><title>Suppression of Cdh1 rescues the BMP-imposed block to differentiation</title><p>The data reported above indicate that BMP/Id can maintain Cdh1, and that downregulation of Cdh1 is a limiting event during differentiation of ES cells. These findings raise the possibility that the mechanism by which BMP blocks differentiation could be through maintenance of Cdh1. In order to test this directly, we asked whether suppression of Cdh1 is sufficient to rescue the differentiation block imposed by BMP4.</p><p>1 ng/ml of BMP4 is sufficient to almost entirely inhibit neural induction and to maintain <italic>Cdh1</italic> expression (<xref ref-type="fig" rid="fig6">Figure 6A</xref>), as expected. Strikingly, suppression of Cdh1 via dox-induction of TwistE is sufficient to rescue neural differentiation in the presence of 1 ng/ml BMP. Tuj1+ neurons can be readily found in dox-treated cultures but are only rarely found in control sister dishes (<xref ref-type="fig" rid="fig6">Figure 6A</xref>), and dox treatment rescues the expression of early neural markers <italic>Mash1, Zfp521, Sox9</italic> and <italic>Pax3</italic> to levels similar to those observed in the absence of exogenous BMP (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). <italic>Sox1</italic> is downregulated before day 4, in keeping with the ability of TwistE to accelerate the early stages of the differentiation process (<xref ref-type="fig" rid="fig5">Figure 5G,H</xref> and data not shown). TwistE also abolishes the ability of BMP4 to sustain the expression of epiblast markers <italic>Oct4, Cdh1, Fgf5</italic> and <italic>T</italic> (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). We conclude that under these conditions BMP acts primarily through Cdh1 to maintain the expression of epiblast markers and block the expression of neural markers.<fig id="fig6" position="float"><object-id pub-id-type="doi">10.7554/eLife.01197.012</object-id><label>Figure 6.</label><caption><title>Suppression of Cdh1 rescues the BMP-imposed delay to differentiation.</title><p>(<bold>A</bold>) Antibody staining for the indicated markers in dox-inducible TwistE cells after 4 days under neural differentiation conditions in the presence of 1 ng/ml BMP4. Scale bar = 30 μm. (<bold>B</bold>) qRT-PCR analysis of dox-inducible TwistE cells after 4 days under neural differentiation conditions in the presence or absence of 1 ng/ml BMP4. (<bold>C</bold>) Antibody staining for the indicated markers in dox-inducible TwistE cells after 4 days under neural differentiation conditions in the presence of 5 ng/ml BMP4. (<bold>D</bold>) qRT-PCR analysis of dox-inducible TwistE cells under neural differentiation conditions in the presence or absence of 5 ng/ml BMP4. (<bold>E</bold>) MODEL: we propose that BMP controls differentiation of pluripotent cells by suppressing the downregulation of Cdh1. qRT-PCR data are represented as mean +/− standard deviation and * indicates p&lt;0.05 relative to control samples treated with BMP but not treated with dox.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.012">http://dx.doi.org/10.7554/eLife.01197.012</ext-link></p></caption><graphic xlink:href="elife01197f006"/></fig></p><p>We noticed that the dox-treated cultures, in addition to containing abundant neurons (<xref ref-type="fig" rid="fig6">Figure 6A</xref>), also contain many Tuj1-negative cells that do not have a neural morphology (data not shown). This suggests that TwistE does not exclusively drive neural differentiation in this context but may be rescuing a more general delay to differentiation into multiple lineages. We speculated that BMP might have two independent effects: one to block multilineage differentiation by maintaining Cdh1 and another to influence the direction of differentiation independently of Cdh1.</p><p>In order to test this idea, we increased the dose of BMP to 5 ng/ml, with the aim of imposing a posterior positional identity that favours mesodermal and endodermal rather than neural fates (<xref ref-type="fig" rid="fig2">Figure 2</xref>). Under these conditions, activation of TwistE eliminates Cdh1 expression from the majority of cells and upregulates the mesenchymal and neural marker Vimentin (<xref ref-type="fig" rid="fig6">Figure 6C</xref>), but we did not observe any Tuj1+ neurons either in the presence or the absence of dox treatment (data not shown). We next confirmed that 5 ng/ml BMP4 upregulates posterior epiblast markers whilst delaying overt differentiation into mesoderm and endoderm (<xref ref-type="fig" rid="fig6">Figure 6D</xref>, black bars), as expected. Under these conditions, suppression of Cdh1 via dox-induction of TwE efficiently rescues mesoderm and endoderm differentiation, but not neural differentiation (<xref ref-type="fig" rid="fig6">Figure 6D</xref>).</p><p>We conclude that part of the mechanism by which BMP helps to maintain pluripotency is through maintenance of Cdh1, which interferes with efficient neural and mesodermal differentiation. Higher levels of BMP also impose a posterior identity that primes cells for mesoderm and is incompatible with a neural fate. Taken together, these findings help to explain why BMP can at the same time protect pluripotency and promote mesoderm differentiation.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Changes in the expression of the cell-cell adhesion molecule E-Cadherin (Cdh1) are often associated with changes in cell identity throughout development and into adult life (<xref ref-type="bibr" rid="bib42">Thiery et al., 2009</xref>). For example, downregulation of Cdh1 is associated with the epithelial-mesenchymal transition (EMT) that accompanies the formation of mesoderm at the primitive streak and the emergence of neural crest cells from the dorsal neural tube (<xref ref-type="bibr" rid="bib42">Thiery et al., 2009</xref>). The formation of the early neural plate from the epiblast does not bear all the hallmarks of a classical EMT, but it is accompanied by loss of Cdh1 and gain of N-Cadherin (Cdh2) and Vimentin (<xref ref-type="bibr" rid="bib15">Hatta and Takeichi, 1986</xref>; <xref ref-type="bibr" rid="bib1">Aaku-Saraste et al., 1996</xref>). There is already evidence that EMT is required for overt mesoderm differentiation (<xref ref-type="bibr" rid="bib26">Martínez-Estrada et al., 2010</xref>), and we find here that downregulation of Cdh1 is similarly a limiting event for neural differentiation.</p><p>Although it is well established that BMP signalling contributes to the maintenance of pluripotency (<xref ref-type="bibr" rid="bib46">Ying et al., 2003a</xref>; <xref ref-type="bibr" rid="bib11">Di-Gregorio et al., 2007</xref>), the underlying mechanisms remain unclear. We propose that BMP suppresses differentiation by maintaining expression of Cdh1. We support this idea by showing that suppressing Cdh1 is sufficient to rescue the BMP-imposed block to multilineage differentiation.</p><p>It is also unclear how BMP signalling favours mesodermal over neural fates. We find that the BMP target gene <italic>Id1</italic> imposes a proximal posterior identity on undifferentiated cells, priming them towards mesoderm. The ability of Id1 to block neural differentiation is therefore unlikely to be explained entirely by inhibition of a neural-inducing transcription factor as is commonly assumed, nor by a direct activation of mesoderm differentiation, but rather to a shift in the positional identity of pluripotent cells that occurs in the absence of overt differentiation. This may explain why, to our knowledge, no Id-regulated pro-neural bHLH transcription factor has been found that explains the ability of Id1 to influence neural induction.</p><p><italic>Id1</italic> null ES cells have a defect in the maintenance of pluripotency (<xref ref-type="bibr" rid="bib37">Romero-Lanman et al., 2011</xref>), consistent with our finding that Id1 delays exit from an epiblast-like state. We note, though, that the <italic>Id1</italic> null phenotype is also likely to reflect an earlier pre-implantation role for Id1: to suppress the activity of Tcf15 (<xref ref-type="bibr" rid="bib8">Davies et al., 2013</xref>). The consequence of this would be to maintain expression of Nanog and suppress the transition to a T+ epiblast-like state (<xref ref-type="bibr" rid="bib8">Davies et al., 2013</xref>), in keeping with the <italic>Id1</italic> null ES cell phenotype (<xref ref-type="bibr" rid="bib37">Romero-Lanman et al., 2011</xref>).</p><p>The two effects of BMP, to maintain Cdh1 and to impose a posterior identity, can be uncoupled by varying the dose of BMP. Lower doses of BMP are sufficient to maintain Cdh1 and to suppress neural fate, but insufficient to impose a stable posterior identity. Strikingly, suppressing Cdh1 at these lower doses of BMP is sufficient to rescue neural differentiation, indicating that the primary mechanism by which BMP inhibits neural differentiation in this context is through its ability to control Cadherin activity. This is an unexpected finding that highlights the importance of cell adhesion and tissue organisation in controlling receptivity of cells to differentiation cues (<xref ref-type="bibr" rid="bib39">Stepniak et al., 2009</xref>; <xref ref-type="bibr" rid="bib12">Faunes et al., 2013</xref>).</p><p>There is a growing body of evidence that Cdh1 influences growth factor receptiveness of ES cells, and that it can consequently stabilise particular pluripotent states (<xref ref-type="bibr" rid="bib13">Chou et al., 2008</xref>; <xref ref-type="bibr" rid="bib38">Soncin et al., 2009</xref>; <xref ref-type="bibr" rid="bib23">Li et al., 2010</xref>; <xref ref-type="bibr" rid="bib35">Redmer et al., 2011</xref>; <xref ref-type="bibr" rid="bib16">Hawkins et al., 2012</xref>; <xref ref-type="bibr" rid="bib10">del Valle et al., 2013</xref>; <xref ref-type="bibr" rid="bib12">Faunes et al., 2013</xref>), but it is not known what controls Cdh1 expression in this context. We fill this gap with our finding that BMP/Id maintains Cdh1 expression during differentiation of ES cells. Interestingly, <italic>Id1</italic> is excluded from the anterior streak in vivo (<xref ref-type="bibr" rid="bib17">Jen et al., 1997</xref>), so it is possible that it plays a more general role in regulating EMT in the early embryo.</p><p>In vivo, the BMP signals that are generated from the extraembryonic ectoderm not only block neural induction but are also required for formation of mesoderm (<xref ref-type="bibr" rid="bib27">Mishina et al., 1995</xref>; <xref ref-type="bibr" rid="bib44">Winnier et al., 1995</xref>; <xref ref-type="bibr" rid="bib22">Lawson et al., 1999</xref>; <xref ref-type="bibr" rid="bib4">Beppu et al., 2000</xref>; <xref ref-type="bibr" rid="bib9">Davis et al., 2004</xref>). However, BMP signalling is also necessary for maintenance of pluripotency (<xref ref-type="bibr" rid="bib11">Di-Gregorio et al., 2007</xref>), and mouse embryos in which BMP has been experimentally overactivated have an impairment in mesoderm differentiation that cannot easily be explained by models in which BMP drives mesoderm differentiation (<xref ref-type="bibr" rid="bib2">Aoyama et al., 2012</xref>). Our findings unite these observations by showing how BMP can prime cells for mesoderm fate by imposing a posterior identity, but restrain them from undergoing overt mesoderm formation by suppressing EMT.</p><p>In frogs, antagonism of BMP by the organiser induces anterior-posterior axis formation. It has been proposed (<xref ref-type="bibr" rid="bib51">Constance Lane et al., 2004</xref>) that BMP antagonism acts by stimulating mediolateral intercalation of caudal progenitors, releasing them to participate in the formation of the axis, and that the normal role of BMP is to preserve a reservoir of progenitors throughout axis elongation. We propose that BMP acts by a similar mechanism during differentiation of pluripotent mouse cells, preserving a population of undifferentiated cells by preventing the loss of Cdh1. The mechanism by which BMP signalling controls EMT will be an interesting area for future study. This may be connected with BMP’s ability to antagonise Nodal signalling, given that Nodal is required for the initiation of EMT at the primitive streak (<xref ref-type="bibr" rid="bib3">Arnold and Robertson, 2009</xref>; <xref ref-type="bibr" rid="bib45">Yan et al., 2009</xref>).</p><p>Our work also has implications for controlling uniform differentiation of mouse ES cells. It has been known for some time that a subpopulation of ES cells tends to resist neural differentiation, but the reasons for this are not clear. We propose that this subpopulation of cells fail to respond appropriately to a neural-inducing environment because they are unable to downregulate Cdh1. We demonstrate this directly by showing that experimental suppression of Cdh1 activity can rescue neural differentiation capacity in this recalcitrant subpopulation resulting in a more homogenous differentiation response. Importantly, this can be achieved by non-genetic means, such as function-blocking E-Cadherin antibodies, providing a convenient and readily applicable means to improve our control over pluripotent cells.</p><p>In summary, we have identified the loss of Cdh1 activity as a limiting event for the earliest stages of neural differentiation and we propose that BMP controls differentiation in part by maintaining Cdh1 expression. The strategy of coupling changes in cell adhesion to transcriptional control of cell fate specification is used several times during development as a way of coordinating tissue morphogenesis (<xref ref-type="bibr" rid="bib34">Owens et al., 2000</xref>; <xref ref-type="bibr" rid="bib26">Martínez-Estrada et al., 2010</xref>; <xref ref-type="bibr" rid="bib43">Watt and Fujiwara, 2011</xref>), and it will be interesting to investigate the implications of our findings for germ-layer formation in the early embryo.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Mouse ES cell culture</title><p>ES cells were maintained in GMEM supplemented with 2-mercaptoethanol, non-essential amino acids, glutamine, pyruvate, 10% foetal calf serum (FCS) and 100 units/ml LIF on gelatinised tissue culture flasks (<xref ref-type="bibr" rid="bib57">Smith, 1991</xref>).</p></sec><sec id="s4-2"><title>Cell lines</title><p>To generate dox-inducible <italic>Id1</italic>-overexpressing ES cells, E14tg2α ES cells were transfected with a plasmid containing a CAGS promoter driving expression of the reverse tetracycline-controlled transactivator (rtTA), followed by an IRES and a Blasticidin S resistance gene. The cells were cultured in the presence of 20 µg/ml Blasticidin S for two passages. The DNA sequence corresponding to N-terminally 3 × Flag-tagged mouse <italic>Id1-001</italic> was generated by overlapping extension PCR. This sequence was subcloned downstream of a tet-responsive promoter in a plasmid containing a <italic>Pgk</italic> promoter driving expression of a Hygromycin B resistance gene. This construct was transfected into the E14tg2α ES cells under Blasticidin S selection. The cells were subject to dual selection in 20 µg/ml Blasticidin S and in 200 µg/ml Hygromycin B prior to clone isolation and expansion.</p><p>To generate <italic>Id1-</italic>overexpressing ES cells, E14tg2α ES cells were transfected with a previously described <italic>Id1</italic>-overexexpression plasmid (<xref ref-type="bibr" rid="bib46">Ying et al., 2003a</xref>), containing a CAGS promoter driving the expression of <italic>Id1</italic> cDNA, followed by an IRES, a Puromycin resistance gene (<italic>Pac</italic>) and a polyadenylation signal sequence (pA). <italic>Id1-IRES</italic>-<italic>Pac-pA</italic>are flanked by <italic>loxP</italic> sites. Downstream of the second <italic>loxP</italic> site there is a <italic>GFP</italic> transgene, not expressed in <italic>Id1</italic>-overexpressing cells but activated after Cre-mediated excision of <italic>Id1</italic>-<italic>IRES</italic>-<italic>Pac-pA</italic>. Revertant cells were obtained by transfecting <italic>Id1-</italic>overexpressing cells with a circular plasmid encoding Cre recombinase and screening for expression of GFP.</p><p>To generate Id1-Venus reporter lines, E14tg2α cells were electroporated with a targeting construct provided by H-S Song and R Benezra (Sloan-Kettering Memorial Cancer Centre, NY, USA) designed to express a fusion between Id1 and Venus from the endogenous <italic>Id1</italic> locus. This construct is described in detail in <xref ref-type="bibr" rid="bib30">Nam and Benezra (2009)</xref>. Correct targeting was determined by Southern blotting following the strategy described in <xref ref-type="bibr" rid="bib30">Nam and Benezra (2009)</xref>.</p><p>To generate a fluorescent lineage label, the sequence encoding the mKate2 red fluorescent protein was fused at its 3′ end prior to its stop codon with three repeats of the SV40 nuclear localisation signal sequence (NLS). This sequence was subcloned downstream of a CAGS promoter and followed by an IRES and <italic>Pac</italic>. This construct was transfected into the Id1-Venus reporter cells and clones were isolated following Puromycin selection.</p><p>Chimeric embryos were generated by morula aggregation.</p><p>To generate dox-inducible <italic>Twist1-E47</italic> ES cell lines: the DNA sequence encoding an N-terminally Flag-tagged mouse Twist1 tethered at its C-terminus to the N-terminus of mouse E47 through a 13 amino acid flexible linker of sequence TGSTGSKTGSTGS was generated by overlapping extension PCR. This sequence was placed under a tet-responsive promoter and transfected into the E14tg2A_AW2 cell line, which contains the coding sequence for the reverse tetracycline-controlled transactivator (<italic>rtTA</italic>) integrated into the <italic>Rosa26</italic>locus and expressed from the <italic>Rosa26</italic> promoter. The E14tg2A_AW2 cell line is described in more detail elsewhere (<xref ref-type="bibr" rid="bib50">Zhou et al., 2013</xref>). Cells were plated at clonal density and clones expanded in ES cell culture conditions under Hygromycin B selection. The expression of Flag-Twist1-E47 was tested in a number of clones through qRT-PCR analysis (using primers within <italic>Twist1</italic>) and western blot analysis (probed by anti-Flag antibody) over a 5-day time course of treatment in the presence or absence of doxycycline (dox). A dox-inducible Twist1-E47 cell line was selected that had negligible leakiness of Twist1-E47 in the absence of dox, and moderate overexpression in the presence of dox. Cell lines for dox-inducible expression of monomeric N-terminally flag tagged Twist1 were generated in the same way.</p></sec><sec id="s4-3"><title>Differentiation protocols</title><p>Monolayer neural differentiation is described in detail in <xref ref-type="bibr" rid="bib55">Pollard et al. (2006)</xref>. Briefly, ES cells were washed to remove all traces of serum and then plated onto gelatin-coated tissue culture plastic in N2B27 serum-free medium. N2B27 consists of a 1:1 ratio of DMEM/F12 and Neurobasal media supplemented with 0.5% modified N2 (made in house as described in <xref ref-type="bibr" rid="bib55">Pollard et al., 2006</xref>), 0.5% B27 and 2- mercaptoethanol. Medium was changed every second day. Directed mesoderm differentiation on collagen IV was carried out as previously described (<xref ref-type="bibr" rid="bib31">Nishikawa et al., 1998</xref>).</p></sec><sec id="s4-4"><title>qRT-PCR</title><p>Primers used for qRT-PCR are described in <xref ref-type="supplementary-material" rid="SD1-data">Supplementary file 1</xref>. All expression values are normalised to those of the housekeeping gene <italic>TBP</italic>.</p></sec><sec id="s4-5"><title>Statistical analysis</title><p>Experiments in <xref ref-type="fig" rid="fig6">Figure 6D</xref> were performed in four replicates, with paired replicates performed on different days. All other experiments were performed on three independent occasions. Statistical significance was calculated using a paired Student’s <italic>t</italic> test.</p></sec><sec id="s4-6"><title>Single cell qRT-PCR</title><p>RNA reverse transcription and cDNA pre-amplification from single cells were performed as previously described (<xref ref-type="bibr" rid="bib52">Dalerba et al., 2011</xref>) with some modifications. Each well of a 96-well PCR plate was loaded with 5 µl 2X Reaction Mix, 0.2 µl Superscript III RT/Platinum Taq Mix (with RNaseOUT Ribonuclease Inhibitor) (Invitrogen Cells Direct One-Step qRT-PCR kit, Life Technologies), 2.5 µl primer mix (containing 200 nM of each gene-specific primer), 1.3 µl H<sub>2</sub>O. Single-cell suspensions were stained with 100 ng/ml DAPI. DAPI-negative cells were sorted into separate wells of the 96-well PCR plate. 32 cells were sorted into one well, to be used for serial dilution for generation of qRT-PCR standard curves. RNA reverse transcription and 22 cycles of cDNA pre-amplification were performed as previously described (<xref ref-type="bibr" rid="bib52">Dalerba et al., 2011</xref>). The cDNA was diluted 1:5 in H<sub>2</sub>O and 2 µl were loaded into each well of a Lightcycler 480 384 Multiwell plate, with 4 µl Lightcycler 480 Probes Master, 0.08 µl Universal ProbeLibrary probe (Roche, Switzerland), 450 nM of each primer and H<sub>2</sub>O to 8 µl. qRT-PCR reactions were performed using a Lightcycler 480 II instrument with the following cycling conditions: 50°C for 2 min, 95°C for 10 min, then 40 cycles of 95°C for 15 s, 60°C for 1 minute.1:2 serial dilutions of the 32 cells sorted into one well were used for the generation of standard curves. Samples with <italic>TBP</italic> expression lower than 10% of the population average were removed from further analyses. Spearman’s rank correlation coefficients for <italic>TBP</italic>-normalised gene expression values were calculated in R (<ext-link ext-link-type="uri" xlink:href="http://www.r-project.org/">http://www.r-project.org/</ext-link>) using the rcorr () function in the Hmisc package.</p></sec><sec id="s4-7"><title>Immunofluorescence, FACS, in situ hybridisation</title><p>For immunofluorescence analysis, cells were fixed in 4% paraformaldehyde (PFA) and incubated for 30 min in blocking buffer (PBS, 3% Donkey serum and 0.1% Triton). Primary antibodies were diluted in blocking buffer and applied for 1 hr at room temperature or overnight at 4°C. After three washes in PBS, secondary antibodies conjugated to Alexa fluorophores (Life Technologies) were diluted at 1:1000 in blocking buffer and applied for 1 hr at room temperature. The cells were washed at least three times in PBS and visualised on an Olympus inverted fluorescence microscope. For nuclear counter staining, cells were incubated in 1 µg/ml DAPI (Sigma) for 10 min after immunostaining. Embryos were fixed in 4% PFA for 2 hr at room temperature. The PFA was quenched with NH<sub>4</sub>Cl for 30 min at room temperature. For wholemount staining, the embryos were permeabilised in PBS+0.5% Triton for 1 hr at room temperature, then transferred to blocking buffer overnight at 4°C. They were then incubated in primary antibodies for 48 hr at 4°C, subjected to five 10-min washes in PBS+0.1% Triton, incubated in secondary antibodies and 100 ng/μl DAPI for 48 hr at 4°C, then subjected to five 10-min washes in PBS+0.1% Triton. Staining of sectioned embryos (7 μm sections) followed a similar protocol: the slides with gelatine-embedded sections were incubated at 55°C for 15 min to melt the gelatine, then permeabilised with PBS+0.5% Triton for 10 min at room temperature. The blocking and staining procedure is the same as that described for cells. After staining, the sections were mounted in Prolong Gold Antifade Reagent (Life Technologies).</p><p>Fluorescent mages were taken using a monochrome Retiga2000 camera using an Olympus IX51 inverted microscope or a Leica SPE confocal microscope. Images from the Olympus microscope were collected using Volocity software. 3D rendering was done using the 3DViewer plugin in Fiji ImageJ. Fluorochromes were Alexa 488, 568, 594 or 647.</p><p>Primary antibodies were obtained from the following sources: Neuronal beta-III tubulin (TUJ1: Covance, Princeton, NJ), E-Cadherin (ECCD1 for blocking experiments, ECCD2 for immunofluorescence: BD Biosciences, Franklin Lakes, NJ), N-Cadherin (C32: BD Biosciences), Oct4 (Santa Cruz, Dallas, TX), T (R&amp;D, Minneapolis, MN), Nanog (MLC-51: eBioscience, San Diego, CA), Esrrb (PP-H6705-00: Persaeus Proteomics, Japan), Klf4 (R&amp;D), Flag (clone M2 HRP conjugated for Western Blot, or unconjugated for immunofluorescence: Sigma, St Louis, MO). Antibodies against Vimentin and Keratin8 were purchased from the Developmental Studies Hybridoma Bank, developed under the auspices of the NICHD and maintained by The University of Iowa, Department of Biological Sciences, Iowa City, IA 52242.</p><p>FACS analysis was performed using a Becton Dickinson FACS Calibur flow cytometer. FACS sorting was carried out on a FACS Aria.</p><p>In situ hybridisation for <italic>Id1</italic> was performed using a probe described in <xref ref-type="bibr" rid="bib14">Gray et al. (2004)</xref>. The probe was generated using the following primers: F:AAGGTCGCGAGTGGCAGTGC R:GCCTGAAAAGTAAGGAAGGG.</p></sec><sec id="s4-8"><title>Quantification of immunostaining</title><p>In order to quantify the fluorescence signal in each individual cell, we generated an automated pipeline for image analysis as described previously (<xref ref-type="bibr" rid="bib8">Davies et al., 2013</xref>) or used tools provided through the Farsight project (<ext-link ext-link-type="uri" xlink:href="http://www.farsight-toolkit.org">http://www.farsight-toolkit.org</ext-link>).</p><p>In order to quantify neurite density after neural differentiation, five randomly selected fields (for each condition: treatment and day of differentiation) stained for Tuj1 were pictured. Each field was scored depending on the number of neurites present from 0 to 9, where 0 means no neurites can be observed and 9 neurites cover almost the entire field; the scores for each condition were averaged.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Robert Benezra and Hyung-song Nam for the Id1-Venus targeting construct, Val Wilson for help with embryo dissection, Rolf Kemler for <italic>Cdh1</italic> null ES cells, Nicola Festuccia, Ian Chambers, Anna Waterhouse, Andrew Smith and Owen Davies for providing reagents and advice, Aliaksandra Radzisheuskaya for help with qRT-PCR experiments and Kumiko Iwabuchi for advice on single-cell qRT-PCR. We thank Josh Brickman, Tilo Kunath, and Val Wilson for helpful discussions and comments on the manuscript, and Alfonso Martinez Arias and Tristan Rodriguez for constructive review of this manuscript. SL is a Wellcome Trust Career Development Fellow (WT082232AIA) and GB is a Sir Henry Wellcome Postdoctoral Fellow (WT100133).</p></ack><sec sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>MM, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con2"><p>SL, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con3"><p>PAN, Conception and design, Acquisition of data, Analysis and interpretation of data</p></fn><fn fn-type="con" id="con4"><p>GB, Conception and design, Acquisition of data, Analysis and interpretation of data</p></fn><fn fn-type="con" id="con5"><p>AP, Acquisition of data, Analysis and interpretation of data</p></fn><fn fn-type="con" id="con6"><p>XZ, Acquisition of data, Analysis and interpretation of data</p></fn></fn-group></sec><sec sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="SD1-data"><object-id pub-id-type="doi">10.7554/eLife.01197.013</object-id><label>Supplementary file 1.</label><caption><title>Description of primers and Roche UPL probes used for qRT-PCR.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01197.013">http://dx.doi.org/10.7554/eLife.01197.013</ext-link></p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife01197s001.xlsx"/></supplementary-material></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aaku-Saraste</surname><given-names>E</given-names></name><name><surname>Hellwig</surname><given-names>A</given-names></name><name><surname>Huttner</surname><given-names>WB</given-names></name></person-group><year>1996</year><article-title>Loss of occludin and functional tight junctions, but not ZO-1, during neural tube closure–remodeling of the neuroepithelium prior to neurogenesis</article-title><source>Dev Biol</source><volume>180</volume><fpage>664</fpage><lpage>79</lpage><pub-id pub-id-type="doi">10.1006/dbio.1996.0336</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aoyama</surname><given-names>M</given-names></name><name><surname>Sun-Wada</surname><given-names>G-H</given-names></name><name><surname>Yamamoto</surname><given-names>A</given-names></name><name><surname>Yamamoto</surname><given-names>M</given-names></name><name><surname>Hamada</surname><given-names>H</given-names></name><name><surname>Wada</surname><given-names>Y</given-names></name></person-group><year>2012</year><article-title>Spatial restriction of bone morphogenetic protein signaling in mouse gastrula through the mVam2-dependent endocytic pathway</article-title><source>Dev Cell</source><volume>22</volume><fpage>1163</fpage><lpage>75</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2012.05.009</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Arnold</surname><given-names>SJ</given-names></name><name><surname>Robertson</surname><given-names>EJ</given-names></name></person-group><year>2009</year><article-title>Making a commitment: cell lineage allocation and axis patterning in the early mouse embryo</article-title><source>Nat Rev Mol Cell Biol</source><volume>10</volume><fpage>91</fpage><lpage>103</lpage><pub-id pub-id-type="doi">10.1038/nrm2618</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Beppu</surname><given-names>H</given-names></name><name><surname>Kawabata</surname><given-names>M</given-names></name><name><surname>Hamamoto</surname><given-names>T</given-names></name><name><surname>Chytil</surname><given-names>A</given-names></name><name><surname>Minowa</surname><given-names>O</given-names></name><name><surname>Noda</surname><given-names>T</given-names></name><etal/></person-group><year>2000</year><article-title>BMP type II receptor is required for gastrulation and early development of mouse embryos</article-title><source>Dev Biol</source><volume>221</volume><fpage>249</fpage><lpage>58</lpage><pub-id pub-id-type="doi">10.1006/dbio.2000.9670</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bernemann</surname><given-names>C</given-names></name><name><surname>Greber</surname><given-names>B</given-names></name><name><surname>Ko</surname><given-names>K</given-names></name><name><surname>Sterneckert</surname><given-names>J</given-names></name><name><surname>Han</surname><given-names>DW</given-names></name><name><surname>Araúzo-Bravo</surname><given-names>MJ</given-names></name><etal/></person-group><year>2011</year><article-title>Distinct developmental ground states of epiblast stem cell lines determine different pluripotency features</article-title><source>Stem Cells</source><volume>29</volume><fpage>1496</fpage><lpage>503</lpage><pub-id pub-id-type="doi">10.1002/stem.709</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Blum</surname><given-names>M</given-names></name><name><surname>Gaunt</surname><given-names>SJ</given-names></name><name><surname>Cho</surname><given-names>KW</given-names></name><name><surname>Steinbeisser</surname><given-names>H</given-names></name><name><surname>Blumberg</surname><given-names>B</given-names></name><name><surname>Bittner</surname><given-names>D</given-names></name><etal/></person-group><year>1992</year><article-title>Gastrulation in the mouse: the role of the homeobox gene goosecoid</article-title><source>Cell</source><volume>69</volume><fpage>1097</fpage><lpage>106</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(92)90632-M</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cajal</surname><given-names>M</given-names></name><name><surname>Lawson</surname><given-names>KA</given-names></name><name><surname>Hill</surname><given-names>B</given-names></name><name><surname>Moreau</surname><given-names>A</given-names></name><name><surname>Rao</surname><given-names>J</given-names></name><name><surname>Ross</surname><given-names>A</given-names></name><etal/></person-group><year>2012</year><article-title>Clonal and molecular analysis of the prospective anterior neural boundary in the mouse embryo</article-title><source>Development</source><volume>139</volume><fpage>423</fpage><lpage>36</lpage><pub-id pub-id-type="doi">10.1242/dev.075499</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chou</surname><given-names>Y-F</given-names></name><name><surname>Chen</surname><given-names>H-H</given-names></name><name><surname>Eijpe</surname><given-names>M</given-names></name><name><surname>Yabuuchi</surname><given-names>A</given-names></name><name><surname>Chenoweth</surname><given-names>JG</given-names></name><name><surname>Tesar</surname><given-names>P</given-names></name><etal/></person-group><year>2008</year><article-title>The growth factor environment defines distinct pluripotent ground states in novel blastocyst-derived stem cells</article-title><source>Cell</source><volume>135</volume><fpage>449</fpage><lpage>61</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2008.08.035</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Constance Lane</surname><given-names>M</given-names></name><name><surname>Davidson</surname><given-names>L</given-names></name><name><surname>Sheets</surname><given-names>MD</given-names></name></person-group><year>2004</year><article-title>BMP antagonism by Spemann’s organizer regulates rostral-caudal fate of mesoderm</article-title><source>Dev Biol</source><volume>275</volume><fpage>356</fpage><lpage>74</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2004.08.012</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dalerba</surname><given-names>P</given-names></name><name><surname>Kalisky</surname><given-names>T</given-names></name><name><surname>Sahoo</surname><given-names>D</given-names></name><name><surname>Rajendran</surname><given-names>PS</given-names></name><name><surname>Rothenberg</surname><given-names>ME</given-names></name><name><surname>Leyrat</surname><given-names>AA</given-names></name><etal/></person-group><year>2011</year><article-title>Single-cell dissection of transcriptional heterogeneity in human colon tumors</article-title><source>Nat Biotechnol</source><volume>29</volume><fpage>1120</fpage><lpage>7</lpage><pub-id pub-id-type="doi">10.1038/nbt.2038</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Davies</surname><given-names>OR</given-names></name><name><surname>Lin</surname><given-names>C-Y</given-names></name><name><surname>Radzisheuskaya</surname><given-names>A</given-names></name><name><surname>Zhou</surname><given-names>X</given-names></name><name><surname>Taube</surname><given-names>J</given-names></name><name><surname>Blin</surname><given-names>G</given-names></name><etal/></person-group><year>2013</year><article-title>Tcf15 primes pluripotent cells for differentiation</article-title><source>Cell Rep</source><volume>3</volume><fpage>472</fpage><lpage>84</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2013.01.017</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Davis</surname><given-names>S</given-names></name><name><surname>Miura</surname><given-names>S</given-names></name><name><surname>Hill</surname><given-names>C</given-names></name><name><surname>Mishina</surname><given-names>Y</given-names></name><name><surname>Klingensmith</surname><given-names>J</given-names></name></person-group><year>2004</year><article-title>BMP receptor IA is required in the mammalian embryo for endodermal morphogenesis and ectodermal patterning</article-title><source>Dev Biol</source><volume>270</volume><fpage>47</fpage><lpage>63</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2004.01.048</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>del Valle</surname><given-names>I</given-names></name><name><surname>Rudloff</surname><given-names>S</given-names></name><name><surname>Carles</surname><given-names>A</given-names></name><name><surname>Li</surname><given-names>Y</given-names></name><name><surname>Liszewska</surname><given-names>E</given-names></name><name><surname>Vogt</surname><given-names>R</given-names></name><etal/></person-group><year>2013</year><article-title>E-cadherin is required for the proper activation of the Lifr/Gp130 signaling pathway in mouse embryonic stem cells</article-title><source>Development</source><volume>140</volume><fpage>1684</fpage><lpage>92</lpage><pub-id pub-id-type="doi">10.1242/dev.088690</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Di-Gregorio</surname><given-names>A</given-names></name><name><surname>Sancho</surname><given-names>M</given-names></name><name><surname>Stuckey</surname><given-names>DW</given-names></name><name><surname>Crompton</surname><given-names>LA</given-names></name><name><surname>Godwin</surname><given-names>J</given-names></name><name><surname>Mishina</surname><given-names>Y</given-names></name><etal/></person-group><year>2007</year><article-title>BMP signalling inhibits premature neural differentiation in the mouse embryo</article-title><source>Development</source><volume>134</volume><fpage>3359</fpage><lpage>69</lpage><pub-id pub-id-type="doi">10.1242/dev.005967</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Faunes</surname><given-names>F</given-names></name><name><surname>Hayward</surname><given-names>P</given-names></name><name><surname>Descalzo</surname><given-names>SM</given-names></name><name><surname>Chatterjee</surname><given-names>SS</given-names></name><name><surname>Balayo</surname><given-names>T</given-names></name><name><surname>Trott</surname><given-names>J</given-names></name><etal/></person-group><year>2013</year><article-title>A membrane-associated β-catenin/Oct4 complex correlates with ground-state pluripotency in mouse embryonic stem cells</article-title><source>Development</source><volume>140</volume><fpage>1171</fpage><lpage>83</lpage><pub-id pub-id-type="doi">10.1242/dev.085654</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gray</surname><given-names>PA</given-names></name><name><surname>Fu</surname><given-names>H</given-names></name><name><surname>Luo</surname><given-names>P</given-names></name><name><surname>Zhao</surname><given-names>Q</given-names></name><name><surname>Yu</surname><given-names>J</given-names></name><name><surname>Ferrari</surname><given-names>A</given-names></name><etal/></person-group><year>2004</year><article-title>Mouse brain organization revealed through direct genome-scale TF expression analysis</article-title><source>Science</source><volume>306</volume><fpage>2255</fpage><lpage>7</lpage><pub-id pub-id-type="doi">10.1126/science.1104935</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hatta</surname><given-names>K</given-names></name><name><surname>Takeichi</surname><given-names>M</given-names></name></person-group><year>1986</year><article-title>Expression of N-cadherin adhesion molecules associated with early morphogenetic events in chick development</article-title><source>Nature</source><volume>320</volume><fpage>447</fpage><lpage>9</lpage><pub-id pub-id-type="doi">10.1038/320447a0</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hawkins</surname><given-names>K</given-names></name><name><surname>Mohamet</surname><given-names>L</given-names></name><name><surname>Ritson</surname><given-names>S</given-names></name><name><surname>Merry</surname><given-names>CLR</given-names></name><name><surname>Ward</surname><given-names>CM</given-names></name></person-group><year>2012</year><article-title>E-cadherin and, in its absence, N-cadherin promotes Nanog expression in mouse embryonic stem cells via STAT3 phosphorylation</article-title><source>Stem Cells</source><volume>30</volume><fpage>1842</fpage><lpage>51</lpage><pub-id pub-id-type="doi">10.1002/stem.1148</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jen</surname><given-names>Y</given-names></name><name><surname>Manova</surname><given-names>K</given-names></name><name><surname>Benezra</surname><given-names>R</given-names></name></person-group><year>1997</year><article-title>Each member of the Id gene family exhibits a unique expression pattern in mouse gastrulation and neurogenesis</article-title><source>Dev Dyn</source><volume>208</volume><fpage>92</fpage><lpage>106</lpage><pub-id pub-id-type="doi">10.1002/(SICI)1097-0177(199701)208:1&lt;92::AID-AJA9&gt;3.0.CO;2-X</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Karpowicz</surname><given-names>P</given-names></name><name><surname>Inoue</surname><given-names>T</given-names></name><name><surname>Runciman</surname><given-names>S</given-names></name><name><surname>Deveale</surname><given-names>B</given-names></name><name><surname>Seaberg</surname><given-names>R</given-names></name><name><surname>Gertsenstein</surname><given-names>M</given-names></name><etal/></person-group><year>2007</year><article-title>Adhesion is prerequisite, but alone insufficient, to elicit stem cell pluripotency</article-title><source>J Neurosci</source><volume>27</volume><fpage>5437</fpage><lpage>47</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.0300-07.2007</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kamiya</surname><given-names>D</given-names></name><name><surname>Banno</surname><given-names>S</given-names></name><name><surname>Sasai</surname><given-names>N</given-names></name><name><surname>Ohgushi</surname><given-names>M</given-names></name><name><surname>Inomata</surname><given-names>H</given-names></name><name><surname>Watanabe</surname><given-names>K</given-names></name><etal/></person-group><year>2011</year><article-title>Intrinsic transition of embryonic stem-cell differentiation into neural progenitors</article-title><source>Nature</source><volume>470</volume><fpage>503</fpage><lpage>9</lpage><pub-id pub-id-type="doi">10.1038/nature09726</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kondo</surname><given-names>M</given-names></name><name><surname>Cubillo</surname><given-names>E</given-names></name><name><surname>Tobiume</surname><given-names>K</given-names></name><name><surname>Shirakihara</surname><given-names>T</given-names></name><name><surname>Fukuda</surname><given-names>N</given-names></name><name><surname>Suzuki</surname><given-names>H</given-names></name><etal/></person-group><year>2004</year><article-title>A role for Id in the regulation of TGF-beta-induced epithelial-mesenchymal transdifferentiation</article-title><source>Cell Death Differ</source><volume>11</volume><fpage>1092</fpage><lpage>101</lpage><pub-id pub-id-type="doi">10.1038/sj.cdd.4401467</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kubo</surname><given-names>A</given-names></name><name><surname>Shinozaki</surname><given-names>K</given-names></name><name><surname>Shannon</surname><given-names>JM</given-names></name><name><surname>Kouskoff</surname><given-names>V</given-names></name><name><surname>Kennedy</surname><given-names>M</given-names></name><name><surname>Woo</surname><given-names>S</given-names></name><etal/></person-group><year>2004</year><article-title>Development of definitive endoderm from embryonic stem cells in culture</article-title><source>Development</source><volume>131</volume><fpage>1651</fpage><lpage>62</lpage><pub-id pub-id-type="doi">10.1242/dev.01044</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Larue</surname><given-names>L</given-names></name><name><surname>Antos</surname><given-names>C</given-names></name><name><surname>Butz</surname><given-names>S</given-names></name><name><surname>Huber</surname><given-names>O</given-names></name><name><surname>Delmas</surname><given-names>V</given-names></name><name><surname>Dominis</surname><given-names>M</given-names></name><etal/></person-group><year>1996</year><article-title>A role for cadherins in tissue formation</article-title><source>Development</source><volume>122</volume><fpage>3185</fpage><lpage>94</lpage></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lawson</surname><given-names>KA</given-names></name><name><surname>Dunn</surname><given-names>NR</given-names></name><name><surname>Roelen</surname><given-names>BA</given-names></name><name><surname>Zeinstra</surname><given-names>LM</given-names></name><name><surname>Davis</surname><given-names>AM</given-names></name><name><surname>Wright</surname><given-names>CV</given-names></name><etal/></person-group><year>1999</year><article-title>Bmp4 is required for the generation of primordial germ cells in the mouse embryo</article-title><source>Genes Dev</source><volume>13</volume><fpage>424</fpage><lpage>36</lpage><pub-id pub-id-type="doi">10.1101/gad.13.4.424</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname><given-names>R</given-names></name><name><surname>Liang</surname><given-names>J</given-names></name><name><surname>Ni</surname><given-names>S</given-names></name><name><surname>Zhou</surname><given-names>T</given-names></name><name><surname>Qing</surname><given-names>X</given-names></name><name><surname>Li</surname><given-names>H</given-names></name><etal/></person-group><year>2010</year><article-title>A Mesenchymal-to-epithelial transition initiates and is required for the nuclear reprogramming of mouse fibroblasts</article-title><source>Stem Cell</source><volume>7</volume><fpage>51</fpage><lpage>63</lpage><pub-id pub-id-type="doi">10.1016/j.stem.2010.04.014</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Li</surname><given-names>L</given-names></name><name><surname>Liu</surname><given-names>C</given-names></name><name><surname>Biechele</surname><given-names>S</given-names></name><name><surname>Zhu</surname><given-names>Q</given-names></name><name><surname>Song</surname><given-names>L</given-names></name><name><surname>Lanner</surname><given-names>F</given-names></name><etal/></person-group><year>2013</year><article-title>Location of transient ectodermal progenitor potential in mouse development</article-title><source>Development</source><volume>140</volume><fpage>4533</fpage><lpage>43</lpage><pub-id pub-id-type="doi">10.1242/dev.092866</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lowell</surname><given-names>S</given-names></name><name><surname>Benchoua</surname><given-names>A</given-names></name><name><surname>Heavey</surname><given-names>B</given-names></name><name><surname>Smith</surname><given-names>AG</given-names></name></person-group><year>2006</year><article-title>Notch promotes neural lineage entry by pluripotent embryonic stem cells</article-title><source>PLOS Biol</source><volume>4</volume><fpage>e121</fpage><pub-id pub-id-type="doi">10.1371/journal.pbio.0040121</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martínez-Estrada</surname><given-names>OM</given-names></name><name><surname>Lettice</surname><given-names>LA</given-names></name><name><surname>Essafi</surname><given-names>A</given-names></name><name><surname>Guadix</surname><given-names>JA</given-names></name><name><surname>Slight</surname><given-names>J</given-names></name><name><surname>Velecela</surname><given-names>V</given-names></name><etal/></person-group><year>2010</year><article-title>Wt1 is required for cardiovascular progenitor cell formation through transcriptional control of Snail and E-cadherin</article-title><source>Nat Genet</source><volume>42</volume><fpage>89</fpage><lpage>93</lpage><pub-id pub-id-type="doi">10.1038/ng.494</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mishina</surname><given-names>Y</given-names></name><name><surname>Suzuki</surname><given-names>A</given-names></name><name><surname>Ueno</surname><given-names>N</given-names></name><name><surname>Behringer</surname><given-names>RR</given-names></name></person-group><year>1995</year><article-title>Bmpr encodes a type I bone morphogenetic protein receptor that is essential for gastrulation during mouse embryogenesis</article-title><source>Genes Dev</source><volume>9</volume><fpage>3027</fpage><lpage>37</lpage><pub-id pub-id-type="doi">10.1101/gad.9.24.3027</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mitchell</surname><given-names>PJ</given-names></name><name><surname>Timmons</surname><given-names>PM</given-names></name><name><surname>Hebert</surname><given-names>JM</given-names></name><name><surname>Rigby</surname><given-names>PW</given-names></name><name><surname>Tjian</surname><given-names>R</given-names></name></person-group><year>1991</year><article-title>Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis</article-title><source>Genes Dev</source><volume>5</volume><fpage>105</fpage><lpage>19</lpage><pub-id pub-id-type="doi">10.1101/gad.5.1.105</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Murry</surname><given-names>CE</given-names></name><name><surname>Keller</surname><given-names>G</given-names></name></person-group><year>2008</year><article-title>Differentiation of embryonic stem cells to clinically relevant populations: lessons from embryonic development</article-title><source>Cell</source><volume>132</volume><fpage>661</fpage><lpage>80</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2008.02.008</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nam</surname><given-names>H-S</given-names></name><name><surname>Benezra</surname><given-names>R</given-names></name></person-group><year>2009</year><article-title>High levels of Id1 expression define B1 type adult neural stem cells</article-title><source>Cell Stem Cell</source><volume>5</volume><fpage>515</fpage><lpage>26</lpage><pub-id pub-id-type="doi">10.1016/j.stem.2009.08.017</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nishikawa</surname><given-names>SI</given-names></name><name><surname>Nishikawa</surname><given-names>S</given-names></name><name><surname>Hirashima</surname><given-names>M</given-names></name><name><surname>Matsuyoshi</surname><given-names>N</given-names></name><name><surname>Kodama</surname><given-names>H</given-names></name></person-group><year>1998</year><article-title>Progressive lineage analysis by cell sorting and culture identifies FLK1+VE-cadherin+ cells at a diverging point of endothelial and hemopoietic lineages</article-title><source>Development</source><volume>125</volume><fpage>1747</fpage><lpage>57</lpage></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Niwa</surname><given-names>H</given-names></name><name><surname>Yamamura</surname><given-names>K</given-names></name><name><surname>Miyazaki</surname><given-names>J</given-names></name></person-group><year>1991</year><article-title>Efficient selection for high-expression transfectants with a novel eukaryotic vector</article-title><source>Gene</source><volume>108</volume><fpage>193</fpage><lpage>9</lpage><pub-id pub-id-type="doi">10.1016/0378-1119(91)90434-D</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Norton</surname><given-names>JD</given-names></name></person-group><year>2000</year><article-title>ID helix-loop-helix proteins in cell growth, differentiation and tumorigenesis</article-title><source>J Cell Sci</source><volume>113</volume><fpage>3897</fpage><lpage>905</lpage></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Osorno</surname><given-names>R</given-names></name><name><surname>Tsakiridis</surname><given-names>A</given-names></name><name><surname>Wong</surname><given-names>F</given-names></name><name><surname>Cambray</surname><given-names>N</given-names></name><name><surname>Economou</surname><given-names>C</given-names></name><name><surname>Wilkie</surname><given-names>R</given-names></name><etal/></person-group><year>2012</year><article-title>The developmental dismantling of pluripotency is reversed by ectopic Oct4 expression</article-title><source>Development</source><volume>139</volume><fpage>2288</fpage><lpage>98</lpage><pub-id pub-id-type="doi">10.1242/dev.078071</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Owens</surname><given-names>DW</given-names></name><name><surname>Brunton</surname><given-names>VG</given-names></name><name><surname>Parkinson</surname><given-names>EK</given-names></name><name><surname>Frame</surname><given-names>MC</given-names></name></person-group><year>2000</year><article-title>E-cadherin at the cell periphery is a determinant of keratinocyte differentiation in Vitro</article-title><source>Biochem Biophys Res Commun</source><volume>269</volume><fpage>369</fpage><lpage>76</lpage><pub-id pub-id-type="doi">10.1006/bbrc.2000.2292</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pollard</surname><given-names>SM</given-names></name><name><surname>Benchoua</surname><given-names>A</given-names></name><name><surname>Lowell</surname><given-names>S</given-names></name></person-group><year>2006</year><article-title>Conversion of embryonic stem cells to neural stem cells, neurons and glia</article-title><source>Methods Enzymol</source><volume>418</volume><fpage>151</fpage><lpage>69</lpage><pub-id pub-id-type="doi">10.1016/S0076-6879(06)18010-6</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Redmer</surname><given-names>T</given-names></name><name><surname>Diecke</surname><given-names>S</given-names></name><name><surname>Grigoryan</surname><given-names>T</given-names></name><name><surname>Quiroga-Negreira</surname><given-names>A</given-names></name><name><surname>Birchmeier</surname><given-names>W</given-names></name><name><surname>Besser</surname><given-names>D</given-names></name></person-group><year>2011</year><article-title>E-cadherin is crucial for embryonic stem cell pluripotency and can replace OCT4 during somatic cell reprogramming</article-title><source>EMBO Rep</source><volume>12</volume><fpage>720</fpage><lpage>6</lpage><pub-id pub-id-type="doi">10.1038/embor.2011.88</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rivera-Pérez</surname><given-names>JA</given-names></name><name><surname>Magnuson</surname><given-names>T</given-names></name></person-group><year>2005</year><article-title>Primitive streak formation in mice is preceded by localized activation of Brachyury and Wnt3</article-title><source>Dev Biol</source><volume>288</volume><fpage>363</fpage><lpage>71</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2005.09.012</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Romero-Lanman</surname><given-names>EE</given-names></name><name><surname>Pavlovic</surname><given-names>S</given-names></name><name><surname>Amlani</surname><given-names>B</given-names></name><name><surname>Chin</surname><given-names>Y</given-names></name><name><surname>Benezra</surname><given-names>R</given-names></name></person-group><year>2011</year><article-title>Id1 maintains embryonic stem cell self-renewal by up-regulation of Nanog and repression of Brachyury expression</article-title><source>Stem Cells Dev</source><volume>21</volume><fpage>384</fpage><lpage>93</lpage><pub-id pub-id-type="doi">10.1089/scd.2011.0428</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Samavarchi-Tehrani</surname><given-names>P</given-names></name><name><surname>Golipour</surname><given-names>A</given-names></name><name><surname>David</surname><given-names>L</given-names></name><name><surname>Sung</surname><given-names>H-K</given-names></name><name><surname>Beyer</surname><given-names>TA</given-names></name><name><surname>Datti</surname><given-names>A</given-names></name><etal/></person-group><year>2010</year><article-title>Functional Genomics Reveals a BMP-Driven Mesenchymal-to-Epithelial Transition in the Initiation of Somatic Cell Reprogramming</article-title><source>Cell Stem Cell</source><volume>7</volume><fpage>64</fpage><lpage>77</lpage><pub-id pub-id-type="doi">10.1016/j.stem.2010.04.015</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname><given-names>AG</given-names></name></person-group><year>1991</year><article-title>Culture and differentiation of embryonic stem cells</article-title><source>J Tiss Cult Meth</source><volume>13</volume><fpage>89</fpage><lpage>94</lpage><pub-id pub-id-type="doi">10.1007/BF01666137</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Soncin</surname><given-names>F</given-names></name><name><surname>Mohamet</surname><given-names>L</given-names></name><name><surname>Eckardt</surname><given-names>D</given-names></name><name><surname>Ritson</surname><given-names>S</given-names></name><name><surname>Eastham</surname><given-names>AM</given-names></name><name><surname>Bobola</surname><given-names>N</given-names></name><etal/></person-group><year>2009</year><article-title>Abrogation of E-cadherin-mediated cell-cell contact in mouse embryonic stem cells results in reversible LIF-independent self-renewal</article-title><source>Stem Cells</source><volume>27</volume><fpage>2069</fpage><lpage>80</lpage><pub-id pub-id-type="doi">10.1002/stem.134</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stepniak</surname><given-names>E</given-names></name><name><surname>Radice</surname><given-names>GL</given-names></name><name><surname>Vasioukhin</surname><given-names>V</given-names></name></person-group><year>2009</year><article-title>Adhesive and signaling functions of cadherins and catenins in vertebrate development</article-title><source>Cold Spring Harb Perspect Biol</source><volume>1</volume><fpage>a002949</fpage><pub-id pub-id-type="doi">10.1101/cshperspect.a002949</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stern</surname><given-names>CD</given-names></name></person-group><year>2006</year><article-title>Neural induction: 10 years on since the “default model”</article-title><source>Curr Opin Cell Biol</source><volume>18</volume><fpage>692</fpage><lpage>7</lpage><pub-id pub-id-type="doi">10.1016/j.ceb.2006.09.002</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sterneckert</surname><given-names>J</given-names></name><name><surname>Stehling</surname><given-names>M</given-names></name><name><surname>Bernemann</surname><given-names>C</given-names></name><name><surname>Araúzo-Bravo</surname><given-names>MJ</given-names></name><name><surname>Greber</surname><given-names>B</given-names></name><name><surname>Gentile</surname><given-names>L</given-names></name><etal/></person-group><year>2010</year><article-title>Neural induction intermediates exhibit distinct roles of Fgf signaling</article-title><source>Stem Cells</source><volume>28</volume><fpage>1772</fpage><lpage>81</lpage><pub-id pub-id-type="doi">10.1002/stem.498</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thiery</surname><given-names>JP</given-names></name><name><surname>Acloque</surname><given-names>H</given-names></name><name><surname>Huang</surname><given-names>RYJ</given-names></name><name><surname>Nieto</surname><given-names>MA</given-names></name></person-group><year>2009</year><article-title>Epithelial-mesenchymal transitions in development and disease</article-title><source>Cell</source><volume>139</volume><fpage>871</fpage><lpage>90</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2009.11.007</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Watt</surname><given-names>FM</given-names></name><name><surname>Fujiwara</surname><given-names>H</given-names></name></person-group><year>2011</year><article-title>Cell-extracellular matrix interactions in normal and diseased skin</article-title><source>Cold Spring Harb Perspect Biol</source><volume>3</volume><fpage>a005124</fpage><pub-id pub-id-type="doi">10.1101/cshperspect.a005124</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Winnier</surname><given-names>G</given-names></name><name><surname>Blessing</surname><given-names>M</given-names></name><name><surname>Labosky</surname><given-names>PA</given-names></name><name><surname>Hogan</surname><given-names>BL</given-names></name></person-group><year>1995</year><article-title>Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse</article-title><source>Genes Dev</source><volume>9</volume><fpage>2105</fpage><lpage>16</lpage><pub-id pub-id-type="doi">10.1101/gad.9.17.2105</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yan</surname><given-names>X</given-names></name><name><surname>Liu</surname><given-names>Z</given-names></name><name><surname>Chen</surname><given-names>Y</given-names></name></person-group><year>2009</year><article-title>Regulation of TGF-beta signaling by Smad7</article-title><source>Acta Biochim Biophys Sin (Shanghai)</source><volume>41</volume><fpage>263</fpage><lpage>72</lpage><pub-id pub-id-type="doi">10.1093/abbs/gmp018</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ying</surname><given-names>QL</given-names></name><name><surname>Nichols</surname><given-names>J</given-names></name><name><surname>Chambers</surname><given-names>I</given-names></name><name><surname>Smith</surname><given-names>A</given-names></name></person-group><year>2003a</year><article-title>BMP induction of Id proteins suppresses differentiation and sustains embryonic stem cell self-renewal in collaboration with STAT3</article-title><source>Cell</source><volume>115</volume><fpage>281</fpage><lpage>92</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(03)00847-X</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ying</surname><given-names>QL</given-names></name><name><surname>Smith</surname><given-names>AG</given-names></name></person-group><year>2003</year><article-title>Defined conditions for neural commitment and differentiation</article-title><source>Methods Enzymol</source><volume>365</volume><fpage>327</fpage><lpage>41</lpage><pub-id pub-id-type="doi">10.1016/S0076-6879(03)65023-8</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ying</surname><given-names>QL</given-names></name><name><surname>Stavridis</surname><given-names>M</given-names></name><name><surname>Griffiths</surname><given-names>D</given-names></name><name><surname>Li</surname><given-names>M</given-names></name><name><surname>Smith</surname><given-names>A</given-names></name></person-group><year>2003b</year><article-title>Conversion of embryonic stem cells into neuroectodermal precursors in adherent monoculture</article-title><source>Nat Biotechnol</source><volume>21</volume><fpage>183</fpage><lpage>6</lpage><pub-id pub-id-type="doi">10.1038/nbt780</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yoshida-Noro</surname><given-names>C</given-names></name><name><surname>Suzuki</surname><given-names>N</given-names></name><name><surname>Takeichi</surname><given-names>M</given-names></name></person-group><year>1984</year><article-title>Molecular nature of the calcium-dependent cell-cell adhesion system in mouse teratocarcinoma and embryonic cells studied with a monoclonal antibody</article-title><source>Dev Biol</source><volume>101</volume><fpage>19</fpage><lpage>27</lpage><pub-id pub-id-type="doi">10.1016/0012-1606(84)90112-X</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>K</given-names></name><name><surname>Li</surname><given-names>L</given-names></name><name><surname>Huang</surname><given-names>C</given-names></name><name><surname>Shen</surname><given-names>C</given-names></name><name><surname>Tan</surname><given-names>F</given-names></name><name><surname>Xia</surname><given-names>C</given-names></name><etal/></person-group><year>2010</year><article-title>Distinct functions of BMP4 during different stages of mouse ES cell neural commitment</article-title><source>Development</source><volume>137</volume><fpage>2095</fpage><lpage>105</lpage><pub-id pub-id-type="doi">10.1242/dev.049494</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhou</surname><given-names>X</given-names></name><name><surname>Smith</surname><given-names>AJH</given-names></name><name><surname>Waterhouse</surname><given-names>A</given-names></name><name><surname>Blin</surname><given-names>G</given-names></name><name><surname>Malaguti</surname><given-names>M</given-names></name><name><surname>Lin</surname><given-names>C-Y</given-names></name><etal/></person-group><year>2013</year><article-title>Hes1 Desynchronizes differentiation of pluripotent cells by modulating STAT3 activity</article-title><source>Stem Cells</source><volume>31</volume><fpage>1511</fpage><lpage>22</lpage><pub-id pub-id-type="doi">10.1002/stem.1426</pub-id></element-citation></ref></ref-list></back><sub-article article-type="article-commentary" id="SA1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.01197.014</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Miller</surname><given-names>Freda</given-names></name><role>Reviewing editor</role><aff><institution>The Hospital for Sick Children Research Institute, University of Toronto</institution>, <country>Canada</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see <ext-link ext-link-type="uri" xlink:href="http://elife.elifesciences.org/review-process">review process</ext-link>). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.</p></boxed-text><p>Thank you for sending your work entitled “BMP suppresses differentiation of pluripotent cells by blocking an epithelial to mesenchymal transition” for consideration at <italic>eLife</italic>. Your article has been favorably evaluated by a Senior editor and 3 reviewers, one of whom is a member of our Board of Reviewing Editors.</p><p>The following individuals responsible for the peer review of your submission have agreed to reveal their identity: Freda Miller, Reviewing editor; Tristan Rodriguez and Alfonso Martinez Arias, peer reviewers.</p><p>The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.</p><p>This manuscript addresses the mechanisms whereby BMP4 and its downstream target Id1 regulate the transition between pluripotent cells and their differentiated neural and mesodermal progeny. The study is largely pursued in murine ES cells, and provides evidence for the interesting conclusion that BMP4 and Id1 play an important role in regulating pluripotency and these early stages of differentiation via Cdh1 and potentially EMT.</p><p>1) A major limitation of this work as currently presented is that it is difficult to be definitive about EMT transitions in ES cells. For example, the repression of EMT might be an indirect consequence of the role of BMPs in promoting a posterior epiblast identity. One way the authors could address this question is to test if BMPs can repress EMT in the directed mesoderm assays shown in <xref ref-type="fig" rid="fig2">Figure 2D</xref>. However, while this experiment might strengthen their general conclusion, we also feel that it would be better to rewrite the paper so that the conclusions regarding EMT (particularly with regard to neural induction) are more cautious and not couched as the major conclusion of the manuscript (such as in the title).</p><p>2) Much of this manuscript relies upon qPCR-based approaches for markers associated with certain states. However, although the authors have error bars on these and their other experiments, statistical significance is largely absent from the manuscript. Since their conclusions are largely quantitative ones, the authors need to explicitly indicate how many times each experiment was done, and to perform appropriate tests of significance.</p><p>3) In their studies on Id1, the authors establish a very nice control for their manipulated ES cells by floxing their Id1 transgene so that it can be deleted. They then show that this works with regard to neural differentiation in <xref ref-type="fig" rid="fig3s1">Figure 3–figure supplement. 1</xref>. However, they never take advantage of this control for any of their EMT/mesoderm experiments. It would significantly strengthen the paper if they included these data, since in a sense this is the ultimate control.</p><p>4) The studies in <xref ref-type="fig" rid="fig4">Figure 4</xref> looking at Oct4 versus Cdh1 during neural induction/neural tube establishment should be improved. Also, previous work from Derek van der Kooy's lab has shown that Cdh1 is expressed in the neural tube at later timepoints (Karpowicz et al., J. Neurosci., 2007). Do the authors also find this?</p><p>5) As a general comment, many of the figure legends are unclear. For example, in <xref ref-type="fig" rid="fig4">Figure 4A</xref>, this appears to be the levels of expression of the various genes that are indicated in individual cells taken at 3 days that are sorted out for their relative levels of these markers. Is that the case? And how did the authors obtain the R values for correlation with Cdh1 as shown in 4B? <xref ref-type="fig" rid="fig5">Figure 5E</xref> cold also benefit from better labeling. Thus, in general, clarification in the figure legends would significantly improve “readability”.</p></body></sub-article><sub-article article-type="reply" id="SA2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.01197.015</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p><italic>1) A major limitation of this work as currently presented is that it is difficult to be definitive about EMT transitions in ES cells</italic>.</p><p>This is a very good point. Upon reflection, we realise that the terms “EMT” or “EMT-like” are not appropriate for the events that we are discussing: what we are really talking about are changes in E-Cadherin (Cdh1). We have now removed all inappropriate references to EMT throughout the text and in the title and replaced them with reference to changes in Cdh1. We only use the term EMT where we are referring specifically to conventional EMT events such as those that accompany formation of the mesoderm at the primitive streak, or where we refer to markers of EMT.</p><p>It is interesting, however, to note that the changes in Cdh1 that accompany neural specification are accompanied by some other changes that characterise conventional EMT, such as upregulation of N-Cadherin and Vimentin. We have included a brief discussion on this point at the start of the Discussion, whilst making it clear that these changes do not bear all the hallmarks of a classical EMT.</p><p>We appreciate this constructive advice and feel that our paper is now clearer and more to the point framed in terms of E-Cadherin rather than EMT.</p><p><italic>For example, the repression of EMT might be an indirect consequence of the role of BMPs in promoting a posterior epiblast identity</italic>.</p><p>This is a perceptive point. One piece of evidence that argues against this interpretation is that suppression of Cdh1 alone is sufficient to rescue neural differentiation at moderate doses of BMP4 (<xref ref-type="fig" rid="fig6">Figure 6A,B</xref>). If the primary effect of BMP is to promote posterior identity, with repression of EMT being a secondary consequence of this, then experimental suppression of Cdh1 in the presence of BMP might be expected to always drive mesoderm rather than neural differentiation. Since this does not happen (<xref ref-type="fig" rid="fig6">Figure 6A,B</xref>) we tentatively conclude that repression of “EMT” is not entirely an indirect consequence of the role of BMPs in promoting a posterior epiblast identity. However, we fully accept the wider point that we should be more cautious in our conclusions regarding EMT. We have rewritten our manuscript accordingly as described above.</p><p><italic>One way the authors could address this question is to test if BMPs can repress EMT in the directed mesoderm assays shown in</italic> <xref ref-type="fig" rid="fig2"><italic>Figure 2D</italic></xref><italic>. However, while this experiment might strengthen their general conclusion, we also feel that it would be better to rewrite the paper so that the conclusions regarding EMT (particularly with regard to neural induction) are more cautious and not couched as the major conclusion of the manuscript (such as in the title)</italic>.</p><p>This is a great suggestion. We added BMP to the directed mesoderm protocol based on Collagen IV and FCS (as in <xref ref-type="fig" rid="fig2">Figure 2D</xref>). Exogenous BMP had profound effects during the protocol although unfortunately these effects appear to be somewhat toxic for the cells and so the data is difficult to interpret. We do not feel that these data are sufficiently informative to include in the paper, but we outline our findings below for your consideration.</p><p>Briefly, addition of BMP induced a clear morphological change in the cells. Rather than adopting the usual mesenchymal morphology (<xref ref-type="fig" rid="fig7">Author response image 1A</xref>), the cells became very large and flat (<xref ref-type="fig" rid="fig7">Author response image 1B</xref>). Whilst it is tempting to interpret this as an inhibition of EMT, these flatted cells do not have the typical morphology of healthy epithelial cells: rather they seem unhealthy, unable to proliferate, and destined to die. This is the type of morphology that we typically see in ES cell cultures that have been subjected to environmental or genetic stress.<fig id="fig7" position="float"><label>Author response image 1.</label><graphic xlink:href="elife01197f007"/></fig></p><p>If BMP were simply inhibiting EMT during mesoderm differentiation we would expect these cells to remain, at least for some time, in a T+ pre-ingression epiblast-like state. However, qPCR analysis (for what it is worth from such unhealthy looking cells) reveals that BMP treatment promotes rapid loss of Oct4 (Figure R1C) and abolishes the upregulation of T-Brachyury that usually accompanies epiblast and subsequent mesoderm differentiation (<xref ref-type="fig" rid="fig7">Author response image 1D</xref>). We tested two different doses of BMP4 (10ng/ml and 50ng/ml) with similar results.</p><p>We conclude that BMP treatment in the context of this undefined directed mesoderm differentiation protocol strongly interferes with the normal differentiation process in ways that are difficult to interpret, but that clearly extend beyond a simple suppression of EMT. We think it most likely, based on morphological observations, that the cells adopt an unhealthy non-physiological state, perhaps due to exposure to conflicting environmental signals. We would therefore not feel comfortable drawing any conclusions from these experiments with relation to our proposed model.</p><p>More generally, we entirely agree with the reviewers' point that it is not appropriate for us to draw strong conclusions about control of EMT by BMP signalling, and we have followed their advice and rewritten the paper to remove reference to EMT as described above.</p><p><italic>2) Much of this manuscript relies upon qPCR-based approaches for markers associated with certain states. However, although the authors have error bars on these and their other experiments, statistical significance is largely absent from the manuscript. Since their conclusions are largely quantitative ones, the authors need to explicitly indicate how many times each experiment was done, and to perform appropriate tests of significance</italic>.</p><p>We have included this information in the revised version of the manuscript. Significance is depicted on figures, and details are provided in figure legends and in the Materials and methods.</p><p><italic>3) In their studies on Id1, the authors establish a very nice control for their manipulated ES cells by floxing their Id1 transgene so that it can be deleted. They then show that this works with regard to neural differentiation in</italic> <xref ref-type="fig" rid="fig3"><italic>Figure 3</italic></xref><italic>–figure supplement. 1. However, they never take advantage of this control for any of their EMT/mesoderm experiments. It would significantly strengthen the paper if they included these data, since in a sense this is the ultimate control</italic>.</p><p>We agree that the control we used was not ideal. Whilst the floxed reverted line is a better control, this is also not the absolute ideal. We have recently developed a superior system that is much more tightly controllable. This is a dox-inducible Id1 overexpression system that allows us to compare the behaviour of the same cell line in the presence or absence of Id1 activation, described in <xref ref-type="fig" rid="fig3">Figure 3</xref>–figure supplement 1. We have used this new inducible system to generate a new set of data for <xref ref-type="fig" rid="fig3">Figure 3</xref>. We have additionally improved <xref ref-type="fig" rid="fig3">Figure 3</xref> by including a full time course from d0 to d5 (our original data examined d0 to d3 only).</p><p>We are pleased to report that the data shown in the original version of <xref ref-type="fig" rid="fig3">Figure 3</xref> is fully recapitulated with the better-controlled inducible system and indeed the effects are even more striking with the new system (see new <xref ref-type="fig" rid="fig3">Figure 3</xref>). This is despite the fact that this new inducible expression system provides more modest levels of exogenous Id1 than the original constitutive expression system (see new <xref ref-type="fig" rid="fig3s1">Figure 3–figure supplement 1</xref>). We therefore feel that the new data is not only better controlled but also even more strongly supportive of our model than our original data set.</p><p>When it comes to analysing longer-term consequences of Id1 overexpression on lineage bias we encounter a slight caveat with the dox inducible system. A significant proportion (around 50%) of cells lack expression of the flag-tagged transgene on day 5 of differentiation and the flag-negative population are able to generate neurons (<xref ref-type="fig" rid="fig3s1">Figure 3–figure supplement 1</xref>). Furthermore, the differentiation delay is more pronounced with the inducible system than with the constitutive system (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Taken together, these two things make it difficult to use the dox-inducible system to test the eventual lineage preference of overexpressing cells. To strengthen this particular point we therefore turned back to the constitutive overexpression system, which a) allows for more uniform maintenance of Id1 activity throughout the culture (<xref ref-type="fig" rid="fig3s1">Figure 3–figure supplement 1</xref>) and b) allows for a more rapid ‘escape’ into differentiation (<xref ref-type="fig" rid="fig3s2">Figure 3–figure supplement 2</xref>). We performed a new series of experiments this time using the appropriate floxed-reverted control cell line as suggested by the reviewers.</p><p>These new better-controlled data confirm that cells that are able to persistently maintain exogenous Id1 activity eventually favour mesoderm rather than ectoderm or endoderm fates, in keeping with our original observations. These new data are provided in the new version of <xref ref-type="fig" rid="fig3s2">Figure 3–figure supplement 2</xref>.</p><p><italic>4) The studies in</italic> <xref ref-type="fig" rid="fig4"><italic>Figure 4</italic></xref> <italic>looking at Oct4 versus Cdh1 during neural induction/neural tube establishment should be improved</italic>.</p><p>We agree that the correlation between Oct4 and Cdh1 during neural development was difficult to see clearly in the original version of <xref ref-type="fig" rid="fig4">Figure 4</xref>. We have now strengthened these data by repeating these experiments and performing quantitative analysis. We first quantified the expression of Oct4 and Cdh1 in the epiblast at E7.5 to provide a baseline starting figure. We then compared this with expression of Oct4 and Cdh1 within the developing neural tube at three developmental stages spaced approximately four hours apart, spanning the time period over which Oct4 is lost from the developing neural tube, i.e., during formation of the first 12 somites. Note that our timing is assessed by somite number, and that the first several somites form in the mouse at hourly intervals (Tam 1981).</p><p>All antibody staining was performed simultaneously to minimize artifactual variation between time points, but we also directly controlled for technical variability between sections by quantifying E-Cadherin expression in the surface ectoderm immediately adjacent to the neural tube and confirming that these measurements are similar across all time points.</p><p>These new data confirm a striking correlation between the decline of Oct4 and the decline of Cdh1 within the neural tube.</p><p><italic>Also, previous work from Derek van der Kooy's lab has shown that Cdh1 is expressed in the neural tube at later timepoints (Karpowicz et al., J. Neurosci., 2007). Do the authors also find this</italic>?</p><p>It is indeed interesting that E-Cadherin becomes re-expressed in foetal and adult neural stem cells as reported by Karpowicz et al. We have not examined these later stages of foetal and adult development ourselves as our focus is on the transition from pluripotency to lineage commitment. Interestingly, these authors also report a steep decline in E-Cadherin expression in the early neural tube by E9.0 (see <xref ref-type="fig" rid="fig2">Figure 2E</xref> in [<xref ref-type="bibr" rid="bib18">Karpowicz et al., 2007</xref>]). This fit exactly with our own observations (<xref ref-type="fig" rid="fig4">Figure 4C,D</xref>) and we apologise for failing to reference this work in our original manuscript:Karpowiczet al.are cited in our revised manuscript and we modify our text to clarify that “Cdh1 is downregulated during the early stages of neural tube formation”.</p><p><italic>5) As a general comment, many of the figure legends are unclear. For example, in</italic> <xref ref-type="fig" rid="fig4"><italic>Figure 4A</italic></xref><italic>, this appears to be the levels of expression of the various genes that are indicated in individual cells taken at 3 days that are sorted out for their relative levels of these markers. Is that the case? And how did the authors obtain the R values for correlation with Cdh1 as shown in 4B?</italic> <xref ref-type="fig" rid="fig5"><italic>Figure 5E</italic></xref> <italic>cold also benefit from better labeling. Thus, in general, clarification in the figure legends would significantly improve “readability”</italic>.</p><p>We have improved the figure legends and hope that they are now easier to follow.</p></body></sub-article></article>