Permalink
Switch branches/tags
Nothing to show
Find file
Fetching contributors…
Cannot retrieve contributors at this time
1 lines (1 sloc) 126 KB
<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d1 20130915//EN" "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1d1" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="hwp">eLife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">01473</article-id><article-id pub-id-type="doi">10.7554/eLife.01473</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research article</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>Identification of Redeye, a new sleep-regulating protein whose expression is modulated by sleep amount</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-7727"><name><surname>Shi</surname><given-names>Mi</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-7728"><name><surname>Yue</surname><given-names>Zhifeng</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-7729"><name><surname>Kuryatov</surname><given-names>Alexandre</given-names></name><xref ref-type="aff" rid="aff2"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-7730"><name><surname>Lindstrom</surname><given-names>Jon M</given-names></name><xref ref-type="aff" rid="aff2"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-4923"><name><surname>Sehgal</surname><given-names>Amita</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="aff" rid="aff2"/><xref ref-type="corresp" rid="cor1">*</xref><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><institution>Howard Hughes Medical Institute, University of Pennsylvania</institution>, <addr-line><named-content content-type="city">Philadelphia</named-content></addr-line>, <country>United States</country></aff><aff id="aff2"><institution content-type="dept">Department of Neuroscience, Perelman School of Medicine</institution>, <institution>University of Pennsylvania</institution>, <addr-line><named-content content-type="city">Philadelphia</named-content></addr-line>, <country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Griffith</surname><given-names>Leslie C</given-names></name><role>Reviewing editor</role><aff><institution>Brandeis University</institution>, <country>United States</country></aff></contrib></contrib-group><author-notes><corresp id="cor1"><label>*</label>For correspondence: <email>amita@mail.med.upenn.edu</email></corresp></author-notes><pub-date date-type="pub" publication-format="electronic"><day>04</day><month>02</month><year>2014</year></pub-date><pub-date pub-type="collection"><year>2014</year></pub-date><volume>3</volume><elocation-id>e01473</elocation-id><history><date date-type="received"><day>04</day><month>09</month><year>2013</year></date><date date-type="accepted"><day>12</day><month>12</month><year>2013</year></date></history><permissions><copyright-statement>© 2013, Shi et al</copyright-statement><copyright-year>2013</copyright-year><copyright-holder>Shi et al</copyright-holder><license xlink:href="http://creativecommons.org/licenses/by/3.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/3.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife01473.pdf"/><related-article ext-link-type="doi" id="ra1" related-article-type="commentary" xlink:href="10.7554/eLife.02087"/><abstract><object-id pub-id-type="doi">10.7554/eLife.01473.001</object-id><p>In this study, we report a new protein involved in the homeostatic regulation of sleep in <italic>Drosophila</italic>. We conducted a forward genetic screen of chemically mutagenized flies to identify short-sleeping mutants and found one, <italic>redeye</italic> (<italic>rye</italic>) that shows a severe reduction of sleep length. Cloning of <italic>rye</italic> reveals that it encodes a nicotinic acetylcholine receptor α subunit required for <italic>Drosophila</italic> sleep. Levels of RYE oscillate in light–dark cycles and peak at times of daily sleep. Cycling of RYE is independent of a functional circadian clock, but rather depends upon the sleep homeostat, as protein levels are up-regulated in short-sleeping mutants and also in wild type animals following sleep deprivation. We propose that the homeostatic drive to sleep increases levels of RYE, which responds to this drive by promoting sleep.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.001">http://dx.doi.org/10.7554/eLife.01473.001</ext-link></p></abstract><abstract abstract-type="executive-summary"><object-id pub-id-type="doi">10.7554/eLife.01473.002</object-id><title>eLife digest</title><p>Almost all animals need to sleep, including most insects. In experiments in the 1980s, a group of rats that were completely deprived of sleep died within only a few weeks. Sleep has been implicated in processes including tissue repair, memory consolidation and, more recently, the removal of waste materials from the brain. However, a full understanding of why we sleep is still lacking.</p><p>As anyone who has experienced jetlag can testify, the timing of the sleep/wake cycle is governed by the circadian clock, which leads us to feel sleepy at certain points of the day–night cycle and alert at others. The duration of sleep is regulated by a second process called sleep/wake homeostasis. The longer we remain awake, the more the body’s need for sleep—or ‘sleep drive’—increases, until it becomes almost impossible to stay awake any longer. Whereas many components of the circadian clock have been identified, relatively little is known about the molecular basis of this second process.</p><p>Now, Shi et al. have identified a key component of the sleep/wake homeostatic system using the fruit fly and genetic model organism, <italic>Drosophila</italic>. Flies with a mutation in one particular gene, subsequently named <italic>redeye</italic>, were found to sleep only half as long as normal flies. While the insects were able to fall asleep, they would wake again only a few minutes later.</p><p><italic>Redeye</italic> encodes a subunit of a receptor that has previously been implicated in the control of wakefulness, known as the nicotinic acetylcholine receptor. Mutant flies had normal circadian rhythms, suggesting that their sleep problems were the result of disrupted sleep/wake homeostasis. Consistent with this, levels of redeye showed two daily peaks, one corresponding to night-time sleep and the second to the time at which flies would normally take an afternoon siesta. This suggests that redeye signals an acute need for sleep, and then helps to maintain sleep once it is underway.</p><p>While redeye is not thought to be the factor that triggers sleep per se, it is directly under control of the sleep homeostat, and may be a useful biomarker for sleep deprivation. The fact that <italic>redeye</italic> was identified in fruit flies, a species whose genome has been fully sequenced, opens up the possibility of further studies to identify the genetic basis of sleep regulation.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.002">http://dx.doi.org/10.7554/eLife.01473.002</ext-link></p></abstract><kwd-group kwd-group-type="author-keywords"><title>Author keywords</title><kwd>sleep</kwd><kwd>acetylcholine signaling</kwd><kwd>cycling</kwd><kwd>Sleepless/Lynx-1</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>D. melanogaster</italic></kwd></kwd-group><funding-group><award-group id="par-1"><funding-source><institution-wrap><institution>Howard Hughes Medical Institute</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Sehgal</surname><given-names>Amita</given-names></name></principal-award-recipient></award-group><funding-statement>The funder had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name><meta-value>2</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>A gene found in <italic>Drosophila</italic>, and named <italic>redeye</italic>, encodes a protein that accumulates during sleep deprivation and forms part of the homeostatic system that promotes and maintains sleep.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Sleep is a common and prominent behavior in almost all vertebrate animals and also in most invertebrates (<xref ref-type="bibr" rid="bib3">Cirelli, 2009</xref>; <xref ref-type="bibr" rid="bib24">Sehgal and Mignot, 2011</xref>). The function of sleep is a mystery, but it is surely of great importance to animals, as prolonged sleep deprivation can lead to death. Anatomical studies in mammals and birds have revealed brain structures and neurotransmitters that regulate sleep and wakefulness (<xref ref-type="bibr" rid="bib23">Saper et al., 2010</xref>). However, our understanding of the molecular mechanisms that drive the need to sleep is still in its infancy, partially due to the challenge of performing genetic experiments with mammalian models. In the past decade, several premier genetic organisms have been introduced into the sleep field, including fruit flies, worms and zebra fish. Mammalian counterparts of some sleep components identified in these model animals also regulate sleep (<xref ref-type="bibr" rid="bib8">Joho et al., 2006</xref>), which argues that (i) behavioral genetics in lower organisms provides an efficient tool to identify sleep components, (ii) at least some of the mechanisms underlying sleep are conserved through evolution.</p><p>A two-process model for sleep regulation has been widely accepted by the sleep field. Process C (the circadian clock) controls the timing, in other words the onset and offset of sleep, whereas process S (the sleep homeostat) regulates sleep duration based on the sleep pressure built up during prior wakefulness (<xref ref-type="bibr" rid="bib2">Borbely, 1982</xref>). This simple model explains sleep related phenomena, including sleep rebound after sleep deprivation. Molecular mechanisms of circadian control have been well characterized (<xref ref-type="bibr" rid="bib30">Zheng and Sehgal, 2012</xref>), but, as noted above, relatively little is known about process S. Forward genetic screens in <italic>Drosophila</italic> have led to the identification of several mutants with altered sleep length, but while the genes implicated by these mutants are required for implementation of sleep drive, they have not yet been directly linked to this drive (<xref ref-type="bibr" rid="bib24">Sehgal and Mignot, 2011</xref>).</p><p>Using a forward genetic screen, we identified a new sleep mutant we termed <italic>redeye</italic> (<italic>rye</italic>), which is directly controlled by the homeostatic drive to sleep. The <italic>rye</italic> mutation maps to a nicotinic acetylcholine receptor (nAChR), which interacts with a previously identified sleep-regulating protein, SLEEPLESS (SSS). Levels of RYE are expressed cyclically, in conjunction with the sleep state, and reflect sleep need such that they are up-regulated after sleep deprivation and in short-sleeping mutants. We conclude that homeostatic sleep drive promotes sleep at least in part by increasing expression of RYE.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Identification of redeye, a short-sleeping mutant</title><p>As previous screens have identified sleep components on the X chromosome and the second chromosome (<xref ref-type="bibr" rid="bib4">Cirelli et al., 2005</xref>; <xref ref-type="bibr" rid="bib9">Koh et al., 2008</xref>; <xref ref-type="bibr" rid="bib26">Stavropoulos and Young, 2011</xref>), we sought to identify sleep-altering mutations on the third chromosome in <italic>Drosophila</italic>. To this end, we generated a stock of iso31 (<xref ref-type="bibr" rid="bib22">Ryder et al., 2004</xref>) flies carrying a newly isogenized third chromosome and treated males of this stock with 10–25 mM ethyl-methanesulfonate (EMS). Individual male progeny were bred to achieve homozygosity of the third chromosome, and females of the F3 generation were tested for daily sleep patterns in the presence of light:dark cycles (<xref ref-type="bibr" rid="bib9">Koh et al., 2008</xref>). As seen in previous screens (<xref ref-type="bibr" rid="bib9">Koh et al., 2008</xref>), sleep amounts were normally distributed in the 1857 lines assayed (<xref ref-type="fig" rid="fig1">Figure 1A</xref>, <xref ref-type="supplementary-material" rid="SD1-data">Figure 1—source data 1</xref>). Two homozygous mutant lines showed a severe reduction of sleep length, and we focused on one of these that we named <italic>redeye</italic> (<italic>rye</italic>). <italic>rye</italic> homozygotes show a &gt;50% reduction in both daytime and night-time sleep (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). The activity (average number of beam crossings during periods of activity) of <italic>rye</italic> mutants is comparable with that of wild type controls, suggesting it is not a hyperactive mutant (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). <italic>rye</italic> heterozygotes have slightly less sleep than wild type, suggesting that the <italic>rye</italic> mutation is partially dominant (<xref ref-type="fig" rid="fig1">Figure 1B,C</xref>). The dramatic reduction of baseline sleep results largely from a shortening of the average sleep episode duration (<xref ref-type="fig" rid="fig1">Figure 1D</xref>), which is indicative of a defect in sleep maintenance. The average number of sleep episodes at night is actually increased significantly in <italic>rye</italic> mutants, perhaps because the sleep homeostat senses sleep loss and compensates by initiating more bouts. We also assayed <italic>rye</italic> mutants in sleep deprivation assays and found that they did not lose much additional sleep in response to mechanical stimulation (data not shown). We surmise that an inability to sustain sleep bouts leads to the buildup of high sleep need in <italic>rye</italic> mutants, which makes them resist any further sleep loss.<fig id="fig1" position="float"><object-id pub-id-type="doi">10.7554/eLife.01473.003</object-id><label>Figure 1.</label><caption><title>Identification of a short sleep mutant, <italic>redeye</italic> (<italic>rye</italic>), through a chemical mutagenesis (EMS) screen.</title><p>(<bold>A</bold>) Histogram depicting average sleep levels in females from homozygous EMS-mutagenized lines (n = 1857). The mean sleep value for each mutant was calculated by assaying sleep in 4–8 individual flies in the presence of 12 hr L-12 hr D cycles. Average sleep for all lines is indicated on the X axis in increments of 25 min. The Y axis depicts the number of mutant lines within each group. The dashed lines mark the sleep values that correspond to plus/minus 3× standard deviation of the mean. The arrowhead indicates the <italic>redeye</italic> mutant. (<bold>B</bold>) Top: average activity pattern of females from control lines and from <italic>rye</italic> mutants recorded in 12hr L-D cycles (n = 14–16 in 5 days). Bottom: sleep profiles with standard error bars. Black: lines isogenized on the 3<sup>rd</sup> chromosome for chemical mutagenesis; Blue: flies heterozygous for <italic>rye</italic> and the isogenized control chromosome; Orange: <italic>rye</italic> homozygotes. (<bold>C</bold>) Mean values of total sleep, daytime sleep and night-time sleep for <italic>rye</italic> mutants (<xref ref-type="supplementary-material" rid="SD1-data">Figure 1—source data 1</xref>). For each genotype 14–16 flies were assayed over a 5 day period. Bars represent standard error. One-way ANOVA was performed followed by Tukey post hoc analysis. * represents p&lt;0.05, **p&lt;0.01 and ***p&lt;0.001. (<bold>D</bold>) Sleep quality of <italic>rye</italic> mutants: Daytime and night-time sleep episode length and episode number are plotted in the box-and-whisker diagram (<xref ref-type="supplementary-material" rid="SD1-data">Figure 1—source data 1</xref>). The middle line represents the median value; Bottom and top line of each box represent 25% and 75% respectively; Bottom bar and top bar represent 5% and 95% respectively. ns: not significant, ***p&lt;0.001.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.003">http://dx.doi.org/10.7554/eLife.01473.003</ext-link></p><p><supplementary-material id="SD1-data"><object-id pub-id-type="doi">10.7554/eLife.01473.004</object-id><label>Figure 1—Source data 1.</label><caption><title>Measurement of sleep duration for all EMS mutants and sleep analysis of <italic>rye</italic> mutants.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.004">http://dx.doi.org/10.7554/eLife.01473.004</ext-link></p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife01473s001.xlsx"/></supplementary-material></p></caption><graphic xlink:href="elife01473f001"/></fig></p></sec><sec id="s2-2"><title>Normal circadian rhythms in rye homozygotes</title><p>As the circadian clock regulates the timing of sleep and some clock mutants show reduced sleep (<xref ref-type="bibr" rid="bib7">Hendricks et al., 2003</xref>), we also assayed <italic>rye</italic> flies for defects in circadian rhythms. These endogenously generated rhythms are best monitored under constant conditions, in the absence of cyclic environmental cues, so we monitored behavior in constant darkness (DD). <italic>rye</italic> mutants display robust rest:activity rhythms in DD (∼62% rhythmicity) despite showing prolonged duration of activity (<xref ref-type="fig" rid="fig2">Figure 2A</xref>; <xref ref-type="table" rid="tbl1">Table 1</xref>). Of the ‘arrhythmic’ <italic>rye</italic> homozygotes detected, half (6/11) actually displayed a rhythm of ∼12 hr period length, which likely resulted from persistence of bimodal behavior (typically seen in light:dark) in DD. Thus, most <italic>rye</italic> homozygotes are rhythmic. Consistent with the intact circadian behavior, circadian cycling of the clock protein, PERIOD (PER), is normal in central clock cells of <italic>rye</italic> mutants. The peaks and troughs of expression, as well as the subcellular localization, at different times of day are similar to those in <italic>iso</italic> controls (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). Thus, PER is largely nuclear at ZT20, entirely nuclear at ZT2, expressed at low levels at ZT8 and undetectable at ZT14. We conclude that only the homeostatic regulation of sleep is affected in <italic>rye</italic> mutants.<fig id="fig2" position="float"><object-id pub-id-type="doi">10.7554/eLife.01473.005</object-id><label>Figure 2.</label><caption><title><italic>rye</italic> homozygotes display normal circadian rhythms and clock protein cycling.</title><p>(<bold>A</bold>) Double plotted activity records of <italic>iso</italic> controls and <italic>rye</italic> homozygotes in DD. Rhythmic, but prolonged cross-beam activity was recorded in <italic>rye</italic> homozygotes. (<bold>B</bold>) Immunostaining of PERIOD in ventral lateral neurons (LNvs) of <italic>iso</italic> controls and <italic>rye</italic> homozygotes at CT time points on the second day of DD following LD entrainment. PER oscillates in these clock neurons in <italic>iso</italic> as well as in <italic>rye</italic> homozygotes. PDF labels the small and large LNvs.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.005">http://dx.doi.org/10.7554/eLife.01473.005</ext-link></p></caption><graphic xlink:href="elife01473f002"/></fig><table-wrap id="tbl1" position="float"><object-id pub-id-type="doi">10.7554/eLife.01473.006</object-id><label>Table 1.</label><caption><p>Rhythmic behavior of rye homozygotes in constant darkness</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.006">http://dx.doi.org/10.7554/eLife.01473.006</ext-link></p></caption><table frame="hsides" rules="groups"><thead><tr><th>Genotype</th><th>Rhythmicity% (n)<xref ref-type="table-fn" rid="tblfn1">*</xref></th><th>Period ± SEM (h)<xref ref-type="table-fn" rid="tblfn2">†</xref></th><th>FFT ± SEM<xref ref-type="table-fn" rid="tblfn2">†</xref></th></tr></thead><tbody><tr><td><italic>W</italic><sup><italic>1118</italic></sup> (<italic>iso</italic>)</td><td>93.8% (30/32)</td><td>23.21 ± 0.04</td><td>0.051 ± 0.005</td></tr><tr><td><italic>rye</italic></td><td>62.1% (18/29)</td><td>23.66 ± 0.09</td><td>0.054 ± 0.005</td></tr></tbody></table><table-wrap-foot><fn id="tblfn1"><label>*</label><p>Flies were entrained to a light–dark cycle (12 hr/12 hr) for 3 days before being moved into constant darkness (DD). Behavior was analyzed from day 3 to day 11 in DD, and flies with a fast fourier transform value (FFT) above 0.01 were considered rhythmic.</p></fn><fn id="tblfn2"><label>†</label><p>Period lengths and FFT values of rhythmic flies are listed as average value plus minus the standard error of mean (SEM).</p></fn></table-wrap-foot></table-wrap></p></sec><sec id="s2-3"><title>Identification of rye as an α subunit of the nicotinic acetylcholine receptor</title><p>We identified the sleep-altering lesion in <italic>rye</italic> mutants through a combination of recombination mapping and deep-sequencing. Despite starting with a newly isogenized line, deep-sequencing identified many nucleotide changes in the <italic>rye</italic> background relative to the parental control and so considerable mapping was required to pinpoint the relevant mutation. Meiotic recombination analysis positioned <italic>rye</italic> between two genetic markers, <italic>thread</italic> and <italic>curled,</italic> in the centromeric region of the 3<sup>rd</sup> chromosome. Further mapping studies, using self identified single nucleotide polymorphism (SNP) markers, narrowed it down to ∼11 mega-bases (<xref ref-type="fig" rid="fig3">Figure 3A</xref>, <xref ref-type="supplementary-material" rid="SD2-data">Figure 3—source data 1</xref>). For finer localization, we utilized the genome-wide sequence data, which provided 40× and 10× genomes worth of nucleotide sequence, corresponding to 95% and 88% coverage, for the <italic>rye</italic> and <italic>iso31</italic> genomes respectively. Following alignment with the published <italic>Drosophila</italic> genome, unique nucleotide polymorphisms present in <italic>rye</italic> mutants were pooled together as potential EMS-induced mutations (n = 26,224). Within the 11 Mb region identified through recombination mapping, there were 1457 potential mutations, but only nine that produced an amino-acid change in coding regions. Sanger sequencing allowed us to exclude seven of these. Two turned out to be deep-sequencing errors and five polymorphisms were also present in the wild type <italic>iso</italic> stock but not detected due to the low coverage of deep-sequencing in this stock. One polymorphism, in a gene annotated CG7320, was at a site that was also polymorphic in <italic>iso</italic>, although the amino acid change was different in the two strains. Because of the change in <italic>iso</italic>, which does not produce a sleep phenotype, we considered CG7320 a less likely candidate for <italic>rye</italic>. The last of the nine changes identified by deep-sequencing was a C-T transition (typical for EMS-induced mutations) that leads to a threonine to methionine change in CG12414 and is present only in <italic>rye</italic> mutants (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). CG12414 encodes an α subunit of a nicotinic acetylcholine receptor (nAchR) (<xref ref-type="bibr" rid="bib12">Lansdell and Millar, 2000</xref>). Five alternatively spliced variants produced by this gene are predicted to generate three possible open reading frames with one (pC/pG) containing an intact ligand bind domain (LBD) (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). The predicted protein is homologous to several nAChR subunits, including α3, α2, α6, α4 and α7 in order of similarity. Alignment of CG12414 with α3 and α7 using the ClustalW2 algorithm shows that the <italic>rye</italic> mutation is at the junction between the LBD and the trans-membrane domain (TM) (<xref ref-type="fig" rid="fig3">Figure 3D,E</xref>). Interestingly, this junction region is highly conserved across species and the specific threonine mutated in <italic>rye</italic> is conserved in all α7 subunits (<xref ref-type="fig" rid="fig3">Figure 3D</xref>).<fig id="fig3" position="float"><object-id pub-id-type="doi">10.7554/eLife.01473.007</object-id><label>Figure 3.</label><caption><title>Genetic mapping and genome-wide deep-sequencing reveal a missense mutation in a nicotinic acetylcholine receptor α subunit gene in <italic>rye</italic> mutants.</title><p>(<bold>A</bold>) Through genetic mapping, using classical phenotypic markers and newly identified SNP markers, <italic>rye</italic> was mapped between two SNP markers (SNP_L and SNP_R) near the centromere on the 3<sup>rd</sup> chromosome. (<bold>B</bold>) Paired-end genomic deep-sequencing of <italic>rye</italic> mutants identified a missense mutation in CG12414. We confirmed this through Sanger sequencing. This C-T/G-A transition that generated the <italic>rye</italic><sup>T227M</sup> allele is typical of EMS-induced mutations. (<bold>C</bold>) Schematic representation of the <italic>rye</italic> candidate gene, a nicotinic acetylcholine receptor (CG12414: nAcRα-80B). The gene spans ∼100 kb with alternative splicing predicted to produce five transcripts (RC-RG). The spliced forms are predicted to translate into three proteins isoforms (pC-pG). pC(pG) produces the largest protein with the longest ligand binding domain (LBD). (<bold>D</bold>) Alignment of the partial sequence of <italic>Drosophila</italic> RYE with nAChR α3 and α7 subunits in other animals using ClustalW2. The region shown is at the boundary of the ligand binding domain (LBD) and transmembrane domain (TM), and is evolutionarily conserved. T227 in RYE is marked in bold form. ‘*’ identity; ‘:’ high similarity; ‘.’ similarity. (<bold>E</bold>) Protein sequence analysis predicts four transmembrane domains (TM) in RYE, which is typical of most nAChR proteins. RYE appears to contain a single ligand binding domain (LBD) in the extracellular region, and four TMs with three loop regions (L1-L3). The mutated threonine227 is in the LBD, close to the beginning of the TM.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.007">http://dx.doi.org/10.7554/eLife.01473.007</ext-link></p><p><supplementary-material id="SD2-data"><object-id pub-id-type="doi">10.7554/eLife.01473.008</object-id><label>Figure 3—Source data 1.</label><caption><title>Recombination mapping of the <italic>rye</italic> mutation using a chromosome marked with visible markers <italic>h</italic>,<italic>th</italic>,<italic>cu</italic>,<italic>sr</italic>,<italic>e</italic>, and using SNP markers.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.008">http://dx.doi.org/10.7554/eLife.01473.008</ext-link></p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife01473s002.xlsx"/></supplementary-material></p></caption><graphic xlink:href="elife01473f003"/></fig></p></sec><sec id="s2-4"><title>Functional analysis of rye</title><p>The genetic mapping and deep-sequencing data combined implicated CG12414 as a candidate gene responsible for the <italic>rye</italic> sleep phenotype<italic>.</italic> To verify this function for CG12414, we attempted to rescue <italic>rye</italic> mutants with a CG12414 transgene. To drive expression in areas that normally express this gene, we cloned the CG12414 promoter region (1.8 kb) and generated a GAL4 construct. This GAL4 is expressed broadly in the <italic>Drosophila</italic> brain (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). We also cloned the CG12414 cDNA into a UAS construct and crossed the GAL4 and UAS transgenes into an <italic>iso</italic><sup><italic>31</italic></sup> stock to ensure a homogenous genetic background. These transgenes were then introduced into <italic>rye</italic> mutants. While either transgene alone did not alter the <italic>rye</italic> short sleep phenotype, the <italic>rye</italic> promoter driving RYE expression (<italic>ryeP</italic> &gt; <italic>uas-rye</italic>) partially rescued the mutant phenotype and restored total sleep to levels seen in <italic>rye</italic> heterozygotes (<xref ref-type="fig" rid="fig4">Figure 4B</xref>). This is expected, given that <italic>rye</italic><sup>T227M</sup> is partially dominant over wild type. In a wild type background, <italic>ryeP &gt; uas-rye</italic> does not increase sleep length (data not shown), suggesting that the increase in sleep is specific to the mutant. Thus, we identified the gene responsible for the short sleep phenotype in <italic>rye</italic> mutants, and henceforth refer to this gene CG12414, previously called nAChR-80B, as <italic>redeye.</italic><fig id="fig4" position="float"><object-id pub-id-type="doi">10.7554/eLife.01473.009</object-id><label>Figure 4.</label><caption><title>An alpha subunit of the nicotinic acetylcholine receptor accounts for the <italic>rye</italic> mutant phenotype.</title><p>(<bold>A</bold>) Expression pattern of ryeP-GAL4. Rye-GAL4 was used to express nGFP, which is visualized with an anti-GFP antibody. The anti-nc82 staining marks the neuropil. (<bold>B</bold>) Expression of the alpha subunit, as described in <xref ref-type="fig" rid="fig3">Figure 3</xref>, increases sleep duration in <italic>rye</italic> mutants (<xref ref-type="supplementary-material" rid="SD3-data">Figure 4—source data 1</xref>). Left: sleep profiles, with standard error, of <italic>rye</italic> mutants and mutants expressing a UAS construct of the putative <italic>rye</italic> cDNA under control of its own promoter (<italic>ryeP-Gal4)</italic> in a 12:12 LD cycle. Right: quantification of sleep length. **p&lt;0.01, ***p&lt;0.001. (<bold>C</bold>) Reduction of <italic>rye</italic> expression in <italic>rye</italic> neurons through the expression of an RNAi construct, together with Dicer2, diminishes sleep length (<xref ref-type="supplementary-material" rid="SD3-data">Figure 4—source data 1</xref>). Left: sleep profile in a 12:12 LD cycle. Right: quantification of sleep length. *p&lt;0.05. (<bold>D</bold>) Western blot analysis shows reduced expression of RYE when actin-GAL4 is used to drive <italic>rye</italic> RNAi (VDRC#11392) with Uas-Dicer2 in female and male flies.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.009">http://dx.doi.org/10.7554/eLife.01473.009</ext-link></p><p><supplementary-material id="SD3-data"><object-id pub-id-type="doi">10.7554/eLife.01473.010</object-id><label>Figure 4—Source data 1.</label><caption><title>Sleep behaviour of transgenically rescued <italic>rye</italic> mutants and <italic>rye</italic> RNAi lines.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.010">http://dx.doi.org/10.7554/eLife.01473.010</ext-link></p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife01473s003.xlsx"/></supplementary-material></p></caption><graphic xlink:href="elife01473f004"/></fig></p><p>To further characterize <italic>rye</italic> function, we knocked down RYE expression through RNA interference. A <italic>rye</italic> RNAi line (#11392) from the VDRC stock center in Vienna was crossed into the <italic>ryeP-</italic>GAL4 line along with a UAS-Dicer2 transgene, included to improve efficacy of the RNAi. Levels of RYE were reduced (<xref ref-type="fig" rid="fig4">Figure 4D</xref>), as was the total sleep length (<xref ref-type="fig" rid="fig4">Figure 4C</xref>). Since <italic>rye</italic><sup>T227M</sup> reduces sleep as well (<xref ref-type="fig" rid="fig1">Figure 1</xref>), these data suggest that the T227M mutant allele causes loss of RYE function. The sleep phenotype produced by <italic>rye</italic> knock-down is rather mild in comparison with the phenotype of the homozygous <italic>rye</italic> mutant, possibly due to inefficient knockdown in relevant cells or because <italic>rye</italic><sup><italic>T227M</italic></sup> is a dominant-negative mutation. The nicotinic acetylcholine receptor forms a pentameric structure, consisting of five homo-oligomeric or hetero-oligomeric subunits (<xref ref-type="bibr" rid="bib18">Miwa et al., 2011</xref>), so a dominant negative mutation in any one subunit may well interfere with activity of the complex.</p></sec><sec id="s2-5"><title>RYE interacts with SSS</title><p>We next addressed if <italic>rye</italic> interacts with other known sleep mutants, in particular with a mutant we identified previously, <italic>sleepless (sss</italic>), that has an extreme short-sleeping phenotype (<xref ref-type="bibr" rid="bib9">Koh et al., 2008</xref>). While transheterozygotes of <italic>rye</italic> and <italic>sss (sss</italic>/+; <italic>rye</italic>/+) showed sleep duration comparable to that of <italic>rye/+</italic> alone (data not shown), <italic>rye</italic> heterozygotes carrying a genomic <italic>sss</italic> transgene, which increases SSS expression above that of wild type controls, showed a further reduction of sleep (<xref ref-type="fig" rid="fig5">Figure 5A</xref>). The effect was observed with three independent insertions of the <italic>sss</italic> transgene, indicating that it was not due to insertion site effects (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). We note that this <italic>sss</italic> transgene does not have a significant effect on sleep in wild type flies although it completely rescues the sleep phenotype of <italic>sss</italic> mutants (<xref ref-type="bibr" rid="bib9">Koh et al., 2008</xref>). Thus, the effect is specific to <italic>rye</italic> mutants.<fig id="fig5" position="float"><object-id pub-id-type="doi">10.7554/eLife.01473.011</object-id><label>Figure 5.</label><caption><title>Overexpression of <italic>sss</italic> exacerbates the <italic>rye</italic> phenotype by repressing RYE activity.</title><p>(<bold>A</bold>) An extra copy of SSS reduces sleep in <italic>rye</italic> heterozygotes. Sleep profile of <italic>rye</italic> heterozygotes with or without a genomic <italic>sss</italic> transgenic line inserted on the third chromosome (<italic>sss</italic>TG2) and of <italic>sss</italic> transgenics alone. (<bold>B</bold>) Quantification of sleep in the genotypes as indicated (<xref ref-type="supplementary-material" rid="SD4-data">Figure 5—source data 1</xref>). TG1 and TG3 are additional independent genomic <italic>sss</italic> transgenes inserted on the 3<sup>rd</sup> and X chromosomes respectively. Sleep reduction was observed in <italic>rye</italic> transheterozygotes with all three <italic>sss</italic> transgenic lines. *p&lt;0.05. (<bold>C</bold>) Heterologous expression of SSS reduces current following ACh application in <italic>Xenopus</italic> oocytes expressing <italic>Drosophila</italic> RYE and human nAChR β2 (<xref ref-type="supplementary-material" rid="SD4-data">Figure 5—source data 1</xref>). *p&lt;0.05. (<bold>D</bold>) Heterologous expression of SSS reduces current following ACh application in <italic>Xenopus</italic> oocytes expressing human nAChR α4β2 (<xref ref-type="supplementary-material" rid="SD4-data">Figure 5—source data 1</xref>). ***p&lt;0.001.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.011">http://dx.doi.org/10.7554/eLife.01473.011</ext-link></p><p><supplementary-material id="SD4-data"><object-id pub-id-type="doi">10.7554/eLife.01473.012</object-id><label>Figure 5—Source data 1.</label><caption><title>Sleep analysis of <italic>rye</italic> mutants overexpressing sss, and whole-cell membrane current recording of <italic>Xenopus</italic> oocytes.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.012">http://dx.doi.org/10.7554/eLife.01473.012</ext-link></p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife01473s004.xlsx"/></supplementary-material></p></caption><graphic xlink:href="elife01473f005"/></fig></p><p>SSS is a GPI-anchored protein that regulates the Shaker potassium channel and its predicted structure resembles that of a specific class of toxins (<xref ref-type="bibr" rid="bib29">Wu et al., 2010</xref>; <xref ref-type="bibr" rid="bib5">Dean et al., 2011</xref>). It is most similar to the mammalian Lynx-1 protein, which is known to inhibit activity of the nicotinic acetylcholine receptor (<xref ref-type="bibr" rid="bib18">Miwa et al., 2011</xref>). The fact that SSS exacerbated the phenotype of flies heterozygous for <italic>rye</italic>, which have reduced activity of nAChR, suggested that SSS also regulates nAChRs. We tested a possible Lynx-1-like function of SSS in regulating nAChR activity by using a heterologous expression system, specifically <italic>Xenopus laveis</italic> oocytes. For functional expression of wild type RYE, we expressed it with a human β2 subunit, as insect β subunits typically do not work in heterologous systems (<xref ref-type="bibr" rid="bib17">Millar and Lansdell, 2010</xref>). cRNAs encoding <italic>sss</italic>, wild type <italic>rye</italic> and human β2 were injected into oocytes, and 4–7 days later whole cell currents were measured following application of ACh (<xref ref-type="bibr" rid="bib11">Kuryatov and Lindstrom, 2011</xref>). Heterologous expression of insect nAChRs has, in general, been challenging (<xref ref-type="bibr" rid="bib16">Millar, 2009</xref>), which accounts for the low current values observed (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). However, we still detected a significant reduction of nAChR current upon co-expression with SSS (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). We also co-expressed in vitro transcribed <italic>sss</italic> and human α4 and β2 subunits and found that SSS also inhibits the robust current produced by the human receptor complex (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). Thus, in addition to its sleep-promoting role reported previously, SSS may also promote wake by repressing activity of nAChRs. As discussed below, loss of the sleep-promoting role has a dominant effect in <italic>sss</italic> mutants.</p></sec><sec id="s2-6"><title>RYE is expressed cyclically in association with the sleep state</title><p>We next asked if levels of <italic>rye</italic> vary over the course of the day. Groups of wild type flies were housed in a 12 hr-light and 12 hr-dark incubator and harvested at different Zeitgeber times (ZT). Zeitgeber time defines time based on the environmental stimulus, so ZT0 corresponds to light-on and ZT12 to light-off. RNA was extracted and subjected to quantitative PCR analyses. While <italic>period</italic> (<italic>per</italic>), a well-known circadian clock component, oscillates with a circadian rhythm (<xref ref-type="bibr" rid="bib30">Zheng and Sehgal, 2012</xref>), <italic>rye</italic> mRNA levels were found to be constant (<xref ref-type="fig" rid="fig6">Figure 6A</xref>).<fig-group><fig id="fig6" position="float"><object-id pub-id-type="doi">10.7554/eLife.01473.013</object-id><label>Figure 6.</label><caption><title>The RYE protein is expressed cyclically in association with the sleep state, but independently of the circadian clock.</title><p>(<bold>A</bold>) Quantitative PCR analyses show oscillations of <italic>per</italic> mRNA (left panel), but constant levels of <italic>rye</italic> mRNA (right panel). <italic>actin</italic> was used as a normalization control (<xref ref-type="supplementary-material" rid="SD5-data">Figure 6—source data 1</xref>). (<bold>B</bold>) Left: a representative western blot of head extracts from wild type flies shows cyclic expression of RYE with two daily peaks, in the middle of the day (ZT6-10) and in the middle of the night (ZT18-22), corresponding to the sleep state (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). PER, in contrast, shows only one daily peak. MAPK was used to control for loading. Right: densitometry quantification of western blots with error bars representing standard error (n = 8). RYE value at ZT0 is set as 1 (<xref ref-type="supplementary-material" rid="SD5-data">Figure 6—source data 1</xref>). *p&lt;0.05, **p&lt;0.01. (<bold>C</bold>) RYE cycling is similar to wild type in <italic>Clk</italic><sup><italic>jrk</italic></sup> flies<italic>,</italic> indicating that cycling per se does not require a functional clock. However, the phase is variable, so for quantification purposes five independent experiments were split into two groups of roughly similar phase (<xref ref-type="supplementary-material" rid="SD5-data">Figure 6—source data 1</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.013">http://dx.doi.org/10.7554/eLife.01473.013</ext-link></p><p><supplementary-material id="SD5-data"><object-id pub-id-type="doi">10.7554/eLife.01473.014</object-id><label>Figure 6—Source data 1.</label><caption><title>qPCR analysis of <italic>per</italic> and <italic>rye</italic> expression during LD cycle and densitometry quantification of RYE expression.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.014">http://dx.doi.org/10.7554/eLife.01473.014</ext-link></p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife01473s005.xlsx"/></supplementary-material></p></caption><graphic xlink:href="elife01473f006"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01473.015</object-id><label>Figure 6—figure supplement 1.</label><caption><title>RYE expression in a LD cycle (repeats).</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.015">http://dx.doi.org/10.7554/eLife.01473.015</ext-link></p></caption><graphic xlink:href="elife01473fs001"/></fig><fig id="fig6s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01473.016</object-id><label>Figure 6—figure supplement 2.</label><caption><title>Supporting data for <xref ref-type="fig" rid="fig6">Figure 6C</xref>.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.016">http://dx.doi.org/10.7554/eLife.01473.016</ext-link></p></caption><graphic xlink:href="elife01473fs002"/></fig></fig-group></p><p>To examine protein levels of RYE, we generated an antibody against the cytoplasmic L3 domain of RYE (<xref ref-type="fig" rid="fig3">Figure 3E</xref>), which is the most variable region across all nAChR subunits (<xref ref-type="bibr" rid="bib13">Lindstrom, 2003</xref>). On western blots, the antibody recognizes a band (or sometimes a doublet) of ∼60 Kd, which is the size predicted for the full-length isoform. Surprisingly, in contrast to the flat mRNA levels, levels of RYE protein show a robust rhythm with two peaks each day, one at around ZT6-10 and the other at ZT18-22 (<xref ref-type="fig" rid="fig6">Figure 6B</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). Interestingly, these correspond to the two daily times of sleep, the afternoon siesta and night-time sleep (<xref ref-type="fig" rid="fig1">Figure 1B</xref>), suggesting that RYE is expressed in phase with sleep. The cycling of RYE persists in constant darkness, as do rhythms of sleep (data not shown). However, RYE does not appear to be regulated like other cycling clock components, such as PER, which usually show only one peak (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). Furthermore, we found that RYE continues to cycle in <italic>Clk</italic><sup><italic>jrk</italic></sup> flies that lack a circadian clock, although the phase of RYE expression tends to be more variable in these flies (<xref ref-type="fig" rid="fig6">Figure 6C</xref>, <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2</xref>). These data suggest that the RYE oscillation per se does not require process C of the two process model, but may depend upon process S (sleep homeostasis). However, the circadian clock may function to provide more precise timing of RYE expression, perhaps through its control of sleep onset and offset.</p></sec><sec id="s2-7"><title>Expression of RYE is under control of the sleep homeostat</title><p>Increases in RYE expression could occur as a consequence of sleep, and thereby reflect the sleep state, but in that case levels should remain high throughout the sleep state. Given that RYE levels do not remain high throughout the night or through the afternoon siesta, another possibility is that elevations in RYE correspond to sleep drive and so occur at the time of sleep onset. To test this idea, we assayed RYE expression in short-sleeping mutants. These mutants have low sleep levels, but probably have high sleep drive that cannot be implemented. As shown in <xref ref-type="fig" rid="fig7">Figure 7</xref>, for the most part RYE expression exhibits two peaks in these mutants, but the phase is more variable (<xref ref-type="fig" rid="fig7s1 fig7s2 fig7s3">Figure 7—figure supplements 1–3</xref>), indicating that defects in sleep behavior affect the RYE expression pattern. Interestingly, overall RYE values are higher in <italic>fumin</italic> (<xref ref-type="bibr" rid="bib10">Kume et al., 2005</xref>; <xref ref-type="bibr" rid="bib28">Ueno et al., 2012</xref>), <italic>sss</italic> (<xref ref-type="bibr" rid="bib9">Koh et al., 2008</xref>) and <italic>insomniac</italic> (<xref ref-type="bibr" rid="bib26">Stavropoulos and Young, 2011</xref>) mutants than in wild type controls. As noted above, the <italic>sss</italic> mutation affects channel activity, <italic>fumin</italic> is a mutation in the dopamine transporter (short sleep is thought to result from the high levels of dopamine in the synaptic cleft) and <italic>insomniac</italic> is thought to affect protein turnover. The one feature these mutants have in common is short sleep, yet they all have elevated RYE expression during an LD cycle (<xref ref-type="fig" rid="fig7">Figure 7A–C</xref>). Based upon these data, we suggest that RYE reflects sleep need. It is elevated at the time of sleep onset and is further increased in short-sleeping mutants because they have high sleep need.<fig-group><fig id="fig7" position="float"><object-id pub-id-type="doi">10.7554/eLife.01473.017</object-id><label>Figure 7.</label><caption><title>RYE levels are elevated in short-sleeping mutants.</title><p>(<bold>A</bold>) Western analyses of RYE expression over the course of a day in <italic>iso</italic> controls and <italic>fumin</italic> mutants. While RYE still cycles in <italic>fumin</italic>, the mean value of all six daily time points from three independent experiments (n = 3) shows that overall levels of RYE are higher than in wild type controls (<xref ref-type="supplementary-material" rid="SD6-data">Figure 7—source data 1</xref>). *p&lt;0.05. (<bold>B</bold>) Western analyses of RYE expression over the course of a day in <italic>iso</italic> controls and <italic>sss</italic> mutants. As in <bold>A</bold>, the quantification reflects the mean across the day from three independent experiments (n = 3). *p&lt;0.05. (<bold>C</bold>) Western analyses of RYE expression over the course of a day in <italic>iso</italic> controls and <italic>insomniac</italic> mutants. Quantification as above (n = 3). *p&lt;0.05.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.017">http://dx.doi.org/10.7554/eLife.01473.017</ext-link></p><p><supplementary-material id="SD6-data"><object-id pub-id-type="doi">10.7554/eLife.01473.018</object-id><label>Figure 7—Source data 1.</label><caption><title>Densitometry quantification of RYE expression in short sleep mutants.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.018">http://dx.doi.org/10.7554/eLife.01473.018</ext-link></p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife01473s006.xlsx"/></supplementary-material></p></caption><graphic xlink:href="elife01473f007"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01473.019</object-id><label>Figure 7—figure supplement 1.</label><caption><title>Supporting data for <xref ref-type="fig" rid="fig7">Figure 7A</xref>.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.019">http://dx.doi.org/10.7554/eLife.01473.019</ext-link></p></caption><graphic xlink:href="elife01473fs003"/></fig><fig id="fig7s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01473.020</object-id><label>Figure 7—figure supplement 2.</label><caption><title>Supporting data for <xref ref-type="fig" rid="fig7">Figure 7B</xref>.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.020">http://dx.doi.org/10.7554/eLife.01473.020</ext-link></p></caption><graphic xlink:href="elife01473fs004"/></fig><fig id="fig7s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01473.021</object-id><label>Figure 7—figure supplement 3.</label><caption><title>Supporting data for <xref ref-type="fig" rid="fig7">Figure 7C</xref>.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.021">http://dx.doi.org/10.7554/eLife.01473.021</ext-link></p></caption><graphic xlink:href="elife01473fs005"/></fig></fig-group></p><p>If the expression of RYE changes in response to the accumulation of sleep need, it should also be affected by acute sleep deprivation. We mechanically deprived flies of sleep in the second half night (6 hr) in an LD cycle, and confirmed, through the presence of a substantial sleep rebound the following morning, that the flies were successfully deprived (<xref ref-type="fig" rid="fig8">Figure 8A</xref>; <xref ref-type="bibr" rid="bib9">Koh et al., 2008</xref>). RYE levels were assayed during the 5 hr sleep rebound window. In the non-deprived control, RYE levels were low at ZT0 and high at ZT5, as noted above. Sleep-deprived flies had high levels of RYE immediately following deprivation (ZT0), but levels were low at ZT5 (<xref ref-type="fig" rid="fig8">Figure 8A</xref>, <xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref>). This fits the profile for sleep drive, which is expected to be high at the end of deprivation, but then dissipated over the course of rebound sleep.<fig-group><fig id="fig8" position="float"><object-id pub-id-type="doi">10.7554/eLife.01473.022</object-id><label>Figure 8.</label><caption><title>RYE expression is under control of the sleep homeostat.</title><p>(<bold>A</bold>) Left: sleep profile of sleep deprived flies. Blue line: non-deprived controls, Grey line: sleep deprived flies. Arrowheads point to the 6 hr sleep deprivation (SD) window (ZT18-24) and sleep rebound the following morning (ZT0-5). Right: a representative western blot of fly head samples at ZT0 and ZT5 in sleep-deprived (SD) animals and non-deprived (ND) controls. RYE levels are high immediately following sleep deprivation (SD0) and dissipate after sleep rebound (SD5). In contrast, the circadian clock is not affected by SD, since PER cycling is comparable in the SD group and the non-deprived control (ND). Densitometry quantification of the western data (n = 5) is shown below with error bars showing standard error (<xref ref-type="supplementary-material" rid="SD7-data">Figure 8—source data 1</xref>). *p&lt;0.05. (<bold>B</bold>) Model for the role of RYE in the homeostatic regulation of sleep: We propose that RYE is required to maintain sleep, and posttranslational regulation of RYE reflects homeostatic sleep drive. Sleep need builds up during wakefulness and upregulates levels of RYE, which are essential to maintain sleep behavior. Homeostatic drive dissipates during sleep, and levels of RYE are reduced, leading to wakefulness. SSS represses RYE activity, thus acting as a wake-promoting factor in this particular context.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.022">http://dx.doi.org/10.7554/eLife.01473.022</ext-link></p><p><supplementary-material id="SD7-data"><object-id pub-id-type="doi">10.7554/eLife.01473.023</object-id><label>Figure 8—Source data 1.</label><caption><title>Densitometry quantification of RYE expression after SD.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.023">http://dx.doi.org/10.7554/eLife.01473.023</ext-link></p></caption><media mime-subtype="xlsx" mimetype="application" xlink:href="elife01473s007.xlsx"/></supplementary-material></p></caption><graphic xlink:href="elife01473f008"/></fig><fig id="fig8s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01473.024</object-id><label>Figure 8—figure supplement 1.</label><caption><title>Supporting data for <xref ref-type="fig" rid="fig8">Figure 8A</xref>.</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01473.024">http://dx.doi.org/10.7554/eLife.01473.024</ext-link></p></caption><graphic xlink:href="elife01473fs006"/></fig></fig-group></p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>The molecular mechanism of sleep homeostasis is a mystery and a subject of intense research in the sleep field (<xref ref-type="bibr" rid="bib27">Suzuki et al., 2013</xref>). In addition to the investigation of mechanisms underlying sleep drive, considerable effort is being put into identifying biomarkers of sleep need. Based on what we know about the so-called sleep homeostat, which consists of increasing sleep pressure during wakefulness and dissipation of such pressure following sleep, we suggest that a component or direct output of the homeostat should satisfy three criteria: (i) the gene product should regulate the sleep:wake cycle (i.e., genetic alleles of this gene should have some sleep phenotype); (ii) expression levels or activity of the gene product should go up during wakefulness or during sleep deprivation and (iii) expression levels or activity should decrease after sleep. The function of RYE and the molecular kinetics of the RYE protein largely satisfy these criteria. However, while RYE builds up during sleep deprivation, it does not accumulate gradually over the wake period in a daily cycle. Rather, it displays a marked increase close to the time of sleep onset, suggesting that it is not a central component of the homeostat, but responds to an upstream homeostatic signal, perhaps when that signal reaches a certain threshold. The fact that over-expression of RYE does not promote sleep also supports the idea that it is not the sleep-inducing homeostatic signal (further discussed below). Nevertheless, RYE is not simply a sleep output gene or sleep biomarker. It is required for implementation of signals from the homeostat and it functions to maintain sleep. Thus, we propose that <italic>rye</italic> is a sleep-regulating gene immediately downstream of the homeostat.</p><sec id="s3-1"><title>RYE expression reflects sleep need</title><p>We suggest that RYE represents a molecular correlate of delta power, a characteristic of an electroencephalogram (EEG) that reflects sleep drive. Recently, a few other molecules were reported to change with sleep drive, but the effects were at the level of the mRNA, the magnitude of the increase was less than we report here for RYE and loss of the molecules did not affect baseline sleep duration (<xref ref-type="bibr" rid="bib25">Seugnet et al., 2006</xref>; <xref ref-type="bibr" rid="bib15">Maret et al., 2007</xref>; <xref ref-type="bibr" rid="bib19">Naidoo et al., 2007</xref>). In addition, only one is expressed cyclically (<xref ref-type="bibr" rid="bib20">Nelson et al., 2004</xref>), indicating that others reflect sleep drive only under pathological conditions of sleep deprivation. RYE levels oscillate robustly in a daily cycle, although the phase is not as coherent as seen for circadian clock proteins. The timing of the peak varies within a temporal range, such that there is almost always a daytime peak and a night-time peak but not necessarily at the exact same time (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). We suggest that RYE cycles under control of the sleep homeostat, which may not time behavior as precisely as the circadian clock, perhaps because sleep can be influenced by many factors. The variability in RYE cycling is particularly pronounced in short-sleeping mutants and in the <italic>Clk</italic><sup><italic>Jrk</italic></sup> circadian clock mutant (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2</xref>, <xref ref-type="fig" rid="fig7s1 fig7s2 fig7s3">Figure 7—figure supplements 1–3</xref>), suggesting that the clock does influence RYE expression although it is not required for its cycling in an LD cycle. Interestingly, RYE cycles exclusively at the level of the protein, indicating translational or post-translational mechanisms. It is worth noting that a recently identified sleep regulator, Insomniac, is a component of specific protein degradation pathways in the cell (<xref ref-type="bibr" rid="bib26">Stavropoulos and Young, 2011</xref>). Although our study indicates that RYE cycling does not require Insomniac (<xref ref-type="fig" rid="fig7">Figure 7C</xref>), it is possible that it is regulated by other protein turn-over machinery. Thus, translational/posttranslational regulation appears to be part of the mechanism of sleep homeostasis.</p></sec><sec id="s3-2"><title>RYE is required to maintain the sleep state</title><p>We show that RYE not only reflects sleep drive, but is also required for sleep maintenance (<xref ref-type="fig" rid="fig1 fig4 fig8">Figures 1, 4 and 8</xref>). Given that RYE is induced by sleep deprivation and it promotes sleep, one might expect over-expression of the protein to increase sleep. However, transgenic expression of <italic>rye</italic> in a wild type background does not increase sleep, suggesting that while <italic>rye</italic> is necessary, it is not sufficient for sleep onset. We cannot exclude the possibility that RYE functions together with other signals as part of the sleep-inducing homeostatic drive. On the other hand, it is also possible that transgenic expression does not produce adequate amounts of RYE protein in relevant cells. This might be the case if RYE is tightly regulated at the level of protein stability. For the moment, though, we prefer the parsimonious explanation noted above, that RYE is not part of the homeostat, but immediately downstream of it.</p><p>Acetylcholine signaling has been long proposed as an arousal factor, as the nAChR complex is a cation channel that normally promotes neuronal activity and ACh is released during wakefulness in mammals (<xref ref-type="bibr" rid="bib21">Platt and Riedel, 2011</xref>). In contrast, our study indicates that at least one nAChR subunit (RYE) promotes sleep in the fly. There are more than 10 paralogs of nAChR subunits in the fly genome. One possibility is that RYE is expressed specifically in sleep promoting neurons, while other subunits of AChRs are in wake-promoting cells. An increase in ACh during wakefulness may contribute to the accumulation of sleep drive and to the increase in RYE (<xref ref-type="bibr" rid="bib13">Lindstrom, 2003</xref>). Alternatively, sleep drive may increase RYE independently of ACh, but in either scenario, RYE then promotes sleep. The precise site of RYE action is currently not known. <italic>rye-gal4</italic> driven GFP is expressed widely in the brain (<xref ref-type="fig" rid="fig4">Figure 4A</xref>), but we cannot be sure that endogenous RYE is as widespread, as our antibody was not effective in immunohistochemistry experiments, and we find that GAL4 drivers are often quite promiscuous (unpublished observations).</p></sec><sec id="s3-3"><title>SSS inhibits RYE activity and promotes arousal in a sensitized background</title><p>SSS was previously identified as a sleep promoting factor, essential for maintaining baseline sleep and for homeostatic rebound (<xref ref-type="bibr" rid="bib9">Koh et al., 2008</xref>). An interaction between <italic>rye</italic> and <italic>sss</italic> is therefore not surprising. What is surprising is that overexpression of SSS promotes wakefulness in <italic>rye</italic><sup><italic>T227M</italic></sup> heterozygotes (<xref ref-type="fig" rid="fig5">Figure 5A,B</xref>). SSS is a GPI-anchored protein that functions as a neuronal modulator. Previous studies indicate that SSS promotes activity of the voltage-gated potassium channel, Shaker (<xref ref-type="bibr" rid="bib29">Wu et al., 2010</xref>). In this study, we report that SSS acts like a brake on nAChR (RYE) activity (<xref ref-type="fig" rid="fig5">Figure 5C,D</xref>), as does Lynx-1, a SSS-like molecule, in mammals (<xref ref-type="bibr" rid="bib18">Miwa et al., 2011</xref>). Although the data we show for <italic>Drosophila</italic> receptors used only the RYE α subunit, it is likely that SSS also inhibits activity of other <italic>Drosophila</italic> nAChR receptors. As both <italic>sss</italic><sup><italic>P1</italic></sup> (a null mutation) and <italic>sss</italic><sup><italic>P2</italic></sup> (a hypomorphic allele) are short-sleeping mutants (<xref ref-type="bibr" rid="bib9">Koh et al., 2008</xref>), we propose that the overall effect of SSS is to promote sleep. The reduced sleep in <italic>sss</italic> mutants probably results from an increase of neuronal excitability, through inactivation of potassium channels (Shaker) (<xref ref-type="bibr" rid="bib5">Dean et al., 2011</xref>), or from hyperactivity of nAChR channels in wake-promoting neurons. Thus, typically the sleep-inhibiting effect of SSS, mediated through RYE, is masked by these other more dominant influences. However, in a sensitized background (i.e., <italic>rye/+</italic>), this effect is evident. RYE promotes sleep, and so loss of RYE results in a decrease in sleep, which is further impacted by SSS overexpression (<xref ref-type="fig" rid="fig8">Figure 8B</xref>).</p><p>We note that there are some caveats to these data. For instance, the <italic>rye</italic><sup><italic>T227M</italic></sup> allele could confer a neomorphic function that accounts for the interaction with <italic>sss</italic>. Likewise, the effects in oocytes could be non-physiological, not necessarily reflecting what happens in the fly brain. However, given that we observe interactions in these two very different types of assays, and both assays indicate repression of nAchR function by SSS, which is the effect predicted from the role of the mammalian SSS-like protein, Lynx1, we believe SSS does indeed regulate nAchRs such as RYE. Interactions between SSS and nicotinic acetylcholine receptors are also reported by recent work from another laboratory (W Joiner, personal communication).</p><p>It is interesting that genes identified through independent genetic screens in <italic>Drosophila</italic> are turning out to interact with one another. SSS and Shaker were isolated independently as sleep-regulating genes (<xref ref-type="bibr" rid="bib4">Cirelli et al., 2005</xref>; <xref ref-type="bibr" rid="bib9">Koh et al., 2008</xref>), and subsequently shown to interact, and now we find that RYE interacts with SSS. Given that each of these genes represents a relatively infrequent hit in an unbiased screen, the interactions suggest that genetic approaches are converging upon specific sleep-regulating pathways. Interestingly, a recent GWAS study for sleep-altering loci in humans identified significant effects of SNPs in an nAchR subunit as well as in a regulatory subunit of Shaker, suggesting that these mechanisms are also conserved across species (<xref ref-type="bibr" rid="bib1">Allebrandt et al., 2013</xref>).</p></sec></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Generation of an isogenic 3<sup>rd</sup> chromosome stock</title><p>Wild type <italic>iso</italic><sup>31</sup> (<xref ref-type="bibr" rid="bib22">Ryder et al., 2004</xref>) was crossed with TM2/TM6C, Sb (Bloomington stock #5906), and a single male progeny was selected and crossed with #5906 to balance the 3<sup>rd</sup> chromosome and generate a line isogenic for this chromosome.</p></sec><sec id="s4-2"><title>Behavioral analysis</title><p>Flies were housed in Percival incubators (Perry, IA) and beam–break activity was recorded with the Trikinetics DAM system (<ext-link ext-link-type="uri" xlink:href="http://www.trikinetics.com/">http://www.trikinetics.com/</ext-link>). Pysolo (<xref ref-type="bibr" rid="bib6">Gilestro and Cirelli, 2009</xref>) software was used to analyze and plot sleep patterns. Sleep deprivation was achieved through repeated mechanical shaking (2 s randomized shaking in every 20-s interval).</p></sec><sec id="s4-3"><title>Mapping analysis</title><p>A 3<sup>rd</sup> chromosome marker line <italic>h, th, cu, sr, e</italic> (Bloomington stock #576) was crossed to <italic>rye/</italic>TM6C, Sb, and heterozygote female progeny (<italic>h, th, cu, sr, e/rye</italic>) were further crossed to TM2/TM6C, Sb (#5906). A single recombinant male offspring was back-crossed to #576 to score the genotype of recessive markers and also back-crossed to <italic>rye</italic> for behavioral analysis to score the <italic>rye</italic> genotype. Overlap in the genotypes of recombinants narrowed down the location of the <italic>rye</italic> mutation to the region between markers <italic>th</italic> and <italic>cu.</italic></p><p>Genomic DNA of homozygous recombinants was subject to SNP analysis. The primer set 5′TGTTTAGTGGTGTTGTGTGAGC3′ and 5′GCCGAGTGTCATCGCCTTTG3′ for SNP_L and the primer set 5′AAAGGTCATCTTGCTTCGGAGTTG3′ and 5′GGAGTGGCTTCCTCGTCATC3′ for SNP_R were used for PCR amplification. Nucleotide polymorphisms were identified between <italic>iso</italic> and #576. Thus, those recombinants were scored accordingly and <italic>rye</italic> was further narrowed down to a region between those two SNP markers.</p></sec><sec id="s4-4"><title>Sequencing and cloning</title><p>Fragmented genomic DNA (∼400 bp in size) obtained through the Covaris instrument (Woburn, MA) was subjected to Illumina paired-end DNA library preparation. The libraries were amplified for 10 PCR cycles prior to Illumina Hi-Seq analyses. SNP calling analyses identified nucleotide polymorphisms in both <italic>rye</italic> mutants and <italic>iso</italic> flies.</p><p>The primer set 5′GGCTCGATGTGCTTTCAAGAGTTC3′ and 5′CATGCCAGATGAGTGCGTTTC3′ was used to clone the <italic>rye</italic> promoter region from genomic DNA derived from the <italic>iso</italic> stock. The primer set 5′TTTAGGCTTAGTCCGCTACC 3′ and 5′AATGTCGTGGTTTGAAGTGC 3′ was used to clone the full length <italic>rye</italic> cDNA. The PhiC31 integration system was used for injection. The <italic>rye</italic> promoter construct was specifically inserted onto the 2<sup>nd</sup> chromosome and the Uas-<italic>rye</italic> construct was integrated on the 3<sup>rd</sup> chromosome.</p></sec><sec id="s4-5"><title>Generation of RYE antibodies</title><p>The primer set 5′ATGCATCATCACCATCACCATAGTATCTGCGTGACGGTTGTTG3′ and 5′GTGGTGGTGCACAACTGCCAACGTGAATATCC 3′ was used to clone the L3 epitope of RYE. A GST-RYE<sup>L3</sup> fusion protein was expressed in <italic>Escherichia coli</italic>, excised from a PAGE gel and injected into rats for antibody generation.</p></sec><sec id="s4-6"><title>Extractions and measurements of DNA, RNA and protein</title><p><italic>Drosophila</italic> genomic DNA: flies (3–15) were frozen and homogenized in DNA extraction buffer. After LiCl/KAc precipitation, supernatants were subject to isopropanol precipitation. DNA pellets were dissolved in TE for sequencing analyses and PCR amplification.</p><p>RNA: adult flies were collected at indicated time points and fly heads (10∼20) were subject to Trizol extraction (Ambion, Life Technologies, Grand Island, NY). cDNA libraries were made through high-capacity cDNA reverse transcription kits (Applied Biosystems, Life Technologies, Grand Island, NY). Quantitative PCR analysis was performed using SYBR green reagents in the Applied Biosystems 7000 sequence detection system. The primer set 5′AGTTGAATGGAAGCCACCAGC3′ and 5′TGTTCATCCATGTGCCTCAG3′ was used for qPCR analysis of <italic>rye</italic> expression.</p><p>Protein: flies were collected at indicated time points and fly heads (∼5) were prepared for protein extraction and for Western analyses as previously described (<xref ref-type="bibr" rid="bib14">Luo and Sehgal, 2012</xref>).</p></sec><sec id="s4-7"><title>Immunocytochemistry assays</title><p>Adult fly brains were dissected in cold PBS buffers at indicated CT time points. Brains were fixed in 4% PFA for 30 m and incubated with 5% Normal Donkey Serum (NDS) for 1 hr at the blocking step. Incubation with primary rabbit anti-PER (1:1000), mouse anti-PDF (1:1000) and rabbit anti-GFP, mouse anti nc82 was performed overnight in the cold room. After extensive washing, brains were incubated with the donkey anti-rabbit or anti-mouse secondary antibody (1:1000) for 2 hr. Images were taken under a Leica confocal microscope.</p></sec><sec id="s4-8"><title>Electrophysiological current recording in <italic>Xenopus</italic> oocytes</title><p>Oocytes were removed surgically from <italic>Xenopus laevis</italic> and placed in an OR-2 solution containing 82.5 mM NaCl, 2 mM KCl, 1 mM MgCl<sub>2</sub>, 5 mM HEPES, and pH 7.5. They were defolliculated in this buffer containing 2 mg/ml collagenase type IA (Sigma, St. Louis, MO) for 1.5 hr. After defolliculation, oocytes were incubated at 18°C in 50% L15 (Invitrogen, Carlsbad, CA) 10 mM HEPES, pH 7.5, 10 units/ml penicillin, and 10 g/ml streptomycin at 18°C. 3–6 days after injection, whole-cell membrane currents evoked by acetylcholine were recorded in oocytes at room temperature with a standard two-electrode voltage-clamp amplifier (Oocyte Clamp OC-725; Warner Instrument, Hamden, CT). Recordings were performed at a holding potential of −50 mV. All perfusion solutions contained 0.5M atropine to block responses of endogenous muscarinic AChRs that might be present in oocytes. Acetylcholine was applied by means of a set of 2-mm glass tubes directed to the animal pole of the oocytes. Application was achieved by manual unclamping/clamping of a flexible tube connected to the glass tubes and to reservoirs with the test solutions. The recording chamber was perfused at a flow rate of 15–20 ml/min. cRNAs for human AChR subunits 4 and 2 and <italic>Drosophila sss</italic> were synthesized in vitro using SP6 RNA polymerase (mMESSAGEmMACHINETM, Ambion). Oocytes were injected with 5 ng of cRNA of each of the subunits.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We are grateful to Christine Quake for technical support of this project, Matt Kayser, Dan Cavanaugh, Katarina Moravcevic and Christine Dubowy for critical reading of the manuscript and other members of the laboratory for useful discussions. We thank William Joiner for communicating results prior to publication. We also thank Natania Field for suggesting the name, redeye. AS is an Investigator of the HHMI.</p></ack><sec sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>MS, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con2"><p>ZY, Acquisition of data, Analysis and interpretation of data</p></fn><fn fn-type="con" id="con3"><p>AK, Acquisition of data, Analysis and interpretation of data</p></fn><fn fn-type="con" id="con4"><p>JML, Conception and design, Analysis and interpretation of data</p></fn><fn fn-type="con" id="con5"><p>AS, Conception and design, Analysis and interpretation of data, Drafting or revising the article</p></fn></fn-group></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Allebrandt</surname><given-names>KV</given-names></name><name><surname>Amin</surname><given-names>N</given-names></name><name><surname>Muller-Myhsok</surname><given-names>B</given-names></name><name><surname>Esko</surname><given-names>T</given-names></name><name><surname>Teder-Laving</surname><given-names>M</given-names></name><name><surname>Azevedo</surname><given-names>RV</given-names></name><name><surname>Hayward</surname><given-names>C</given-names></name><name><surname>Van Mill</surname><given-names>J</given-names></name><name><surname>Vogelzangs</surname><given-names>N</given-names></name><name><surname>Green</surname><given-names>EW</given-names></name><name><surname>Melville</surname><given-names>SA</given-names></name><name><surname>Lichtner</surname><given-names>P</given-names></name><name><surname>Wichmann</surname><given-names>HE</given-names></name><name><surname>Oostra</surname><given-names>BA</given-names></name><name><surname>Janssens</surname><given-names>AC</given-names></name><name><surname>Campbell</surname><given-names>H</given-names></name><name><surname>Wilson</surname><given-names>JF</given-names></name><name><surname>Hicks</surname><given-names>AA</given-names></name><name><surname>Pramstaller</surname><given-names>PP</given-names></name><name><surname>Dogas</surname><given-names>Z</given-names></name><name><surname>Rudan</surname><given-names>I</given-names></name><name><surname>Merrow</surname><given-names>M</given-names></name><name><surname>Penninx</surname><given-names>B</given-names></name><name><surname>Kyriacou</surname><given-names>CP</given-names></name><name><surname>Metspalu</surname><given-names>A</given-names></name><name><surname>Van Duijn</surname><given-names>CM</given-names></name><name><surname>Meitinger</surname><given-names>T</given-names></name><name><surname>Roenneberg</surname><given-names>T</given-names></name></person-group><year>2013</year><article-title>A K(ATP) channel gene effect on sleep duration: from genome-wide association studies to function in Drosophila</article-title><source>Molecular Psychiatry</source><volume>18</volume><fpage>122</fpage><lpage>132</lpage><pub-id pub-id-type="doi">10.1038/mp.2011.142mp2011142</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Borbely</surname><given-names>AA</given-names></name></person-group><year>1982</year><article-title>A two process model of sleep regulation</article-title><source>Human Neurobiology</source><volume>1</volume><fpage>195</fpage><lpage>204</lpage></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cirelli</surname><given-names>C</given-names></name></person-group><year>2009</year><article-title>The genetic and molecular regulation of sleep: from fruit flies to humans</article-title><source>Nature Reviews Neuroscience</source><volume>10</volume><fpage>549</fpage><lpage>560</lpage><pub-id pub-id-type="doi">10.1038/nrn2683</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cirelli</surname><given-names>C</given-names></name><name><surname>Bushey</surname><given-names>D</given-names></name><name><surname>Hill</surname><given-names>S</given-names></name><name><surname>Huber</surname><given-names>R</given-names></name><name><surname>Kreber</surname><given-names>R</given-names></name><name><surname>Ganetzky</surname><given-names>B</given-names></name><name><surname>Tononi</surname><given-names>G</given-names></name></person-group><year>2005</year><article-title>Reduced sleep in Drosophila Shaker mutants</article-title><source>Nature</source><volume>434</volume><fpage>1087</fpage><lpage>1092</lpage><pub-id pub-id-type="doi">10.1038/nature03486</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dean</surname><given-names>T</given-names></name><name><surname>Xu</surname><given-names>R</given-names></name><name><surname>Joiner</surname><given-names>W</given-names></name><name><surname>Sehgal</surname><given-names>A</given-names></name><name><surname>Hoshi</surname><given-names>T</given-names></name></person-group><year>2011</year><article-title>Drosophila QVR/SSS modulates the activation and C-type inactivation kinetics of Shaker K(+) channels</article-title><source>The Journal of Neuroscience</source><volume>31</volume><fpage>11387</fpage><lpage>11395</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.0502-11.2011</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gilestro</surname><given-names>GF</given-names></name><name><surname>Cirelli</surname><given-names>C</given-names></name></person-group><year>2009</year><article-title>pySolo: a complete suite for sleep analysis in Drosophila</article-title><source>Bioinformatics</source><volume>25</volume><fpage>1466</fpage><lpage>1467</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/btp237btp237</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hendricks</surname><given-names>JC</given-names></name><name><surname>Lu</surname><given-names>S</given-names></name><name><surname>Kume</surname><given-names>K</given-names></name><name><surname>Yin</surname><given-names>JC</given-names></name><name><surname>Yang</surname><given-names>Z</given-names></name><name><surname>Sehgal</surname><given-names>A</given-names></name></person-group><year>2003</year><article-title>Gender dimorphism in the role of cycle (BMAL1) in rest, rest regulation, and longevity in <italic>Drosophila melanogaster</italic></article-title><source>Journal of Biological Rhythms</source><volume>18</volume><fpage>12</fpage><lpage>25</lpage><pub-id pub-id-type="doi">10.1177/0748730402239673</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Joho</surname><given-names>RH</given-names></name><name><surname>Marks</surname><given-names>GA</given-names></name><name><surname>Espinosa</surname><given-names>F</given-names></name></person-group><year>2006</year><article-title>Kv3 potassium channels control the duration of different arousal states by distinct stochastic and clock-like mechanisms</article-title><source>European Journal of Neuroscience</source><volume>23</volume><fpage>1567</fpage><lpage>1574</lpage><pub-id pub-id-type="doi">10.1111/j.1460-9568.2006.04672.x</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Koh</surname><given-names>K</given-names></name><name><surname>Joiner</surname><given-names>WJ</given-names></name><name><surname>Wu</surname><given-names>MN</given-names></name><name><surname>Yue</surname><given-names>Z</given-names></name><name><surname>Smith</surname><given-names>CJ</given-names></name><name><surname>Sehgal</surname><given-names>A</given-names></name></person-group><year>2008</year><article-title>Identification of SLEEPLESS, a sleep-promoting factor</article-title><source>Science</source><volume>321</volume><fpage>372</fpage><lpage>376</lpage><pub-id pub-id-type="doi">10.1126/science.1155942</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kume</surname><given-names>K</given-names></name><name><surname>Kume</surname><given-names>S</given-names></name><name><surname>Park</surname><given-names>SK</given-names></name><name><surname>Hirsh</surname><given-names>J</given-names></name><name><surname>Jackson</surname><given-names>FR</given-names></name></person-group><year>2005</year><article-title>Dopamine is a regulator of arousal in the fruit fly</article-title><source>The Journal of Neuroscience</source><volume>25</volume><fpage>7377</fpage><lpage>7384</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.2048-05.2005</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kuryatov</surname><given-names>A</given-names></name><name><surname>Lindstrom</surname><given-names>J</given-names></name></person-group><year>2011</year><article-title>Expression of functional human alpha6beta2beta3* acetylcholine receptors in <italic>Xenopus laevis</italic> oocytes achieved through subunit chimeras and concatamers</article-title><source>Molecular Pharmacology</source><volume>79</volume><fpage>126</fpage><lpage>140</lpage><pub-id pub-id-type="doi">10.1124/mol.110.066159</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lansdell</surname><given-names>SJ</given-names></name><name><surname>Millar</surname><given-names>NS</given-names></name></person-group><year>2000</year><article-title>Cloning and heterologous expression of Dalpha4, a Drosophila neuronal nicotinic acetylcholine receptor subunit: identification of an alternative exon influencing the efficiency of subunit assembly</article-title><source>Neuropharmacology</source><volume>39</volume><fpage>2604</fpage><lpage>2614</lpage><pub-id pub-id-type="doi">10.1016/S0028-3908(00)00111-8</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lindstrom</surname><given-names>JM</given-names></name></person-group><year>2003</year><article-title>Nicotinic acetylcholine receptors of muscles and nerves: comparison of their structures, functional roles, and vulnerability to pathology</article-title><source>Annals of the New York Academy of Sciences</source><volume>998</volume><fpage>41</fpage><lpage>52</lpage><pub-id pub-id-type="doi">10.1196/annals.1254.007</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Luo</surname><given-names>W</given-names></name><name><surname>Sehgal</surname><given-names>A</given-names></name></person-group><year>2012</year><article-title>Regulation of circadian behavioral output via a MicroRNA-JAK/STAT circuit</article-title><source>Cell</source><volume>148</volume><fpage>765</fpage><lpage>779</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2011.12.024</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maret</surname><given-names>S</given-names></name><name><surname>Dorsaz</surname><given-names>S</given-names></name><name><surname>Gurcel</surname><given-names>L</given-names></name><name><surname>Pradervand</surname><given-names>S</given-names></name><name><surname>Petit</surname><given-names>B</given-names></name><name><surname>Pfister</surname><given-names>C</given-names></name><name><surname>Hagenbuchle</surname><given-names>O</given-names></name><name><surname>O’hara</surname><given-names>BF</given-names></name><name><surname>Franken</surname><given-names>P</given-names></name><name><surname>Tafti</surname><given-names>M</given-names></name></person-group><year>2007</year><article-title>Homer1a is a core brain molecular correlate of sleep loss</article-title><source>Proceedings of the National Academy of Sciences of the United States of America</source><volume>104</volume><fpage>20090</fpage><lpage>20095</lpage><pub-id pub-id-type="doi">10.1073/pnas.0710131104</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Millar</surname><given-names>NS</given-names></name></person-group><year>2009</year><article-title>A review of experimental techniques used for the heterologous expression of nicotinic acetylcholine receptors</article-title><source>Biochemical Pharmacology</source><volume>78</volume><fpage>766</fpage><lpage>776</lpage><pub-id pub-id-type="doi">10.1016/j.bcp.2009.06.015</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Millar</surname><given-names>NS</given-names></name><name><surname>Lansdell</surname><given-names>SJ</given-names></name></person-group><year>2010</year><article-title>Characterisation of insect nicotinic acetylcholine receptors by heterologous expression</article-title><source>Advances in Experimental Medicine and Biology</source><volume>683</volume><fpage>65</fpage><lpage>73</lpage><pub-id pub-id-type="doi">10.1007/978-1-4419-6445-8_6</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Miwa</surname><given-names>JM</given-names></name><name><surname>Freedman</surname><given-names>R</given-names></name><name><surname>Lester</surname><given-names>HA</given-names></name></person-group><year>2011</year><article-title>Neural systems governed by nicotinic acetylcholine receptors: emerging hypotheses</article-title><source>Neuron</source><volume>70</volume><fpage>20</fpage><lpage>33</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2011.03.014</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Naidoo</surname><given-names>N</given-names></name><name><surname>Casiano</surname><given-names>V</given-names></name><name><surname>Cater</surname><given-names>J</given-names></name><name><surname>Zimmerman</surname><given-names>J</given-names></name><name><surname>Pack</surname><given-names>AI</given-names></name></person-group><year>2007</year><article-title>A role for the molecular chaperone protein BiP/GRP78 in Drosophila sleep homeostasis</article-title><source>Sleep</source><volume>30</volume><fpage>557</fpage><lpage>565</lpage></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nelson</surname><given-names>SE</given-names></name><name><surname>Duricka</surname><given-names>DL</given-names></name><name><surname>Campbell</surname><given-names>K</given-names></name><name><surname>Churchill</surname><given-names>L</given-names></name><name><surname>Krueger</surname><given-names>JM</given-names></name></person-group><year>2004</year><article-title>Homer1a and 1bc levels in the rat somatosensory cortex vary with the time of day and sleep loss</article-title><source>Neuroscience Letters</source><volume>367</volume><fpage>105</fpage><lpage>108</lpage><pub-id pub-id-type="doi">10.1016/j.neulet.2004.05.089</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Platt</surname><given-names>B</given-names></name><name><surname>Riedel</surname><given-names>G</given-names></name></person-group><year>2011</year><article-title>The cholinergic system, EEG and sleep</article-title><source>Behavioural Brain Research</source><volume>221</volume><fpage>499</fpage><lpage>504</lpage><pub-id pub-id-type="doi">10.1016/j.bbr.2011.01.017</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ryder</surname><given-names>E</given-names></name><name><surname>Blows</surname><given-names>F</given-names></name><name><surname>Ashburner</surname><given-names>M</given-names></name><name><surname>Bautista-Llacer</surname><given-names>R</given-names></name><name><surname>Coulson</surname><given-names>D</given-names></name><name><surname>Drummond</surname><given-names>J</given-names></name><name><surname>Webster</surname><given-names>J</given-names></name><name><surname>Gubb</surname><given-names>D</given-names></name><name><surname>Gunton</surname><given-names>N</given-names></name><name><surname>Johnson</surname><given-names>G</given-names></name><name><surname>O’kane</surname><given-names>CJ</given-names></name><name><surname>Huen</surname><given-names>D</given-names></name><name><surname>Sharma</surname><given-names>P</given-names></name><name><surname>Asztalos</surname><given-names>Z</given-names></name><name><surname>Baisch</surname><given-names>H</given-names></name><name><surname>Schulze</surname><given-names>J</given-names></name><name><surname>Kube</surname><given-names>M</given-names></name><name><surname>Kittlaus</surname><given-names>K</given-names></name><name><surname>Reuter</surname><given-names>G</given-names></name><name><surname>Maroy</surname><given-names>P</given-names></name><name><surname>Szidonya</surname><given-names>J</given-names></name><name><surname>Rasmuson-Lestander</surname><given-names>A</given-names></name><name><surname>Ekstrom</surname><given-names>K</given-names></name><name><surname>Dickson</surname><given-names>B</given-names></name><name><surname>Hugentobler</surname><given-names>C</given-names></name><name><surname>Stocker</surname><given-names>H</given-names></name><name><surname>Hafen</surname><given-names>E</given-names></name><name><surname>Lepesant</surname><given-names>JA</given-names></name><name><surname>Pflugfelder</surname><given-names>G</given-names></name><name><surname>Heisenberg</surname><given-names>M</given-names></name><name><surname>Mechler</surname><given-names>B</given-names></name><name><surname>Serras</surname><given-names>F</given-names></name><name><surname>Corominas</surname><given-names>M</given-names></name><name><surname>Schneuwly</surname><given-names>S</given-names></name><name><surname>Preat</surname><given-names>T</given-names></name><name><surname>Roote</surname><given-names>J</given-names></name><name><surname>Russell</surname><given-names>S</given-names></name></person-group><year>2004</year><article-title>The DrosDel collection: a set of P-element insertions for generating custom chromosomal aberrations in <italic>Drosophila melanogaster</italic></article-title><source>Genetics</source><volume>167</volume><fpage>797</fpage><lpage>813</lpage><pub-id pub-id-type="doi">10.1534/genetics.104.026658</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Saper</surname><given-names>CB</given-names></name><name><surname>Fuller</surname><given-names>PM</given-names></name><name><surname>Pedersen</surname><given-names>NP</given-names></name><name><surname>Lu</surname><given-names>J</given-names></name><name><surname>Scammell</surname><given-names>TE</given-names></name></person-group><year>2010</year><article-title>Sleep state switching</article-title><source>Neuron</source><volume>68</volume><fpage>1023</fpage><lpage>1042</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2010.11.032</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sehgal</surname><given-names>A</given-names></name><name><surname>Mignot</surname><given-names>E</given-names></name></person-group><year>2011</year><article-title>Genetics of sleep and sleep disorders</article-title><source>Cell</source><volume>146</volume><fpage>194</fpage><lpage>207</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2011.07.004</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seugnet</surname><given-names>L</given-names></name><name><surname>Boero</surname><given-names>J</given-names></name><name><surname>Gottschalk</surname><given-names>L</given-names></name><name><surname>Duntley</surname><given-names>SP</given-names></name><name><surname>Shaw</surname><given-names>PJ</given-names></name></person-group><year>2006</year><article-title>Identification of a biomarker for sleep drive in flies and humans</article-title><source>Proceedings of the National Academy of Sciences of the United States of America</source><volume>103</volume><fpage>19913</fpage><lpage>19918</lpage><pub-id pub-id-type="doi">10.1073/pnas.0609463104</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stavropoulos</surname><given-names>N</given-names></name><name><surname>Young</surname><given-names>MW</given-names></name></person-group><year>2011</year><article-title>insomniac and Cullin-3 regulate sleep and wakefulness in Drosophila</article-title><source>Neuron</source><volume>72</volume><fpage>964</fpage><lpage>976</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2011.12.003</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Suzuki</surname><given-names>A</given-names></name><name><surname>Sinton</surname><given-names>CM</given-names></name><name><surname>Greene</surname><given-names>RW</given-names></name><name><surname>Yanagisawa</surname><given-names>M</given-names></name></person-group><year>2013</year><article-title>Behavioral and biochemical dissociation of arousal and homeostatic sleep need influenced by prior wakeful experience in mice</article-title><source>Proceedings of the National Academy of Sciences of the United States of America</source><volume>110</volume><fpage>10288</fpage><lpage>10293</lpage><pub-id pub-id-type="doi">10.1073/pnas.1308295110</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ueno</surname><given-names>T</given-names></name><name><surname>Tomita</surname><given-names>J</given-names></name><name><surname>Tanimoto</surname><given-names>H</given-names></name><name><surname>Endo</surname><given-names>K</given-names></name><name><surname>Ito</surname><given-names>K</given-names></name><name><surname>Kume</surname><given-names>S</given-names></name><name><surname>Kume</surname><given-names>K</given-names></name></person-group><year>2012</year><article-title>Identification of a dopamine pathway that regulates sleep and arousal in Drosophila</article-title><source>Nature Neuroscience</source><volume>15</volume><fpage>1516</fpage><lpage>1523</lpage><pub-id pub-id-type="doi">10.1038/nn.3238</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wu</surname><given-names>MN</given-names></name><name><surname>Joiner</surname><given-names>WJ</given-names></name><name><surname>Dean</surname><given-names>T</given-names></name><name><surname>Yue</surname><given-names>Z</given-names></name><name><surname>Smith</surname><given-names>CJ</given-names></name><name><surname>Chen</surname><given-names>D</given-names></name><name><surname>Hoshi</surname><given-names>T</given-names></name><name><surname>Sehgal</surname><given-names>A</given-names></name><name><surname>Koh</surname><given-names>K</given-names></name></person-group><year>2010</year><article-title>SLEEPLESS, a Ly-6/neurotoxin family member, regulates the levels, localization and activity of Shaker</article-title><source>Nature Neuroscience</source><volume>13</volume><fpage>69</fpage><lpage>75</lpage><pub-id pub-id-type="doi">10.1038/nn.2454</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zheng</surname><given-names>X</given-names></name><name><surname>Sehgal</surname><given-names>A</given-names></name></person-group><year>2012</year><article-title>Speed control: cogs and gears that drive the circadian clock</article-title><source>Trends in Neurosciences</source><volume>35</volume><fpage>574</fpage><lpage>585</lpage><pub-id pub-id-type="doi">10.1016/j.tins.2012.05.007</pub-id></element-citation></ref></ref-list></back><sub-article article-type="article-commentary" id="SA1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.01473.025</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Griffith</surname><given-names>Leslie C</given-names></name><role>Reviewing editor</role><aff><institution>Brandeis University</institution>, <country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see <ext-link ext-link-type="uri" xlink:href="http://elife.elifesciences.org/review-process">review process</ext-link>). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.</p></boxed-text><p>Thank you for sending your work entitled “Identification of Redeye, a new sleep-regulating protein whose expression is modulated by sleep amount” for consideration at <italic>eLife</italic>. Your article has been favorably evaluated by a Senior editor and 3 reviewers, one of whom is a member of our Board of Reviewing Editors, and one of whom, Subhabrata Sanyal (Reviewer 3), has agreed to reveal his identity.</p><p>The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.</p><p>The consensus of the reviewers was that the identification of <italic>rye</italic> is an important and novel contribution. To our knowledge there are no other protein markers that have been reported that are independent of the clock and external conditions and respond only to sleep drive. RYE levels therefore potentially represent an important new biomarker for sleep deprivation. The reviewers also felt that the data on the interaction of <italic>rye</italic> and <italic>sss</italic> were the weakest part of the paper and that without deeper investigation the precise interpretation of those experiments was difficult. While it would be satisfying to have mechanism, this study is still quite important without a full understanding of the interaction of <italic>rye</italic> and <italic>sss</italic>. We would therefore recommend publication of a suitably revised paper. The full reviews below contain a number of minor things that will help the authors to make the paper stronger, but the main concerns/suggestions are enumerated as follows:</p><p>1) Eliminate <xref ref-type="fig" rid="fig5">Figure 5</xref> or cut back on the mechanistic claims and give a much fuller discussion of the caveats surrounding the data (see Reviewer 1 comments).</p><p>2) More balanced discussion of the issue of phase and whether <italic>rye</italic> is downstream of S or actually part of the homeostat (see Reviewer 2 comments). The overexpression data suggest the former.</p><p>3) Discussion of the issues surrounding the variability of the western blots (see comment from Reviewers 1 and 3).</p><p>4) More information on <italic>rye</italic> expression (or GAL4 pattern) and localization of requirement would strengthen the paper, especially if <xref ref-type="fig" rid="fig5">Figure 5</xref> is eliminated. If such data exist it would be good to include them, but we would not require new experiments to be done.</p><p><italic>Reviewer 1</italic> <italic>comments:</italic></p><p>This is a very interesting study. The authors used the power of genetics to identify a novel sleep regulator: RYE. The fact that RYE levels are apparently controlled by sleep drive and not the clock make this a very novel and important discovery. I believe this may be the first molecule of this class and for that reason I am very enthusiastic about this paper.</p><p>Unfortunately, I think that the data that go beyond the characterization of <italic>rye</italic> are not very strong and are in many cases not interpretable in the simple way that the authors try to suggest. I almost wonder if the <italic>sss</italic> connection should not just be taken out of the paper until the authors have more data and can present a believable story. The isolation of the <italic>rye</italic> gene could stand alone as a brief communication. As it is the SSS stuff just muddies the waters. Perhaps if they added more detail about how the mutants are resistant to SD to the basic story?</p><p>I am not convinced that there is a specific interaction between SSS and RYE that regulates sleep in WT animals. First, the authors claim that the <italic>sssTg</italic> lines have no effects on sleep, but they show data that the sleep levels in these lines are equivalent to <italic>rye/+</italic>, which has reduced sleep. The fact that now combining them results in even less sleep suggests a simple additive and independent effect of each manipulation on sleep. Second, there are no data on RNAi of RYE + OE of SSS. It is possible that the SSS effect is specific to the mutant allele because it has neomorphic function and that SSS may not regulate WT RYE.</p><p>The oocyte data are not deep enough to ameliorate these concerns. The fact that SSS can decrease current from both human and fly alpha containing complexes makes me suspicious that the SSS effect is indirect via some effect on trafficking/sorting in general or perhaps increased K channel expression. No data on RMP etc. are presented. Many more controls and experiments would be needed to make this cleanly interpretable (e.g., does SSS block current from other unrelated ionotropic receptors? Is there physical interaction of RYE and SSS? Co-expression of the point mutant RYE – is it really DN? Etc.).</p><p>It is also interesting that SSS seems to promote SHAKER expression yet suppress RYE. How do the authors fit this into a global model? They casually say its sleep promoting role is dominant but how would this really work? One thing we are never shown is where RYE is expressed in the brain. What is the pattern of <italic>rye</italic>-GAL4? Does this shed any light on the issue of SSS function? Since SHAKER is basically all over the brain perhaps RYE is more tightly localized and this might allow dissection of differential local effects of SSS on activity?</p><p><italic>Reviewer 2</italic> <italic>comments:</italic></p><p>This paper presents studies that are truly a break-through for the sleep field – the identification of a mutant (<italic>rye</italic>) in which the affected protein is clearly part of the sleep homeostat (process S), which responds to increasing periods of wakefulness by producing a proportional increase in sleep drive. While the existence of such a homeostat is well supported by sleep behavior, the molecular basis has remained mysterious, and therefore this manuscript presents an important entry point for such a molecular analysis. The experiments are thorough, well controlled and convincing. The mutation affects a subunit for the nicotinic acetyl choline receptor, and the fact that a protein identified as mutated in a previously isolated short-sleeping mutant (<italic>sss</italic>) is shown to negatively regulate RYE is important because it suggests that the genetic analysis of sleep in <italic>Drosophila</italic> may be identifying some mutants in a single genetic pathway – something that has not been clear thus far. One perhaps could have hoped that this manuscript would also reveal the signals that lead to upregulation of RYE (i.e., more about the pathway for the sleep homeostat), but this will undoubtedly require more years of work by multiple labs.</p><p>The data supporting a role for RYE in the sleep homeostat are very compelling, but unless I'm missing something it seems to me that RYE expression is more likely to be triggered by an upstream S process than to be a direct part of the actual S process. For one thing, the phase for RYE expression is not right. A factor which directly responds to S should build up during wakefulness and dissipate during sleep, but RYE accumulates when the flies are asleep and only dissipates towards the end of sleep. While this feature of RYE expression alone might suggest that RYE accumulates during sleep to measure sleep recovery and promote waking, the short-sleep phenotype of the mutant and the elevated levels of RYE in various short-sleep mutants and under conditions of sleep deprivation are not consistent with this alternative (so it does seem that RYE is part of the process S). Another interesting feature is that RYE overexpression in a wild type genetic background does not alter sleep, which is inconsistent with a factor that directly drives the S process (this should elevate or phase advance sleep). The authors note this paradox and postulate that RYE overexpression may not be sufficient to induce sleep, or may not produce higher levels of RYE in the relevant cells (perhaps overexpressed proteins is not stable in these cells). Along these lines, perhaps RYE can only accumulate when the S process reaches a threshold that triggers sleep, and then RYE remains high until sleep debt is dissipated. Consideration of these points needs to be added to the Discussion; if nothing else, there needs to be more discussion of the phase of RYE expression and its relationship to its postulated role in the sleep homeostat.</p><p><italic>Reviewer 3</italic> <italic>comments:</italic></p><p>This manuscript by Shi et al. describes sleep phenotypes of a very interesting mutation in <italic>Drosophila</italic> named redeye (<italic>rye</italic>). The authors do a very commendable job of isolating, identifying, characterizing and defining this mutation and in so doing further establish <italic>Drosophila</italic> as a powerful platform to study the biochemical and genetic basis of sleep. The authors convincingly show that loss of Rye leads to a short-sleeping phenotype that can be rescued partially by adding back Rye in a domain circumscribed by a newly generated Rye-GAL4 driver line and weakly phenocopied using RNAi. What is most interesting though is that the Rye protein (assayed using newly generated Rye antibodies) cycles during the day and is most prominently present just before sleep onset, is elevated by sleep deprivation and in several short-sleeping mutants such as sleepless, insomniac and fumin, but is not controlled by the clock machinery. These are hallmarks of a true “somnogen”; however, Rye fails in one test, i.e., artificially increased expression of Rye does not promote sleep. Even so, it seems clear that as the authors suggest, Rye is part of the sleep homeostat and is necessary but not sufficient for sleep drive. This is a very interesting study and is suitable for publication in <italic>eLife</italic>. One area that could have been investigated a bit more deeply is that of the tissue-specificity of Rye. The authors use the Rye-Gal4 and yet suggest that the expression pattern of this GAL4 line may not reflect that of endogenous Rye expression. Given the large number of extant GAL4 lines and some understanding of the sleep circuitry in <italic>Drosophila</italic>, it might have been instructive to test a few of these (e.g., pan neuronal, dopaminergic neurons, fan shaped body etc) to define the tissue-restricted requirement of Rye, if any. This could be most simply achieved using RNAi (though the phenotypes are arguably weaker than Rye mutants), selective rescue of Rye phenotypes using the UAS-Rye transgene, or perhaps even attempting to test if strong Rye over-expression in neuronal subsets might induce sleep (due to either stronger over-expression than Rye-GAL4 or a circuit-specific effect of Rye elevation). A minor point is the difference in the timing of the first peak of Rye between wild type and clock mutants (<xref ref-type="fig" rid="fig6">Figure 6 B and C</xref>). Do the authors think this is relevant or is the peak of Rye temporally more loosely defined than, say, clock proteins? Overall, this is an excellent manuscript and one of the few that describes a protein that is clearly correlated with sleep drive. Mechanistic associations with sleepless and channel activity further highlight the importance of this protein in sleep regulation.</p></body></sub-article><sub-article article-type="reply" id="SA2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.01473.026</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p><italic>The consensus of the reviewers was that the identification of</italic> rye <italic>is an important and novel contribution. To our knowledge there are no other protein markers that have been reported that are independent of the clock and external conditions and respond only to sleep drive. RYE levels therefore potentially represent an important new biomarker for sleep deprivation. The reviewers also felt that the data on the interaction of</italic> rye <italic>and</italic> sss <italic>were the weakest part of the paper and that without deeper investigation the precise interpretation of those experiments was difficult. While it would be satisfying to have mechanism, this study is still quite important without a full understanding of the interaction of</italic> rye <italic>and</italic> sss<italic>. We would therefore recommend publication of a suitably revised paper. The reviews contain a number of minor things that will help the authors to make the paper stronger, but the main concerns/suggestions are enumerated below</italic>.</p><p>We appreciate the reviewers’ remarks regarding the novelty and importance of the work. The comment pertaining to the interaction between <italic>rye</italic> and <italic>sss</italic> is addressed below, and in detail in the response to Reviewer 1.</p><p><italic>1) Eliminate</italic> <xref ref-type="fig" rid="fig5"><italic>Figure 5</italic></xref> <italic>or cut back on the mechanistic claims and give a much fuller discussion of the caveats surrounding the data (see Reviewer 1 comments)</italic>.</p><p>Because the interaction between <italic>rye</italic> and <italic>sss</italic> (<xref ref-type="fig" rid="fig5">Figure 5</xref>) represents a connection to a known sleep-regulating gene, and two very different assays (genetic and electrophysiology) are consistent in indicating evolutionarily conserved repression of nAchRs by SSS-like molecules, we chose to leave these data in the manuscript. We note too that Reviewer2 really liked this part of the manuscript. We did, however, conduct additional tests, and the new data (added to the manuscript) strengthen the case for genetic interaction. In addition, our colleague Bill Joiner recently obtained results indicating regulation of nAcHr by SSS (personal communication). Nevertheless, we acknowledge the reviewer’s concern, and have toned down the claims based upon these data (they are no longer mentioned in the Abstract) and we have also acknowledged the caveats in the Discussion.</p><p><italic>2) More balanced discussion of the issue of phase and whether</italic> rye <italic>is downstream of S or actually part of the homeostat (see Reviewer 2 comments). The overexpression data suggest the former</italic>.</p><p>We agree that RYE is likely downstream of the homeostat. However, RYE is not a simple readout or output of the homeostat (S) as it is directly controlled by S, and functions to maintain the sleep process. We now discuss these issues in the text.</p><p><italic>3) Discussion of the issues surrounding the variability of the western blots (see Reviewers 1 and 3 comments)</italic>.</p><p>We have added this (see also the Response to Reviewers 1 and 3). One possibility is that Process S cycles, but not with very precise timing because sleep and wake states can be influenced by many factors. The variable phase of RYE expression during an LD cycle may reflect the inaccurate timing of process S.</p><p><italic>4) More information on</italic> rye <italic>expression (or GAL4 pattern) and localization of requirement would strengthen the paper, especially if</italic> <xref ref-type="fig" rid="fig5"><italic>Figure 5</italic></xref> <italic>is eliminated. If such data exist it would be good to include them, but we would not require new experiments to be done</italic>.</p><p>We have included the ryeGAL4&gt;GFP expression pattern in the brain. As mentioned in the initial submission, the expression pattern is broad, and does not implicate any specific structure in sleep regulation. We are mapping relevant cells, but thus far do not have any functional data.</p><p>Reviewer 1 comments:</p><p><italic>This is a very interesting study. The authors used the power of genetics to identify a novel sleep regulator: RYE. The fact that RYE levels are apparently controlled by sleep drive and not the clock make this a very novel and important discovery. I believe this may be the first molecule of this class and for that reason I am very enthusiastic about this paper</italic>.</p><p>We thank the reviewer for these comments.</p><p><italic>Unfortunately, I think that the data that go beyond the characterization of</italic> rye <italic>are not very strong and are in many cases not interpretable in the simple way that the authors try to suggest. I almost wonder if the</italic> sss <italic>connection should not just be taken out of the paper until the authors have more data and can present a believable story. The isolation of the</italic> rye <italic>gene could stand alone as a brief communication. As it is the SSS stuff just muddies the waters. Perhaps if they added more detail about how the mutants are resistant to SD to the basic story</italic>?</p><p>As noted above, we would prefer to leave in the <italic>sss-rye</italic> interaction data, which are now strengthened by additional genetic experiments, and are supported by data from Bill Joiner’s laboratory. We have also added a bit more discussion of the sleep deprivation experiments, although these are still not included as we did not feel we could draw any strong conclusions about them (we’re happy to include them if the reviewers deem otherwise).</p><p><italic>I am not convinced that there is a specific interaction between SSS and RYE that regulates sleep in WT animals. First, the authors claim that the</italic> sssTg <italic>lines have no effects on sleep, but they show data that the sleep levels in these lines are equivalent to</italic> rye/+<italic>, which has reduced sleep. The fact that now combining them results in even less sleep suggests a simple additive and independent effect of each manipulation on sleep. Second, there are no data on RNAi of RYE + OE of SSS. It is possible that the SSS effect is specific to the mutant allele because it has neomorphic function and that SSS may not regulate WT RYE</italic>.</p><p>We believe that the apparent decrease in sleep in some <italic>sssTg</italic> lines (<italic>sssTG2/+</italic> and <italic>sssTG3/+</italic>) resulted from small sample sizes (n=8 and n=4, respectively). Please note that <italic>sssTG1</italic> did not reduce sleep in wild type, and yet this also reduced sleep in a <italic>rye</italic>/+ background. Nevertheless, we repeated the experiments with <italic>sssTG2</italic> and <italic>sssTG3,</italic> so as to increase the N<italic>,</italic> and pooled the old and new data. As shown in the revision, <italic>sssTG2/+</italic> (n=24) and <italic>sssTG3/+</italic> (n=12) have a sleep length comparable to <italic>sssTG1/+</italic> and to the <italic>iso</italic> stock. We conclude that the reduction of sleep in rye/ <italic>sssTG</italic> transhets is due to genetic interaction rather than additive effects.</p><p>It is true that the interaction could reflect a neomorphic function of the new mutant allele, and we have included this caveat in the discussion. As <italic>rye</italic> RNAi had a weak phenotype, we did not use it for additional experiments, but rather focused on the allele from the screen.</p><p>Finally, we note that interactions between SSS and nAchRs have been independently discovered by Bill Joiner (personal communication), so there is now increasing evidence to support such interactions.</p><p><italic>The oocyte data are not deep enough to ameliorate these concerns. The fact that SSS can decrease current from both human and fly alpha containing complexes makes me suspicious that the SSS effect is indirect via some effect on trafficking/sorting in general or perhaps increased K channel expression. No data on RMP etc. are presented. Many more controls and experiments would be needed to make this cleanly interpretable (e.g., does SSS block current from other unrelated ionotropic receptors? Is there physical interaction of RYE and SSS? Co-expression of the point mutant RYE – is it really DN? Etc.)</italic>.</p><p>These are all valid points. We attempted to express RYE in S2 cells to test interactions with SSS, but, as noted by others previously for nAChR subunits, we could not get consistent expression. Thus, we could not perform co-immunoprecipitation assays. We have included this and other caveats in the Discussion. We have also deleted mention of the interaction data from the Abstract, and toned down our conclusions. However, we believe it is worth documenting the interaction in the manuscript, given that the genetic experiments are now stronger and the genetic and electrophysiology experiments are consistent in indicating repression of RYE by SSS. We believe the data will be of interest to many researchers, in that they indicate a conserved mechanism for regulation of nAchRs such as RYE by SSS-like molecules (given the known Lynx1-nAchR data in mammals). As noted above, Bill Joiner has also obtained evidence for regulation of nAchRs by SSS (personal communication).</p><p><italic>It is also interesting that SSS seems to promote SHAKER expression yet suppress RYE. How do the authors fit this into a global model? They casually say its sleep promoting role is dominant but how would this really work? One thing we are never shown is where RYE is expressed in the brain. What is the pattern of</italic> rye<italic>-GAL4? Does this shed any light on the issue of SSS function? Since SHAKER is basically all over the brain perhaps RYE is more tightly localized and this might allow dissection of differential local effects of SSS on activity</italic>?</p><p>We have added more discussion of these issues. As <italic>sss</italic> mutants have a stronger sleep phenotype than <italic>Shaker,</italic> it is not surprising that <italic>sss</italic> also has other functions. For instance, SSS may normally promote sleep, not only by promoting Shaker activity, but also by inhibiting activity of various nAchRs, most of which are likely wake-promoting (RYE is clearly an exception). We have included the expression pattern of rye-GAL4 driven GFP. It is quite broad, so it does not reveal why the effect of SSS on RYE is masked in <italic>sss</italic> mutants. Possibly, co-expression of RYE and SSS occurs in a limited number of sleep-regulating cells.</p><p>Reviewer 2 comments:</p><p><italic>This paper presents studies that are truly a break-through for the sleep field - the identification of a mutant (</italic>rye<italic>) in which the affected protein is clearly part of the sleep homeostat (process S), which responds to increasing periods of wakefulness by producing a proportional increase in sleep drive. While the existence of such a homeostat is well supported by sleep behavior, the molecular basis has remained mysterious, and therefore this manuscript presents an important entry point for such a molecular analysis. The experiments are thorough, well controlled and convincing. The mutation affects a subunit for the nicotinic acetyl choline receptor, and the fact that a protein identified as mutated in a previously isolated short-sleeping mutant (</italic>sss<italic>) is shown to negatively regulate RYE is important because it suggests that the genetic analysis of sleep in Drosophila may be identifying some mutants in a single genetic pathway - something that has not been clear thus far. One perhaps could have hoped that this manuscript would also reveal the signals that lead to upregulation of RYE (i.e., more about the pathway for the sleep homeostat), but this will undoubtedly require more years of work by multiple labs</italic>.</p><p>We thank the reviewer for these very complimentary remarks.</p><p><italic>The data supporting a role for RYE in the sleep homeostat are very compelling, but unless I'm missing something it seems to me that RYE expression is more likely to be triggered by an upstream S process than to be a direct part of the actual S process. For one thing, the phase for RYE expression is not right. A factor which directly responds to S should build up during wakefulness and dissipate during sleep, but RYE accumulates when the flies are asleep and only dissipates towards the end of sleep. While this feature of RYE expression alone might suggest that RYE accumulates during sleep to measure sleep recovery and promote waking, the short-sleep phenotype of the mutant and the elevated levels of RYE in various short-sleep mutants and under conditions of sleep deprivation are not consistent with this alternative (so it does seem that RYE is part of the process S). Another interesting feature is that RYE overexpression in a wild type genetic background does not alter sleep, which is inconsistent with a factor that directly drives the S process (this should elevate or phase advance sleep). The authors note this paradox and postulate that RYE overexpression may not be sufficient to induce sleep, or may not produce higher levels of RYE in the relevant cells (perhaps overexpressed proteins is not stable in these cells). Along these lines, perhaps RYE can only accumulate when the S process reaches a threshold that triggers sleep, and then RYE remains high until sleep debt is dissipated. Consideration of these points needs to be added to the Discussion; if nothing else, there needs to be more discussion of the phase of RYE expression and its relationship to its postulated role in the sleep homeostat</italic>.</p><p>These are all great points. We agree that RYE could be immediately downstream of process S. RYE levels may be higher in short sleepers because those mutants have defects in further downstream regulators (e.g., dopamine pathways). We have added discussion of these possibilities to the manuscript.</p><p>Reviewer 3 comments:</p><p><italic>This manuscript by Shi et al. describes sleep phenotypes of a very interesting mutation in</italic> Drosophila <italic>named redeye (</italic>rye<italic>). The authors do a very commendable job of isolating, identifying, characterizing and defining this mutation and in so doing further establish</italic> Drosophila <italic>as a powerful platform to study the biochemical and genetic basis of sleep. The authors convincingly show that loss of Rye leads to a short-sleeping phenotype that can be rescued partially by adding back Rye in a domain circumscribed by a newly generated Rye-GAL4 driver line and weakly phenocopied using RNAi. What is most interesting though is that the Rye protein (assayed using newly generated Rye antibodies) cycles during the day and is most prominently present just before sleep onset, is elevated by sleep deprivation and in several short-sleeping mutants such as sleepless, insomniac and fumin, but is not controlled by the clock machinery. These are hallmarks of a true “somnogen”; however, Rye fails in one test, i.e., artificially increased expression of Rye does not promote sleep. Even so, it seems clear that as the authors suggest, Rye is part of the sleep homeostat and is necessary but not sufficient for sleep drive. This is a very interesting study and is suitable for publication in eLife. One area that could have been investigated a bit more deeply is that of the tissue-specificity of Rye. The authors use the Rye-Gal4 and yet suggest that the expression pattern of this GAL4 line may not reflect that of endogenous Rye expression. Given the large number of extant GAL4 lines and some understanding of the sleep circuitry in</italic> Drosophila<italic>, it might have been instructive to test a few of these (e.g., pan neuronal, dopaminergic neurons, fan shaped body etc) to define the tissue-restricted requirement of Rye, if any. This could be most simply achieved using RNAi (though the phenotypes are arguably weaker than Rye mutants), selective rescue of Rye phenotypes using the UAS-Rye transgene, or perhaps even attempting to test if strong Rye over-expression in neuronal subsets might induce sleep (due to either stronger over-expression than Rye-GAL4 or a circuit-specific effect of Rye elevation)</italic>.</p><p>As the reviewer notes, the RNAi phenotype is weak, so we did not use this as an assay to identify the relevant circuit. We are attempting to map the circuit through other means, but do not have any conclusions thus far.</p><p><italic>A minor point is the difference in the timing of the first peak of Rye between wild type and clock mutants (</italic><xref ref-type="fig" rid="fig6"><italic>Figure 6 B and C</italic></xref><italic>). Do the authors think this is relevant or is the peak of Rye temporally more loosely defined than, say, clock proteins? Overall, this is an excellent manuscript and one of the few that describes a protein that is clearly correlated with sleep drive. Mechanistic associations with sleepless and channel activity further highlight the importance of this protein in sleep regulation</italic>.</p><p>The peak of RYE is indeed more loosely defined than that of clock proteins. The phase is even looser in short-sleeping mutants and in <italic>Clk</italic><sup><italic>jrk</italic></sup><italic>.</italic> It is possible that these data reflect the nature of Process S, which is perhaps more flexible/sloppy than Process C (circadian control).</p></body></sub-article></article>