Permalink
Cannot retrieve contributors at this time
Fetching contributors…
Cannot retrieve contributors at this time
| <?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d1 20130915//EN" "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1d1" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="hwp">eLife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">01524</article-id><article-id pub-id-type="doi">10.7554/eLife.01524</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research article</subject></subj-group><subj-group subj-group-type="heading"><subject>Cell biology</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>Synaptotagmin 7 functions as a Ca<sup>2+</sup>-sensor for synaptic vesicle replenishment</article-title></title-group><contrib-group><contrib contrib-type="author" corresp="yes" id="author-7736"><name><surname>Liu</surname><given-names>Huisheng</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="pa1">†</xref><xref ref-type="corresp" rid="cor1">*</xref><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-9484"><name><surname>Bai</surname><given-names>Hua</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-7766"><name><surname>Hui</surname><given-names>Enfu</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="other" rid="par-1"/><xref ref-type="other" rid="par-2"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-7767"><name><surname>Yang</surname><given-names>Lu</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-7768"><name><surname>Evans</surname><given-names>Chantell S</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-7769"><name><surname>Wang</surname><given-names>Zhao</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-10742"><name><surname>Kwon</surname><given-names>Sung E</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con7"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-1824"><name><surname>Chapman</surname><given-names>Edwin R</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="corresp" rid="cor2">*</xref><xref ref-type="other" rid="par-1"/><xref ref-type="other" rid="par-2"/><xref ref-type="fn" rid="con8"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><institution content-type="dept">Department of Neuroscience</institution>, <institution>Howard Hughes Medical Institute, University of Wisconsin–Madison</institution>, <addr-line><named-content content-type="city">Madison</named-content></addr-line>, <country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Davis</surname><given-names>Graeme</given-names></name><role>Reviewing editor</role><aff><institution>University of California, San Francisco</institution>, <country>United States</country></aff></contrib></contrib-group><author-notes><corresp id="cor1"><label>*</label>For correspondence: <email>liu25@wisc.edu</email> (HL);</corresp><corresp id="cor2"><label>*</label>For correspondence: <email>chapman@wisc.edu</email> (ERC)</corresp><fn fn-type="present-address" id="pa1"><label>†</label><p>Waisman Center, University of Wisconsin–Madison, Madison, United States</p></fn></author-notes><pub-date date-type="pub" publication-format="electronic"><day>25</day><month>02</month><year>2014</year></pub-date><pub-date pub-type="collection"><year>2014</year></pub-date><volume>3</volume><elocation-id>e01524</elocation-id><history><date date-type="received"><day>12</day><month>09</month><year>2013</year></date><date date-type="accepted"><day>15</day><month>01</month><year>2014</year></date></history><permissions><copyright-statement>© 2014, Liu et al</copyright-statement><copyright-year>2014</copyright-year><copyright-holder>Liu et al</copyright-holder><license xlink:href="http://creativecommons.org/licenses/by/3.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/3.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife01524.pdf"/><abstract><object-id pub-id-type="doi">10.7554/eLife.01524.001</object-id><p>Synaptotagmin (syt) 7 is one of three syt isoforms found in all metazoans; it is ubiquitously expressed, yet its function in neurons remains obscure. Here, we resolved Ca<sup>2+</sup>-dependent and Ca<sup>2+</sup>-independent synaptic vesicle (SV) replenishment pathways, and found that syt 7 plays a selective and critical role in the Ca<sup>2+</sup>-dependent pathway. Mutations that disrupt Ca<sup>2+</sup>-binding to syt 7 abolish this function, suggesting that syt 7 functions as a Ca<sup>2+</sup>-sensor for replenishment. The Ca<sup>2+</sup>-binding protein calmodulin (CaM) has also been implicated in SV replenishment, and we found that loss of syt 7 was phenocopied by a CaM antagonist. Moreover, we discovered that syt 7 binds to CaM in a highly specific and Ca<sup>2+</sup>-dependent manner; this interaction requires intact Ca<sup>2+</sup>-binding sites within syt 7. Together, these data indicate that a complex of two conserved Ca<sup>2+</sup>-binding proteins, syt 7 and CaM, serve as a key regulator of SV replenishment in presynaptic nerve terminals.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.001">http://dx.doi.org/10.7554/eLife.01524.001</ext-link></p></abstract><abstract abstract-type="executive-summary"><object-id pub-id-type="doi">10.7554/eLife.01524.002</object-id><title>eLife digest</title><p>Neurons communicate with one another at junctions called synapses. The arrival of an electrical signal called an action potential at the first neuron triggers the release of chemicals called neurotransmitters into the synapse. These chemicals then diffuse across the gap between the neurons and bind to receptors on the second cell.</p><p>The neurotransmitter molecules are stored in the first cell in packages known as vesicles, which release their contents by fusing with the cell membrane. Following a fusion event, neurons must replenish their vesicle stocks to ensure that they are ready for the arrival of the next action potential. This replenishment process is known to involve a calcium-dependent pathway and a calcium-independent pathway.</p><p>A protein called calmodulin, that binds calcium ions, has an important role in the first of these pathways. Now, Liu et al. have shown that another protein, synaptotagmin 7, also has a key role in the replenishment of synaptic vesicles, possibly as a sensor for calcium ions. Moreover, Liu et al. found that synaptotagmin 7 and calmodulin bind to each other to form a complex, which suggests that the calcium-dependent replenishment pathway is regulated by this complex.</p><p>The synaptotagmins are a family of 17 proteins, three of which are present in all animals. Two of these were known to have roles in synapses, but the role of the third—synaptotagmin 7—had been unclear. In addition to providing a more complete understanding of the replenishment of synaptic vesicles, the work of Liu et al. also supplies the final piece of the jigsaw regarding the role of the synaptotagmins that are present in all animals.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.002">http://dx.doi.org/10.7554/eLife.01524.002</ext-link></p></abstract><kwd-group kwd-group-type="author-keywords"><title>Author keywords</title><kwd>synaptotagmin</kwd><kwd>neurotranmission</kwd><kwd>synaptic vesicle</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>mouse</kwd></kwd-group><funding-group><award-group id="par-1"><funding-source><institution-wrap><institution>National Institutes of Health</institution></institution-wrap></funding-source><award-id>MH 61876</award-id><principal-award-recipient><name><surname>Liu</surname><given-names>Huisheng</given-names></name><name><surname>Bai</surname><given-names>Hua</given-names></name><name><surname>Hui</surname><given-names>Enfu</given-names></name><name><surname>Yang</surname><given-names>Lu</given-names></name><name><surname>Evans</surname><given-names>Chantell S</given-names></name><name><surname>Wang</surname><given-names>Zhao</given-names></name><name><surname>Kwon</surname><given-names>Sung E</given-names></name><name><surname>Chapman</surname><given-names>Edwin R</given-names></name></principal-award-recipient></award-group><award-group id="par-2"><funding-source><institution-wrap><institution>Howard Hughes Medical Institute</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Hui</surname><given-names>Enfu</given-names></name><name><surname>Chapman</surname><given-names>Edwin R</given-names></name></principal-award-recipient></award-group><funding-statement>The funder had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name><meta-value>2</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Two proteins—synaptotagmin 7 and calmodulin—have central roles in the calcium-dependent pathway that maintains synaptic transmission.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Chemical communication at synapses in the central nervous system is subject to short- and long-term changes in strength (<xref ref-type="bibr" rid="bib25">Malenka, 1994</xref>). For example, the replenishment of synaptic vesicles (SV) in the readily releasable pool (RRP), which can be exhausted during high frequency stimulation (HFS), plays a critical role in determining the rate and degree of short-term synaptic depression (<xref ref-type="bibr" rid="bib43">Wang and Kaczmarek, 1998</xref>). It has been reported that Ca<sup>2+</sup> plays an important role in the replenishment step (<xref ref-type="bibr" rid="bib12">Dittman and Regehr, 1998</xref>; <xref ref-type="bibr" rid="bib43">Wang and Kaczmarek, 1998</xref>; <xref ref-type="bibr" rid="bib17">Hosoi et al., 2007</xref>; <xref ref-type="bibr" rid="bib36">Sakaba, 2008</xref>). Thus, identification of Ca<sup>2+</sup> sensors for SV replenishment has emerged as a critical issue, and the ubiquitous Ca<sup>2+</sup>-binding protein CaM has been implicated in this process (<xref ref-type="bibr" rid="bib37">Sakaba and Neher, 2001</xref>; <xref ref-type="bibr" rid="bib17">Hosoi et al., 2007</xref>), by interacting with Munc13-1 (<xref ref-type="bibr" rid="bib23">Lipstein et al., 2013</xref>).</p><p>Synaptotagmins represent another well-known family of Ca<sup>2+</sup>-binding proteins; some isoforms function as Ca<sup>2+</sup>-sensors for rapid SV exocytosis (<xref ref-type="bibr" rid="bib6">Chapman, 2008</xref>). Of the 17 syt isoforms in the mammalian genome, only syt 1, 4, and 7 appear to be expressed in all metazoans (<xref ref-type="bibr" rid="bib2">Barber et al., 2009</xref>), suggesting that they are involved in key, evolutionarily conserved, membrane trafficking pathways. In neurons, functions for syt 1 and 4 have been established. Syt 1 serves as a Ca<sup>2+</sup> sensor for fast synchronous SV release (<xref ref-type="bibr" rid="bib16">Geppert et al., 1994</xref>; <xref ref-type="bibr" rid="bib20">Koh and Bellen, 2003</xref>; <xref ref-type="bibr" rid="bib31">Nishiki and Augustine, 2004</xref>; <xref ref-type="bibr" rid="bib24">Liu et al., 2009</xref>), and syt 4 modulates transmission by regulating neurotrophin release (<xref ref-type="bibr" rid="bib9">Dean et al., 2009</xref>, <xref ref-type="bibr" rid="bib10">2012b</xref>) and also regulates exocytosis in the posterior pituitary (<xref ref-type="bibr" rid="bib52">Zhang et al., 2009</xref>). One group reported that <italic>Syt7</italic> knock-out (KO) mice (hereafter termed KO) had normal synaptic transmission (<xref ref-type="bibr" rid="bib26">Maximov et al., 2008</xref>), but in a more recent study from the same group concluded that syt 7 functions as Ca<sup>2+</sup> sensor for asynchronous release (<xref ref-type="bibr" rid="bib1">Bacaj et al., 2013</xref>). It was proposed that this contradiction was due to the use of KO mice in the former study, as opposed to the more acute knock-down (KD) approach used in the latter study. However, KD of syt 7 in otherwise WT neurons had no effect (<xref ref-type="bibr" rid="bib1">Bacaj et al., 2013</xref>), so the physiological function of syt 7 in the mammalian central nervous system remains an open issue, whereas there is evidence that syt 7 regulates asynchronous synaptic transmission at the Zebrafish neuromuscular junction (<xref ref-type="bibr" rid="bib46">Wen et al., 2010</xref>). The apparent discrepancy regarding the physiological function of syt 7 between mice and Zebrafish is likely due to species differences, analogous to the different functions of syt 4 in <italic>Drosophila</italic> vs mice (<xref ref-type="bibr" rid="bib51">Yoshihara et al., 2005</xref>; <xref ref-type="bibr" rid="bib9">Dean et al., 2009</xref>; <xref ref-type="bibr" rid="bib45">Wang and Chapman, 2010</xref>).</p><p>Here, we used high frequency stimulation, and other methods, to study synaptic transmission in cultured hippocamal neurons from KO mice and discovered that syt 7, via a highly specific interaction with CaM, functions as a Ca<sup>2+</sup>-sensor that regulates Ca<sup>2+</sup>-dependent SV replenishment.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Loss of syt 7 does not affect spontaneous release, or evoked release triggered by single action potentials</title><p>We first carried out whole-cell voltage clamp recordings using primary hippocampal neurons obtained from wild-type (WT) and KO mice and found that spontaneous SV release, measured in the presence of TTX, was unaffected in the KO neurons (<xref ref-type="fig" rid="fig1">Figure 1A–E</xref>). We then carried out paired recordings by stimulating one neuron with a bipolar glass electrode and recording from a second synaptically connected neuron, as previously described (<xref ref-type="bibr" rid="bib24">Liu et al., 2009</xref>), to examine evoked excitatory postsynaptic currents (EPSCs) triggered by single action potentials (AP). The EPSC amplitudes (<xref ref-type="fig" rid="fig1">Figure 1F–I,K–L</xref>), and the charge transfer kinetics (<xref ref-type="fig" rid="fig1">Figure 1J</xref>), were also unchanged in the KOs, confirming that syt 7 does not function as Ca<sup>2+</sup> sensor for asynchronous release in hippocampal neurons (<xref ref-type="bibr" rid="bib26">Maximov et al., 2008</xref>). We also examined the Ca<sup>2+</sup>-sensitivity of single AP-evoked SV release, by recording at different concentrations of extracellular Ca<sup>2+</sup>, and found that it was the same between WT and KO neurons (<xref ref-type="fig" rid="fig1">Figure 1K–M</xref>).<fig id="fig1" position="float"><object-id pub-id-type="doi">10.7554/eLife.01524.003</object-id><label>Figure 1.</label><caption><title>Normal spontaneous and single AP evoked EPSCs in KO neurons.</title><p>(<bold>A</bold>) Representative miniature EPSC (mEPSC; recorded in the presence of TTX) traces from WT and KO hippocampal neurons. (<bold>B</bold>) Representative mEPSCs from WT (grey) and KO (red) neurons. (<bold>C</bold>–<bold>E</bold>) mEPSC amplitude (<bold>C</bold>, WT: 20.78 ± 1.26 pA; KO: 20.46 ± 2.38 pA), charge (<bold>D</bold>, WT: 116 ± 12 fC; KO: 119 ± 18 fC) and frequency (<bold>E</bold>, WT: 2.32 ± 0.44 Hz; KO: 2.83 ± 0.63 pA) were the same between WT and KO neurons. (<bold>F</bold>–<bold>J</bold>) Analysis of single AP evoked EPSCs recorded from WT and KO neurons in the presence of 10 mM [Ca<sup>2+</sup>]<sub>o</sub>. (<bold>F</bold>) Representative EPSCs recorded from WT and KO neurons. (<bold>G</bold>–<bold>I</bold>) EPSC amplitude (<bold>G</bold>, WT: 0.25 ± 0.05 nA; KO: 0.24 ± 0.03 nA), peak latency (<bold>H</bold>, WT: 17.03 ± 2.22 ms; KO: 18.27 ± 2.29 ms) and rise time (<bold>I</bold>, WT: 4.8 ± 0.53 ms; KO: 5.21 ± 0.74 ms) were the same between WT and KO neurons. (<bold>J</bold>) The normalized cumulative total charge was fitted with a double exponential function (solid line). WT and KO neurons had identical charge transfer kinetics. (<bold>K</bold>) Representative single AP evoked EPSCs recorded from WT and KO neurons in the presence of the indicated [Ca<sup>2+</sup>]<sub>o</sub>. (<bold>L</bold>–<bold>M</bold>) EPSC amplitudes (<bold>L</bold>) and relative amplitudes (<bold>M</bold>) plotted vs [Ca<sup>2+</sup>]<sub>o</sub>. The n values indicate the number of neurons from two independent litters of mice; these values are provided in the bars in all figures in this study. All data represent mean ± SEM. Statistical significance was analyzed using the Student’s <italic>t</italic> test.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.003">http://dx.doi.org/10.7554/eLife.01524.003</ext-link></p></caption><graphic xlink:href="elife01524f001"/></fig></p></sec><sec id="s2-2"><title>KO neurons exhibit enhanced synaptic depression</title><p>We next examined short-term synaptic plasticity in WT and KO neurons by examining the paired pulse ratio (PPR), calculated by dividing the second EPSC (EPSC2) by the first EPSC (EPSC1) (50 ms interval; <xref ref-type="fig" rid="fig2">Figure 2A</xref>). We also measured synaptic depression during trains of HFS (20 Hz/2.5 s, <xref ref-type="fig" rid="fig3">Figure 3A</xref>). The PPR was the same between WT and KO neurons (<xref ref-type="fig" rid="fig2">Figure 2B</xref>), but KO neurons displayed faster depression during HFS (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). Importantly, expression of WT syt 7, but not the 4D/N Ca<sup>2+</sup>-ligand mutant (which was properly folded but failed to bind Ca<sup>2+</sup> (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>)), rescued the depression phenotype (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). We note that WT syt 7, and the 4D/N mutant, were both present in synapses but were not well colocalized with the SV marker, synapsin, as compared to syt 1 (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). The surface fractions, as well as the internal fractions, were similar between syt 1 and 7 measured by using a pHluorin tag (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>), consistent with a previous report (<xref ref-type="bibr" rid="bib8">Dean et al., 2012a</xref>).<fig id="fig2" position="float"><object-id pub-id-type="doi">10.7554/eLife.01524.004</object-id><label>Figure 2.</label><caption><title>Loss of syt 7 does not affect the PPR.</title><p>(<bold>A</bold>) Representative EPSCs recorded in paired-pulse experiments, with 50 ms inter-stimulus intervals, from WT, KO, or KO neurons expressing either WT (KO + syt 7) or the Ca<sup>2+</sup> ligand mutant form (KO + syt 7 4D/N) of syt 7. (<bold>B</bold>) The PPRs were the same among all groups (WT: 0.83 ± 0.04; KO: 0.75 ± 0.03; KO + syt 7: 0.84 ± 0.05; and KO + syt 7 4D/N: 0.76 ± 0.03). The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data represent mean ± SEM. Statistical significance was analyzed by one-way ANOVA.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.004">http://dx.doi.org/10.7554/eLife.01524.004</ext-link></p></caption><graphic xlink:href="elife01524f002"/></fig><fig-group><fig id="fig3" position="float"><object-id pub-id-type="doi">10.7554/eLife.01524.005</object-id><label>Figure 3.</label><caption><title>SV replenishment is reduced in KO neurons.</title><p>(<bold>A</bold>) Representative EPSC traces (20 Hz/2.5 s) recorded from WT (black), KO (red), or KO neurons expressing either WT (KO + syt 7, gray) or the 4D/N mutant form of syt 7 (KO + syt 7 4D/N, blue). The phasic and tonic components of transmission are indicated within the representative WT trace. (<bold>B</bold>) The peak amplitude of each EPSC was divided by the peak of the first response and plotted vs time. Inset: expansion of the last 10 responses. (<bold>C</bold>) Plot of cumulative total phasic charge transfer vs time. Data points from the last ten EPSCs were fitted with a linear function to calculate the RRP size (y-intercept in panel <bold>D</bold>), and SV replenishment rate (the slope divided by the RRP size; panel <bold>E</bold>). Inset: expansion of the last ten responses. (<bold>D</bold>) The RRP size is the same among all groups (WT: 38.70 ± 4.78 pC; KO: 33.49 ± 2.48 pC; KO + syt 7: 37.58 ± 3.02 pC; and KO + syt 7 4D/N: 34.16 ± 3.63 pC). (<bold>E</bold>) The SV replenishment rate was reduced in KO (0.26 ± 0.03 s<sup>−1</sup>) as compared to WT neurons (0.52 ± 0.06 s<sup>−1</sup>). WT (0.47 ± 0.05 s<sup>−1</sup>), but not 4D/N mutant syt 7 (0.24 ± 0.02 s<sup>−1</sup>), rescued SV replenishment. The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ± SEM. ***p<0.001, analyzed by one-way ANOVA, compared to WT.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.005">http://dx.doi.org/10.7554/eLife.01524.005</ext-link></p></caption><graphic xlink:href="elife01524f003"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01524.006</object-id><label>Figure 3—figure supplement 1.</label><caption><title>Ca<sup>2+</sup>-ligand mutations disrupt Ca<sup>2+</sup> binding, but not proper folding, of syt 7.</title><p>(<bold>A</bold>) CD spectra of WT (syt 7 C2AB; solid lines) and the 4D/N mutant (syt 7 C2AB 4D/N, dashed line) versions of syt 7 C2AB domains; the spectra were identical. (<bold>B</bold>) ITC experiments utilizing the isolated C2-domains of WT (syt 7 C2A, syt 7 C2B) and mutant forms of each domain in which two putative acidic Ca<sup>2+</sup> ligands were changed to Asn (syt 7 C2A 2D/N, syt 7 C2B 2D/N). Ca<sup>2+</sup>-binding to C2A and C2B was endothermic and exothermic, respectively; neither of the mutant C2-domains appeared to bind Ca<sup>2+</sup> under these experimental conditions.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.006">http://dx.doi.org/10.7554/eLife.01524.006</ext-link></p></caption><graphic xlink:href="elife01524fs001"/></fig><fig id="fig3s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01524.007</object-id><label>Figure 3—figure supplement 2.</label><caption><title>Syt 7 is not localized to SVs.</title><p>(<bold>A</bold>) A c-myc tag with a signal sequence was fused to the N-terminus of syt 7 (ss-myc-syt 7), syt 7 4D/N (ss-myc-syt 7 4D/N), and 1 (ss-myc-syt 1) as described in 'Materials and methods', and the resultant fusion protein was expressed in KO hippocampal neurons using lentivirus; cells were immunostained with antibodies against c-myc, the SV marker synapsin, or against GFP that was expressed via an independent promoter. (<bold>B</bold>) Analysis of the c-myc signals relative to the synapsin signals revealed that syt 1 (0.48 ± 0.03), but not syt 7 (0.18 ± 0.02) and syt 7 4D/N (0.19 ± 0.01), co-localized with SVs. Average colocalization, from 12 fields of view (∼100 boutons per field) from six coverslips, two coverslips each from three independent litters of mice. All data shown represent mean ± SEM. ***p<0.001, analyzed by one-way ANOVA, compared to WT.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.007">http://dx.doi.org/10.7554/eLife.01524.007</ext-link></p></caption><graphic xlink:href="elife01524fs002"/></fig><fig id="fig3s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01524.008</object-id><label>Figure 3—figure supplement 3.</label><caption><title>Relative distribution of syt 7 in the plasma membrane, vs internal compartments, in hippocampal neurons.</title><p>(<bold>A</bold>) Average fluorescence signals from pHluorin-syt 1 (black) and pHluorin-syt 7 (red) during perfusion with a low pH solution (pH 5.5) to quench surface fluorescence, and during perfusion with NH<sub>4</sub>Cl to neutralize acidic internal compartments and thus reveal internal pHluorin signals. (<bold>B</bold>) Quantitation of the surface fraction of syt 7 and syt 1; the majority of the signal is internal, but significant fractions of each protein are present in the plasma membrane. Data are averages from ∼300 boutons; 50 boutons from each of six coverslips, two coverslips per mouse, three independent litters of mice. All data shown represent mean ± SEM. Statistical significance was analyzed by the Student's <italic>t</italic> test.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.008">http://dx.doi.org/10.7554/eLife.01524.008</ext-link></p></caption><graphic xlink:href="elife01524fs003"/></fig><fig id="fig3s4" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01524.009</object-id><label>Figure 3—figure supplement 4.</label><caption><title>Postsynaptic receptor desensitization and saturation do not contribute to the KO phenotype.</title><p>(<bold>A</bold>) Representative EPSC traces (20 Hz/2.5 s) recorded from WT (black) and KO (red) neurons, in the presence of both CTZ and KYN. (<bold>B</bold>) The peak amplitude of each EPSC was normalized to the peak of the first response and plotted vs time. The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ± SEM.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.009">http://dx.doi.org/10.7554/eLife.01524.009</ext-link></p></caption><graphic xlink:href="elife01524fs004"/></fig><fig id="fig3s5" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01524.010</object-id><label>Figure 3—figure supplement 5.</label><caption><title>Replenishment of the tonic component of transmission is reduced in KO neurons.</title><p>(<bold>A</bold>) Representative EPSC traces from WT neurons illustrating both phasic and tonic release as shown in <xref ref-type="fig" rid="fig3">Figure 3A</xref>. (<bold>B</bold>) Plot of cumulative total tonic charge transfer vs time. Data were fitted and analyzed as described in <xref ref-type="fig" rid="fig3">Figure 3C</xref>. (<bold>C</bold>) SV replenishment was reduced in KO (2.19 ± 0.22 s<sup>−1</sup>) as compared to WT neurons (3.95 ± 0.61 s<sup>−1</sup>). WT (3.93 ± 0.31 s<sup>−1</sup>), but not the 4D/N mutant form (1.88 ± 0.26 s<sup>−1</sup>) of syt 7, rescued replenishment. The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ± SEM. ***p<0.001, analyzed by one-way ANOVA, compared to WT.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.010">http://dx.doi.org/10.7554/eLife.01524.010</ext-link></p></caption><graphic xlink:href="elife01524fs005"/></fig></fig-group></p><p>Five mechanisms could potentially contribute to the faster depression observed in KO neurons: changes in postsynaptic receptor density or kinetic properties; saturation or desensitization of postsynaptic receptors; a smaller RRP size which fails to supply sufficient SVs; defective SV replenishment; or slower SV recycling/refilling. Below, we address each of these possibilities and demonstrate that defective SV replenishment underlies the increased rate of depression in KO neurons.</p></sec><sec id="s2-3"><title>Loss of syt 7 impairs SV replenishment</title><p>The unaltered quantal release properties in KO neurons (<xref ref-type="fig" rid="fig1">Figure 1A–E</xref>) rule out changes in postsynaptic components, such as the density or kinetic properties of AMPA receptors. To further exclude the role of desensitization or saturation of postsynaptic receptors during HFS, we monitored transmission, during HFS, in the presence of cyclothiazide (CTZ, 50 µM) and kynurenic acid (KYN, 100 µM), as described previously (<xref ref-type="bibr" rid="bib30">Neher and Sakaba, 2001</xref>; <xref ref-type="fig" rid="fig3s4">Figure 3—figure supplement 4A</xref>). CTZ and KYN reduce AMPA receptor desensitization and saturation, respectively. KO neurons still displayed faster depression (<xref ref-type="fig" rid="fig3s4">Figure 3—figure supplement 4B</xref>).</p><p>Next, we integrated the phasic charge from the HFS experiments (<xref ref-type="fig" rid="fig3">Figure 3A</xref>) and plotted the cumulative charge vs time (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). The last ten EPSCs were best fitted by a linear function (solid line in <xref ref-type="fig" rid="fig3">Figure 3C</xref>; linearity is established in the inset), as described in previous reports utilizing hippocampal neurons (<xref ref-type="bibr" rid="bib41">Stevens and Williams, 2007</xref>) and the calyx of Held (<xref ref-type="bibr" rid="bib38">Schneggenburger et al., 1999</xref>; <xref ref-type="bibr" rid="bib17">Hosoi et al., 2007</xref>), to calculate RRP size, release probability, and SV replenishment rates. The size of the RRP (the y-intercept) was similar between WT and KO neurons (<xref ref-type="fig" rid="fig3">Figure 3D</xref>). Since single AP evoked EPSCs were identical between WT and KO neurons (<xref ref-type="fig" rid="fig1">Figure 1F</xref>), SV release probability (calculated by dividing the EPSC charge by the RRP size) was unchanged in the KOs (0.21 ± 0.03 for KO vs 0.24 ± 0.02 for WT). The slope of the linear function was divided by the y-intercept in a given cell pair to calculate the SV replenishment rate. Strikingly, we found that the replenishment rate was reduced by ∼50% for phasic release in KO neurons (0.26 ± 0.03 s<sup>−1</sup> for KO vs 0.52 ± 0.06 s<sup>−1</sup> for WT) (<xref ref-type="fig" rid="fig3">Figure 3E</xref>). WT syt 7, but not the 4D/N mutant, fully rescued SV replenishment (<xref ref-type="fig" rid="fig3">Figure 3C,E</xref>). The size of the RRP was unchanged in the rescue experiments (<xref ref-type="fig" rid="fig3">Figure 3D</xref>).</p><p>We also applied similar methods as described in <xref ref-type="fig" rid="fig3">Figure 3C</xref> to investigate SV replenishment during tonic transmission (<xref ref-type="fig" rid="fig3s5">Figure 3—figure supplement 5A,B</xref>); the replenishment rate was, again, reduced by ∼50% in KO neurons (2.19 ± 0.22 s<sup>−1</sup> for KO vs 3.95 ± 0.61 s<sup>−1</sup> for WT), and WT syt 7, but not the 4D/N mutant, rescued this defect (<xref ref-type="fig" rid="fig3s5">Figure 3—figure supplement 5C</xref>). These results are consistent with a previous report indicating that tonic transmission is maintained by Ca<sup>2+</sup>-dependent SV replenishment during activity (<xref ref-type="bibr" rid="bib32">Otsu et al., 2004</xref>).</p></sec><sec id="s2-4"><title>Slower RRP recovery in KO neurons</title><p>To further confirm the replenishment defect in KO neurons, we investigated the recovery kinetics of phasic release after HFS. Recovery was calculated by measuring the total charge transfer during phasic release at various time intervals, between bouts of HFS, where the second response was divided by the first response (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). A double exponential function was used to fit the recovery time-course, revealing fast and slow components of recovery. Notably, fast recovery (<xref ref-type="fig" rid="fig4">Figure 4B</xref>) was delayed by ∼60% in KO neurons (1.32 ± 0.22 s) as compared to WT neurons (0.55 ± 0.17 s), while slow recovery (<xref ref-type="fig" rid="fig4">Figure 4C</xref>) was unaffected by loss of syt 7 (WT: 15.72 ± 2.85 s; KO: 14.13 ± 2.24 s). WT syt 7 (0.52 ± 0.12 s), but not the 4D/N mutant (1.28 ± 0.26 s), rescued fast recovery (<xref ref-type="fig" rid="fig4">Figure 4A,B</xref>), indicating that syt 7 regulates this process in a Ca<sup>2+</sup>-dependent manner during phasic release. Surprisingly, the recovery of total tonic transmission during HFS also displayed the same two recovery components (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1A–C</xref>). WT syt 7, but not the 4D/N mutant, rescued fast recovery of tonic transmission (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1A,B</xref>). Thus, recovery of phasic and tonic release might involve the same Ca<sup>2+</sup>-dependent pathway.<fig-group><fig id="fig4" position="float"><object-id pub-id-type="doi">10.7554/eLife.01524.011</object-id><label>Figure 4.</label><caption><title>Impaired fast recovery of phasic transmission in KO neurons.</title><p>(<bold>A</bold>) Time course for the recovery of phasic release (Δt = 0.5, 1, 3, 5, 9, 17, 33 and 65 s). Data were fitted using a double exponential function, yielding fast (<bold>B</bold>) and slow (<bold>C</bold>) recovery. The upper diagram is the stimulation protocol. Inset: expansion of the early phase of the plot. (<bold>B</bold>) The fast recovery time constant was increased in KO (1.32 ± 0.22 s) as compared to WT neurons (0.55 ± 0.17 s). WT syt 7 (0.52 ± 0.12 s), but not the 4D/N mutant (1.28 ± 0.26 s), rescued the SV replenishment rate in KO neurons. (<bold>C</bold>) The slow recovery time constant was invariant among all groups. (WT: 15.72 ± 2.85 s; KO: 14.13 ± 2.24 s; KO + syt 7: 17.03 ± 3.24 s; and KO + syt 7 4D/N: 18.88 ± 4.45 s). The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ± SEM. ***p<0.001, analyzed by one-way ANOVA, compared to WT.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.011">http://dx.doi.org/10.7554/eLife.01524.011</ext-link></p></caption><graphic xlink:href="elife01524f004"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01524.012</object-id><label>Figure 4—figure supplement 1.</label><caption><title>The fast recovery component of tonic transmission is impaired in KO neurons.</title><p>(<bold>A</bold>) Time course for the recovery of tonic release. Data were fitted and analyzed as described in <xref ref-type="fig" rid="fig4">Figure 4A</xref>. Upper panel depicts the HFS protocol (Δt = 0.5, 1, 3, 5, 9, 17, 33 and 65 s). (<bold>B</bold>) The fast recovery time constant for tonic release was increased in KO (1.20 ± 0.24 s) as compared to WT neurons (0.54 ± 0.05 s). WT (0.61 ± 0.15 s), but not the 4D/N mutant form (1.4 ± 0.22 s) of syt 7, rescued SV replenishment. (<bold>C</bold>) The slow recovery time constant for tonic release was the same among all groups. (WT: 18.52 ± 2.43 s; KO: 17.43 ± 3.39 s; KO + syt 7: 17.42 ± 3.65 s; and KO + syt 7 4D/N: 16.07 ± 4.15 s). The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ± SEM. ***p<0.001, analyzed by one-way ANOVA, compared to WT.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.012">http://dx.doi.org/10.7554/eLife.01524.012</ext-link></p></caption><graphic xlink:href="elife01524fs006"/></fig></fig-group></p></sec><sec id="s2-5"><title>Enhanced synaptic depression in KO neurons during ‘first fusion’ events</title><p>To address potential defects in SV recycling/refilling in KO neurons during ongoing transmission, we utilized synaptophysin-pHluorin (sypHy) to measure SV exocytosis driven by HFS (20 Hz) in the presence of bafilomycin (1 µM), an inhibitor of the vesicular proton pump (<xref ref-type="fig" rid="fig5">Figure 5A–C</xref>), to measure first fusion events. Under these conditions, in which SV recycling cannot play a role in ongoing synaptic transmission, KO neurons still displayed a significant reduction in SV release (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). Importantly, KO neurons exhibited reductions in SV release as early as the second imaging time point (i.e., 1 sec, 20 Hz stimulation) (<xref ref-type="fig" rid="fig5">Figure 5C</xref>), consistent with electrophysiological recordings in <xref ref-type="fig" rid="fig3">Figure 3C</xref>. Moreover, we also examined first release events during HFS by recording synaptic currents in the presence of bafilomycin and, again, significantly faster depression (<xref ref-type="fig" rid="fig5">Figure 5D</xref>), reduced cumulative release (<xref ref-type="fig" rid="fig5">Figure 5E</xref>), unchanged RRP size (<xref ref-type="fig" rid="fig5">Figure 5F</xref>), and slower SV replenishment (<xref ref-type="fig" rid="fig5">Figure 5G</xref>), were observed in the KOs. These data indicate that SV recycling does not contribute to the observed reduction in SV release in KO neurons during HFS.<fig id="fig5" position="float"><object-id pub-id-type="doi">10.7554/eLife.01524.013</object-id><label>Figure 5.</label><caption><title>The reduction in SV release in KO neurons during HFS is independent of vesicle recycling.</title><p>(<bold>A</bold>) Representative image showing the sypHy signal from the same synapse upon stimulation in the absence, and presence, of bafilomycin. (<bold>B</bold>) Averaged traces of sypHy in WT (black) and KO (red) neurons in response to stimulation in the presence of bafilomycin. KO neurons displayed a significant reduction in sustained SV release as compared to WT neurons. Data were collected for ∼300 boutons per condition as follows: ∼50 boutons per coverlip, from six coverslips (two each from three independent litters of mice). All data shown represent mean ±SEM. ***p<0.001 analyzed by two-way ANOVA. The initial response, indicated by the tan rectangle, is expanded in panel <bold>C</bold>. (<bold>C</bold>) KO neurons display reduced sypHy responses early in the train. *p<0.05, analyzed using the Student’s <italic>t</italic> test. (<bold>D</bold>–<bold>G</bold>) ESPC recordings, in response to HFS, in the presence of bafilomycin. (<bold>D</bold>) The peak amplitude of each EPSC was normalized to the peak of the first response and plotted vs time. (<bold>E</bold>) Plot of cumulative total phasic charge transfer vs time. Data were fitted and analyzed as described in <xref ref-type="fig" rid="fig3">Figure 3C</xref>. (<bold>F</bold>) The size of the RRP is the same in WT and KO neurons (WT: 35.42 ± 5.07 pC; KO: 32.07 ± 4.54 pC). (<bold>G</bold>) Reduction in the SV replenishment rate in KO neurons in the presence of bafilomycin (WT: 0.49 ± 0.06 s<sup>−1</sup>; KO: 0.23 ± 0.03 s<sup>−1</sup>). The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ± SEM. ***p<0.001, analyzed using the Student’s <italic>t</italic> test.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.013">http://dx.doi.org/10.7554/eLife.01524.013</ext-link></p></caption><graphic xlink:href="elife01524f005"/></fig></p></sec><sec id="s2-6"><title>Syt 7 functions as a Ca<sup>2+</sup>-sensor for Ca<sup>2+</sup>-dependent SV replenishment</title><p>Previous studies demonstrated that Ca<sup>2+</sup> plays a critical role in the replenishment of SVs (<xref ref-type="bibr" rid="bib12">Dittman and Regehr, 1998</xref>; <xref ref-type="bibr" rid="bib43">Wang and Kaczmarek, 1998</xref>; <xref ref-type="bibr" rid="bib17">Hosoi et al., 2007</xref>; <xref ref-type="bibr" rid="bib36">Sakaba, 2008</xref>). The syt 7 4D/N mutant, which fails to bind Ca<sup>2+</sup>, was unable to rescue SV replenishment in KO neurons (<xref ref-type="fig" rid="fig3">Figure 3</xref>), suggesting that syt 7 functions as Ca<sup>2+</sup>-sensor during replenishment. To test whether Ca<sup>2+</sup> is essential for the function of syt 7, we measured recovery of the RRP by applying paired pulses of hypertonic sucrose (500 mM, each for 10 s), with varying interpulse time intervals, under Ca<sup>2+</sup>-free conditions (replacement of [Ca<sup>2+</sup>]<sub>o</sub> with EGTA, incubation with BAPTA-AM, and addition of cyclopazonic acid [CPA] to empty internal stores [<xref ref-type="bibr" rid="bib24">Liu et al., 2009</xref>]) (<xref ref-type="fig" rid="fig6">Figure 6A</xref>). For comparison, we also measured RRP recovery under physiological [Ca<sup>2+</sup>]<sub>o</sub> (2 mM; <xref ref-type="fig" rid="fig6">Figure 6A</xref>).<fig id="fig6" position="float"><object-id pub-id-type="doi">10.7554/eLife.01524.014</object-id><label>Figure 6.</label><caption><title>Syt 7 functions as a Ca<sup>2+</sup>-sensor for Ca<sup>2+</sup>-dependent SV replenishment.</title><p>(<bold>A</bold>) Upper panel illustrates the sucrose application protocol (Δt = 7, 14, 21, 28 and 60 s). Lower panel shows typical responses to sequential application of sucrose (7 s interval) from different groups in 2 mM [Ca<sup>2+</sup>]<sub>o</sub> or Ca<sup>2+</sup>-free conditions. (<bold>B</bold>) The RRP size, calculated from the first sucrose response, was same among the all groups (in 2 mM [Ca<sup>2+</sup>]<sub>o</sub>, WT: 0.86 ± 0.21 nC; KO: 0.72 ± 0.14 nC; KO + syt 7: 0.78 ± 0.09 nC; and KO + syt 7 4D/N: 0.85 ± 0.08 nC; in Ca<sup>2+</sup>-free conditions, WT: 0.83 ± 0.18 nC; KO: 0.76 ± 0.2 nC). (<bold>C</bold>) The time course of RRP recovery in 2 mM [Ca<sup>2+</sup>]<sub>o</sub> conditions between applications of hypertonic sucrose. Data were fitted with a single exponential function to calculate the recovery time constant in panel <bold>E</bold>. (<bold>D</bold>) The recovery of the RRP in Ca<sup>2+</sup>-free conditions. Data were fitted with a single exponential function to calculate the recovery time constant in panel <bold>E</bold>. (<bold>E</bold>) In 2 mM [Ca<sup>2+</sup>]<sub>o</sub>, recovery of the RRP was significantly slowed in KO (18.03 ± 2.87 s) neurons as compared to WT (7.29 ± 1.05 s) neurons, and was rescued by WT syt 7 (8.30 ± 0.79 s), but not the 4D/N mutant (20.07 ± 2.63 s). In Ca<sup>2+</sup>-free conditions, RRP recovery in WT neurons (17.42 ± 2.11 s) was slowed to the same level as in KO neurons (19.2 ± 3.95 s). The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ± SEM. ***p<0.001, analyzed using one-way ANOVA, compared to WT.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.014">http://dx.doi.org/10.7554/eLife.01524.014</ext-link></p></caption><graphic xlink:href="elife01524f006"/></fig></p><p>Consistent with the same RRP size measured by HFS among different groups (<xref ref-type="fig" rid="fig3">Figure 3D</xref>), the RRP size, calculated from the first response to sucrose, was the same between WT, KO, and KOs expressing WT or the syt 7 4D/N mutant, in physiological [Ca<sup>2+</sup>]<sub>o</sub> (<xref ref-type="fig" rid="fig6">Figure 6B</xref>), excluding a role for syt 7 in SV priming. Moreover, the RRP size was the same between the Ca<sup>2+</sup>-free and physiological [Ca<sup>2+</sup>]<sub>o</sub> conditions (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). Of note, there was a significant difference in the absolute size of the RRP as measured using hypertonic sucrose (<xref ref-type="fig" rid="fig6">Figure 6B</xref>; ∼8000 SVs, calculated by dividing the RRP charge by the quantal charge) vs HFS (<xref ref-type="fig" rid="fig3">Figure 3D</xref>; ∼300 SVs). This was expected, because during electrical stimulation, only the synapses formed between the recorded neuron and stimulated neuron are measured. In contrast, hypertonic sucrose activates all of the synapses that impinge on the recorded neuron.</p><p>We then plotted the ratio of the second (P2) relative to the first (P1) sucrose response, as a function of the interpulse time interval, to calculate the recovery time course of the RRP in physiological [Ca<sup>2+</sup>]<sub>o</sub> (<xref ref-type="fig" rid="fig6">Figure 6C</xref>) and Ca<sup>2+</sup>-free conditions (<xref ref-type="fig" rid="fig6">Figure 6D</xref>); these data were best fitted by a single exponential function (solid line in <xref ref-type="fig" rid="fig6">Figure 6C,D</xref>). In physiological [Ca<sup>2+</sup>]<sub>o</sub>, recovery of the RRP was slowed by ∼60% in the KOs (18.03 ± 2.87 s for KO vs 7.29 ± 1.05 s for WT) (<xref ref-type="fig" rid="fig6">Figure 6E</xref>), which is similar to the findings reported above using HFS (<xref ref-type="fig" rid="fig4">Figure 4B</xref>). WT syt 7 (8.30 ± 0.79 s), but not the 4D/N mutant (20.07 ± 2.63 s), rescued this phenotype (<xref ref-type="fig" rid="fig6">Figure 6C,E</xref>). Remarkably, in Ca<sup>2+</sup>-free conditions (<xref ref-type="fig" rid="fig6">Figure 6D</xref>), the recovery of the RRP in WT neurons was reduced to the same level as observed for KO neurons, with or without expression of the 4D/N mutant in physiological [Ca<sup>2+</sup>]<sub>o</sub> conditions (<xref ref-type="fig" rid="fig6">Figure 6E</xref>). Together, the results thus far suggest that there are Ca<sup>2+</sup>-dependent and Ca<sup>2+</sup>-independent pathways for replenishment, and that syt 7 functions as a Ca<sup>2+</sup>-sensor that regulates the Ca<sup>2+</sup>-dependent pathway.</p><p>Hypertonic sucrose stimulates SV release without increasing [Ca<sup>2+</sup>]<sub>i</sub> (<xref ref-type="bibr" rid="bib49">Yao et al., 2011</xref>, <xref ref-type="bibr" rid="bib50">2012</xref>). Therefore, the Ca<sup>2+</sup>-dependent component for recovery of the RRP, observed in the hypertonic sucrose experiments, is likely due to the resting [Ca<sup>2+</sup>]<sub>i</sub>. In vitro reconstitution experiments revealed that syt 7 begins to drive fusion at [Ca<sup>2+</sup>] > 100 nM ([Ca<sup>2+</sup>]<sub>½</sub> = 300 nM) (<xref ref-type="bibr" rid="bib4">Bhalla et al., 2005</xref>). Hence, it is plausible that syt 7 can indeed sense resting [Ca<sup>2+</sup>]<sub>i</sub> to regulate Ca<sup>2+</sup>-dependent SV replenishment.</p></sec><sec id="s2-7"><title>Syt 7 cooperates with CaM to regulate Ca<sup>2+</sup>-dependent SV replenishment</title><p>The reduced SV replenishment phenotype in KO neurons is reminiscent of the effects of CaM antagonists on vesicle replenishment in the calyx of Held (<xref ref-type="bibr" rid="bib37">Sakaba and Neher, 2001</xref>; <xref ref-type="bibr" rid="bib17">Hosoi et al., 2007</xref>), raising the possibility that there are links between CaM and syt 7; indeed, syt 1 has been reported to bind CaM (<xref ref-type="bibr" rid="bib35">Popoli, 1993</xref>; <xref ref-type="bibr" rid="bib34">Perin, 1996</xref>). We therefore conducted pull-down assays using immobilized CaM and the soluble cytoplasmic domains (C2AB) of syt 1, 2, 4, 7, 9 and 10 (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). Surprisingly, robust Ca<sup>2+</sup>-dependent binding to CaM was observed only for syt 7, demonstrating the specificity of the interaction (note: low levels of binding of syt 1, or other syt isoforms, to CaM might have escaped detection). Moreover, the Ca<sup>2+</sup>-promoted interaction between syt 7 and CaM was abolished by the Ca<sup>2+</sup>-ligand mutations in the syt 7 4D/N mutant (<xref ref-type="fig" rid="fig7">Figure 7A</xref>) and was specific for Ca<sup>2+</sup> as Mg<sup>2+</sup> was without effect (<xref ref-type="fig" rid="fig7">Figure 7B</xref>). Together, these biochemical findings are consistent with a model in which the Ca<sup>2+</sup>-sensor for replenishment is actually a complex formed between these two conserved Ca<sup>2+</sup>-binding proteins, syt 7 and CaM.<fig-group><fig id="fig7" position="float"><object-id pub-id-type="doi">10.7554/eLife.01524.015</object-id><label>Figure 7.</label><caption><title>Syt 7 cooperates with CaM to regulate Ca<sup>2+</sup>-dependent SV replenishment.</title><p>(<bold>A</bold>) Immobilized CaM efficiently pulled-down the C2AB domain of syt 7, but not syt 1, 2, 4, 9 or 10, in the presence, but not the absence, of Ca<sup>2+</sup>; the syt 7 4D/N mutant failed to bind. E, 2 mM EGTA; Ca, 1 mM free Ca<sup>2+</sup>. Spaces between gels indicate samples that were run separately. Input corresponds to 25% of the starting material; 50% of the bound material was loaded per lane; no binding was observed when CaM was omitted from the beads (data not shown). (<bold>B</bold>) Mg<sup>2+</sup> fails to promote binding of syt 7 C2AB to CaM. E, 2 mM EGTA; Ca, 1 mM free Ca<sup>2+</sup>; Mg, 1 mM free Mg<sup>2+</sup>. Gels were loaded as in panel <bold>A</bold>. (<bold>C</bold>) Representative EPSCs traces (20 Hz/2.5 s) recorded from WT (black) and KO (red) neurons in the presence of CDZ. (<bold>D</bold>) Plot of cumulative total phasic release charge vs time in the presence of CDZ. Data were analyzed as described in <xref ref-type="fig" rid="fig3">Figure 3C</xref>. (<bold>E</bold>) The size of the RRP was the same among all groups (in control: WT: 38.70 ± 4.78 pC; KO: 33.49 ± 2.48 pC; in CDZ treated neurons: WT: 36.85 ± 5.35 pC; KO: 34.77 ± 6.74 pC). (<bold>F</bold>) CDZ treatment reduced SV replenishment in WT neurons (0.24 ± 0.04 s<sup>−1</sup> vs 0.52 ± 0.06 s<sup>−1</sup> for controls), but had no effect on KO neurons (0.21 ± 0.05 s<sup>−1</sup> vs 0.26 ± 0.03 s<sup>−1</sup> for controls). The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ± SEM. ***p<0.001, analyzed by one-way ANOVA, compared to WT.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.015">http://dx.doi.org/10.7554/eLife.01524.015</ext-link></p></caption><graphic xlink:href="elife01524f007"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01524.016</object-id><label>Figure 7—figure supplement 1.</label><caption><title>CDZ inhibits SV replenishment during tonic transmission in WT neurons.</title><p>(<bold>A</bold>) Plot of cumulative total tonic charge transfer vs time from WT and KO neurons, in the presence and absence of CDZ, during HFS. Data were fitted and analyzed as described in <xref ref-type="fig" rid="fig3">Figure 3C</xref>. (<bold>B</bold>) During tonic transmission, CDZ treatment reduced SV replenishment in WT neurons (1.88 ± 0.32 s<sup>−1</sup> vs 3.95 ± 0.61 s<sup>−1</sup> for controls), but had no effect on the already compromised replenishment rate in KO neurons (1.73 ± 0.34 s<sup>−1</sup> vs 2.19 ± 0.22 s<sup>−1</sup> for controls). The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ± SEM. ***p<0.001, analyzed by one-way ANOVA, compared to WT.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.016">http://dx.doi.org/10.7554/eLife.01524.016</ext-link></p></caption><graphic xlink:href="elife01524fs007"/></fig></fig-group></p><p>To address the potential contribution of CaM to SV replenishment in hippocampal neurons, we next analyzed the SV replenishment rate in WT and KO neurons in the presence and absence of calmidazolium (CDZ; 20 µM), a cell-permeable CaM antagonist (<xref ref-type="bibr" rid="bib37">Sakaba and Neher, 2001</xref>; <xref ref-type="fig" rid="fig7">Figure 7C</xref>). Cells were incubated for 30 min prior to recording to ensure that CDZ had taken effect, and then HFS trains were applied. WT neurons displayed faster depression (<xref ref-type="fig" rid="fig7">Figure 7D</xref>, upper) and reduced cumulative phasic release (<xref ref-type="fig" rid="fig7">Figure 7D</xref>, lower) in the presence of CDZ, consistent with previous observations based on the calyx of Held (<xref ref-type="bibr" rid="bib37">Sakaba and Neher, 2001</xref>; <xref ref-type="bibr" rid="bib17">Hosoi et al., 2007</xref>). Similarly, cumulative tonic transmission in WT neurons was also reduced by CDZ (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1A</xref>). Interestingly, both cumulative phasic and tonic release in WT neurons were reduced to the same levels as in the KO neurons, which were not affected by CDZ (<xref ref-type="fig" rid="fig7">Figure 7C</xref>, <xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1A</xref>). These experiments also revealed that: (1) CDZ does not change the size of the RRP (<xref ref-type="fig" rid="fig7">Figure 7E</xref>), and (2) in WT neurons, the replenishment rates for phasic (<xref ref-type="fig" rid="fig7">Figure 7F</xref>) and tonic release (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1B</xref>) were both reduced to the same levels observed for the KOs, with or without CDZ.</p></sec><sec id="s2-8"><title>A CaM antagonist inhibits recovery of the RRP in WT neurons, phenocopying loss of syt 7</title><p>We next examined the recovery of phasic (<xref ref-type="fig" rid="fig8">Figure 8A</xref>) and tonic release (<xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1A</xref>), as described in <xref ref-type="fig" rid="fig4">Figure 4</xref>, in the presence of CDZ during HFS, in WT and KO neurons. The time course for fast recovery, during phasic (<xref ref-type="fig" rid="fig8">Figure 8B</xref>) and tonic (<xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1B</xref>) transmission in WT neurons, was impaired, phenocopying the KO neurons which, in turn, were unaffected by CDZ. The time course for slow recovery was unaffected under all conditions tested (<xref ref-type="fig" rid="fig8">Figure 8C</xref>, <xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1C</xref>).<fig-group><fig id="fig8" position="float"><object-id pub-id-type="doi">10.7554/eLife.01524.017</object-id><label>Figure 8.</label><caption><title>CDZ inhibits RRP recovery in WT neurons, phenocopying the KO.</title><p>(<bold>A</bold>) Time course for the recovery of phasic release upon HFS; data were collected and analyzed as described in <xref ref-type="fig" rid="fig4">Figure 4A</xref>. The inset panel shows the expanded early phase of the plot. (<bold>B</bold>) CDZ slowed the time course of fast recovery of the RRP in WT neurons (1.35 ± 0.37 s vs 0.55 ± 0.17 s for control), phenocopying the KO neurons, which were not affected by CDZ (1.22 ± 0.36 s vs 1.32 ± 0.22 s for control). (<bold>C</bold>) The time course of slow recovery of the RRP was the same between WT and KO neurons with or without CDZ (WT: 16.02 ± 3.02 s vs 15.72 ± 2.85 s for controls; KO: 15.78 ± 2.5 s vs 14.13 ± 2.24 s for controls). (<bold>D</bold>) Typical responses to sequential (7 s) applications of sucrose to WT and KO neurons in 2 mM [Ca<sup>2+</sup>]<sub>o</sub> in the presence of CDZ. The upper diagram illustrates the protocol used (Δt = 7, 14, 21, 28 and 60 s). (<bold>E</bold>) Time course for the recovery of the RRP after depletion with hypertonic sucrose in 2 mM [Ca<sup>2+</sup>]<sub>o</sub>. Data were fitted with a single exponential function to calculate the recovery time constant (F). (<bold>F</bold>) CDZ increased the time constant for recovery of the RRP in WT neurons (20.69 ± 1.43 s vs 7.29 ± 1.05 s for controls), but had no effect on KO neurons (20.37 ± 2.1 s vs 18.03 ± 2.87 s for controls). The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ±SEM. ***p<0.001, analyzed by one-way ANOVA, compared to WT.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.017">http://dx.doi.org/10.7554/eLife.01524.017</ext-link></p></caption><graphic xlink:href="elife01524f008"/></fig><fig id="fig8s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01524.018</object-id><label>Figure 8—figure supplement 1.</label><caption><title>CDZ impairs recovery of tonic transmission in WT neurons.</title><p>(<bold>A</bold>) Time course of recovery of tonic transmission. Data were fitted and analyzed as described in <xref ref-type="fig" rid="fig4">Figure 4A</xref>. Upper diagram describes the stimulation protocol (Δt = 0.5, 1, 3, 5, 9, 17, 33 and 65 s). Inset: expanded view of the initial section of the plot. (<bold>B</bold>) CDZ slowed the fast recovery component during tonic transmission in WT neurons (1.34 ± 0.35 s vs 0.54 ± 0.05 s for controls), but had no effect on KO neurons (1.18 ± 0.24 s vs 1.20 ± 0.24 s for controls). (<bold>C</bold>) The slow recovery time constant was the same between WT and KO neurons, with or without CDZ (WT: 17.32 ± 2.64 s vs 18.52 ± 2.43 s for controls; KO: 15.83 ± 3.13 s vs 17.43 ± 3.39 s for controls). The n values indicate the number of neurons, obtained from three independent litters of mice, used for these experiments. All data shown represent mean ± SEM. ***p<0.001, analyzed by one-way ANOVA, compared to WT.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.018">http://dx.doi.org/10.7554/eLife.01524.018</ext-link></p></caption><graphic xlink:href="elife01524fs008"/></fig><fig id="fig8s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.01524.019</object-id><label>Figure 8—figure supplement 2.</label><caption><title>CDZ does not compete with syt 7 for binding to CaM.</title><p>The cytoplasmic domains of syt 7 (syt 7 C2AB) and different concentrations of CDZ were simultaneously incubated with immobilized CaM for 2 hr at 37°C in the presence and absence of Ca<sup>2+</sup>. CDZ had no effect on Ca<sup>2+</sup>-dependent binding of syt 7 to CaM. E, 2 mM EGTA; Ca, 1 mM free Ca<sup>2+</sup>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.01524.019">http://dx.doi.org/10.7554/eLife.01524.019</ext-link></p></caption><graphic xlink:href="elife01524fs009"/></fig></fig-group></p><p>We also used hypertonic sucrose, in 2 mM [Ca<sup>2+</sup>]<sub>o</sub> and in the presence of CDZ, to measure the time course for recovery of the RRP in WT and KO neurons (<xref ref-type="fig" rid="fig8">Figure 8D</xref>). CDZ impaired the RRP recovery kinetics in WT neurons, again phenocopying the KOs, which were not affected by the drug (<xref ref-type="fig" rid="fig8">Figure 8E,F</xref>).</p><p>The findings reported above indicate that CaM and syt 7 might act together to regulate vesicle replenishment. We therefore assayed the effect of CDZ on this interaction. CDZ, up to 100 µM, was simultaneously incubated with the syt 7 C2AB domain and immobilized CaM. Competition was not observed (<xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2</xref>). We also incubated immobilized CaM with CDZ for 30 min prior to the addition of syt 7 C2AB. Again, CDZ had no effect on syt 7·CaM interactions (data not shown). These findings indicate that syt 7 and CDZ occupy different sites on CaM to regulate SV replenishment. Thus, CaM might serve as an adaptor, linking syt 7 to another CDZ-sensitive effector in the Ca<sup>2+</sup>-dependent replenishment pathway.</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Short term synaptic plasticity (STP) plays an important role in the central nervous system, including learning and memory (<xref ref-type="bibr" rid="bib53">Zucker and Regehr, 2002</xref>). Changes in SV release probability, RRP size, SV replenishment, or SV recycling can impact STP. In the current report, we discovered that syt 7 contributes to STP by regulating SV replenishment.</p><p>WT syt 7, but not the 4D/N mutant that fails to bind Ca<sup>2+</sup>, rescues the defects in SV replenishment observed in KO neurons, indicating that syt 7 functions as Ca<sup>2+</sup> sensor for this process. We further distinguished a Ca<sup>2+</sup>-independent SV replenishment pathway from the Ca<sup>2+</sup>-dependent pathway by using hypertonic sucrose to drive secretion in the complete absence of Ca<sup>2+</sup> (<xref ref-type="fig" rid="fig6">Figure 6</xref>). Ca<sup>2+</sup>-independent SV replenishment has been discussed in previous studies (<xref ref-type="bibr" rid="bib40">Stevens and Wesseling, 1998</xref>; <xref ref-type="bibr" rid="bib17">Hosoi et al., 2007</xref>); however, only the slow Ca<sup>2+</sup> chelator, EGTA-AM, was used. In the current study, extracellular Ca<sup>2+</sup> was removed and EGTA was included in the bath solution. Moreover, intracellular stores of Ca<sup>2+</sup> were depleted using CPA and the fast Ca<sup>2+</sup> chelator, BAPTA-AM. The finding that WT neurons, in Ca<sup>2+</sup>-free conditions, display a similar RRP recovery rate as compared to KO neurons in normal (Ca<sup>2+</sup>) conditions, along with the inability of the syt 7 4D/N mutant to rescue recovery of the RRP in the presence of Ca<sup>2+</sup> (<xref ref-type="fig" rid="fig6">Figure 6</xref>), strongly indicate that syt 7 is a Ca<sup>2+</sup>-sensor in the Ca<sup>2+</sup>-dependent SV replenishment pathway.</p><p>CaM is a ubiquitous Ca<sup>2+</sup>-binding protein with multiple functions in the SV cycle, including SV replenishment (<xref ref-type="bibr" rid="bib37">Sakaba and Neher, 2001</xref>; <xref ref-type="bibr" rid="bib17">Hosoi et al., 2007</xref>). Remarkably, when applied to WT hippocampal neurons, a CaM antagonist precisely phenocopies the defects in SV replenishment apparent in KO neurons. Moreover, we discovered an avid and direct Ca<sup>2+</sup>-promoted interaction between CaM and syt 7; in contrast, syt 1, 2, 4, 9 and 10 failed to bind to CaM in response to Ca<sup>2+</sup>, and loss of these latter isoforms has not been associated with enhanced synaptic depression (<xref ref-type="bibr" rid="bib27">Maximov and Sudhof, 2005</xref>; <xref ref-type="bibr" rid="bib33">Pang et al., 2006</xref>; <xref ref-type="bibr" rid="bib42">Sun et al., 2007</xref>; <xref ref-type="bibr" rid="bib48">Xu et al., 2007</xref>; <xref ref-type="bibr" rid="bib9">Dean et al., 2009</xref>; <xref ref-type="bibr" rid="bib24">Liu et al., 2009</xref>; <xref ref-type="bibr" rid="bib5">Cao et al., 2011</xref>; <xref ref-type="bibr" rid="bib8">Dean et al., 2012a</xref>). These findings underscore both the specificity of the syt 7•CaM interaction, as well as the specific role played by syt 7 during synaptic depression. Thus, we propose that the Ca<sup>2+</sup>-sensor for replenishment consists of a complex formed between two conserved Ca<sup>2+</sup>-binding proteins, syt 7 and CaM.</p><p>From the data reported here, neuronal functions for the only three syt isoforms found in all metazoans (isoforms 1, 4 and 7; <xref ref-type="bibr" rid="bib2">Barber et al., 2009</xref>) have been determined. In presynaptic terminals, syt 1 acts to directly trigger rapid SV exocytosis (<xref ref-type="bibr" rid="bib16">Geppert et al., 1994</xref>; <xref ref-type="bibr" rid="bib20">Koh and Bellen, 2003</xref>; <xref ref-type="bibr" rid="bib31">Nishiki and Augustine, 2004</xref>; <xref ref-type="bibr" rid="bib24">Liu et al., 2009</xref>), syt 4 regulates the release of brain derived neurotrophic factor to modulate synaptic function (<xref ref-type="bibr" rid="bib9">Dean et al., 2009</xref>, <xref ref-type="bibr" rid="bib10">2012b</xref>), and syt 7 functions as a Ca<sup>2+</sup> sensor for SV replenishment during and after HFS.</p><p>In a previous study it was concluded that neurotransmission was completely normal in KO inhibitory neurons, and that syt 7 did not regulate asynchronous synaptic transmission (<xref ref-type="bibr" rid="bib26">Maximov et al., 2008</xref>). In that study, there was a slight reduction in synaptic transmission in KO neurons during high, but not low, frequency stimulation, suggestive of a defect in replenishment. This effect was less pronounced as compared to our observations; the reasons for this difference are unknown, but might involve differences between the inhibitory and excitatory neurons used in these studies. Moreover, a more recent report from the same group (<xref ref-type="bibr" rid="bib1">Bacaj et al., 2013</xref>), using a KD approach, reached the contradictory conclusion that syt 7 plays a role in asynchronous evoked release. However, loss of syt 7, by either KD or KO, had no effect on asynchronous release (<xref ref-type="bibr" rid="bib26">Maximov et al., 2008</xref>; <xref ref-type="bibr" rid="bib1">Bacaj et al., 2013</xref>); the only case where a loss of release was observed was when syt 7 was knocked down (and not knocked out) in a syt 1 KO background. So, the physiological relevance of this observation is unclear. Moreover, in <xref ref-type="bibr" rid="bib1">Bacaj et al. (2013)</xref>, there was, again, a reduction in release only at late, but not early stages, in the stimulus train in KO neurons. We argue that this result should be interpreted as defective SV replenishment, because loss of asynchronous release should occur for all evoked responses, early and late. Furthermore, impaired replenishment of large dense core vesicles (LDCV) was also reported in KO chromaffin cells (<xref ref-type="bibr" rid="bib39">Schonn et al., 2008</xref>), consistent with our current study. Thus, syt 7 might serve as a ubiquitous Ca<sup>2+</sup> sensor for replenishment of vesicles, including LDCVs and SVs.</p><p>At present, it remains unknown as to how syt 7 and CaM regulate SV replenishment. We observed that c-myc tagged WT syt 7, as well as the 4D/N mutant, were enriched in synapses, but were not co-localized with SV markers (<xref ref-type="fig" rid="fig3s2">Figure 3—figure supplement 2</xref>). These findings raise the possibility that syt 7 may be targeted to, and thereby act at the plasma membrane, as proposed by <xref ref-type="bibr" rid="bib41a">Sugita et al. (2001)</xref>, to drive replenishment by either conveying SVs from reserve pools to the RRP (<xref ref-type="bibr" rid="bib21">Kuromi and Kidokoro, 1998</xref>; <xref ref-type="bibr" rid="bib28">Murthy and Stevens, 1999</xref>; <xref ref-type="bibr" rid="bib18">Ikeda and Bekkers, 2009</xref>), or clearing vesicle release sites (<xref ref-type="bibr" rid="bib19">Kawasaki et al., 2000</xref>; <xref ref-type="bibr" rid="bib47">Wu et al., 2009</xref>; <xref ref-type="bibr" rid="bib29">Neher, 2010</xref>). Using a pHluorin tag, we found that syt 1 and 7 have similar cell surface fractions; while significant levels of each protein are present in the plasma membrane, the largest pools of syt 7 and syt 1 are on internal organelles that acidify (<xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>), consistent with earlier work localizing syt 7 to LDCVs and lysosomes in neuroendocrine cells and cells in the immune system (<xref ref-type="bibr" rid="bib15">Fukuda et al., 2004</xref>; <xref ref-type="bibr" rid="bib44">Wang et al., 2005</xref>; <xref ref-type="bibr" rid="bib7">Czibener et al., 2006</xref>). Clearly, syt 7 is not selectively targeted to the plasma membrane (though, again, like all syt isoforms, some fraction is present in the plasma membrane [<xref ref-type="bibr" rid="bib8">Dean et al., 2012a</xref>]). Moreover, pHluorin-syt 7 does not recycle with SV-like kinetics, even after repetitive stimulation (<xref ref-type="bibr" rid="bib8">Dean et al., 2012a</xref>), excluding the possibility that syt 7 traffics to SVs before, during, or after stimulation. So, syt 7 is likely to regulate replenishment either from the plasma membrane, or from LDCVs or lysosomes.</p><p>In molecular terms, the emerging view is that CaM regulates SV replenishment via interactions with both Munc13-1 (<xref ref-type="bibr" rid="bib23">Lipstein et al., 2013</xref>) and syt 7. Future studies are needed to determine whether CaM can physically interact with both proteins simultaneously, or whether CaM forms mutually exclusive complexes in the replenishment pathway.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Cell culture</title><p>KO mice were provided by NW Andrews (College Park, MD). Primary hippocampal cultures were prepared as described previously (<xref ref-type="bibr" rid="bib24">Liu et al., 2009</xref>). Briefly, heterozygous KO mice were bred, and hippocampal neurons from newborn pups (postnatal day 0) were isolated. Neurons were plated at low density (∼5000 cells/cm<sup>2</sup>) on poly-lysine coated coverslips (Carolina Biologicals, Burlington, NC), and cultured in Neurobasal media supplemented with 2% B-27 and 2 mM Glutamax (Life Technologies, Great Island, NY). Tails from KO pups were kept for genotyping, and electrophysiological recordings from KO and WT littermate neurons were compared.</p><p>All procedures involving animals were performed in accordance with the guidelines of the National Institutes of Health; the protocol used (M01221-0-06-11) was approved by the Institutional Animal Care and Use Committee of the University of Wisconsin–Madison.</p></sec><sec id="s4-2"><title>Molecular biology</title><p>cDNA encoding rat syt 1 and syt 4 were provided by TC Südhof (Stanford, CA) and H. Herschman (Los Angeles, CA), respectively. cDNA encoding mouse syt 2, 7, 9, and 10 were provided by M Fukuda (Saitama, Japan). We note that the D374 mutation in the original syt 1 cDNA was corrected by replacement with a glycine residue (<xref ref-type="bibr" rid="bib11">Desai et al., 2000</xref>). cDNA encoding sypHy was provided by E Kavalali (Dallas, TX).</p><p>The syt 7 4D/N mutant harbors a D225,227,357,359N quadruple mutation in which four acidic Ca<sup>2+</sup>-ligands (two in each C2 domain) were neutralized, thereby disrupting Ca<sup>2+</sup>-binding activity.</p><p>Because specific, high affinity syt 7 antibodies are not currently available, a c-myc tag, TGGAGCAGAAGCTGATCAGCGAGGAGGACCTGAACGGAATT, was added to the N-terminus of WT and syt 7 4D/N mutant to detect and localize the exogenously expressed proteins. C-myc tagged syt 1 was used as a control. A signal sequence (ss): ATGGACAGCAAAGGTTCGTCGCAGAAAGGGTCCCGCCTGCTCCTGCTGCTGGTGGTGTCAAATCTACTCTTGTGCCAGGGTGTGGTCTCCGA, was appended onto the N-terminus of the c-myc tag to ensure translocation of the fusion proteins (ss-myc-syt 1, ss-myc-syt 7 and ss-myc-syt 7 4D/N) into the endoplasmic reticulum (<xref ref-type="bibr" rid="bib8">Dean et al., 2012a</xref>). These constructs were subcloned into the pLox Syn-DsRed-Syn-GFP lentivirus vector (provided by F Gomez-School [Spain]) using BamH I and Not I, thereby replacing the DsRed sequence. The GFP was used to identify infected neurons. For pHluorin imaging, sypHy (<xref ref-type="bibr" rid="bib22">Kwon and Chapman, 2011</xref>) was subcloned into this vector, again using BamH I and Not I to replace DsRed. GFP in the pLox vector was replaced by mCherry to avoid spectral overlap with pHluorin.</p></sec><sec id="s4-3"><title>Infection, transfection and immunostaining of hippocampal neurons</title><p>For electrophysiological recordings, WT syt 7 or the 4D/N mutant were expressed in KO neurons at 5 days in vitro (DIV) using lentivirus as described previously (<xref ref-type="bibr" rid="bib13">Dong et al., 2006</xref>).</p><p>For the pHluorin imaging experiments, neurons were grown on 12 mm coverslips in 24-well plates and transfected using the calcium phosphate method at 3–4 days in vitro (DIV) as described previously (<xref ref-type="bibr" rid="bib14">Dresbach et al., 2003</xref>; <xref ref-type="bibr" rid="bib8">Dean et al., 2012a</xref>). Prior to transfection, medium was removed, saved, and replaced with 500 µl Optimem (Life Technologies, Great Island, NY) and incubated for 30–60 min. 105 µl of transfection buffer (274 mM NaCl, 10 mM KCl, 1.4 mM Na<sub>2</sub>HPO<sub>4</sub>, 15 mM glucose, 42 mM HEPES, pH 7.06) was added drop-wise to a 105 µl solution containing 7 µg of DNA and 250 mM CaCl<sub>2</sub>, with gentle vortexing. This mixture was incubated for 20 min at room temperature (RT); 30 µl was added per well and neurons were further incubated for 60–90 min. Medium was removed, cells were washed three times in Neurobasal medium, and the saved medium was added back to the transfected cells. Neurons were used for imaging between 12–17 DIV.</p><p>For the immunostaining experiments, neuronal cultures were immunostained with a mouse monoclonal antibody directed against c-myc (EMD Millipore, Bilerica, MA) to determine the localization of exogenously expressed c-myc-tagged syt 1, syt 7 and the syt 7 4D/N mutant. A polyclonal rabbit anti-synapsin antibody (Synaptic System, Germany) was used to localize synaptic vesicles in presynaptic terminals. 12–17 DIV neurons were fixed with 4% paraformaldehyde in PBS, permeabilized with 0.15% Triton X-100 for 30 min, blocked in 10% goat serum plus 0.1% Triton X-100, stained with primary antibodies for 2 hr, washed with PBS three times, and then incubated with either Cy3-tagged anti-mouse or Alexa 647-tagged anti-rabbit (Jackson ImmunoResearch Laboratories, West Grove, PA) secondary antibodies for 1 hr at room temperature. Coverslips were then mounted in Fluoromount (Southern Biotechnology, Birmingham, AL) and images of were acquired on an Olympus FV1000 upright confocal microscope (Japan) with a 60× 1.10 numerical aperture water-immersion lens. To quantify the degree colocalization, images were imported into ImageJ (NIH) for analysis. The Pearson’s coefficient for colocalization was calculated using the intensity correlation analysis plugin for ImageJ.</p></sec><sec id="s4-4"><title>Electrophysiology</title><p>As described previously (<xref ref-type="bibr" rid="bib24">Liu et al., 2009</xref>), whole-cell voltage-clamp recordings of mEPSCs, evoked EPSCs, and hypertonic sucrose responses were carried out at RT using an EPC-10/2 amplifier (HEKA, Germany) from neurons at 12-17 DIV. The pipette solution consisted of, in mM: 130 K-gluconate, 1 EGTA, 5 Na-phosphocreatine, 2 Mg-ATP, 0.3 Na-GTP, and 10 HEPES, pH 7.3 (290 mOsm). The extracellular solution consisted of (mM): 140 NaCl, 5 KCl, 1 MgCl<sub>2</sub>, 10 glucose, 10 HEPES, pH 7.3 (300 mOsm), 0.05 D-2-amino-5-phosphonopentanoate (D-AP5), 0.1 picrotoxin. For mEPSC recordings, 2 mM Ca<sup>2+</sup> was included, and 1 µM tetrodotoxin (TTX) was added to the extracellular solution. For evoked EPSCs, 5 mM QX-314 (lidocaine N-ethyl bromide) was added to the pipette solution. Various concentrations of [Ca<sup>2+</sup>]<sub>o</sub> (in mM: 0.5, 2, 5 and 10) were used for recording single AP evoked EPSCs. Ten mM [Ca<sup>2+</sup>]<sub>o</sub> was used for the HFS recordings in order to maximize the first response. To evoke EPSCs, a bipolar electrode was placed against the soma, and used to trigger action potentials via a 1 ms minus 20 V pulse, as described previously (<xref ref-type="bibr" rid="bib24">Liu et al., 2009</xref>). Release was recorded as a postsynaptic response via a whole-cell patch electrode in a connected neuron.</p><p>Neurons were voltage clamped at −70 mV. Only cells with series resistances of <15 M, with 70–80% of this resistance compensated, were analyzed. Currents were acquired using PATCHMASTER software (HEKA, Germany), filtered at 2.9 kHz, and digitized at 10 kHz. Data were analyzed using MiniAnalysis software (Synaptosoft, Decatur, GA), Clampfit (Molecular Devices, Sunnyvale, CA), and Igor (Wavemetrics, Portland, OR).</p><p>For hypertonic sucrose experiments, we puffed sucrose over the entire area viewed under a 40× objective lens, which includes virtually all presynaptic boutons contacting the patched cells. 500 mM sucrose was applied to neurons, using an air pressure system (PicoSpritzer III, Parker Hannifin, Cleveland, OH), for 10 s to empty the RRP of vesicles. After a quick wash (Masterflex C/L, Cole–Parmer, Vernon Hills, IL), a second puff of sucrose was applied for another 10 s at various interpluse intervals. The recovery ratio was calculated by dividing the total charge elicited by the second puff of sucrose by the total charge elicited by the first puff. For the sucrose experiments in the presence of physiological [Ca<sup>2+</sup>]<sub>o</sub>, the extracellular solution included 2 mM Ca<sup>2+</sup>. For the Ca<sup>2+</sup>-free condition, [Ca<sup>2+</sup>]<sub>o</sub> was replaced with 5 mM EGTA, and 25 µM BAPTA-AM (30 mM stock in DMSO) and 30 µM CPA (100 mM stock in DMSO) were added to the bath solution; cultures were incubated for 30 min before recording to allow BAPTA-AM and CPA to exert their effects.</p><p>For the recordings using bafilomycin, 1 µM bafilomycin (1.6 mM stock in DMSO) was added to the bath solution, and incubated for 3 min prior to recording. Neurons that were treated with bafilomycin were used within 20 min. For the CDZ experiments, 20 µM CDZ (100 mM stock in DMSO) was added to the bath solution and neurons were incubated for 30 min prior to recording. In the CTZ and KYN experiments, both 50 µM CTZ (100 mM stock in DMSO) and 100 µM KYN (75 mM stock in DMSO) were added to the bath.</p><p>All chemicals were purchased from Sigma–Aldrich.</p></sec><sec id="s4-5"><title>PHluorin imaging experiments</title><p>PHluorin imaging was performed as described previously (<xref ref-type="bibr" rid="bib22">Kwon and Chapman, 2011</xref>; <xref ref-type="bibr" rid="bib8">Dean et al., 2012a</xref>). Neurons were transferred to a live cell imaging chamber (Warner Instruments, Hamden, CT) and continuously perfused with bath solution (140 mM NaCl, 5 mM KCl, 2 mM CaCl<sub>2</sub>, 2 mM MgCl<sub>2</sub>, 10 mM HEPES, 10 mM glucose, 0.1 mM picrotoxin, 50 μM D-AP5, 10 μM CNQX; 310 mOsm, pH 7.4) at RT. The transfected cells were identified via mCherry fluorescence. For field-stimulation, 1 ms voltage pulses (70 V) were delivered using an SD9 stimulator (Natus Neurology, Warwick, RI) connected to two parallel platinum wires spaced by 10 mm in the imaging chamber (Warner Instruments, Hamden, CT). Time-lapse images were acquired at 1 s intervals, with 484ex/517em, on an inverted microscope (Nikon TE300, Japan) with a 1.42 NA 100× immersion oil objective under illumination with a Xenon light source (Lambda DG4, Sutter Instrument, Novato, CA). Fluorescence changes at individual boutons were detected using a Cascade 512II EMCCD camera (Roper Scientific, Trenton, NJ); data were collected and analyzed offline using MetaMorph 6.0 software. A baseline of 10 images was collected before applying high-frequency field stimulation. A typical exposure time was 400 ms for pHluorin. Puncta that did not exhibit any lateral movement during image acquisition were chosen for analysis.</p><p>For pHluorin-syt 7 and pHluorin-syt 1 quenching/de-quenching experiments, fast solution exchanges were achieved using an MBS-2 perfusion system (MPS-2, World Precision Instruments, Sarasota, FL). The acidic solution, with a pH of 5.5, was prepared by replacing HEPES, in the bath saline used for perfusion, with 2-[<italic>N</italic>-morpholinoethane sulphonic acid (pKa = 6.1). An ammonium chloride solution (pH 7.4) was prepared by substituting 50 mM NaCl in bath saline with NH<sub>4</sub>Cl, while all other components remained unchanged.</p></sec><sec id="s4-6"><title>Recombinant proteins</title><p>Recombinant cytoplasmic domains of syt isforms were generated as either GST fusion proteins, or his6-tagged proteins. For GST fusion proteins, cDNA encoding the tandem C2 domains of syt 1 (residues 96-421), WT (residues 134–403) or the 4D/N mutant form of syt 7, and cDNA encoding the isolated C2A (residues 134–263 ) or C2B (residues 243–403) domain of WT (syt 7 C2A; syt 7 C2B) or the Ca<sup>2+</sup>-ligand mutant forms of each C2-domain (syt 7 C2A 2D/N, D225,227N; syt 7 C2B 2D/N, D357,359N) of syt 7, were expressed as glutathione S-transferase (GST) fusion proteins and purified using glutathione-Sepharose beads (GE healthcare), as described previously (<xref ref-type="bibr" rid="bib3">Bhalla et al., 2008</xref>). The GST tag was removed via thrombin cleavage. For his6-tagged proteins, cDNA encoding the tandem C2 domains of syt 1 (residues 96-421), syt 2 (residues 139–423), syt 4 (residues 152–425), syt 7 (residues 134-403), syt 9 (residues 104–386), and syt 10 (residues 223–501) were subcloned into either pTrc-HisA (Invitrogen) or pET28a (Novagen) generating an N-terminal His<sub>6</sub>-tag. His<sub>6</sub>-tagged proteins were purified using Ni Sepharose (GE healthcare), as described previously (<xref ref-type="bibr" rid="bib3">Bhalla et al., 2008</xref>)</p></sec><sec id="s4-7"><title>CaM pull-down assay</title><p>Aliquots of CaM agarose (EMD Millipore, Bilerica, MA), containing 20 μg of CaM, were mixed with 2 μM of the indicated syt fragment in 150 μl of Dulbecco’s Phosphate Buffered Saline (DPBS) plus 0.5% Triton X-100 in the presence of 2 mM EGTA or 1 mM free Ca<sup>2+</sup> or 1 mM free Mg<sup>2+</sup>. The mixture was incubated with rotation at 4°C for 1 hr, after which the CaM beads were collected via centrifugation at 2000×<italic>g</italic> for 50 s, and washed three times with DPBS. Beads were boiled in sample buffer for 5 min, and then subjected to SDS-PAGE. Proteins were visualized by staining with Coomassie blue. In <xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2</xref>, samples were incubated for 2 hr at 37°C.</p></sec><sec id="s4-8"><title>Circular Dichroism (CD) experiments</title><p>CD spectra were obtained using a Model 420 Circular Dichroism Spectrophotometer (Aviv Biomedical) at 20°C using a 1 mm path length cuvette in 50 mM Na<sub>2</sub>HPO<sub>4</sub> (pH 7.4); the protein concentration was 0.4 mg/ml.</p></sec><sec id="s4-9"><title>Isothermal Titration Calorimetry (ITC) experiments</title><p>ITC was carried-out using a MicroCal iTC<sub>200</sub> calorimeter (GE Healthcare, Madison, WI). WT and the Ca<sup>2+</sup>-ligand (2D/N) mutant form of each isolated C2-domain of syt 7 were dialyzed overnight against ITC buffer (50 mM HEPES, 200 mM NaCl, 10% glycerol, pH 7.4) in the presence of Chelex-100 resin. Heat of binding was measured from 11 serial injections of Ca<sup>2+</sup> (3.5 µl of 7 mM Ca<sup>2+</sup> for C2A and 15 mM Ca<sup>2+</sup> for C2B; higher [Ca<sup>2+</sup>] was needed to saturate C2B) into a sample cell containing 1.5 mg/ml (100 μM) protein at 25°C. Data were corrected for heat of dilution.</p></sec><sec id="s4-10"><title>Statistical analysis</title><p>Electrophysiology and imagining data were obtained from three independent litters of mice, unless otherwise indicated. Data were pooled for statistical analysis, as described in previous studies (<xref ref-type="bibr" rid="bib48">Xu et al., 2007</xref>; <xref ref-type="bibr" rid="bib24">Liu et al., 2009</xref>; <xref ref-type="bibr" rid="bib22">Kwon and Chapman, 2011</xref>). All data are presented as the mean ± SEM and significance was determined using the Student’s <italic>t</italic> test, one-way ANOVA, or two-way ANOVA (*p<0.05, **p<0.01, and ***p<0.001), as appropriate (Prism 6, Graphpad Software).</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank members of the Chapman laboratory for helpful discussions, L Roper for providing WT and KO neurons, and M Dong for providing the myc-tagged versions of syt 1 and 7. ERC is an Investigator of the Howard Hughes Medical Institute.</p></ack><sec sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>HL, Designed and performed experiments, Analyzed data, Co-wrote the paper</p></fn><fn fn-type="con" id="con2"><p>HB, Performed and analyzed the biochemical experiments</p></fn><fn fn-type="con" id="con3"><p>EH, Performed and analyzed the biochemical experiments</p></fn><fn fn-type="con" id="con4"><p>ZW, Performed and analyzed the biochemical experiments</p></fn><fn fn-type="con" id="con5"><p>LY, Performed and analyzed the imaging experiments</p></fn><fn fn-type="con" id="con6"><p>CSE, Performed the CD and ITC experiments</p></fn><fn fn-type="con" id="con7"><p>SEK, Performed the pHluorin-syt quenching experiment</p></fn><fn fn-type="con" id="con8"><p>ERC, Designed experiments, Co-wrote the paper</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>Animal experimentation: All procedures involving animals were performed in accordance with the guidelines of the National Institutes of Health; the protocol used (M01221-0-06-11) was approved by the Institutional Animal Care and Use Committee (IACUC) of the University of Wisconsin–Madison.</p></fn></fn-group></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bacaj</surname><given-names>T</given-names></name><name><surname>Wu</surname><given-names>D</given-names></name><name><surname>Yang</surname><given-names>X</given-names></name><name><surname>Morishita</surname><given-names>W</given-names></name><name><surname>Zhou</surname><given-names>P</given-names></name><name><surname>Xu</surname><given-names>W</given-names></name><name><surname>Malenka</surname><given-names>RC</given-names></name><name><surname>Sudhof</surname><given-names>TC</given-names></name></person-group><year>2013</year><article-title>Synaptotagmin-1 and synaptotagmin-7 trigger synchronous and asynchronous phases of neurotransmitter release</article-title><source>Neuron</source><volume>80</volume><fpage>947</fpage><lpage>959</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2013.10.026</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Barber</surname><given-names>CF</given-names></name><name><surname>Jorquera</surname><given-names>RA</given-names></name><name><surname>Melom</surname><given-names>JE</given-names></name><name><surname>Littleton</surname><given-names>JT</given-names></name></person-group><year>2009</year><article-title>Postsynaptic regulation of synaptic plasticity by synaptotagmin 4 requires both C2 domains</article-title><source>The Journal of Cell Biology</source><volume>187</volume><fpage>295</fpage><lpage>310</lpage><pub-id pub-id-type="doi">10.1083/jcb.200903098</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bhalla</surname><given-names>A</given-names></name><name><surname>Chicka</surname><given-names>MC</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2008</year><article-title>Analysis of the synaptotagmin family during reconstituted membrane fusion. Uncovering a class of inhibitory isoforms</article-title><source>The Journal of Bioloical Chemistry</source><volume>283</volume><fpage>21799</fpage><lpage>21807</lpage><pub-id pub-id-type="doi">10.1074/jbc.M709628200</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bhalla</surname><given-names>A</given-names></name><name><surname>Tucker</surname><given-names>WC</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2005</year><article-title>Synaptotagmin isoforms couple distinct ranges of Ca2+, Ba2+, and Sr2+ concentration to SNARE-mediated membrane fusion</article-title><source>Molecular Biology of the Cell</source><volume>16</volume><fpage>4755</fpage><lpage>4764</lpage><pub-id pub-id-type="doi">10.1091/mbc.E05-04-0277</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cao</surname><given-names>P</given-names></name><name><surname>Maximov</surname><given-names>A</given-names></name><name><surname>Sudhof</surname><given-names>TC</given-names></name></person-group><year>2011</year><article-title>Activity-dependent IGF-1 exocytosis is controlled by the Ca(2+)-sensor synaptotagmin-10</article-title><source>Cell</source><volume>145</volume><fpage>300</fpage><lpage>311</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2011.03.034</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2008</year><article-title>How does synaptotagmin trigger neurotransmitter release?</article-title><source>Annual Review of Biochemistry</source><volume>77</volume><fpage>615</fpage><lpage>641</lpage><pub-id pub-id-type="doi">10.1146/annurev.biochem.77.062005.101135</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Czibener</surname><given-names>C</given-names></name><name><surname>Sherer</surname><given-names>NM</given-names></name><name><surname>Becker</surname><given-names>SM</given-names></name><name><surname>Pypaert</surname><given-names>M</given-names></name><name><surname>Hui</surname><given-names>E</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name><name><surname>Mothes</surname><given-names>W</given-names></name><name><surname>Andrews</surname><given-names>NW</given-names></name></person-group><year>2006</year><article-title>Ca2+ and synaptotagmin VII-dependent delivery of lysosomal membrane to nascent phagosomes</article-title><source>The Journal of Cell Biology</source><volume>174</volume><fpage>997</fpage><lpage>1007</lpage><pub-id pub-id-type="doi">10.1083/jcb.200605004</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dean</surname><given-names>C</given-names></name><name><surname>Dunning</surname><given-names>FM</given-names></name><name><surname>Liu</surname><given-names>H</given-names></name><name><surname>Bomba-Warczak</surname><given-names>E</given-names></name><name><surname>Martens</surname><given-names>H</given-names></name><name><surname>Bharat</surname><given-names>V</given-names></name><name><surname>Ahmed</surname><given-names>S</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2012a</year><article-title>Axonal and dendritic synaptotagmin isoforms revealed by a pHluorin-syt functional screen</article-title><source>Molecular Biology of the Cell</source><volume>23</volume><fpage>1715</fpage><lpage>1727</lpage><pub-id pub-id-type="doi">10.1091/mbc.E11-08-0707</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dean</surname><given-names>C</given-names></name><name><surname>Liu</surname><given-names>H</given-names></name><name><surname>Dunning</surname><given-names>FM</given-names></name><name><surname>Chang</surname><given-names>PY</given-names></name><name><surname>Jackson</surname><given-names>MB</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2009</year><article-title>Synaptotagmin-IV modulates synaptic function and long-term potentiation by regulating BDNF release</article-title><source>Nature Neuroscience</source><volume>12</volume><fpage>767</fpage><lpage>776</lpage><pub-id pub-id-type="doi">10.1038/nn.2315</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dean</surname><given-names>C</given-names></name><name><surname>Liu</surname><given-names>H</given-names></name><name><surname>Staudt</surname><given-names>T</given-names></name><name><surname>Stahlberg</surname><given-names>MA</given-names></name><name><surname>Vingill</surname><given-names>S</given-names></name><name><surname>Buckers</surname><given-names>J</given-names></name><name><surname>Kamin</surname><given-names>D</given-names></name><name><surname>Engelhardt</surname><given-names>J</given-names></name><name><surname>Jackson</surname><given-names>MB</given-names></name><name><surname>Hell</surname><given-names>SW</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2012b</year><article-title>Distinct subsets of Syt-IV/BDNF vesicles are sorted to axons versus dendrites and recruited to synapses by activity</article-title><source>The Journal of Neuroscience</source><volume>32</volume><fpage>5398</fpage><lpage>5413</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.4515-11.2012</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Desai</surname><given-names>RC</given-names></name><name><surname>Vyas</surname><given-names>B</given-names></name><name><surname>Earles</surname><given-names>CA</given-names></name><name><surname>Littleton</surname><given-names>JT</given-names></name><name><surname>Kowalchyck</surname><given-names>JA</given-names></name><name><surname>Martin</surname><given-names>TF</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2000</year><article-title>The C2B domain of synaptotagmin is a Ca(2+)-sensing module essential for exocytosis</article-title><source>The Journal of Cell Biology</source><volume>150</volume><fpage>1125</fpage><lpage>1136</lpage><pub-id pub-id-type="doi">10.1083/jcb.150.5.1125</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dittman</surname><given-names>JS</given-names></name><name><surname>Regehr</surname><given-names>WG</given-names></name></person-group><year>1998</year><article-title>Calcium dependence and recovery kinetics of presynaptic depression at the climbing fiber to Purkinje cell synapse</article-title><source>The Journal of Neuroscience</source><volume>18</volume><fpage>6147</fpage><lpage>6162</lpage></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dong</surname><given-names>M</given-names></name><name><surname>Yeh</surname><given-names>F</given-names></name><name><surname>Tepp</surname><given-names>WH</given-names></name><name><surname>Dean</surname><given-names>C</given-names></name><name><surname>Johnson</surname><given-names>EA</given-names></name><name><surname>Janz</surname><given-names>R</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2006</year><article-title>SV2 is the protein receptor for botulinum neurotoxin A</article-title><source>Science</source><volume>312</volume><fpage>592</fpage><lpage>596</lpage><pub-id pub-id-type="doi">10.1126/science.1123654</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dresbach</surname><given-names>T</given-names></name><name><surname>Hempelmann</surname><given-names>A</given-names></name><name><surname>Spilker</surname><given-names>C</given-names></name><name><surname>tom Dieck</surname><given-names>S</given-names></name><name><surname>Altrock</surname><given-names>WD</given-names></name><name><surname>Zuschratter</surname><given-names>W</given-names></name><name><surname>Garner</surname><given-names>CC</given-names></name><name><surname>Gundelfinger</surname><given-names>ED</given-names></name></person-group><year>2003</year><article-title>Functional regions of the presynaptic cytomatrix protein bassoon: significance for synaptic targeting and cytomatrix anchoring</article-title><source>Molecular and Cellular Neuroscience</source><volume>23</volume><fpage>279</fpage><lpage>291</lpage><pub-id pub-id-type="doi">10.1016/S1044-7431(03)00015-0</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fukuda</surname><given-names>M</given-names></name><name><surname>Kanno</surname><given-names>E</given-names></name><name><surname>Satoh</surname><given-names>M</given-names></name><name><surname>Saegusa</surname><given-names>C</given-names></name><name><surname>Yamamoto</surname><given-names>A</given-names></name></person-group><year>2004</year><article-title>Synaptotagmin VII is targeted to dense-core vesicles and regulates their Ca2+ -dependent exocytosis in PC12 cells</article-title><source>Journal of Biological Chemistry</source><volume>279</volume><fpage>52677</fpage><lpage>52684</lpage><pub-id pub-id-type="doi">10.1074/jbc.M409241200</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Geppert</surname><given-names>M</given-names></name><name><surname>Goda</surname><given-names>Y</given-names></name><name><surname>Hammer</surname><given-names>RE</given-names></name><name><surname>Li</surname><given-names>C</given-names></name><name><surname>Rosahl</surname><given-names>TW</given-names></name><name><surname>Stevens</surname><given-names>CF</given-names></name><name><surname>Sudhof</surname><given-names>TC</given-names></name></person-group><year>1994</year><article-title>Synaptotagmin I: a major Ca2+ sensor for transmitter release at a central synapse</article-title><source>Cell</source><volume>79</volume><fpage>717</fpage><lpage>727</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(94)90556-8</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hosoi</surname><given-names>N</given-names></name><name><surname>Sakaba</surname><given-names>T</given-names></name><name><surname>Neher</surname><given-names>E</given-names></name></person-group><year>2007</year><article-title>Quantitative analysis of calcium-dependent vesicle recruitment and its functional role at the calyx of Held synapse</article-title><source>Journal of Neuroscience</source><volume>27</volume><fpage>14286</fpage><lpage>14298</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.4122-07.2007</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ikeda</surname><given-names>K</given-names></name><name><surname>Bekkers</surname><given-names>JM</given-names></name></person-group><year>2009</year><article-title>Counting the number of releasable synaptic vesicles in a presynaptic terminal</article-title><source>Proceedings of the National Academy of Sciences of the United States of America</source><volume>106</volume><fpage>2945</fpage><lpage>2950</lpage><pub-id pub-id-type="doi">10.1073/pnas.0811017106</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kawasaki</surname><given-names>F</given-names></name><name><surname>Hazen</surname><given-names>M</given-names></name><name><surname>Ordway</surname><given-names>RW</given-names></name></person-group><year>2000</year><article-title>Fast synaptic fatigue in shibire mutants reveals a rapid requirement for dynamin in synaptic vesicle membrane trafficking</article-title><source>Nature Neuroscience</source><volume>3</volume><fpage>859</fpage><lpage>860</lpage><pub-id pub-id-type="doi">10.1038/78753</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Koh</surname><given-names>TW</given-names></name><name><surname>Bellen</surname><given-names>HJ</given-names></name></person-group><year>2003</year><article-title>Synaptotagmin I, a Ca2+ sensor for neurotransmitter release</article-title><source>Trends in Neurosciences</source><volume>26</volume><fpage>413</fpage><lpage>422</lpage><pub-id pub-id-type="doi">10.1016/S0166-2236(03)00195-4</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kuromi</surname><given-names>H</given-names></name><name><surname>Kidokoro</surname><given-names>Y</given-names></name></person-group><year>1998</year><article-title>Two distinct pools of synaptic vesicles in single presynaptic boutons in a temperature-sensitive Drosophila mutant, shibire</article-title><source>Neuron</source><volume>20</volume><fpage>917</fpage><lpage>925</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(00)80473-0</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kwon</surname><given-names>SE</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2011</year><article-title>Synaptophysin regulates the kinetics of synaptic vesicle endocytosis in central neurons</article-title><source>Neuron</source><volume>70</volume><fpage>847</fpage><lpage>854</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2011.04.001</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lipstein</surname><given-names>N</given-names></name><name><surname>Sakaba</surname><given-names>T</given-names></name><name><surname>Cooper</surname><given-names>BH</given-names></name><name><surname>Lin</surname><given-names>KH</given-names></name><name><surname>Strenzke</surname><given-names>N</given-names></name><name><surname>Ashery</surname><given-names>U</given-names></name><name><surname>Rhee</surname><given-names>JS</given-names></name><name><surname>Taschenberger</surname><given-names>H</given-names></name><name><surname>Neher</surname><given-names>E</given-names></name><name><surname>Brose</surname><given-names>N</given-names></name></person-group><year>2013</year><article-title>Dynamic control of synaptic vesicle replenishment and short-term plasticity by Ca(2+)-calmodulin-Munc13-1 signaling</article-title><source>Neuron</source><volume>79</volume><fpage>82</fpage><lpage>96</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2013.05.011</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname><given-names>H</given-names></name><name><surname>Dean</surname><given-names>C</given-names></name><name><surname>Arthur</surname><given-names>CP</given-names></name><name><surname>Dong</surname><given-names>M</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2009</year><article-title>Autapses and networks of hippocampal neurons exhibit distinct synaptic transmission phenotypes in the absence of synaptotagmin I</article-title><source>The Journal of Neuroscience</source><volume>29</volume><fpage>7395</fpage><lpage>7403</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.1341-09.2009</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Malenka</surname><given-names>RC</given-names></name></person-group><year>1994</year><article-title>Synaptic plasticity in the hippocampus: LTP and LTD</article-title><source>Cell</source><volume>78</volume><fpage>535</fpage><lpage>538</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(94)90517-7</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maximov</surname><given-names>A</given-names></name><name><surname>Lao</surname><given-names>Y</given-names></name><name><surname>Li</surname><given-names>H</given-names></name><name><surname>Chen</surname><given-names>X</given-names></name><name><surname>Rizo</surname><given-names>J</given-names></name><name><surname>Sorensen</surname><given-names>JB</given-names></name><name><surname>Sudhof</surname><given-names>TC</given-names></name></person-group><year>2008</year><article-title>Genetic analysis of synaptotagmin-7 function in synaptic vesicle exocytosis</article-title><source>Proceedings of the National Academy of Sciences of the United States of America</source><volume>105</volume><fpage>3986</fpage><lpage>3991</lpage><pub-id pub-id-type="doi">10.1073/pnas.0712372105</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Maximov</surname><given-names>A</given-names></name><name><surname>Sudhof</surname><given-names>TC</given-names></name></person-group><year>2005</year><article-title>Autonomous function of synaptotagmin 1 in triggering synchronous release independent of asynchronous release</article-title><source>Neuron</source><volume>48</volume><fpage>547</fpage><lpage>554</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2005.09.006</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Murthy</surname><given-names>VN</given-names></name><name><surname>Stevens</surname><given-names>CF</given-names></name></person-group><year>1999</year><article-title>Reversal of synaptic vesicle docking at central synapses</article-title><source>Nature Neuroscience</source><volume>2</volume><fpage>503</fpage><lpage>507</lpage><pub-id pub-id-type="doi">10.1038/9149</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Neher</surname><given-names>E</given-names></name></person-group><year>2010</year><article-title>What is rate-limiting during sustained synaptic activity: vesicle supply or the availability of release sites</article-title><source>Frontiers in Synaptic Neuroscience</source><volume>2</volume><fpage>144</fpage><pub-id pub-id-type="doi">10.3389/fnsyn.2010.00144</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Neher</surname><given-names>E</given-names></name><name><surname>Sakaba</surname><given-names>T</given-names></name></person-group><year>2001</year><article-title>Combining deconvolution and noise analysis for the estimation of transmitter release rates at the calyx of held</article-title><source>The Journal of Neuroscience</source><volume>21</volume><fpage>444</fpage><lpage>461</lpage></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nishiki</surname><given-names>T</given-names></name><name><surname>Augustine</surname><given-names>GJ</given-names></name></person-group><year>2004</year><article-title>Synaptotagmin I synchronizes transmitter release in mouse hippocampal neurons</article-title><source>The Journal of Neuroscience</source><volume>24</volume><fpage>6127</fpage><lpage>6132</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.1563-04.2004</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Otsu</surname><given-names>Y</given-names></name><name><surname>Shahrezaei</surname><given-names>V</given-names></name><name><surname>Li</surname><given-names>B</given-names></name><name><surname>Raymond</surname><given-names>LA</given-names></name><name><surname>Delaney</surname><given-names>KR</given-names></name><name><surname>Murphy</surname><given-names>TH</given-names></name></person-group><year>2004</year><article-title>Competition between phasic and asynchronous release for recovered synaptic vesicles at developing hippocampal autaptic synapses</article-title><source>The Journal of Neuroscience</source><volume>24</volume><fpage>420</fpage><lpage>433</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.4452-03.2004</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pang</surname><given-names>ZP</given-names></name><name><surname>Sun</surname><given-names>J</given-names></name><name><surname>Rizo</surname><given-names>J</given-names></name><name><surname>Maximov</surname><given-names>A</given-names></name><name><surname>Sudhof</surname><given-names>TC</given-names></name></person-group><year>2006</year><article-title>Genetic analysis of synaptotagmin 2 in spontaneous and Ca2+-triggered neurotransmitter release</article-title><source>The EMBO Journal</source><volume>25</volume><fpage>2039</fpage><lpage>2050</lpage><pub-id pub-id-type="doi">10.1038/sj.emboj.7601103</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Perin</surname><given-names>MS</given-names></name></person-group><year>1996</year><article-title>Mirror image motifs mediate the interaction of the COOH terminus of multiple synaptotagmins with the neurexins and calmodulin</article-title><source>Biochemistry</source><volume>35</volume><fpage>13808</fpage><lpage>13816</lpage><pub-id pub-id-type="doi">10.1021/bi960853x</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Popoli</surname><given-names>M</given-names></name></person-group><year>1993</year><article-title>Synaptotagmin is endogenously phosphorylated by Ca2+/calmodulin protein kinase II in synaptic vesicles</article-title><source>FEBS Letters</source><volume>317</volume><fpage>85</fpage><lpage>88</lpage><pub-id pub-id-type="doi">10.1016/0014-5793(93)81496-M</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sakaba</surname><given-names>T</given-names></name></person-group><year>2008</year><article-title>Two Ca(2+)-dependent steps controlling synaptic vesicle fusion and replenishment at the cerebellar basket cell terminal</article-title><source>Neuron</source><volume>57</volume><fpage>406</fpage><lpage>419</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2007.11.029</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sakaba</surname><given-names>T</given-names></name><name><surname>Neher</surname><given-names>E</given-names></name></person-group><year>2001</year><article-title>Calmodulin mediates rapid recruitment of fast-releasing synaptic vesicles at a calyx-type synapse</article-title><source>Neuron</source><volume>32</volume><fpage>1119</fpage><lpage>1131</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(01)00543-8</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schneggenburger</surname><given-names>R</given-names></name><name><surname>Meyer</surname><given-names>AC</given-names></name><name><surname>Neher</surname><given-names>E</given-names></name></person-group><year>1999</year><article-title>Released fraction and total size of a pool of immediately available transmitter quanta at a calyx synapse</article-title><source>Neuron</source><volume>23</volume><fpage>399</fpage><lpage>409</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(00)80789-8</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schonn</surname><given-names>JS</given-names></name><name><surname>Maximov</surname><given-names>A</given-names></name><name><surname>Lao</surname><given-names>Y</given-names></name><name><surname>Sudhof</surname><given-names>TC</given-names></name><name><surname>Sorensen</surname><given-names>JB</given-names></name></person-group><year>2008</year><article-title>Synaptotagmin-1 and -7 are functionally overlapping Ca2+ sensors for exocytosis in adrenal chromaffin cells</article-title><source>Proceedings of the National Academy of Sciences of the United States of America</source><volume>105</volume><fpage>3998</fpage><lpage>4003</lpage><pub-id pub-id-type="doi">10.1073/pnas.0712373105</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stevens</surname><given-names>CF</given-names></name><name><surname>Wesseling</surname><given-names>JF</given-names></name></person-group><year>1998</year><article-title>Activity-dependent modulation of the rate at which synaptic vesicles become available to undergo exocytosis</article-title><source>Neuron</source><volume>21</volume><fpage>415</fpage><lpage>424</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(00)80550-4</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stevens</surname><given-names>CF</given-names></name><name><surname>Williams</surname><given-names>JH</given-names></name></person-group><year>2007</year><article-title>Discharge of the readily releasable pool with action potentials at hippocampal synapses</article-title><source>Journal of Neurophysiology</source><volume>98</volume><fpage>3221</fpage><lpage>3229</lpage><pub-id pub-id-type="doi">10.1152/jn.00857.2007</pub-id></element-citation></ref><ref id="bib41a"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sugita</surname><given-names>S</given-names></name><name><surname>Han</surname><given-names>W</given-names></name><name><surname>Butz</surname><given-names>S</given-names></name><name><surname>Liu</surname><given-names>X</given-names></name><name><surname>Fernandez-Chacon</surname><given-names>R</given-names></name><name><surname>Lao</surname><given-names>Y</given-names></name><name><surname>Sudhof</surname><given-names>TC</given-names></name></person-group><year>2001</year><article-title>Synaptotagmin VII as a plasma membrane Ca(2+) sensor in exocytosis</article-title><source>Neuron</source><volume>30</volume><fpage>459</fpage><lpage>473</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(01)00290-2</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sun</surname><given-names>J</given-names></name><name><surname>Pang</surname><given-names>ZP</given-names></name><name><surname>Qin</surname><given-names>D</given-names></name><name><surname>Fahim</surname><given-names>AT</given-names></name><name><surname>Adachi</surname><given-names>R</given-names></name><name><surname>Sudhof</surname><given-names>TC</given-names></name></person-group><year>2007</year><article-title>A dual-Ca2+-sensor model for neurotransmitter release in a central synapse</article-title><source>Nature</source><volume>450</volume><fpage>676</fpage><lpage>682</lpage><pub-id pub-id-type="doi">10.1038/nature06308</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>LY</given-names></name><name><surname>Kaczmarek</surname><given-names>LK</given-names></name></person-group><year>1998</year><article-title>High-frequency firing helps replenish the readily releasable pool of synaptic vesicles</article-title><source>Nature</source><volume>394</volume><fpage>384</fpage><lpage>388</lpage><pub-id pub-id-type="doi">10.1038/28645</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>P</given-names></name><name><surname>Chicka</surname><given-names>MC</given-names></name><name><surname>Bhalla</surname><given-names>A</given-names></name><name><surname>Richards</surname><given-names>DA</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2005</year><article-title>Synaptotagmin VII is targeted to secretory organelles in PC12 cells, where it functions as a high-affinity calcium sensor</article-title><source>Molecular and Cellular Biology</source><volume>25</volume><fpage>8693</fpage><lpage>8702</lpage><pub-id pub-id-type="doi">10.1128/MCB.25.19.8693-8702.2005</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>Z</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2010</year><article-title>Rat and Drosophila synaptotagmin 4 have opposite effects during SNARE-catalyzed membrane fusion</article-title><source>Journal of Biological Chemistry</source><volume>285</volume><fpage>30759</fpage><lpage>30766</lpage><pub-id pub-id-type="doi">10.1074/jbc.M110.137745</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wen</surname><given-names>H</given-names></name><name><surname>Linhoff</surname><given-names>MW</given-names></name><name><surname>McGinley</surname><given-names>MJ</given-names></name><name><surname>Li</surname><given-names>GL</given-names></name><name><surname>Corson</surname><given-names>GM</given-names></name><name><surname>Mandel</surname><given-names>G</given-names></name><name><surname>Brehm</surname><given-names>P</given-names></name></person-group><year>2010</year><article-title>Distinct roles for two synaptotagmin isoforms in synchronous and asynchronous transmitter release at zebrafish neuromuscular junction</article-title><source>Proceedings of the National Academy of Sciences of the United States of America</source><volume>107</volume><fpage>13906</fpage><lpage>13911</lpage><pub-id pub-id-type="doi">10.1073/pnas.1008598107</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wu</surname><given-names>XS</given-names></name><name><surname>McNeil</surname><given-names>BD</given-names></name><name><surname>Xu</surname><given-names>J</given-names></name><name><surname>Fan</surname><given-names>J</given-names></name><name><surname>Xue</surname><given-names>L</given-names></name><name><surname>Melicoff</surname><given-names>E</given-names></name><name><surname>Adachi</surname><given-names>R</given-names></name><name><surname>Bai</surname><given-names>L</given-names></name><name><surname>Wu</surname><given-names>LG</given-names></name></person-group><year>2009</year><article-title>Ca(2+) and calmodulin initiate all forms of endocytosis during depolarization at a nerve terminal</article-title><source>Nature Neuroscience</source><volume>12</volume><fpage>1003</fpage><lpage>1010</lpage><pub-id pub-id-type="doi">10.1038/nn.2355</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xu</surname><given-names>J</given-names></name><name><surname>Mashimo</surname><given-names>T</given-names></name><name><surname>Sudhof</surname><given-names>TC</given-names></name></person-group><year>2007</year><article-title>Synaptotagmin-1, -2, and -9: Ca(2+) sensors for fast release that specify distinct presynaptic properties in subsets of neurons</article-title><source>Neuron</source><volume>54</volume><fpage>567</fpage><lpage>581</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2007.05.004</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yao</surname><given-names>J</given-names></name><name><surname>Gaffaney</surname><given-names>JD</given-names></name><name><surname>Kwon</surname><given-names>SE</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2011</year><article-title>Doc2 is a Ca2+ sensor required for asynchronous neurotransmitter release</article-title><source>Cell</source><volume>147</volume><fpage>666</fpage><lpage>677</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2011.09.046</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yao</surname><given-names>J</given-names></name><name><surname>Kwon</surname><given-names>SE</given-names></name><name><surname>Gaffaney</surname><given-names>JD</given-names></name><name><surname>Dunning</surname><given-names>FM</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name></person-group><year>2012</year><article-title>Uncoupling the roles of synaptotagmin I during endo- and exocytosis of synaptic vesicles</article-title><source>Nature Neuroscience</source><volume>15</volume><fpage>243</fpage><lpage>249</lpage><pub-id pub-id-type="doi">10.1038/nn.3013</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yoshihara</surname><given-names>M</given-names></name><name><surname>Adolfsen</surname><given-names>B</given-names></name><name><surname>Galle</surname><given-names>KT</given-names></name><name><surname>Littleton</surname><given-names>JT</given-names></name></person-group><year>2005</year><article-title>Retrograde signaling by Syt 4 induces presynaptic release and synapse-specific growth</article-title><source>Science</source><volume>310</volume><fpage>858</fpage><lpage>863</lpage><pub-id pub-id-type="doi">10.1126/science.1117541</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>Z</given-names></name><name><surname>Bhalla</surname><given-names>A</given-names></name><name><surname>Dean</surname><given-names>C</given-names></name><name><surname>Chapman</surname><given-names>ER</given-names></name><name><surname>Jackson</surname><given-names>MB</given-names></name></person-group><year>2009</year><article-title>Synaptotagmin IV: a multifunctional regulator of peptidergic nerve terminals</article-title><source>Nature Neuroscience</source><volume>12</volume><fpage>163</fpage><lpage>171</lpage><pub-id pub-id-type="doi">10.1038/nn.2252</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zucker</surname><given-names>RS</given-names></name><name><surname>Regehr</surname><given-names>WG</given-names></name></person-group><year>2002</year><article-title>Short-term synaptic plasticity</article-title><source>Annual Review of Physiology</source><volume>64</volume><fpage>355</fpage><lpage>405</lpage><pub-id pub-id-type="doi">10.1146/annurev.physiol.64.092501.114547</pub-id></element-citation></ref></ref-list></back><sub-article article-type="article-commentary" id="SA1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.01524.020</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Davis</surname><given-names>Graeme</given-names></name><role>Reviewing editor</role><aff><institution>University of California, San Francisco</institution>, <country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see <ext-link ext-link-type="uri" xlink:href="http://elife.elifesciences.org/review-process">review process</ext-link>). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.</p></boxed-text><p>Thank you for sending your work entitled “Synaptotagmin VII Functions as a Ca<sup>2+</sup>-sensor for Synaptic Vesicle Replenishment” for consideration at <italic>eLife</italic>. Your article has been favorably evaluated by a Senior editor and 3 reviewers, one of whom is a member of our Board of Reviewing Editors.</p><p>The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.</p><p>This is a well-done piece of work indicating that synaptotagmin VII has a specific role in synaptic vesicle mobilization. The analyses rely almost completely on a physiological characterization of synaptotagmin VII knockout mice, and data interpretation is greatly aided by the selective effect with no observable change in the response to a single action potential or pool size. In addition, the results are consistent with previous work showing little effect of SytVII on synaptic transmission. An important element of this study is the experiments to rescue the defect with either wild type SytVII or with a mutant version of SytVII that lacks calcium binding (4D/N). An analysis of recovery from depression supports the conclusion that SytVII is required for the fast phase of vesicle recovery, a deficit of ∼50% is resolved. In general, the experiments are nicely performed and clearly documented.</p><p>Despite the quality of the data, all three reviewers raised similar concerns with the manuscript that must be addressed in order for this work to be considered further at <italic>eLife</italic>. These concerns must be addressed.</p><p>1) The authors have in no way addressed the fact that in a 2008 publication from the Sudhof lab (Maximov et al., PNAS) the claim is that there is in fact no real depression in synaptic depression during HFS. Interestingly the authors actually agree on many points, i.e., no change in RRP, no change in PPR etc. However as this is really the crux of this paper and the two studies on the face of it simply do not agree I think it is imperative that this be explained, or examined. There is a possible trivial explanation, which is that the Sudhof report was on inhibitory neurons. If that is the explanation then is lessens the generality of this finding. This must be addressed in the text or through further experimentation.</p><p>2) It is very difficult to understand how a protein that does not localize to either the plasma membrane or synaptic vesicles influences the replenishment of synaptic vesicles. The authors suggest that the known role of syt VII in dense core vesicle release may contribute, presumably by releasing a factor that influences synaptic vesicle recycling. However, the loss of syt VII does not eliminate regulated exocytosis of chromaffin granules, and it is harder to understand how a partial defect would produce this effect on synaptic transmission, particularly since the defect occurs as early as the second action potential in a train. This issue lies at the very heart of this study. As such, this issue has to be introduced in the Introduction and should be clearly and openly discussed. In addition, the authors should attempt additional experimentation to confirm that SytVII does indeed reside on an internal membrane and provide further experimentation to address how SytVII could specifically influence recovery. The interation with calmodulin is interesting, but it remains a protein interaction without a clearly understood relevance to vesicle recovery.</p><p>3) The work provides no mention of the number of animals or samples used for any of the experiments, in either the Methods or the figure legends. The legend to <xref ref-type="fig" rid="fig1">Figure 1</xref> mentions three independent trials, but it is unclear what that means (animals, slices, cells), or its relationship to the statistics. This is a serious deficiency and a low n could greatly reduce confidence in this entire study. Similarly, the imaging in <xref ref-type="fig" rid="fig5">Figure 5</xref> presents unnormalized changes in fluorescence, and it is very hard to evaluate this either-it would be particularly difficult to combine data like this from multiple independent experiments, again raising concern about n.</p><p>4) The authors demonstrate that the D/N mutations in the C2 domain do not rescue, consistent with the need for this tagmin to bind calcium for its function. However the authors never actually show that this protein is actually present at synapses when re-expressed as a mutant. This should be addressed experimentally.</p></body></sub-article><sub-article article-type="reply" id="SA2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.01524.021</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p><italic>1) The authors have in no way addressed the fact that in a 2008 publication from the Sudhof lab (Maximov et al., PNAS) the claim is that there is in fact no real depression in synaptic depression during HFS. Interestingly the authors actually agree on many points, i.e. no change in RRP, no change in PPR etc. However as this is really the crux of this paper and the two studies on the face of it simply do not agree I think it is imperative that this be explained, or examined. There is a possible trivial explanation, which is that the Sudhof report was on inhibitory neurons. If that is the explanation then is lessens the generality of this finding. This must be addressed in the text or through further experimentation</italic>.</p><p>We thank the referees for raising this issue. There are numerous self-contradictory reports from the Sudhof lab concerning the synaptotagmins (syt), and in most cases we are unable to explain these contradictions. Specifically, regarding syt 7: a) the Sudhof lab reported that syt 1 and 7 had the same Ca<sup>2+</sup>- affinity for Ca<sup>2+</sup>-dependent binding to membranes (Li et al., 1995), and reported that syt 7 has a much higher Ca<sup>2+</sup>-affinity for membrane binding, as compared to syt 1 (Sugita et al., 2002).</p><p>b) In 2001, the Sudhof lab reported that: “<italic>We now propose that synaptotagmin VII functions as a plasma membrane Ca</italic><sup><italic>2+</italic></sup> <italic>sensor in synaptic exocytosis complementary to vesicular synaptotagmins</italic>” (Sugita et al., 2001), but later reported that: “…<italic>Ca</italic><sup><italic>2+</italic></sup> <italic>binding by synaptotagmin-VII likely does not regulate SV exocytosis…</italic>” (<xref ref-type="bibr" rid="bib26">Maximov et al., 2008</xref>). [We also note that the Sudhof lab reported that syt 1 must be glycosylated in order to be targeted to SVs, and the reason why syt 7 was targeted to the plasma membrane was because it was not glycosylated (Han et al., 2004). However, we found that glycosylation plays no role in the targeting of syt 1 to SVs, and that syt 7 is not selectively targeted to the plasma membrane (Dean et al., 2012; Kwon and Chapman, 2012).]</p><p>c) During review of our syt 7 manuscript, the Sudhof lab published a new syt 7 paper (<xref ref-type="bibr" rid="bib1">Bacaj et al., 2013</xref>) where they now state: “<italic>We identify a selective essential function for Syt 7 in asynchronous release.</italic>” This contradicts their earlier paper (<xref ref-type="bibr" rid="bib26">Maximov et al., 2008</xref>), in which they state, again, that “<italic>…Ca</italic><sup><italic>2+</italic></sup> <italic>binding by synaptotagmin-VII likely does not regulate SV exocytosis…</italic>”, and that syt 7 plays no role in asynchronous release.</p><p>In <xref ref-type="bibr" rid="bib1">Bacaj et al. (2013)</xref>, the authors used a knock-down (KD) approach to conclude that syt 7 plays a role in asynchronous release. The authors propose that compensatory mechanisms, that result from the knock-out (KO) of syt 7, preclude functional effects (and hence explain the lack of an effect in <xref ref-type="bibr" rid="bib26">Maximov et al. (2008)</xref>, where syt 7 KOs were used), and that a KD approach should be used to study syt 7. This claim predicts that KD of syt 7 should decrease asynchronous release in otherwise WT neurons, but this was not the case: the authors saw no effect on asynchonrous release when syt 7 was knocked-down in otherwise WT neurons (<xref ref-type="bibr" rid="bib1">Bacaj et al., 2013</xref>). So, there is complete agreement that KO or KD of syt 7 has no effect on asynchronous release from mouse central neurons.</p><p>In summary, the physiological relevance of the new proposal from the Sudhof lab, that syt 7 regulates asynchronous release, is unclear, as it occurred only when syt 7 was knocked-down, but not knocked-out, in a syt 1 KO background. Moreover, in the syt 7 KD/syt1 KO study, a key control – hypertonic sucrose (to determine the size and existence of releasable vesicle pools) – was missing, so the reported phenotype could simply be due to a loss of releasable SVs, and the published data set cannot be interpreted.</p><p>Getting back to the specific point raised by the referees, we note that in Figure 5B of <xref ref-type="bibr" rid="bib26">Maximov et al. (2008)</xref>, there was in fact a slight reduction in synaptic transmission in syt 7 KO neurons during high, but not low frequency stimulation, suggestive of a defect in vesicle replenishment. These results are consistent with our findings, although the magnitude of the effect was smaller in Maximov et al (2008). Moreover, in <xref ref-type="bibr" rid="bib1">Bacaj et al. (2013)</xref>, there is a reduction in release at later, but not early, stages in the stimulus train, which we argue should be interpreted as defective SV replenishment, not the “suppression” of “asynchronous” release posited by the authors (<xref ref-type="bibr" rid="bib1">Bacaj et al., 2013</xref>). Loss of asynchronous release should occur for all evoked responses, early and late, but in Figure 7c of <xref ref-type="bibr" rid="bib1">Bacaj et al. (2013)</xref> this is not the case: a loss of charge transfer became apparent only at late stages in the stimulus train in syt 7 KO neurons, again consistent with our model that posits that syt 7 plays in role in SV replenishment, but not in asynchronous release.</p><p>Furthermore, impaired replenishment of large dense core vesicles (LDCVs) was also reported in syt 7 KO chromaffin cells, where the authors state:</p><p>“<italic>Replenishment was inhibited in KO cells</italic>” (<xref ref-type="bibr" rid="bib39">Schonn et al., 2008</xref>). Therefore, we hypothesize that syt 7 is a ubiquitous Ca<sup>2+</sup> sensor for vesicle replenishment, contributing to the replenishment of both LDCVs and SVs.</p><p>We have included a short discussion of the <xref ref-type="bibr" rid="bib26">Maximov et al. (2008)</xref> paper and the <xref ref-type="bibr" rid="bib1">Bacaj et al. (2013)</xref> paper in “Discussion” section of the revised manuscript, to help to clarify these points.</p><p><italic>2) It is very difficult to understand how a protein that does not localize to either the plasma membrane or synaptic vesicles influences the replenishment of synaptic vesicles</italic>.</p><p>Our new pHluorin-syt 7 and -syt 1 quenching/de-quenching experiments confirmed (please see also (Dean et al., 2012)) that the surface and internal fractions of these isoforms were similar (revised <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>), thus syt 7 is not selectively targeted to the plasma membrane (as discussed above). Clearly, some fraction of each proteins is present in the plasma membrane; in general, all syt isoforms are present, to some degree, in the plasma membrane (Dean et al., 2012), and could, in principle, regulate release from this position.</p><p>How any of the proteins, shown to regulate replenishment (CaM, munc13-1, syt 7), operate in this process remains to be determined. The first goal is to identify all the factors, and then to figure out how they work together to regulate replenishment, thereby elucidating the underlying molecular mechanisms. At present, few factors have been identified. Importantly, our study provides an entirely new, novel, and critical regulatory element in the replenishment pathway, syt 7. Rather than engage in extensive speculation as to how syt 7 regulates replenishment, we now state, in the “Discussion” section of the revised manuscript, that:</p><p>“… So, syt 7 is likely to regulate replenishment either from the plasma membrane, or from LDCVs or lysosomes. In molecular terms, the emerging view is that CaM regulates SV replenishment via interactions with both munc13-1 (<xref ref-type="bibr" rid="bib23">Lipstein et al., 2013</xref>) and syt 7. Future studies are needed to determine whether CaM can physically interact with both proteins simultaneously, or whether CaM forms mutually exclusive complexes in the replenishment pathway.”</p><p>We should also note that “replenishment” is an operational definition, and the physical basis that underlies this process is currently the subject of debate: one model posits that replenishment is mobilization from a reserve or reluctant pool to a recycling pool (<xref ref-type="bibr" rid="bib18">Ikeda and Bekkers, 2009</xref>; <xref ref-type="bibr" rid="bib21">Kuromi and Kidokoro, 1998</xref>; <xref ref-type="bibr" rid="bib28">Murthy and Stevens, 1999</xref>), while another model posits that replenishment is limited by clearance of release sites (<xref ref-type="bibr" rid="bib19">Kawasaki et al., 2000</xref>; <xref ref-type="bibr" rid="bib29">Neher, 2010</xref>; <xref ref-type="bibr" rid="bib47">Wu et al., 2009</xref>). So, as we identify key components of the replenishment pathway, the hope is to determine whether these components act to regulate mobilization of SVs or clearance of release sites, and these experiments are likely to require new innovations to address issues such as the movement of SV components away from active zones etc.</p><p><italic>The authors suggest that the known role of syt VII in dense core vesicle release may contribute, presumably by releasing a factor that influences synaptic vesicle recycling. However, the loss of syt VII does not eliminate regulated exocytosis of chromaffin granules, and it is harder to understand how a partial defect would produce this effect on synaptic transmission, particularly since the defect occurs as early as the second action potential in a train. This issue lies at the very heart of this study. As such, this issue has to be introduced in the Introduction and should be clearly and openly discussed</italic>.</p><p>If the referees are referring to the electrophysiological recordings under HFS, there seems to be a misunderstanding as the second AP gave rise to normal release (please see the PPR in <xref ref-type="fig" rid="fig2">Figure 2</xref>). If the referees are referring to the experiment shown in <xref ref-type="fig" rid="fig5">Figure 5</xref>, we note that the second data point in panel C corresponds to 1 second of stimulation at 20 Hz, not the 2<sup>nd</sup> stimulation. The normal release observed at early stages, in conjunction with the deficiencies observed at later stages in syt 7 KO neurons, are indicative of reductions in SV replenishment.</p><p>We understand the point raised by the referees: ∼1 second provides little time for LDCV release to modify synaptic transmission, but it is also possible that previous release of the putative syt 7 LDCV is permissive for SV replenishment. But this example begins to illustrate the problem with speculation: since so little is known concerning replenishment it seems, to us, that too much speculation is not appropriate. Rather than speculate, we simply state that syt 7 must execute its function from where it is located: at the plasma membrane, or on internal vesicles that likely correspond to LDCVs and lysosomes. So, we have simplified the text to some extent to minimize speculation, as detailed in our response to point #2 above.</p><p><italic>In addition, the authors should attempt additional experimentation to confirm that SytVII does indeed reside on an internal membrane</italic>…</p><p>To address this, we carried out pHluorin-syt 7 quenching/de-quenching experiments; pHluorin-syt 1 was used as a control (please see also (Dean et al., 2012)). We confirmed that both syt 7 and 1 are largely targeted to internal membranes, but that a significant fraction of each protein is also present in the plasma membrane (revised <xref ref-type="fig" rid="fig3s3">Figure 3—figure supplement 3</xref>).</p><p><italic>… and provide further experimentation to address how SytVII could specifically influence recovery</italic>.</p><p>Our current study confirmed that loss of syt 7 has no effect on mEPSCs, or single action potential evoked synchronous and asynchronous release, and we further investigated the function of syt 7 on SV priming (hypertonic sucrose), recycling (pHluorin) and replenishment (current work). We found that only SV replenishment was impaired in syt 7 KO neurons, establishing specificity for the reported phenotype. Moreover, this phenotype has not been described for any other member of the syt family, including syt 1, 2, 4, 9, 10 (<xref ref-type="bibr" rid="bib5">Cao et al., 2011</xref>; Dean et al., 2012; Dean et al., 2009; <xref ref-type="bibr" rid="bib24">Liu et al., 2009</xref>; <xref ref-type="bibr" rid="bib27">Maximov and Sudhof, 2005</xref>; <xref ref-type="bibr" rid="bib33">Pang et al., 2006</xref>; <xref ref-type="bibr" rid="bib42">Sun et al., 2007</xref>; <xref ref-type="bibr" rid="bib48">Xu et al., 2007</xref>), further establishing the novelty and specificity of our findings.</p><p>To further address the referees’ concerns, we compared the abilities of syt 1, 2, 4, 7, 9 and 10 to bind to CaM (again, since KO phenotypes have been described for these isoforms). Strikingly, only syt 7 exhibited robust Ca<sup>2+</sup>-dependent CaM binding activity (revised <xref ref-type="fig" rid="fig7">Figure 7A</xref>); these data establish the highly specific nature of the Ca<sup>2+</sup>•syt 7•CaM interaction. Since CaM has emerged as a key factor for replenishment in a variety of earlier studies (Hosoi et al., 2007; Lipstein et al., 2013; Sakaba and Neher, 2001), this biochemical interaction provides a physical link between the physiological function of syt 7 and a known protein for SV replenishment, CaM. Indeed, we show that a CaM antagonist phenocopies loss of syt 7, suggesting that these proteins operate together to regulate replenishment in neurons.</p><p><italic>The interation with calmodulin is interesting, but it remains a protein interaction without a clearly understood relevance to vesicle recovery</italic>.</p><p>It has been rigorously established that CaM regulates SV replenishment (<xref ref-type="bibr" rid="bib17">Hosoi et al., 2007</xref>; <xref ref-type="bibr" rid="bib23">Lipstein et al., 2013</xref>; <xref ref-type="bibr" rid="bib37">Sakaba and Neher, 2001</xref>) and yes, at present it is unknown as to how CaM exerts its effects in this process: no earlier paper has worked-out a molecular mechanism. Our study is novel as we have uncovered a novel CaM binding protein, syt 7, as a key regulator of SV replenishment. So, at present, three molecules have been identified: CaM, munc13-1, and now, syt 7, in the replenishment pathway. Interestingly, both syt 7 and munc13-1 bind to CaM, so CaM perhaps serves as a central ‘hub’ for replenishment, and this issue will prompt further study. For example, we are keen to determine whether CaM can bind to both syt 7 and munc13-1 simultaneously. So, by identifying the key components, we can begin to fit them together into a molecular mechanism. It is likely that a model will await identification of additional components, but the current state-of-the-art is to first identify these components, as we have now done for syt 7 (and as Lipstein et al. (2013) have done by showing CaM works together with munc13-1 to regulate replenishment). We now state, in the “Discussion” section of the revised manuscript, that:</p><p>“In molecular terms, the emerging view is that CaM regulates SV replenishment via interactions with both Munc13-1 (Lipstein et al., 2013) and syt 7. Future studies are needed to determine whether CaM can physically interact with both proteins simultaneously, or whether CaM forms mutually exclusive complexes in the replenishment pathway.”</p><p><italic>3) The work provides no mention of the number of animals or samples used for any of the experiments, in either the Methods or the figure legends. The legend to</italic> <xref ref-type="fig" rid="fig1"><italic>Figure 1</italic></xref> <italic>mentions three independent trials, but it is unclear what that means (animals, slices, cells), or its relationship to the statistics. This is a serious deficiency and a low n could greatly reduce confidence in this entire study. Similarly, the imaging in</italic> <xref ref-type="fig" rid="fig5"><italic>Figure 5</italic></xref> <italic>presents unnormalized changes in fluorescence, and it is very hard to evaluate this either-it would be particularly difficult to combine data like this from multiple independent experiments, again raising concern about n</italic>.</p><p>We apologize for the omission of key information, including the number of animals, statistical analysis etc.; this critical information has been added to each figure legend of the revised manuscript.</p><p>Panel A in <xref ref-type="fig" rid="fig5">Figure 5</xref> is a representative raw image showing that our batch of bafilomycin is active: SVs fail to reacidify in the presence of the drug. This is a well-established effect of this drug, and is commonly used; we simply included a trace to make sure the drug was effective (this control trace is not normally included in publications and could be removed to save space). In contrast, the statistical analysis in panels B and C, in the same figure, were calculated based on the normalized fluorescence changes from three independent experiments (three distinct litters of mice), six coverslips (two from each mouse), and 50 boutons per coverslip, which is ∼ 300 boutons in total. We have added this information in the revised manuscript.</p><p><italic>4) The authors demonstrate that the D/N mutations in the C2 domain do not rescue, consistent with the need for this tagmin to bind calcium for its function. However the authors never actually show that this protein is actually present at synapses when re-expressed as a mutant. This should be addressed experimentally</italic>.</p><p>We thank the referees for this suggestion. We have provided the requested data in the revised manuscript (revised <xref ref-type="fig" rid="fig3s2">Figure 3–figure supplement 2</xref>); the sub-cellular distribution of the mutant was the same as for the transfected WT protein.</p></body></sub-article></article> |