Permalink
Cannot retrieve contributors at this time
Fetching contributors…
Cannot retrieve contributors at this time
| <?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d1 20130915//EN" "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1d1" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="hwp">eLife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">02324</article-id><article-id pub-id-type="doi">10.7554/eLife.02324</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research article</subject></subj-group><subj-group subj-group-type="heading"><subject>Cell biology</subject></subj-group><subj-group subj-group-type="heading"><subject>Genes and chromosomes</subject></subj-group></article-categories><title-group><article-title>Expression site attenuation mechanistically links antigenic variation and development in <italic>Trypanosoma brucei</italic></article-title></title-group><contrib-group><contrib contrib-type="author" id="author-10803"><name><surname>Batram</surname><given-names>Christopher</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-10804"><name><surname>Jones</surname><given-names>Nicola G</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-10805"><name><surname>Janzen</surname><given-names>Christian J</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-10806"><name><surname>Markert</surname><given-names>Sebastian M</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-8285"><name><surname>Engstler</surname><given-names>Markus</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="corresp" rid="cor1">*</xref><xref ref-type="other" rid="par-1"/><xref ref-type="other" rid="par-2"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><institution content-type="dept">Department of Cell and Developmental Biology</institution>, <institution>University of Würzburg</institution>, <addr-line><named-content content-type="city">Würzburg</named-content></addr-line>, <country>Germany</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Ahringer</surname><given-names>Julie</given-names></name><role>Reviewing editor</role><aff><institution>University of Cambridge</institution>, <country>United Kingdom</country></aff></contrib></contrib-group><author-notes><corresp id="cor1"><label>*</label>For correspondence: <email>markus.engstler@biozentrum.uni-wuerzburg.de</email></corresp></author-notes><pub-date date-type="pub" publication-format="electronic"><day>20</day><month>05</month><year>2014</year></pub-date><pub-date pub-type="collection"><year>2014</year></pub-date><volume>3</volume><elocation-id>e02324</elocation-id><history><date date-type="received"><day>15</day><month>01</month><year>2014</year></date><date date-type="accepted"><day>17</day><month>04</month><year>2014</year></date></history><permissions><copyright-statement>© 2014, Batram et al</copyright-statement><copyright-year>2014</copyright-year><copyright-holder>Batram et al</copyright-holder><license xlink:href="http://creativecommons.org/licenses/by/3.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/3.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife02324.pdf"/><related-article ext-link-type="doi" id="ra1" related-article-type="commentary" xlink:href="10.7554/eLife.03176"/><abstract><object-id pub-id-type="doi">10.7554/eLife.02324.001</object-id><p>We have discovered a new mechanism of monoallelic gene expression that links antigenic variation, cell cycle, and development in the model parasite <italic>Trypanosoma brucei</italic>. African trypanosomes possess hundreds of <italic>variant surface glycoprotein</italic> (<italic>VSG</italic>) genes, but only one is expressed from a telomeric expression site (ES) at any given time. We found that the expression of a second <italic>VSG</italic> alone is sufficient to silence the active <italic>VSG</italic> gene and directionally attenuate the ES by disruptor of telomeric silencing-1B (DOT1B)-mediated histone methylation. Three conserved expression-site-associated genes (ESAGs) appear to serve as signal for ES attenuation. Their depletion causes G1-phase dormancy and reversible initiation of the slender-to-stumpy differentiation pathway. ES-attenuated slender bloodstream trypanosomes gain full developmental competence for transformation to the tsetse fly stage. This surprising connection between antigenic variation and developmental progression provides an unexpected point of attack against the deadly sleeping sickness.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.001">http://dx.doi.org/10.7554/eLife.02324.001</ext-link></p></abstract><abstract abstract-type="executive-summary"><object-id pub-id-type="doi">10.7554/eLife.02324.002</object-id><title>eLife digest</title><p>African sleeping sickness is a potentially lethal disease that is caused by a parasite called <italic>T. brucei</italic> and spread by tsetse flies. Like many of the parasites that cause tropical diseases, <italic>T. brucei</italic> employs genetic trickery to evade the immune systems of humans and other mammals. This involves changing the variant surface glycoprotein (VSG) coat that surrounds the parasite on a regular basis in order to remain one step ahead of the immune system of its host: while the immune system looks for invaders wearing a particular coat, the parasites are spreading through the host in a completely different coat.</p><p>To infect other hosts, the parasite must undergo changes that allow it to re-infect the tsetse fly. Therefore, besides the ‘antigenic variation’ that allows <italic>it</italic> to change its surface coat when it is in the blood of its host, <italic>T. brucei</italic> must undergo a more fundamental metamorphosis before it is capable of colonizing the tsetse fly. However, many details of the changes that allow the parasites to re-infect flies are not understood.</p><p><italic>T. brucei</italic> has several hundred VSG genes clustered in about 15 regions known as expression sites, but only a single expression site is active at any given time. Each expression site also contains a number of other genes known as expression site-associated genes (ESAGs). Antigenic variation can occur as a result of different VSG genes within the same expression site being expressed as proteins, or when the active expression site is silenced and another expression site is activated. This is another process that is not fully understood.</p><p>Batram et al. now reveal that the expression of VSG genes, antigenic variation and the changes that allow the parasites to re-infect flies are all related to each other. This suggests that the expression site could provide a new point of attack in the fight against African sleeping sickness.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.002">http://dx.doi.org/10.7554/eLife.02324.002</ext-link></p></abstract><kwd-group kwd-group-type="author-keywords"><title>Author keywords</title><kwd><italic>Trypanosoma brucei</italic></kwd><kwd>variant surface glycoprotein (VSG)</kwd><kwd>monoallelic expression</kwd><kwd>antigenic variation</kwd><kwd>expression site attenuation</kwd><kwd>developmental reprogramming</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>other</kwd></kwd-group><funding-group><award-group id="par-1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100001659</institution-id><institution>Deutsche Forschungsgemeinschaft (DFG)</institution></institution-wrap></funding-source><award-id>EN 305</award-id><principal-award-recipient><name><surname>Engstler</surname><given-names>Markus</given-names></name></principal-award-recipient></award-group><award-group id="par-2"><funding-source><institution-wrap><institution>DFG Sonderforschungsbereich (SFB) 630</institution></institution-wrap></funding-source><award-id>SFB 630-B8</award-id><principal-award-recipient><name><surname>Engstler</surname><given-names>Markus</given-names></name></principal-award-recipient></award-group><funding-statement>The funder had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name><meta-value>2</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>The VSG gene controls its monoallelic expression, and expression site activity determines developmental progression.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Functional variation between cells in a population is often achieved by selective expression of one protein from a pool of possibilities. To achieve this goal, a variety of mechanisms have evolved that ensure allelic exclusion, namely the silencing of expression of all but one member of a gene family, either temporarily or for the remainder of the life of the cell.</p><p>In the mammalian central nervous system, each olfactory sensory neuron expresses only one olfactory receptor (OR) from a family of ∼1200 genes (<xref ref-type="bibr" rid="bib6">Buck and Axel, 1991</xref>). Before an <italic>OR</italic> gene is expressed, all alleles are silenced and converted to heterochromatin (<xref ref-type="bibr" rid="bib24">Magklara et al., 2011</xref>). A limiting enzymatic activity then stochastically removes the heterochromatin marks from one allele to activate it. The expressed OR protein mediates a feedback loop that inhibits removal of heterochromatin marks from all other alleles, preventing their transcription (<xref ref-type="bibr" rid="bib31">Serizawa et al., 2003</xref>; <xref ref-type="bibr" rid="bib21a">Lyons et al., 2013</xref>).</p><p>Allelic exclusion commonly occurs in pathogens that exploit antigenic variation of their cell surface proteins to keep ahead of the host immune response, usually as part of a population survival strategy. The malaria parasite <italic>Plasmodium falciparum</italic>, for example, expresses only one out of 60 members of the <italic>var</italic> gene family, each coding for different versions of the surface virulence factor PfEMP1 (<xref ref-type="bibr" rid="bib16">Guizetti and Scherf, 2013</xref>).</p><p>Monoallelic expression of the variant surface glycoprotein (VSG) in <italic>Trypanosoma brucei</italic> is a particularly striking example of allelic exclusion in a pathogen. In the mammalian host, the cell surface is covered with millions of copies of VSG that form a dense layer that is virtually impervious to host-derived antibodies (<xref ref-type="bibr" rid="bib9">Cross, 1975</xref>; <xref ref-type="bibr" rid="bib13">Engstler et al., 2007</xref>; <xref ref-type="bibr" rid="bib30">Schwede et al., 2011</xref>). VSGs are highly immunogenic and provoke a rapid and efficient immune response that diminishes the parasite population. Only trypanosomes that have successfully switched to expression of another, structurally similar but immunologically distinct VSG survive. Trypanosomes possess several hundred <italic>VSG</italic> genes (<xref ref-type="bibr" rid="bib3">Berriman et al., 2005</xref>). Their potentially unlimited capacity for antigenic variation forms the basis of trypanosome persistence and virulence. <italic>VSG</italic> genes are expressed from one of ∼15 telomeric expression sites (ES) but only one of these is transcribed at any given time (<xref ref-type="bibr" rid="bib17">Hertz-Fowler et al., 2008</xref>). Chromatin remodeling appears to play an important role in maintaining the monoallelic expression of the active ES (<xref ref-type="bibr" rid="bib20">Horn and McCulloch, 2010</xref>). Antigenic variation can result from either a change in the active ES, usually gene conversion at the <italic>VSG</italic> locus, or by an epigenetic change that results in silencing of the active ES and transcription of a previously silent ES (in situ switch). No mechanism or factor has been identified that is involved in the initiation of the latter.</p><p>The complex life cycle of <italic>T. brucei</italic> represents a succession of proliferative and quiescent developmental forms, which vary widely in cell architecture and function (<xref ref-type="bibr" rid="bib22">MacGregor et al., 2012</xref>). Throughout the parasite's life cycle, the plasma membrane is covered with a series of different surface coats. Antigenic variation only occurs in the mammalian host, and not in the transmitting tsetse fly. Consequently, the trypanosome bloodstream form ES is exclusively functional in the proliferating slender bloodstream stage of the parasite. In response to quorum sensing, the trypanosomes differentiate to the quiescent stumpy form. Stumpy forms are competent for the next developmental transition to procyclic forms, which occurs after ingestion by a tsetse fly (<xref ref-type="bibr" rid="bib29">Reuner et al., 1997</xref>). This developmental transition is accompanied by silencing of the active ES so that allelic exclusion is lost. How this silencing is achieved is unknown.</p><p>In this study, we show that high-level expression of an ectopic <italic>VSG</italic> transgene is sufficient to initiate the directional silencing of the active ES from the telomere inwards. The silencing of the active ES is dependent on the histone methyltransferase DOT1B. Thus, the VSG itself mediates a feedback loop that controls the state of monoallelic gene expression. Furthermore, we show that transcriptional activity of the ES directly determines cell proliferation and developmental competence via a subset of <italic>expression site associated genes (ESAGs)</italic>. Thus, the trypanosome ES can be regarded as a fine-tuned regulator at the crossroads of antigenic variation, proliferation, and development.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Expression of wild-type levels of a second VSG causes gradual attenuation of the active expression site</title><p>To simulate a transcriptional switching event (in situ switch) in the most straightforward manner, we adopted a strategy that allows inducible high-level expression of <italic>VSG121</italic> in trypanosomes that have <italic>VSG221</italic> in their active expression site (221<sup>ES</sup>). This was achieved by introducing a <italic>VSG121</italic> gene under the control of a tetracycline-inducible T7 RNA polymerase promoter (121<sup>tet</sup>) into an rDNA spacer locus (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). We decided to use the T7 RNA polymerase-based expression system instead of a polymerase I-based system to minimize interference with the endogenous transcription machinery. Quantitative Northern blot analysis revealed an almost instantaneous increase of <italic>VSG121</italic> mRNA, reaching 82(±1)% of wild type levels within 2 hr (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). This was followed by a reduction of endogenous <italic>VSG221</italic> transcripts, which declined with kinetics compatible with the mRNA half-life (<xref ref-type="bibr" rid="bib11">Ehlers et al., 1987</xref>). The total <italic>VSG</italic> mRNA initially peaked at 180%, but within 8 hr leveled to approximately wild-type quantities. Thus, the <italic>VSG</italic> mRNA population was effectively exchanged in this time period.<fig-group><fig id="fig1" position="float"><object-id pub-id-type="doi">10.7554/eLife.02324.003</object-id><label>Figure 1.</label><caption><title>Inducible <italic>VSG121</italic> expression leads to endogenous <italic>VSG</italic> silencing.</title><p>(<bold>A</bold>) Illustration of the ectopic <italic>VSG</italic> expression strategy. <italic>VSG121</italic> integration into the transcriptionally silent rDNA spacer is achieved in the absence of tetracycline by using a constitutive 10% T7 promoter driving the <italic>BLE</italic> resistance cassette. High-level expression of ectopic <italic>VSG121</italic> occurs upon tetracycline induction of a full T7 promoter. (<bold>B</bold>) Quantification of <italic>VSG</italic> mRNA and protein levels during the course of tetracycline-induced <italic>VSG121</italic> expression. The values are percentages ± SD for two independent clones normalized to the parental 221<sup>ES</sup> or VSG121 wild-type cells. Total RNA samples were prepared at the time points indicated and analyzed by dot blotting. The blots were hybridized with VSG-specific fluorescent DNA probes and quantified by normalization to <italic>beta-tubulin</italic> mRNA using a Licor Odyssey near infrared scanner. Protein equivalents of 6 × 10<sup>5</sup> cells were dot blotted and incubated with anti-VSG121 or anti-VSG221 antibodies. Quantification was done by normalization to the paraflagellar rod (PFR) protein using the Licor Odyssey system.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.003">http://dx.doi.org/10.7554/eLife.02324.003</ext-link></p></caption><graphic xlink:href="elife02324f001"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.02324.004</object-id><label>Figure 1—figure supplement 1.</label><caption><title>VSG immunofluorescence after tetracycline-induced <italic>VSG121</italic> expression.</title><p>Double indirect immunofluorescence with mouse anti-VSG121 (green), rabbit anti-VSG221 (red) antibodies and DAPI staining (blue) was performed 0, 12, and 24 hr after tet induction. 121<sup>wt</sup> and parental 221<sup>ES</sup> cells served as controls for antibody specificity. Scale, 20 µm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.004">http://dx.doi.org/10.7554/eLife.02324.004</ext-link></p></caption><graphic xlink:href="elife02324fs001"/></fig></fig-group></p><p>The VSG121 protein was detectable within 4–6 hr after induction (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). After 24 hr, the surface coat of all cells was dominated by VSG121 (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>) and the amount of VSG221 had declined to 21(±2)% (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). Thus, expression of an ectopic VSG at wild-type quantities caused a reduction in the abundance of the ES-resident VSG, which decreased with a half-life of 12 hr that corresponds to the population doubling time within the first 24 hr of induction.</p><p>The reduction in steady state levels of <italic>VSG221</italic> mRNA was caused by an active process, which specifically affects the ES-resident <italic>VSG,</italic> either through reduction of transcription or by <italic>VSG</italic> mRNA degradation. To distinguish between these possibilities, we quantified other mRNAs derived from the ES. As transcription of the ES is polycistronic, any transcriptional silencing would also affect genes upstream of the <italic>VSG</italic>. Initially, the levels of three <italic>ESAG</italic> mRNAs were measured over a period of 8 hr after <italic>VSG121</italic> induction (<xref ref-type="fig" rid="fig2">Figure 2A,B</xref>). It appears that mRNAs from the telomere proximal <italic>ESAG1</italic> and <italic>2</italic> genes decreased faster than mRNA from the telomere distal <italic>ESAG12</italic> gene. To examine whether this effect was the result of different mRNA half-lives, we inserted the same <italic>GFP</italic> transgene either upstream of the <italic>VSG</italic> gene (promoter distal) or next to the ES promoter (promoter proximal) (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). Upon induction of <italic>VSG121</italic> expression, the promoter proximal <italic>GFP</italic> mRNA decreased with significantly slower kinetics (p<0.018; two-way ANOVA test) than that of the promoter distal <italic>GFP</italic> (<xref ref-type="fig" rid="fig2">Figure 2C</xref>, left panel), revealing that the kinetics of <italic>GFP</italic> mRNA reduction was determined solely by the position of the <italic>GFP</italic> gene within the active ES. Thus, <italic>VSG121</italic> overexpression caused a gradual loss of ES activity that started at the telomere and propagated towards the <italic>VSG</italic> promoter. This process was completed within one cell division cycle and was maintained for 120 hr (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). Then the ES was gradually reactivated in the reverse direction (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). The ES was not silenced completely, so the effect did not constitute a bona fide ES silencing, but a fine-tuned ES attenuation. We postulate that this VSG-induced attenuation represents the initiation step of an antigenic in situ switch.<fig id="fig2" position="float"><object-id pub-id-type="doi">10.7554/eLife.02324.005</object-id><label>Figure 2.</label><caption><title>Ectopic <italic>VSG121</italic> expression induces gradual ES attenuation.</title><p>(<bold>A</bold>) Scheme illustrating the anatomy of the <italic>VSG221</italic> expression site in a set of reporter lines. Cell line 221<sup>ES</sup>.121<sup>tet</sup> was used to quantify three different <italic>ESAG</italic> transcripts. In GFP<sup>ESpro</sup>-221<sup>ES</sup>.121<sup>tet</sup>, a <italic>GFP</italic> reporter gene was inserted just downstream of the ES promoter and in GFP<sup>EStel</sup>-221<sup>ES</sup>.121<sup>tet</sup> just upstream of the endogenous <italic>VSG221</italic>. <italic>NEO</italic>, neomycin resistance; <italic>BLAS</italic>, blasticidin resistance; numbered boxes, <italic>ESAGs</italic>; arrow, ES promoter. (<bold>B</bold>) <italic>ESAG1</italic> and <italic>2</italic> transcripts decrease faster than <italic>ESAG12</italic> mRNA. After 0, 4, and 8 hr of ectopic <italic>VSG121</italic> induction, mRNA levels of three <italic>ESAG</italic>s were quantified using <sup>32</sup>P-labeled probes on Northern blots and normalized to 18S rRNA using a fluorescent probe. Values are relative to the parental 221<sup>ES</sup> cells (P). (<bold>C</bold>) Expression site attenuation starts at the telomere and is released in the reverse direction. The <italic>GFP</italic> reporter lines were induced for ectopic <italic>VSG121</italic> expression and mRNA levels of <italic>GFP</italic>, <italic>VSG221</italic> and <italic>VSG121</italic> were quantified using fluorescently labeled probes, normalized to <italic>beta-tubulin</italic> mRNA (upper panel). Values are relative to the non-induced levels ± SD for two independent clones (lower panel).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.005">http://dx.doi.org/10.7554/eLife.02324.005</ext-link></p></caption><graphic xlink:href="elife02324f002"/></fig></p></sec><sec id="s2-2"><title>Expression site attenuation causes specific prolongation of the G1 cell cycle phase and concomitant global transcriptional diminution</title><p>The immediate early effect of <italic>VSG121</italic> overexpression was the attenuation of the active ES (<xref ref-type="fig" rid="fig1 fig2">Figures 1 and 2</xref>). Parasite growth was not affected for the first 24 hr of tetracycline induction, but then cell proliferation slowed down significantly (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). The cell cycle was analyzed by determining the nucleus (N) and kinetoplast (K) configuration and showed an accumulation of 1K1N cells with the kinetoplasts having a pre-replication morphology and a reduction of cells containing a dividing kinetoplast (<xref ref-type="fig" rid="fig3">Figure 3B,C</xref>). These observations are consistent with the slowed growth resulting from a G1 phase prolongation. To test this model, the percentage of cells in S-phase was determined at different times after induction of <italic>VSG121</italic> expression. Cells were incubated with the nucleoside-analogue EdU for either 4 or 18 hr (<xref ref-type="fig" rid="fig3">Figure 3D</xref>). In the control (0 hr), 80% of trypanosomes had entered nuclear S-phase within the 4-hr labeling window. In contrast, after 24 hr of <italic>VSG121</italic> expression only 17% incorporated EdU into nuclear DNA within an equivalent 4-hr window. However, when the parasites were incubated with EdU for 18 hr, 86% had entered S-phase. Thus, the cells were clearly not arrested in the cell cycle, but showed a specific, at least fivefold expansion of the G1-phase from 3 to 15 hr. Remarkably, all trypanosomes remained fully motile and no morphological abnormality or cell death was observed. The marked G1-phase prolongation obviously required a reduction in metabolic flux and anabolic pathways, including protein synthesis, which in turn might be reflected in decreased overall RNA synthesis. Therefore, we measured total RNA synthesis by labeling nascent transcripts with BrUTP and detection with an anti-BrdU antibody. After 8 hr of tetracycline induction, when <italic>VSG221</italic> transcripts had already decreased to 20%, the general transcription rate was not impaired at all. Only after 24 hr was the global transcription reduced to 30% (p<0.0001; unpaired <italic>t</italic> test) (<xref ref-type="fig" rid="fig3">Figure 3E</xref>). This formally proves that ES attenuation precedes growth retardation and general transcriptional diminution. To test if RNA polymerase I and II transcription was both affected, we inserted luciferase reporter transgenes either downstream of an rDNA promoter or into the <italic>tubulin</italic>-locus (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). In both the cases, luciferase activity was down to 30–50% within 2 days. Thus, all tested regions of the genome were slowly silenced. This also explains the gradual decrease in the amount of ectopically expressed <italic>VSG121</italic> mRNA, which started after 24 hr of tetracycline induction (<xref ref-type="fig" rid="fig1">Figure 1B</xref>) that is at a time when the active <italic>VSG221</italic> ES was already attenuated.<fig-group><fig id="fig3" position="float"><object-id pub-id-type="doi">10.7554/eLife.02324.006</object-id><label>Figure 3.</label><caption><title>Expression site attenuation causes G1 retardation and transcriptional shut-down.</title><p>(<bold>A</bold>) Cumulative growth curve after induction of ectopic <italic>VSG121</italic> expression. Two independent clones were analyzed for 9 days in the absence (−tet) or presence (+tet) of 1 µg/ml tetracycline. (<bold>B</bold>) Cell cycle analysis. 221<sup>ES</sup>.121<sup>tet</sup> cells were induced for <italic>VSG121</italic> expression and fixed at the time points indicated. The configurations of the mitochondrial genome (kinetoplast, K) and the nucleus (N) were visualized by light microscopy following staining with DAPI. The configuration of K and N was subdivided into 1K1N for cells having single copies of each organelle, 1K<sup>v</sup>1N for those with an early dividing kinetoplast and 1K<sup>b</sup>1N with a late dividing kinetoplast. Cells in G2/M phase reveal 2K1N configuration and post-mitotic trypanosomes are marked by 2K2N. Abnormal configurations are scored as ‘other’. For each time point, n >300 cells were analyzed. Significance was determined using Fisher's exact test. (<bold>C</bold>) Cell cycle retardation has no effect on cell morphology. Trypanosomes before (−tet) and 3 days after <italic>VSG121</italic> induction (+tet) were stained with DAPI and the cell surface labeled using AMCA-<italic>sulfo</italic>-NHS. The arrowhead points to a 1K<sup>v</sup>1N cell. Scale bar: 5 µm. (<bold>D</bold>) Expression site attenuation leads to reduced growth, but not to cell cycle arrest. Incorporation of EdU into 221<sup>ES</sup>.121<sup>tet</sup> cells induced for <italic>VSG121</italic> expression. The trypanosomes were induced for ectopic <italic>VSG121</italic> expression and at 0, 1, 2, and 3 days, they were incubated with 50 µM EdU for both 4 and 18 hr. After chemical fixation the cells were co-stained with DAPI and analyzed by light microscopy (n >100 each). (<bold>E</bold>) Quantification of RNA synthesis rate after ectopic <italic>VSG121</italic> expression. After 0, 8, 24, and 48 hr of tetracycline induction, cells were incubated in the presence of 0.5 mM BrUTP for 15 min at 33°C, subsequently chemically fixed and incubated with a monoclonal mouse anti-BrdU and an Alexa488-coupled goat anti-mouse antibody. The intensities of 3D images (100 images; z-step 100 nm) were measured in summed slice projections using the ImageJ software and are expressed as arbitrary units. To exclude variations in signal intensities due to different positions within the cell cycle, only G1 cells were analyzed. After 8 hr of tet induction, no altered fluorescence intensity was observed. After both 24 and 48 hr, fluorescence intensity was significantly decreased to 30% (p<0.0001; unpaired <italic>t</italic> test). For each time point more than 60 cells were analyzed. Red lines and error bars show mean ± SD.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.006">http://dx.doi.org/10.7554/eLife.02324.006</ext-link></p></caption><graphic xlink:href="elife02324f003"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.02324.007</object-id><label>Figure 3—figure supplement 1.</label><caption><title>Growth retardation is accompanied by a reduced transcriptional rate of Pol I and Pol II.</title><p>Ectopic expression of <italic>VSG121</italic> causes reduction in gene expression. (<bold>A</bold>) Luciferase reporters were inserted downstream of an rDNA polymerase I promoter and (<bold>B</bold>) into the polymerase II-transcribed <italic>tubulin</italic> locus. Values are given as mean RLU ± SD of 1 × 10<sup>5</sup> cells for three (Luc<sup>tub</sup>.221<sup>ES</sup>.121<sup>tet</sup>) and two (Luc<sup>rPro</sup>.221<sup>ES</sup>.121<sup>tet</sup>) independent clones.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.007">http://dx.doi.org/10.7554/eLife.02324.007</ext-link></p></caption><graphic xlink:href="elife02324fs002"/></fig></fig-group></p></sec><sec id="s2-3"><title>Expression site attenuation requires histone methylation</title><p>The histone methyltransferase DOT1B is involved in the silencing of the active ES during in situ switching (<xref ref-type="bibr" rid="bib14">Figueiredo et al., 2008</xref>). To test if DOT1B was also required for the attenuation of the active ES upon ectopic <italic>VSG</italic> expression, we inserted the tetracycline-inducible <italic>VSG121</italic> gene into <italic>DOT1B-</italic>deleted trypanosomes (Δdot1b.221<sup>ES</sup>.121<sup>tet</sup>) (<xref ref-type="bibr" rid="bib20a">Janzen et al., 2006</xref>). Following induction of <italic>VSG121</italic> expression, the decrease of the ES-resident VSG221 protein occurred with the same kinetics as in the parental cells (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). However, unlike in the parental cell line the protein levels did not increase again. Furthermore, the cells did not display a growth phenotype (<xref ref-type="fig" rid="fig4">Figure 4B</xref>). Therefore, we measured ES activity just upstream of the <italic>VSG221</italic> gene by inserting a luciferase reporter transgene into both Δdot1b and parental cell lines (<xref ref-type="fig" rid="fig4">Figure 4C</xref>). As expected, the luciferase activity decreased rapidly in the parental cells (<xref ref-type="fig" rid="fig4">Figure 4C</xref>, right panel). However, in the <italic>DOT1B</italic>-knockout trypanosomes luciferase activity was only marginally and transiently reduced at day 2 (<xref ref-type="fig" rid="fig4">Figure 4C</xref>, left panel). Thus, in <italic>DOT1B</italic>-deleted cells, the ES was not attenuated, except for the most telomere-proximal part, where the <italic>VSG221</italic> gene resides. This suggests that silencing of a <italic>VSG</italic> gene can be uncoupled from ES silencing. While ES attenuation seems to require DOT1B-dependent histone tri-methylation, <italic>VSG</italic> silencing does not. This is remarkable as it suggests a mechanism that specifically represses the telomeric <italic>VSG</italic> gene but not any other part of the ES (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). Furthermore, these results formally prove that the ES-resident <italic>VSG</italic> can be complemented in trans by a heterologous <italic>VSG</italic> gene. We conclude that the activation of a new <italic>VSG</italic> ES initiates an in situ switch, and that high-level expression of a second VSG is sufficient to attenuate and eventually silence the formerly active ES. This feedback loop assures monoallelic expression of the <italic>VSG</italic>.<fig id="fig4" position="float"><object-id pub-id-type="doi">10.7554/eLife.02324.008</object-id><label>Figure 4.</label><caption><title>Expression site attenuation requires the histone methyltransferase DOT1B.</title><p>(<bold>A</bold>) Quantification of VSG protein levels during the course of tetracycline-induced <italic>VSG121</italic> expression in <italic>DOT1B</italic>-depleted cells. Quantification was done by normalization to the paraflagellar rod protein (PFR), using the Licor Odyssey system. The values are percentages ± SD for two independent clones normalized to the parental <italic>Δdot1b</italic> or VSG121 wild-type cells. (<bold>B</bold>) Growth curve after induction of ectopic <italic>VSG121</italic> expression in a <italic>Δdot1b</italic> cell line. Two independent clones were analyzed for 25 days in the absence (−tet) or presence (+tet) of 1 µg/ml tetracycline. (<bold>C</bold>) A luciferase reporter gene (<italic>LUC</italic>) was inserted into the active <italic>VSG221</italic> ES (upper panel) of Δdot1b.121<sup>tet</sup> and 221<sup>ES</sup>.121<sup>tet</sup> cells. <italic>VSG121</italic> expression was induced in the resulting Luc<sup>ES</sup>Δdot1b.121<sup>tet</sup> and Luc<sup>ES</sup>.221<sup>ES</sup>.121<sup>tet</sup> cells and luciferase activity of three (Luc<sup>ES</sup>Δdot1b.121<sup>tet</sup>) or two (Luc<sup>ES</sup>.221<sup>ES</sup>.121<sup>tet</sup>) independent clones was measured at the time points indicated and expressed as relative light units (RLU) ± SD.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.008">http://dx.doi.org/10.7554/eLife.02324.008</ext-link></p></caption><graphic xlink:href="elife02324f004"/></fig></p></sec><sec id="s2-4"><title>Expression site attenuation induces full developmental competence</title><p>There is a period in the life cycle of trypanosomes, when allelic exclusion of <italic>VSG</italic> is lifted, namely during differentiation to the quiescent stumpy stage. This developmental transition occurs in the mammalian bloodstream and involves ES-attenuation and growth arrest. The VSG-induced ES attenuation described here does not cause a bona fide cell cycle arrest and the parasites do not display the typical morphology of stumpy trypanosomes. Nevertheless, we hypothesized that the ES-attenuated parasites could have adopted stumpy-like characteristics and actually may represent the enigmatic intermediate stage, which is not yet committed to stumpy differentiation. Therefore, we tested for expression of the cell surface transporter <italic>protein associated with differentiation 1</italic> (PAD1), which is a molecular marker for stumpy cells and is not expressed in the dividing slender stage (<xref ref-type="bibr" rid="bib10">Dean et al., 2009</xref>). In addition to a PAD1-specific antibody, we used a transgene, <italic>GFP:PAD</italic><sub><italic>utr</italic></sub>, encoding a GFP with a nuclear localization signal and a <italic>PAD1</italic> 3′UTR (J Sunter, A Schwede and M Carrington, unpublished), which confers the stage specificity of PAD1 (<xref ref-type="bibr" rid="bib23">MacGregor and Matthews, 2012</xref>). This reporter allowed for live cell analysis of PAD1-expression by flow cytometry (<xref ref-type="fig" rid="fig5s1">Figure 5—figure supplement 1</xref>). Prior to induction of the ectopic <italic>VSG</italic>, the cells showed no PAD1-expression and no GFP signal. After 48 hr of <italic>VSG121</italic> overexpression, however, the PAD1 protein was clearly detectable on the surface of trypanosomes in the G1-phase of the cell cycle (<xref ref-type="fig" rid="fig5">Figure 5A,B</xref>). Likewise, the GFP:PAD<sub>utr</sub> reporter was visible in most G1 cells, but was also expressed in a minor portion of trypanosomes in other cell cycle phases (<xref ref-type="fig" rid="fig5">Figure 5C</xref>). This is in agreement with the observation that the <italic>PAD1</italic> mRNA is detectable prior to the protein (<xref ref-type="bibr" rid="bib22">MacGregor et al., 2012</xref>). We conclude that in the absence of the quorum-sensing factor SIF and at 37°C, the <italic>VSG</italic> overexpression-induced ES attenuation triggers G1-phase prolongation and concomitant expression of a bona fide stumpy marker in monomorphic slender stage trypanosomes. Notably, PAD1 expression was induced despite the global transcriptional attenuation that started at the same time. This again is reminiscent of the situation in stumpy parasites, where PAD1 expression is induced while general transcription decreases (<xref ref-type="bibr" rid="bib2">Amiguet-Vercher et al., 2004</xref>).<fig-group><fig id="fig5" position="float"><object-id pub-id-type="doi">10.7554/eLife.02324.009</object-id><label>Figure 5.</label><caption><title>Expression site attenuation leads to PAD1 surface expression.</title><p>(<bold>A</bold>) GFP:PAD<sub>utr</sub> and endogenous PAD1 are both expressed following ES attenuation. Maximum intensity projections of three-channel, 3D images (100 images, z-step: 200 nm) of GFP:PAD<sub>utr</sub>.221<sup>ES</sup>.121<sup>tet</sup> cells induced for <italic>VSG121</italic>. After 48 hr, the cells were chemically fixed and incubated with an anti-PAD1 antibody (red) and counterstained with DAPI (grey). The GFP:PAD<sub>utr</sub> reporter is expressed in the nucleus (green). The upper panel shows an example of G1 cells co-expressing the native PAD1 (red) and the reporter GFP:PAD<sub>utr</sub> (green). S- and G2-phase cells did not show PAD1 expression (lower panel). Scale bar: 10 µm. (<bold>B</bold> and <bold>C</bold>) Cell cycle distribution of trypanosomes expressing the native PAD1 protein (<bold>B</bold>) and the GFP:PAD<sub>utr</sub> reporter (<bold>C</bold>). Both the GFP-reporter and the PAD1 protein are expressed specifically in G1 cells. PAD1 expression is limited to G1. GFP:PAD1<sub>utr</sub> is visible in more G1 cells and also in other cell cycle stages. Values show percentages of positive cells of the indicated cell cycle stages and p-values were calculated using the Fisher's exact test.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.009">http://dx.doi.org/10.7554/eLife.02324.009</ext-link></p></caption><graphic xlink:href="elife02324f005"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.02324.010</object-id><label>Figure 5—figure supplement 1.</label><caption><title>Flow cytometry analysis of GFP:PAD<sub>utr</sub> expression in live cells.</title><p>(<bold>A</bold>) GFP expression of the parental 221<sup>ES</sup> cell line with the GFP:PAD<sub>utr</sub> reporter inserted into the <italic>tubulin</italic> locus. Cells were analyzed for GFP expression before (day 0) and 1 and 2 days after the addition of 100 µM pCPT-cAMP, which is a membrane permeable analogue of cAMP and induces stumpy gene expression. At day 2, 42.3(±3.7)% of the cells were GFP positive (mean ± SD for two clones). (<bold>B</bold>) Flow cytometry analysis of 221<sup>ES</sup>.121<sup>tet</sup> cells with the GFP:PAD<sub>utr</sub> reporter. Cells were induced for <italic>VSG121</italic> expression and analyzed for GFP expression at the indicated times. At day 2, 31.1(±0.1)% of the cells showed GFP expression (mean ± SD for two clones).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.010">http://dx.doi.org/10.7554/eLife.02324.010</ext-link></p></caption><graphic xlink:href="elife02324fs003"/></fig></fig-group></p><p>Next, we asked if PAD1 was fully functional as a transporter on the cell surface of slender trypanosomes. If so, the parasites should have become sensitive to the differentiation trigger <italic>cis</italic>-aconitate, the chemical cue that triggers progression from the stumpy to the procyclic insect stage. This developmental step is accompanied by loss of the VSG coat and expression of the surface protein EP. We induced <italic>VSG121</italic> expression for 48 hr and then incubated the trypanosomes in the absence of tetracycline with 6 mM <italic>cis</italic>-aconitate. Immunofluorescence analysis revealed EP1 surface expression as early as 6 hr after addition of <italic>cis</italic>-aconitate (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). Thus, the mechanism of cell surface access block that prevents EP1 from being routed to the plasma membrane of proliferating bloodstream parasites had been deactivated, just as in stumpy cells (<xref ref-type="bibr" rid="bib12">Engstler and Boshart, 2004</xref>). To quantify the EP1 surface expression, samples were collected 0, 6, and 24 hr after addition of <italic>cis</italic>-aconitate and analyzed by flow cytometry. In the control cells, no fluorescent EP1 signal was detectable (<xref ref-type="fig" rid="fig6">Figure 6A,B</xref>). In contrast, VSG121-expressors revealed strong EP1 cell surface expression after only 6 hr of <italic>cis</italic>-aconitate treatment. After 24 hr, 70(±6)% of cells were EP1-positive (<xref ref-type="fig" rid="fig6">Figure 6A,B</xref>). Furthermore, the trypanosomes also altered their cell architecture, adopting a stumpy-like morphology after 6 hr of <italic>cis</italic>-aconitate treatment. After 24 hr, the posterior part of the cells had elongated and the kinetoplast had repositioned and segregated (<xref ref-type="fig" rid="fig6">Figure 6C</xref>, <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). These morphological changes are hallmarks of the differentiation to the procyclic insect stage.<fig-group><fig id="fig6" position="float"><object-id pub-id-type="doi">10.7554/eLife.02324.011</object-id><label>Figure 6.</label><caption><title>G1-retardation renders trypanosomes sensitive to the differentiation trigger <italic>cis</italic>-aconitate and provides full developmental competence at 37°C.</title><p>The response of trypanosomes to <italic>cis</italic>-aconitate was determined 48 hr after induction of ectopic <italic>VSG121</italic> expression. (<bold>A</bold>) Flow cytometry of EP1 surface expression at 37°C. The induced cell line 221<sup>ES</sup>.121<sup>tet</sup> was treated with <italic>cis</italic>-aconitate at 37°C in bloodstream form medium for 0, 6, and 24 hr (+tet). Non-induced cells (−tet) were used as a control. (<bold>B</bold>) Percentage of cells expressing EP1 at the surface in (<bold>A</bold>). Values represent mean ± SD of two independent clones. (<bold>C</bold>) Cell cycle analysis after treatment with <italic>cis</italic>-aconitate for various lengths of time. At least 100 cells were analyzed for each time point. For details see legend to <xref ref-type="fig" rid="fig2">Figure 2</xref>. (<bold>D</bold>) Flow cytometry analysis of EP1 surface expression at 27°C. The experiments were conducted as described in (<bold>A</bold>) except that cells were grown in differentiation medium DTM at 27°C. (<bold>E</bold>) Percentage of cells expressing EP1 at the surface in (<bold>D</bold>). Values represent mean ± SD of two independent clones. As expected for differentiation at 27°C, after 24 hr of <italic>cis</italic>-aconitate treatment, both populations were expressing EP1. This is due to cold-shock induction of EP1 in the presence of the dominant differentiation trigger. Values are mean ± SD of two independent clones. (<bold>F</bold>) <italic>Cis</italic>-aconitate treatment releases growth attenuation. After induction for ectopic <italic>VSG121</italic> expression for 48 hr, 221<sup>ES</sup>.121<sup>tet</sup> cells were transferred to differentiation medium at 27°C in the presence or absence of <italic>cis</italic>-aconitate and kept at a density of 2 × 10<sup>6</sup> cells/ml. Cumulative cell numbers per ml are shown as mean ± SD of two independent clones.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.011">http://dx.doi.org/10.7554/eLife.02324.011</ext-link></p></caption><graphic xlink:href="elife02324f006"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.02324.012</object-id><label>Figure 6—figure supplement 1.</label><caption><title>Immunofluorescence detection of the insect stage surface protein EP1.</title><p>The trypanosomes were incubated at 37°C with 6 mM <italic>cis</italic>-aconitate in bloodstream form culture medium HMI-9 for 0, 6, and 24 hr. Red indicates EP1 fluorescence and blue is DAPI staining of the nucleus (N) and kinetoplast (K). Note the characteristic posterior elongation of the cell marked by an arrowhead. Scale bar, 5 µm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.012">http://dx.doi.org/10.7554/eLife.02324.012</ext-link></p></caption><graphic xlink:href="elife02324fs004"/></fig></fig-group></p><p>It is important to note that the above experiments were conducted at 37°C to exclude the possibility that EP1 expression was induced by cold-shock (<xref ref-type="bibr" rid="bib12">Engstler and Boshart, 2004</xref>). As growth of procyclic trypanosomes in fact requires temperatures of 27°C or below and a specific culture medium, we repeated the experiment at 27°C in the differentiation medium DTM (<xref ref-type="bibr" rid="bib27">Overath et al., 1986</xref>). Following tetracycline removal, ES-attenuated trypanosomes were incubated with <italic>cis</italic>-aconitate for 6 and 24 hr, and then analyzed for EP1 expression using flow cytometry. After 6 hr, 58(±8)% of cells revealed strong EP1 fluorescence on the cell surface, while only 5(±2)% of the control population were EP1-positive (<xref ref-type="fig" rid="fig6">Figure 6D,E</xref>). Interestingly, the ES-attenuated trypanosomes accelerated the cell cycle after 24 hr and started growing as procyclic trypanosomes (<xref ref-type="fig" rid="fig6">Figure 6F</xref>). This delayed growth response is a characteristic of the differentiation of stumpy trypanosomes to the procyclic insect stage (<xref ref-type="bibr" rid="bib35">van Deursen et al., 2001</xref>) and probably marks the terminal shutdown of the attenuated ES. We conclude that the VSG-induced ES attenuation triggers the cell biological reprogramming of the parasite and causes the concomitant gain of full developmental competence.</p></sec><sec id="s2-5"><title>Signaling of expression site attenuation involves three ESAGs</title><p>We initiated the shutdown of the active ES by providing wild-type levels of a second VSG. While the overall amount of VSG did not become limiting at any time during our experiments, transcription of <italic>ESAG</italic>s was obviously affected early on (<xref ref-type="fig" rid="fig2">Figure 2B</xref>). Thus, we surmised that the loss of ESAG homeostasis caused growth retardation and developmental reprogramming of the parasite. As shown above, the reduction of ES activity is gradual, affecting the telomere-proximal <italic>ESAG1</italic> and <italic>2</italic> first. Therefore, we initially examined if loss of these two ESAGs resulted in G1-prolongation and/or PAD1-induction. The GFP:PAD<sub>utr</sub> cell line was first transfected with an tetracycline-inducible RNAi-construct targeting <italic>ESAG1</italic>. Growth was significantly but transiently impaired at days 2 and 3 of RNAi (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). The GFP:PAD<sub>utr</sub> expression was monitored by flow cytometry (<xref ref-type="fig" rid="fig7">Figure 7B</xref>). Whereas no GFP was detected in the first 24 hr, there was an accumulation of GFP-positive cells after 48 hr and a peak of GFP expression at day 3. Then the GFP-signal decreased again and was close to pre-induction at day 5, when normal growth had resumed.<fig-group><fig id="fig7" position="float"><object-id pub-id-type="doi">10.7554/eLife.02324.013</object-id><label>Figure 7.</label><caption><title>Depletion of <italic>ESAG 1</italic> or <italic>2</italic> by RNAi causes distinct growth defects and induction of PAD1 expression.</title><p>(<bold>A</bold> and <bold>C</bold>) Growth of GFP:PAD<sub>utr</sub> cells induced for RNAi against either (<bold>A</bold>) <italic>ESAG1</italic> or (<bold>C</bold>) <italic>ESAG2</italic> is presented as the cumulative mean cell number ± SD for two (<italic>ESAG1</italic>) and three (<italic>ESAG2</italic>) independent clones. Upper panels in (<bold>A</bold>) and (<bold>C</bold>) show Northern blots specific for <italic>ESAG1</italic> and <italic>2</italic>, respectively, normalized to 18S rRNA. (<bold>B</bold> and <bold>D</bold>) Flow cytometric analysis of GFP:PAD<sub>utr</sub> expression in a time course of (<bold>B</bold>) <italic>ESAG1</italic>-RNAi and (<bold>D</bold>) <italic>ESAG2</italic>-RNAi.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.013">http://dx.doi.org/10.7554/eLife.02324.013</ext-link></p></caption><graphic xlink:href="elife02324f007"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.02324.014</object-id><label>Figure 7—figure supplement 1.</label><caption><title>Down-regulation of a subset of three <italic>ESAG</italic>s induces GFP:PAD<sub>utr</sub>.</title><p>Growth curves (upper panels) and flow cytometry analysis (lower panels) of GFP:PAD<sub>utr</sub> cells induced for RNAi against several <italic>ESAG</italic>s. Depletion of <italic>ESAG</italic>s <italic>3</italic> (<bold>A</bold>) and <italic>6/7</italic> (<bold>B</bold>) causes severe growth phenotypes without induction of GFP:PAD<sub>utr</sub> expression. In contrast, RNAi against <italic>ESAG</italic>s <italic>8</italic> (<bold>C</bold>) and <italic>12</italic> (<bold>D</bold>) leads to transient growth retardation after day 2, but only <italic>ESAG8</italic> depletion leads to the appearance of a fraction of GFP-positive cells at day 3. All growth curves show the cumulative cell numbers/ml of uninduced (−tet) and induced (+tet) cells as mean ± SD for 2 (<italic>ESAG</italic>s <italic>3</italic>, <italic>8</italic> and <italic>12</italic>) and 3 (<italic>ESAG 6/7</italic>) independent clones.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.014">http://dx.doi.org/10.7554/eLife.02324.014</ext-link></p></caption><graphic xlink:href="elife02324fs005"/></fig></fig-group></p><p>Next, we knocked down <italic>ESAG2</italic> in GFP:PAD<sub>utr</sub> cells. No growth defect was observed within the first 2 days of RNAi, but the fraction of GFP-positive cells increased twofold in the first 24 hr. After 3 days, GFP was detected in 75% of all cells. At this time, cell growth stopped and the parasites started to die (<xref ref-type="fig" rid="fig7">Figure 7C,D</xref>). It should be mentioned that <italic>ESAG1</italic>-RNAi reduced transcript levels to only 30%, while <italic>ESAG2</italic>-RNAi was more effective and reduced the mRNA to less than 5%, which may explain the lethal phenotype.</p><p>To examine the possibility that down-regulation of any ESAG induces PAD1 expression, we targeted other ESAGs of the <italic>VSG221</italic> ES. In addition to ESAG1 and 2, only ablation of ESAG8 caused PAD1 induction, albeit in a less pronounced manner. The distinctive growth phenotypes observed after down-regulation of ESAGs 3, 6, 7, and 12 were not accompanied by PAD1 expression at any time (<xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). We also depleted ESAG5 by RNAi and no growth phenotype was observed. These results strongly suggest that G1-retardation and PAD1 expression is caused by the depletion of three ESAGs. Thus, loss of ESAG homeostasis is an immediate early signal for developmental stage transition.</p></sec><sec id="s2-6"><title>Expression site attenuation and growth retardation are fully reversible processes</title><p>Although ES attenuation provides the cells with full differentiation competence, it does not lead to an irreversible developmental commitment, as is the case in stumpy cells. Starting at day 5 of <italic>VSG121</italic> induction, the attenuation of the <italic>VSG221</italic> ES was gradually lifted. Interestingly, the kinetics of ES re-activation was also directional, starting at the promoter and proceeding towards the telomere. Thus, the linearity of ES attenuation was reversed (<xref ref-type="fig" rid="fig2">Figure 2C</xref>, left panel).</p><p><italic>VSG221</italic> mRNA slowly increased to pre-induction levels between days 5 and 8 (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). At day 8, the VSG221 surface coat had returned and VSG121 was back to pre-induction levels (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). With onset of <italic>VSG</italic> ES reactivation, the G1-retardation was lifted, cell cycle progression was accelerated, and at day 10, the population doubling times were back to normal (6 hr) (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). This exact timing was reproducible in many independent experiments with subcloned populations. We have analyzed 20 clonal populations and all clones re-activated the <italic>VSG221</italic> ES; no indication of ES switching was found. We cultivated the trypanosomes for an additional 10 days in the absence of tetracycline and then re-induced expression of <italic>VSG121</italic>. More than 20% of the population was responsive to re-induction and showed strong VSG121 expression, pointing against destructive mutations in the inducible expression system. As an additional control, we have expressed the <italic>VSG121</italic> gene using a constitutive T7 promoter. All resulting clonal populations revealed reduced levels of ectopic VSG121 expression, comparable to inducible VSG121-expressors after ES-re-activation (after 5 days). Importantly, in those cell lines the tetracycline system was still fully functional, as shown by tetracycline induction of an unrelated transgene (data not shown). These observations strongly argue against selection of revertants that prevent <italic>VSG121</italic> expression by interfering with the T7-system.</p><p>Thus, ES attenuation opens a time-window in which the trypanosomes linger in an intermediate state and can progress in two directions, either by differentiating to the insect stage or by returning to proliferation in the mammalian host. This questions the common view that trypanosome development is inevitably unidirectional as in the case of the SIF-induced pathway (<xref ref-type="bibr" rid="bib21">MacGregor et al., 2011</xref>).</p></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>The unique feature of the mammalian infective form of African trypanosomes is the plasma membrane with a dense VSG coat. The parasite has evolved an efficient system of antigenic variation that relies on monoallelic expression of <italic>VSG</italic> genes (<xref ref-type="bibr" rid="bib5">Borst, 2002</xref>). Though the system is optimized for a monotypic coat, two VSGs have to be handled on the same cell surface during antigen switching. Although nothing is known about the length of this period, the different underlying molecular mechanisms suggest variable time scales. Telomere exchange or gene conversion are probably rather fast processes as loss of <italic>VSG</italic> mRNA by RNAi results in rapid cell cycle arrest (<xref ref-type="bibr" rid="bib32">Sheader et al., 2005</xref>). A similar scenario applies if the active ES would be silenced before a new one is activated. In contrast, time would not necessarily be limiting if an in situ switch would involve activation of a new ES before silencing of the old one.</p><p>In this study, we simulated the activation of a new ES by high-level, inducible expression of a second heterologous <italic>VSG</italic>. The induction of <italic>VSG121</italic> expression resulted in the rapid decrease of <italic>VSG221</italic> mRNA and protein. The ectopic VSG121 dominated the surface coat for several days. The <italic>ESAG</italic>s were also down regulated, showing that induction of a second <italic>VSG</italic> gene attenuates the entire active ES. The insertion of reporter genes showed that this ES attenuation starts at the telomere and progresses towards the promoter region. Our data further indicate that the initial spike in the production of ectopic VSG acts as an immediate early signal, which is relayed to an epigenetic ES silencing machinery that requires the histone methyltransferase DOT1B. This model further explains the expression levels in stable VSG double-expressors that have a second <italic>VSG</italic> inserted into the active ES, just upstream of the endogenous copy (<xref ref-type="bibr" rid="bib25">Muñoz-Jordán et al., 1996</xref>). In these double-expressors, both VSGs are expressed in a 50/50 ratio, not exceeding a total amount of 100% compared to wild-type single expressors (data not shown). The generation of such double-expressors requires antibiotic selection for 7 days after transfection. In that time, the trypanosomes react to the initial overexpression of VSG, which occurs immediately after recombination of the transgene into the active ES, and attenuate the ES. When the VSG expression is adapted, attenuation is hold, not affecting the upstream located <italic>ESAG</italic>s. Thus, high-level expression of a second <italic>VSG</italic> alone is sufficient to initiate attenuation of the active ES. Importantly and unlike the endogenous <italic>VSG</italic>, this second <italic>VSG</italic> does not have to be expressed from an ES and it does not need to be transcribed by RNA polymerase I. Furthermore, <italic>VSG</italic> silencing and shutdown of the active ES are mechanistically distinct events, as in <italic>DOT1B</italic>-knockout trypanosomes, the ES-resident <italic>VSG</italic> is silenced upon <italic>VSG</italic> overexpression, but the <italic>ESAG</italic>s are not. No phenotype is observed after <italic>VSG</italic> overexpression in the <italic>DOT1B</italic>-knockout cells, proving that neither the initial surplus of VSG production nor the non-trypanosomal T7 RNA polymerase system is toxic.</p><p>In the mammalian olfactory receptor (OR) system, the expression of an ectopic <italic>OR</italic> transgene is sufficient to mediate a feedback inhibition that prevents the expression of the active endogenous <italic>OR</italic> gene, independent of the receptor signal transduction pathway (<xref ref-type="bibr" rid="bib26">Nguyen et al., 2007</xref>). This is strongly reminiscent of the VSG-mediated attenuation of the trypanosome ES reported here. Despite the enormous evolutionary distance between kinetoplastids and mammals the mechanistic principle appears to be conserved. The trypanosome model obviously offers some opportunities that are not readily available in the OR system, such as following the kinetics of initiation and reversal of gene silencing. Furthermore, in trypanosomes an array of genes is attenuated, whereas in the olfactory system only the <italic>OR</italic> is silenced. Importantly, the OR system fulfills a single function, namely detection of an almost infinite number of odorant molecules. Our work suggests that the control of monoallelic expression of <italic>VSG</italic> links at least three key-processes, namely antigenic variation, host range determination, and parasite development. Our findings clearly support a model in which the <italic>VSG</italic> ES orchestrates events at the crossroads of antigenic variation, cell cycle, and development. The trypanosome cell can operate for significant periods in a dormant state. This ability may become crucial in the course of an in situ switch to a non-functional or impaired VSG or upon activation of a defective ES. Any trypanosome with an attenuated ES will experience a time window of full developmental competence. Thus, the stumpy life cycle stage with its genuine cell cycle arrest can be bypassed.</p><p>While our experimental system clearly initiates <italic>VSG</italic> switching, it is not suited for completion of the process, most likely because it does not provide functional <italic>ESAG</italic>s. Interestingly, the cells react by not fully silencing the ES, but rather attenuating its activity to about 20%, probably by chromatin remodeling after histone methylation. In response to ES attenuation trypanosomes enter a semi-quiescent state with a specifically extended G1-phase. The parasites remain in this slow growth state for about 5 days and then resume normal growth without any sign of reduced fitness. While ES attenuation is triggered by the brief period of true <italic>VSG</italic> overexpression, the entry into the dormant phase is the consequence of ESAG shortage. It is important to note that ES attenuation does not lead to complete ESAG exhaustion, but rather to gradual reduction in expression. Thus, individual ESAGs could reach growth-limiting levels at different concentrations and hence, could induce G1-retardation at different times. In fact, depletion of <italic>ESAG1</italic> mRNA by RNAi leads to transient growth retardation after 48 hr. The cells recover from this phenotype 2 days later, which is in agreement with the existence of <italic>ESAG1</italic> knockout lines (<xref ref-type="bibr" rid="bib7">Carruthers et al., 1996</xref>). Importantly, even depletion of the non-essential and ES-specific <italic>ESAG8</italic> (<xref ref-type="bibr" rid="bib19">Hoek and Cross, 2001</xref>) becomes growth limiting for a transient period. In contrast, <italic>ESAG2</italic>-RNAi is irreversibly lethal and therefore, a complete ES shutdown without functional rescue from non-ES copies or a new ES would be detrimental. Although essential, the down-regulation of <italic>ESAG2</italic> to the level prevailing in ES-attenuated cells (20%) is tolerated. However, the function of these ESAGs remains elusive. ESAG1 and 2 are N-glycosylated, membrane-associated proteins localized in the flagellar pocket. It is suggested that both could function in the endosome pathway (<xref ref-type="bibr" rid="bib26a">Nolan et al., 1999</xref>; <xref ref-type="bibr" rid="bib28">Pays et al., 2001</xref>). Thus, ESAG1 and 2 could act in concert, which would explain the in parts redundant RNAi phenotypes. In contrast, ESAG8 is found in the nucleolus and the cytoplasm, and interacts with a Puf family member (<xref ref-type="bibr" rid="bib18a">Hoek et al., 2000</xref>; <xref ref-type="bibr" rid="bib19a">Hoek et al., 2002</xref>). This suggests that ESAG8 plays a role in mRNA regulation and might be linked to the differentiation pathway.</p><p>Thus, the concept of transient ES attenuation rather than immediate and complete ES silencing may be of some physiological relevance; it could allow probing for ES performance, for example ESAG functionality, VSG switching orders, quality of novel mosaic VSGs, or newly assembled expression sites. If both VSGs are compatible, and produce a mixed and dense surface coat and the <italic>ESAG</italic>s of the new ES are fully functional, the old expression site is rapidly and completely silenced with no effects on cell cycle progression. However, if any component of the new ES fails or is not sufficiently functional, the cells can adjust growth, in the extreme, to very basal levels. This way the parasites may either gain time to adapt to the new conditions or reverse the attenuation and re-activate the old ES. We suggest that the latter case resembles an unsuccessful switching event, which would escape experimental detection. In fact, we can only observe successful <italic>VSG</italic> switching events, thereby neglecting the surprising capacity of trypanosomes to reverse switching directions.</p><p>This flexibility could become particularly productive in varying host environments. Provided a sufficiently high ES activation frequency exists, the parasites could effectively probe for host serum-compatible ESAGs (<xref ref-type="bibr" rid="bib4">Bitter et al., 1998</xref>; <xref ref-type="bibr" rid="bib8">Chaves et al., 1999</xref>; <xref ref-type="bibr" rid="bib28">Pays et al., 2001</xref>). Hence, ES switching plasticity could determine the host range. One extreme example for this is <italic>Trypanosoma b. rhodesiense,</italic> which is human-infective and thought to be a host-range variant of <italic>T. b. brucei</italic>. The parasites are specifically adapted to human serum by expression of the serum-resistance antigen (SRA) from one particular <italic>VSG</italic> ES in most isolates. The structure of the <italic>SRA</italic>-containing ES is unusual as it is missing several <italic>ESAG</italic>s present in all other ESs. During an infection of a human, an in situ switch to a <italic>VSG</italic> in another ES would cause loss of <italic>SRA</italic> expression, with lethal consequences. Thus, <italic>T. b. rhodesiense</italic> must not switch off the <italic>SRA</italic>-containing ES, thus making the ESAG-dependent differentiation pathway obsolete. This may be the reason why the <italic>T. b. rhodesiense</italic> ES has lost <italic>ESAG1</italic>, <italic>2</italic> and <italic>8</italic>.</p><p>The fact that ES attenuation causes growth retardation could also become mechanistically relevant during another phase of the trypanosome life cycle, namely upon differentiation to the G1/G0-arrested stumpy stage. The developmental transition from the proliferating slender to the quiescent stumpy bloodstream stage is initiated by quorum sensing of the trypanosome-derived compound SIF (<xref ref-type="bibr" rid="bib29">Reuner et al., 1997</xref>). The monomorphic cells used in this study are unresponsive to SIF and hence, should have lost the capacity to differentiate to the tsetse-infective stage (<xref ref-type="bibr" rid="bib36">Vassella et al., 1997</xref>). In our experiments, however, VSG-induced ES attenuation renders monomorphic trypanosomes fully competent for development. After 2 days of <italic>VSG</italic> overexpression the stumpy stage marker PAD1 was strongly up-regulated, specifically in G1-phase cells, and despite global transcriptional silencing being initiated at the same time. This indicates a highly specific event, which, in the absence of SIF, is orchestrated solely by the state of the <italic>VSG</italic> expression site. We are currently investigating this alternative pathway in a pleomorphic strain. The induced expression of a second <italic>VSG</italic> indeed leads to the formation of stumpy forms (data not shown). While VSG itself is not involved, as it is not limiting in our system, three ESAGs signal ES attenuation to the differentiation pathway. Depletion of <italic>ESAG</italic>s <italic>1, 2</italic> and <italic>8</italic> mRNA by RNAi resulted in induction of the PAD1 reporter GFP:PAD<sub>utr</sub>. Down-regulation of any of the other <italic>ESAG</italic>s did not cause GFP:PAD<sub>utr</sub> expression. This underlines the specificity of the pathway and suggests that ES activity controls the induction of transient developmental competence. Remarkably, by embedding the endogenous PAD1 protein into the VSG coat, the ES attenuated trypanosomes became fully responsive to the developmental trigger <italic>cis</italic>-aconitate. They initiated transformation to the procyclic insect stage with the same kinetics as stumpy parasites.</p><p>There is, however, one principal feature that distinguishes SIF-mediated stumpy formation from ES-regulated cell dormancy. While stumpy parasites are terminally differentiated and can only survive if taken up by an insect, the onset of differentiation is fully reversible in the ES-attenuated trypanosomes. We postulate that these parasites linger in an intermediate state with open developmental choices (<xref ref-type="fig" rid="fig8">Figure 8</xref>). They have the capacity to complete ES switching by adapting to the new ES or, alternatively, they can re-activate the old, attenuated ES. In both of these cases the parasites resume growth as mammalian bloodstream form cells. If taken up by the tsetse fly, however, they would immediately transform to the procyclic insect stage.<fig id="fig8" position="float"><object-id pub-id-type="doi">10.7554/eLife.02324.015</object-id><label>Figure 8.</label><caption><title>Model of the dual roles of expression site attenuation for antigenic variation and development of <italic>T. brucei</italic>.</title><p>Activation of a new ES leads to attenuation of the previously active one in a DOT1B-dependent manner. The attenuation and subsequent growth retardation allows ES quality control via ESAG1, 2 and 8. If the newly activated ES is functional, the old one is rapidly silenced, resulting in a <italic>successful</italic> VSG switch. If, however, a non-functional or non-compatible ES is activated, the cells react with a specific prolongation of the G1-cell cycle phase. This dormancy can last for up to 5 days and is fully reversible. Within this period the trypanosomes become competent for developmental stage transition, which involves expression of the stumpy marker PAD1. The stumpy stage, however, is irreversibly arrested in G0 and therefore committed to a life in the tsetse fly. In contrast, ES attenuation causes a reversible G1 dormancy, which allows either re-activation of the attenuated ES (<italic>unsuccessful switch</italic>) or survival by development in the insect vector. Thus, ES attenuation operates at the crossroads of antigenic variation and development.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.015">http://dx.doi.org/10.7554/eLife.02324.015</ext-link></p></caption><graphic xlink:href="elife02324f008"/></fig></p><p>This high flexibility might become biologically relevant especially during early infections, when certain ESAGs or VSGs are not compatible with the new host environment: cells either adapt or regain fly-infectivity. Thus, the state of the expression site must not be regarded as a simple on-off switch, but rather represents a fine-tuned module at the unexpected crossroads of antigenic variation and development.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Trypanosome culturing and transfection</title><p>All cell lines generated in this study are based on <italic>T. brucei</italic> 427 MITat 1.2 13-90 bloodstream forms (221<sup>ES</sup>) (<xref ref-type="bibr" rid="bib38">Wirtz et al., 1999</xref>) and were cultivated in HMI-9 medium with 10% fetal bovine serum (Sigma-Aldrich, St. Louis, MO) at 37°C and 5% CO<sub>2</sub>. For T7-polymerase and tetracycline repressor maintenance, cells were selected with 5 µg/ml hygromycin and 2.5 µg/ml G418. For transfections, 3 × 10<sup>7</sup> parasites were electroporated with 10 µg of linearized plasmid DNA using the AMAXA Nucleofector II (Lonza, Switzerland). Details of expression constructs and cell lines are provided in <xref ref-type="supplementary-material" rid="SD1-data">Supplementary file 1</xref>.</p></sec><sec id="s4-2"><title>Plasmid construction and generation of cell lines</title><p>The VSG121 open reading frame with the full 3′UTR was amplified from MITat1.6 wild-type genomic DNA with the primers VSG121_fw and VSG121_rev, subcloned into a pBluescriptSK, mobilized with HindIII and cloned into the pLew82v4 (24,009; Addgene plasmid). The resulting plasmid pRS.121 was NotI-linearized and transfected into the bloodstream form 221<sup>ES</sup>, giving rise to the 221<sup>ES</sup>.121<sup>tet</sup> transformants. pkD.GFP was generated by cloning a 1.6 kb SpeI/EcoRI fragment containing a <italic>GFP</italic> ORF flanked by VSG221 5′ and 3′UTRs from p3845 (kindly provided by A Schwede and M Carrington, Cambridge, UK) into the VSG221 ES targeting vector pkD (<xref ref-type="bibr" rid="bib25">Muñoz-Jordán et al., 1996</xref>). Cell lines GFP<sup>ESpro</sup>-221<sup>ES</sup>.121<sup>tet</sup> and GFP<sup>EStel</sup>-221<sup>ES</sup>.121<sup>tet</sup> were generated by inserting p3845 and pkD.GFP, respectively, into 221<sup>ES</sup>.121<sup>tet</sup>. For the Luc<sup>ES</sup> cell lines, the luciferase gene was mobilized with HindIII from pLew82v4, overhangs were filled in and the resulting product was ligated to an EcoRI digested and blunted pkD vector. The resulting plasmid pkD.Luc was linearized with AvrII and KpnI and transfected into 221<sup>ES</sup>.121<sup>tet</sup> or Δdot1b.121<sup>tet</sup>. pRib.Luc was generated by cloning the luciferase gene between the HindIII and BamHI sites of pTSA-Rib (<xref ref-type="bibr" rid="bib40">Xong et al., 1998</xref>), in which the tubulin 3′UTR had been replaced by the PARP 3′ region and the hygromycin resistance by puromycin resistance. The resulting plasmid was SphI linearized and transfected into 221<sup>ES</sup>.121<sup>tet</sup>, creating Luc<sup>rPro</sup>.221<sup>ES</sup>.121<sup>tet</sup>. pTub.Luc was created by replacing a BsaBI/SphI fragment from pHD328 (<xref ref-type="bibr" rid="bib37">Wirtz et al., 1994</xref>) with a BsaBI/SphI fragment from pLew20 (<xref ref-type="bibr" rid="bib38">Wirtz et al., 1999</xref>) and the <italic>ble</italic> gene was replaced by a puromycin resistance gene. The resulting plasmid was linearized with NotI and transfected into 221<sup>ES</sup>.121<sup>tet</sup>, resulting in Luc<sup>tub</sup>.221<sup>ES</sup>.121<sup>tet</sup>. For generating the GFP:PAD<sub>utr</sub> reporter cell lines, the plasmid p4231 (J Sunter, A Schwede and M Carrington, unpublished) was transfected into the parental 221<sup>ES</sup> or the 221<sup>ES</sup>.121<sup>tet</sup> cell line. For RNAi, the target sequences were amplified from genomic DNA of 221<sup>ES</sup> cells using the following primers: ESAG1_fw (5′-TTGTGTTGATGCATG-3′) and ESAG1_rev (5′-TCGGTCTTG GTTTAG-3′); ESAG2_fw (5′-GAAATAGTGATTGCCG-3′) and ESAG2_rev (5′-CAAACTCAGCTAATGC-3′); ESAG3_fw (5′AAAAAAAAGCTTTCCTTC AAGATGAAG AAGC-3′) and ESAG3_rev (5-AAAAAAGGATCCAAACAAGTCATTCTCCTTGACC-3′); ESAG6/7_fw (5′-AAAAAAAAGCTTGTTTTGGTTTGTGCTGTTGG-3′) and ESAG6/7_rev (5′-AAAAAAGGATCCATACTTTCCGCACCCAAGC-3′); ESAG8_fw (5′-GCACTACGTGATCTGGAAGC-3′) and ESAG8_rev (5′-CATAGAGCACCCTC AAGTGG-3′); ESAG12_fw (5′-AGCGGTGTCAATATTC-3′) and ESAG12_rev (5′-AGGAGGAAGGAGTTTG-3′). The PCR products were subcloned into a pBluescriptSK+ and mobilized with HindIII and SpeI (<italic>ESAG1</italic> and <italic>2</italic>), HindIII and BamHI (<italic>ESAG3</italic>, <italic>ESAG6/7</italic>), or XbaI and XhoI (<italic>ESAG8</italic>) to ligate them into the RNAi plasmid p2T7 (<xref ref-type="bibr" rid="bib33">Shi et al., 2000</xref>). The resulting plasmids were linearized with NotI and transfected into the GFP:PAD<sub>utr</sub>.221<sup>ES</sup> cell line.</p></sec><sec id="s4-3"><title>EdU and BrUTP labeling</title><p>Newly synthesized DNA was labeled with 5-ethynyl-2′-deoxyuridine (EdU) using the Click-iT EdU Alexa Fluor 488 Imaging Kit (Invitrogen, Carlsbad, CA), essentially following the manufacturer's instructions. The cells were incubated with 50 µM EdU in HMI-9 medium, washed in buffer and chemically fixed. After permeabilization with 0.1% Triton X-100, the reaction cocktail was added and the cells were washed twice. BrUTP labeling of nascent transcripts was achieved as described in <xref ref-type="bibr" rid="bib33a">Smith et al. (2009)</xref>.</p></sec><sec id="s4-4"><title>RNA and protein analyses</title><p>Total RNA was isolated from 1 × 10<sup>8</sup> trypanosomes using the Qiagen RNeasy Mini Kit (Qiagen, Netherlands) essentially following the manufacturer's instructions. For RNA quantification with fluorescently labeled probes (GFP-probe: GCCGTTCTTCTGCTTGTCGGCCATGATATAGA; VSG121-probe: GGCTGCGGTTACGTAGGTGTCGATGTCGAGATTAAG; VSG221-probe: CAGCGTAAACAACGCACCCTTCGGTTGGTCGTCTAG; Tubulin-probe: ATCAAAGTACACATTGATGCGCTCCAGCTGCAGGTC; 18SrRNA-probe: CAACCAAACAAATCACTCCACCGACCAAAA), 3 µg of total RNA was denatured with glyoxal and blotted with a Minifold Dotblotter (Schleicher & Schuell, Germany) onto nitrocellulose and hybridized overnight at 42°C. <italic>ESAG</italic> transcripts were detected with <sup>32</sup>P-labeled probes and quantified using a Phosphorimager. To precipitate protein, the cell lysates were mixed with ice-cold acetone and centrifuged at 20,000×<italic>g</italic> for 10 min. The sediment was air-dried and resuspended in sample buffer (2% SDS, 10% glycerol, 60 mM Tris–HCl, pH 6.8, 1% β-mercaptoethanol) to yield equivalents of 2 × 10<sup>5</sup> cells/µl. For protein quantification, 3 µl was spotted onto nitrocellulose, air-dried, and incubated with specific polyclonal anti-VSG antibodies (rabbit anti-VSG221/C-term, 1:5000; rabbit anti-VSG121, 1:2000) and mouse monoclonal anti-PFR antibody (L13D6, 1:20). For fluorescence detection, an IRDye680-conjugated goat-anti-mouse antibody and an IRDye800-conjugated goat-anti-rabbit antibody (1:10,000; Licor, Lincoln, NE) were used. Protein and RNA were analyzed and quantified using the Licor Odyssey System.</p></sec><sec id="s4-5"><title>Luciferase assay</title><p>1 × 10<sup>6</sup> to 1 × 10<sup>7</sup> trypanosomes were washed in ice-cold PBS and resuspended in 100 µl of cell culture lysis buffer (Promega, Madison, WI). 5 µl of lysate were added to 45 µl of luciferase substrate and the luminescence was immediately measured with a Tecan Infinite M200 plate reader (Tecan, Switzerland).</p></sec><sec id="s4-6"><title>Immunofluorescence analysis and flow cytometry</title><p>IF for surface detection of procyclin EP1 was done as in <xref ref-type="bibr" rid="bib12">Engstler and Boshart (2004)</xref>. For VSG IF, chemically fixed cells were incubated with a mouse anti-VSG121 (1:100) and a rabbit anti-VSG221 (1:100) antibody, followed by incubation with an Alexa488- and Alexa594-conjugated anti-mouse and anti-rabbit antibody, respectively (1:1000). For PAD1 detection, chemically fixed cells were permeabilized with 0.05% Triton X-100 for 10 min and incubated with a rabbit anti-PAD1 antibody (1:100), followed by incubation with an Alexa488-conjugated anti-rabbit antibody (1:1000). Flow cytometry was performed with a BD Bioscience FACSCalibur Flow Cytometer. Data were analyzed with the BD CellQuest Pro Software. For each sample, 20,000 cells were counted.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>This work was supported by the Deutsche Forschungsgemeinschaft (grant EN 305 to ME). We are grateful to M Carrington (University of Cambridge, UK) for helpful discussion and critical reading of the manuscript. We thank A Schwede (University of Cambridge, UK) for the plasmid p3845, J Sunter (University of Oxford, UK) for the plasmid p4231, M Carrington and K Matthews (Edinburgh) for providing antibodies. We thank L Figueiredo (Universidade de Lisboa), N Siegel, and A Hartel (Universität Würzburg) for discussion.</p></ack><sec sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>CB, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con2"><p>NGJ, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con3"><p>CJJ, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con4"><p>SMM, Acquisition of data, Analysis and interpretation of data</p></fn><fn fn-type="con" id="con5"><p>ME, Conception and design, Analysis and interpretation of data, Drafting or revising the article</p></fn></fn-group></sec><sec sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="SD1-data"><object-id pub-id-type="doi">10.7554/eLife.02324.016</object-id><label>Supplementary file 1.</label><caption><p>Cell lines and targeting constructs.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.02324.016">http://dx.doi.org/10.7554/eLife.02324.016</ext-link></p></caption><media mime-subtype="docx" mimetype="application" xlink:href="elife02324s001.docx"/></supplementary-material></sec><ref-list><title>References</title><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Amiguet-Vercher</surname><given-names>A</given-names></name><name><surname>Pérez-Morga</surname><given-names>D</given-names></name><name><surname>Pays</surname><given-names>A</given-names></name><name><surname>Poelvoorde</surname><given-names>P</given-names></name><name><surname>Xong</surname><given-names>H</given-names></name><name><surname>Tebabi</surname><given-names>P</given-names></name><name><surname>Vanhamme</surname><given-names>L</given-names></name><name><surname>Pays</surname><given-names>E</given-names></name></person-group><year>2004</year><article-title>Loss of the mono-allelic control of the VSG expression sites during the development of <italic>Trypanosoma brucei</italic> in the bloodstream</article-title><source>Molecular Microbiology</source><volume>51</volume><fpage>1577</fpage><lpage>1588</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2958.2003.03937.x</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Berriman</surname><given-names>M</given-names></name><name><surname>Ghedin</surname><given-names>E</given-names></name><name><surname>Hertz-Fowler</surname><given-names>C</given-names></name><name><surname>Blandin</surname><given-names>G</given-names></name><name><surname>Renauld</surname><given-names>H</given-names></name><name><surname>Bartholomeu</surname><given-names>DC</given-names></name><name><surname>Lennard</surname><given-names>NJ</given-names></name><name><surname>Caler</surname><given-names>E</given-names></name><name><surname>Hamlin</surname><given-names>NE</given-names></name><name><surname>Haas</surname><given-names>B</given-names></name><name><surname>Böhme</surname><given-names>U</given-names></name><name><surname>Hannick</surname><given-names>L</given-names></name><name><surname>Aslett</surname><given-names>MA</given-names></name><name><surname>Shallom</surname><given-names>J</given-names></name><name><surname>Marcello</surname><given-names>L</given-names></name><name><surname>Hou</surname><given-names>L</given-names></name><name><surname>Wickstead</surname><given-names>B</given-names></name><name><surname>Alsmark</surname><given-names>UC</given-names></name><name><surname>Arrowsmith</surname><given-names>C</given-names></name><name><surname>Atkin</surname><given-names>RJ</given-names></name><name><surname>Barron</surname><given-names>AJ</given-names></name><name><surname>Bringaud</surname><given-names>F</given-names></name><name><surname>Brooks</surname><given-names>K</given-names></name><name><surname>Carrington</surname><given-names>M</given-names></name><name><surname>Cherevach</surname><given-names>I</given-names></name><name><surname>Chillingworth</surname><given-names>TJ</given-names></name><name><surname>Churcher</surname><given-names>C</given-names></name><name><surname>Clark</surname><given-names>LN</given-names></name><name><surname>Corton</surname><given-names>CH</given-names></name><name><surname>Cronin</surname><given-names>A</given-names></name><name><surname>Davies</surname><given-names>RM</given-names></name><name><surname>Doggett</surname><given-names>J</given-names></name><name><surname>Djikeng</surname><given-names>A</given-names></name><name><surname>Feldblyum</surname><given-names>T</given-names></name><name><surname>Field</surname><given-names>MC</given-names></name><name><surname>Fraser</surname><given-names>A</given-names></name><name><surname>Goodhead</surname><given-names>I</given-names></name><name><surname>Hance</surname><given-names>Z</given-names></name><name><surname>Harper</surname><given-names>D</given-names></name><name><surname>Harris</surname><given-names>BR</given-names></name><name><surname>Hauser</surname><given-names>H</given-names></name><name><surname>Hostetler</surname><given-names>J</given-names></name><name><surname>Ivens</surname><given-names>A</given-names></name><name><surname>Jagels</surname><given-names>K</given-names></name><name><surname>Johnson</surname><given-names>D</given-names></name><name><surname>Johnson</surname><given-names>J</given-names></name><name><surname>Jones</surname><given-names>K</given-names></name><name><surname>Kerhornou</surname><given-names>AX</given-names></name><name><surname>Koo</surname><given-names>H</given-names></name><name><surname>Larke</surname><given-names>N</given-names></name><name><surname>Landfear</surname><given-names>S</given-names></name><name><surname>Larkin</surname><given-names>C</given-names></name><name><surname>Leech</surname><given-names>V</given-names></name><name><surname>Line</surname><given-names>A</given-names></name><name><surname>Lord</surname><given-names>A</given-names></name><name><surname>Macleod</surname><given-names>A</given-names></name><name><surname>Mooney</surname><given-names>PJ</given-names></name><name><surname>Moule</surname><given-names>S</given-names></name><name><surname>Martin</surname><given-names>DM</given-names></name><name><surname>Morgan</surname><given-names>GW</given-names></name><name><surname>Mungall</surname><given-names>K</given-names></name><name><surname>Norbertczak</surname><given-names>H</given-names></name><name><surname>Ormond</surname><given-names>D</given-names></name><name><surname>Pai</surname><given-names>G</given-names></name><name><surname>Peacock</surname><given-names>CS</given-names></name><name><surname>Peterson</surname><given-names>J</given-names></name><name><surname>Quail</surname><given-names>MA</given-names></name><name><surname>Rabbinowitsch</surname><given-names>E</given-names></name><name><surname>Rajandream</surname><given-names>MA</given-names></name><name><surname>Reitter</surname><given-names>C</given-names></name><name><surname>Salzberg</surname><given-names>SL</given-names></name><name><surname>Sanders</surname><given-names>M</given-names></name><name><surname>Schobel</surname><given-names>S</given-names></name><name><surname>Sharp</surname><given-names>S</given-names></name><name><surname>Simmonds</surname><given-names>M</given-names></name><name><surname>Simpson</surname><given-names>AJ</given-names></name><name><surname>Tallon</surname><given-names>L</given-names></name><name><surname>Turner</surname><given-names>CM</given-names></name><name><surname>Tait</surname><given-names>A</given-names></name><name><surname>Tivey</surname><given-names>AR</given-names></name><name><surname>Van Aken</surname><given-names>S</given-names></name><name><surname>Walker</surname><given-names>D</given-names></name><name><surname>Wanless</surname><given-names>D</given-names></name><name><surname>Wang</surname><given-names>S</given-names></name><name><surname>White</surname><given-names>B</given-names></name><name><surname>White</surname><given-names>O</given-names></name><name><surname>Whitehead</surname><given-names>S</given-names></name><name><surname>Woodward</surname><given-names>J</given-names></name><name><surname>Wortman</surname><given-names>J</given-names></name><name><surname>Adams</surname><given-names>MD</given-names></name><name><surname>Embley</surname><given-names>TM</given-names></name><name><surname>Gull</surname><given-names>K</given-names></name><name><surname>Ullu</surname><given-names>E</given-names></name><name><surname>Barry</surname><given-names>JD</given-names></name><name><surname>Fairlamb</surname><given-names>AH</given-names></name><name><surname>Opperdoes</surname><given-names>F</given-names></name><name><surname>Barrell</surname><given-names>BG</given-names></name><name><surname>Donelson</surname><given-names>JE</given-names></name><name><surname>Hall</surname><given-names>N</given-names></name><name><surname>Fraser</surname><given-names>CM</given-names></name><name><surname>Melville</surname><given-names>SE</given-names></name><name><surname>El-Sayed</surname><given-names>NM</given-names></name></person-group><year>2005</year><article-title>The genome of the African trypanosome <italic>Trypanosoma brucei</italic></article-title><source>Science</source><volume>309</volume><fpage>416</fpage><lpage>422</lpage><pub-id pub-id-type="doi">10.1126/science.1112642</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bitter</surname><given-names>W</given-names></name><name><surname>Gerrits</surname><given-names>H</given-names></name><name><surname>Kieft</surname><given-names>R</given-names></name><name><surname>Borst</surname><given-names>P</given-names></name></person-group><year>1998</year><article-title>The role of transferrin-receptor variation in the host range of <italic>Trypanosoma brucei</italic></article-title><source>Nature</source><volume>391</volume><fpage>499</fpage><lpage>502</lpage><pub-id pub-id-type="doi">10.1038/35166</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Borst</surname><given-names>P</given-names></name></person-group><year>2002</year><article-title>Antigenic variation and allelic exclusion</article-title><source>Cell</source><volume>109</volume><fpage>5</fpage><lpage>8</lpage></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Buck</surname><given-names>L</given-names></name><name><surname>Axel</surname><given-names>R</given-names></name></person-group><year>1991</year><article-title>A novel multigene family may encode odorant receptors: a molecular basis for odor recognition</article-title><source>Cell</source><volume>65</volume><fpage>175</fpage><lpage>187</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(91)90418-X</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Carruthers</surname><given-names>VB</given-names></name><name><surname>Navarro</surname><given-names>M</given-names></name><name><surname>Cross</surname><given-names>GA</given-names></name></person-group><year>1996</year><article-title>Targeted disruption of expression site-associated gene-1 in bloodstream-form <italic>Trypanosoma brucei</italic></article-title><source>Molecular and Biochemical Parasitology</source><volume>81</volume><fpage>65</fpage><lpage>79</lpage><pub-id pub-id-type="doi">10.1016/0166-6851(96)02672-2</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chaves</surname><given-names>I</given-names></name><name><surname>Rudenko</surname><given-names>G</given-names></name><name><surname>Dirks-Mulder</surname><given-names>A</given-names></name><name><surname>Cross</surname><given-names>M</given-names></name><name><surname>Borst</surname><given-names>P</given-names></name></person-group><year>1999</year><article-title>Control of variant surface glycoprotein gene-expression sites in <italic>Trypanosoma brucei</italic></article-title><source>The EMBO Journal</source><volume>18</volume><fpage>4846</fpage><lpage>4855</lpage><pub-id pub-id-type="doi">10.1093/emboj/18.17.4846</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cross</surname><given-names>GA</given-names></name></person-group><year>1975</year><article-title>Identification, purification and properties of clone-specific glycoprotein antigens constituting the surface coat of <italic>Trypanosoma brucei</italic></article-title><source>Parasitology</source><volume>71</volume><fpage>393</fpage><lpage>417</lpage><pub-id pub-id-type="doi">10.1017/S003118200004717X</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dean</surname><given-names>S</given-names></name><name><surname>Marchetti</surname><given-names>R</given-names></name><name><surname>Kirk</surname><given-names>K</given-names></name><name><surname>Matthews</surname><given-names>KR</given-names></name></person-group><year>2009</year><article-title>A surface transporter family conveys the trypanosome differentiation signal</article-title><source>Nature</source><volume>459</volume><fpage>213</fpage><lpage>217</lpage><pub-id pub-id-type="doi">10.1038/nature07997</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ehlers</surname><given-names>B</given-names></name><name><surname>Czichos</surname><given-names>J</given-names></name><name><surname>Overath</surname><given-names>P</given-names></name></person-group><year>1987</year><article-title>RNA turnover in <italic>Trypanosoma brucei</italic></article-title><source>Molecular and Cellular Biology</source><volume>7</volume><fpage>1242</fpage><lpage>1249</lpage></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Engstler</surname><given-names>M</given-names></name><name><surname>Boshart</surname><given-names>M</given-names></name></person-group><year>2004</year><article-title>Cold shock and regulation of surface protein trafficking convey sensitization to inducers of stage differentiation in <italic>Trypanosoma brucei</italic></article-title><source>Genes & Development</source><volume>18</volume><fpage>2798</fpage><lpage>2811</lpage><pub-id pub-id-type="doi">10.1101/gad.323404</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Engstler</surname><given-names>M</given-names></name><name><surname>Pfohl</surname><given-names>T</given-names></name><name><surname>Herminghaus</surname><given-names>S</given-names></name><name><surname>Boshart</surname><given-names>M</given-names></name><name><surname>Wiegertjes</surname><given-names>G</given-names></name><name><surname>Heddergott</surname><given-names>N</given-names></name><name><surname>Overath</surname><given-names>P</given-names></name></person-group><year>2007</year><article-title>Hydrodynamic flow-mediated protein sorting on the cell surface of trypanosomes</article-title><source>Cell</source><volume>131</volume><fpage>505</fpage><lpage>515</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2007.08.046</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Figueiredo</surname><given-names>LM</given-names></name><name><surname>Janzen</surname><given-names>CJ</given-names></name><name><surname>Cross</surname><given-names>GAM</given-names></name></person-group><year>2008</year><article-title>A histone methyltransferase modulates antigenic variation in African trypanosomes</article-title><source>PLOS Biology</source><volume>6</volume><fpage>e161</fpage><pub-id pub-id-type="doi">10.1371/journal.pbio.0060161</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Guizetti</surname><given-names>J</given-names></name><name><surname>Scherf</surname><given-names>A</given-names></name></person-group><year>2013</year><article-title>Silence, activate, poise and switch! Mechanisms of antigenic variation in <italic>Plasmodium falciparum</italic></article-title><source>Cellular Microbiology</source><volume>15</volume><fpage>718</fpage><lpage>726</lpage><pub-id pub-id-type="doi">10.1111/cmi.12115</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hertz-Fowler</surname><given-names>C</given-names></name><name><surname>Figueiredo</surname><given-names>LM</given-names></name><name><surname>Quail</surname><given-names>MA</given-names></name><name><surname>Becker</surname><given-names>M</given-names></name><name><surname>Jackson</surname><given-names>A</given-names></name><name><surname>Bason</surname><given-names>N</given-names></name><name><surname>Brooks</surname><given-names>K</given-names></name><name><surname>Churcher</surname><given-names>C</given-names></name><name><surname>Fahkro</surname><given-names>S</given-names></name><name><surname>Goodhead</surname><given-names>I</given-names></name><name><surname>Heath</surname><given-names>P</given-names></name><name><surname>Kartvelishvili</surname><given-names>M</given-names></name><name><surname>Mungall</surname><given-names>K</given-names></name><name><surname>Harris</surname><given-names>D</given-names></name><name><surname>Hauser</surname><given-names>H</given-names></name><name><surname>Sanders</surname><given-names>M</given-names></name><name><surname>Saunders</surname><given-names>D</given-names></name><name><surname>Seeger</surname><given-names>K</given-names></name><name><surname>Sharp</surname><given-names>S</given-names></name><name><surname>Taylor</surname><given-names>JE</given-names></name><name><surname>Walker</surname><given-names>D</given-names></name><name><surname>White</surname><given-names>B</given-names></name><name><surname>Young</surname><given-names>R</given-names></name><name><surname>Cross</surname><given-names>GA</given-names></name><name><surname>Rudenko</surname><given-names>G</given-names></name><name><surname>Barry</surname><given-names>JD</given-names></name><name><surname>Louis</surname><given-names>EJ</given-names></name><name><surname>Berriman</surname><given-names>M</given-names></name></person-group><year>2008</year><article-title>Telomeric expression sites are highly conserved in <italic>Trypanosoma brucei</italic></article-title><source>PLOS ONE</source><volume>3</volume><fpage>e3527</fpage><pub-id pub-id-type="doi">10.1371/journal.pone.0003527</pub-id></element-citation></ref><ref id="bib18a"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hoek</surname><given-names>M</given-names></name><name><surname>Engstler</surname><given-names>M</given-names></name><name><surname>Cross</surname><given-names>GA</given-names></name></person-group><year>2000</year><article-title>Expression-site-associated gene 8 (ESAG8) of <italic>Trypanosoma brucei</italic> is apparently essential and accumulates in the nucleolus</article-title><source>Journal of Cell Science</source><volume>113</volume><fpage>3959</fpage><lpage>3968</lpage></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hoek</surname><given-names>M</given-names></name><name><surname>Cross</surname><given-names>GA</given-names></name></person-group><year>2001</year><article-title>Expression-site-associated-gene-8 (ESAG8) is not required for regulation of the VSG expression site in <italic>Trypanosoma brucei</italic></article-title><source>Molecular and Biochemical Parasitology</source><volume>117</volume><fpage>211</fpage><lpage>215</lpage><pub-id pub-id-type="doi">10.1016/S0166-6851(01)00341-3</pub-id></element-citation></ref><ref id="bib19a"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hoek</surname><given-names>M</given-names></name><name><surname>Zanders</surname><given-names>T</given-names></name><name><surname>Cross</surname><given-names>GAM</given-names></name></person-group><year>2002</year><article-title><italic>Trypanosoma brucei</italic> expression-site-associated-gene-8 protein interacts with a Pumilio family protein</article-title><source>Molecular and Biochemical Parasitology</source><volume>120</volume><fpage>269</fpage><lpage>283</lpage></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Horn</surname><given-names>D</given-names></name><name><surname>McCulloch</surname><given-names>R</given-names></name></person-group><year>2010</year><article-title>Molecular mechanisms underlying the control of antigenic variation in African trypanosomes</article-title><source>Current Opinion in Microbiology</source><volume>13</volume><fpage>700</fpage><lpage>705</lpage><pub-id pub-id-type="doi">10.1016/j.mib.2010.08.009</pub-id></element-citation></ref><ref id="bib20a"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Janzen</surname><given-names>CJ</given-names></name><name><surname>Hake</surname><given-names>SB</given-names></name><name><surname>Lowell</surname><given-names>JE</given-names></name><name><surname>Cross</surname><given-names>GAM</given-names></name></person-group><year>2006</year><article-title>Selective di- or trimethylation of histone H3 lysine 76 by two DOT1 homologs is important for cell cycle regulation in <italic>Trypanosoma brucei</italic></article-title><source>Molecular Cell</source><volume>23</volume><fpage>497</fpage><lpage>507</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2006.06.027</pub-id></element-citation></ref><ref id="bib21a"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lyons</surname><given-names>DB</given-names></name><name><surname>Allen</surname><given-names>WE</given-names></name><name><surname>Goh</surname><given-names>T</given-names></name><name><surname>Tsai</surname><given-names>L</given-names></name><name><surname>Barnea</surname><given-names>G</given-names></name><name><surname>Lomvardas</surname><given-names>S</given-names></name></person-group><year>2013</year><article-title>An epigenetic trap stabilizes singular olfactory receptor expression</article-title><source>Cell</source><volume>154</volume><fpage>325</fpage><lpage>336</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2013.06.039</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>MacGregor</surname><given-names>P</given-names></name><name><surname>Savill</surname><given-names>NJ</given-names></name><name><surname>Hall</surname><given-names>D</given-names></name><name><surname>Matthews</surname><given-names>KR</given-names></name></person-group><year>2011</year><article-title>Transmission stages dominate trypanosome within-host dynamics during chronic infections</article-title><source>Cell Host & Microbe</source><volume>9</volume><fpage>310</fpage><lpage>318</lpage><pub-id pub-id-type="doi">10.1016/j.chom.2011.03.013</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>MacGregor</surname><given-names>P</given-names></name><name><surname>Szöőr</surname><given-names>B</given-names></name><name><surname>Savill</surname><given-names>NJ</given-names></name><name><surname>Matthews</surname><given-names>KR</given-names></name></person-group><year>2012</year><article-title>Trypanosomal immune evasion, chronicity and transmission: an elegant balancing act</article-title><source>Nature Reviews Microbiology</source><volume>10</volume><fpage>431</fpage><lpage>438</lpage><pub-id pub-id-type="doi">10.1038/nrmicro2779</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>MacGregor</surname><given-names>P</given-names></name><name><surname>Matthews</surname><given-names>KR</given-names></name></person-group><year>2012</year><article-title>Identification of the regulatory elements controlling the transmission stage-specific gene expression of PAD1 in <italic>Trypanosoma brucei</italic></article-title><source>Nucleic Acids Research</source><volume>40</volume><fpage>7705</fpage><lpage>7717</lpage><pub-id pub-id-type="doi">10.1093/nar/gks533</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Magklara</surname><given-names>A</given-names></name><name><surname>Yen</surname><given-names>A</given-names></name><name><surname>Colquitt</surname><given-names>BM</given-names></name><name><surname>Clowney</surname><given-names>EJ</given-names></name><name><surname>Allen</surname><given-names>W</given-names></name><name><surname>Markenscoff-Papadimitriou</surname><given-names>E</given-names></name><name><surname>Evans</surname><given-names>ZA</given-names></name><name><surname>Kheradpour</surname><given-names>P</given-names></name><name><surname>Mountoufaris</surname><given-names>G</given-names></name><name><surname>Carey</surname><given-names>C</given-names></name><name><surname>Barnea</surname><given-names>G</given-names></name><name><surname>Kellis</surname><given-names>M</given-names></name><name><surname>Lomvardas</surname><given-names>S</given-names></name></person-group><year>2011</year><article-title>An epigenetic signature for monoallelic olfactory receptor expression</article-title><source>Cell</source><volume>145</volume><fpage>555</fpage><lpage>570</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2011.03.040</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Muñoz-Jordán</surname><given-names>JL</given-names></name><name><surname>Davies</surname><given-names>KP</given-names></name><name><surname>Cross</surname><given-names>GA</given-names></name></person-group><year>1996</year><article-title>Stable expression of mosaic coats of variant surface glycoproteins in <italic>Trypanosoma brucei</italic></article-title><source>Science</source><volume>272</volume><fpage>1795</fpage><lpage>1797</lpage><pub-id pub-id-type="doi">10.1126/science.272.5269.1795</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nguyen</surname><given-names>MQ</given-names></name><name><surname>Zhou</surname><given-names>Z</given-names></name><name><surname>Marks</surname><given-names>CA</given-names></name><name><surname>Ryba</surname><given-names>NJP</given-names></name><name><surname>Belluscio</surname><given-names>L</given-names></name></person-group><year>2007</year><article-title>Prominent roles for odorant receptor coding sequences in allelic exclusion</article-title><source>Cell</source><volume>131</volume><fpage>1009</fpage><lpage>1017</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2007.10.050</pub-id></element-citation></ref><ref id="bib26a"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nolan</surname><given-names>DP</given-names></name><name><surname>Geuskens</surname><given-names>M</given-names></name><name><surname>Pays</surname><given-names>E</given-names></name></person-group><year>1999</year><article-title>N-linked glycans containing linear poly-N-acetyllactosamine as sorting signals in endocytosis in <italic>Trypanosoma brucei</italic></article-title><source>Current Biology</source><volume>9</volume><fpage>1169</fpage><lpage>11S1</lpage><pub-id pub-id-type="doi">10.1016/S0960-9822(00)80018-4</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Overath</surname><given-names>P</given-names></name><name><surname>Czichos</surname><given-names>J</given-names></name><name><surname>Haas</surname><given-names>C</given-names></name></person-group><year>1986</year><article-title>The effect of citrate/cis-aconitate on oxidative metabolism during transformation of <italic>Trypanosoma brucei</italic></article-title><source>European Journal of Biochemistry</source><volume>160</volume><fpage>175</fpage><lpage>182</lpage><pub-id pub-id-type="doi">10.1111/j.1432-1033.1986.tb09955.x</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pays</surname><given-names>E</given-names></name><name><surname>Lips</surname><given-names>S</given-names></name><name><surname>Nolan</surname><given-names>D</given-names></name><name><surname>Vanhamme</surname><given-names>L</given-names></name><name><surname>Pérez-Morga</surname><given-names>D</given-names></name></person-group><year>2001</year><article-title>The VSG expression sites of <italic>Trypanosoma brucei</italic>: multipurpose tools for the adaptation of the parasite to mammalian hosts</article-title><source>Molecular and Biochemical Parasitology</source><volume>114</volume><fpage>1</fpage><lpage>16</lpage><pub-id pub-id-type="doi">10.1016/S0166-6851(01)00242-0</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Reuner</surname><given-names>B</given-names></name><name><surname>Vassella</surname><given-names>E</given-names></name><name><surname>Yutzy</surname><given-names>B</given-names></name><name><surname>Boshart</surname><given-names>M</given-names></name></person-group><year>1997</year><article-title>Cell density triggers slender to stumpy differentiation of <italic>Trypanosoma brucei</italic> bloodstream forms in culture</article-title><source>Molecular and Biochemical Parasitology</source><volume>90</volume><fpage>269</fpage><lpage>280</lpage><pub-id pub-id-type="doi">10.1016/S0166-6851(97)00160-6</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schwede</surname><given-names>A</given-names></name><name><surname>Jones</surname><given-names>N</given-names></name><name><surname>Engstler</surname><given-names>M</given-names></name><name><surname>Carrington</surname><given-names>M</given-names></name></person-group><year>2011</year><article-title>The VSG C-terminal domain is inaccessible to antibodies on live trypanosomes</article-title><source>Molecular and Biochemical Parasitology</source><volume>175</volume><fpage>201</fpage><lpage>204</lpage><pub-id pub-id-type="doi">10.1016/j.molbiopara.2010.11.004</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Serizawa</surname><given-names>S</given-names></name><name><surname>Miyamichi</surname><given-names>K</given-names></name><name><surname>Nakatani</surname><given-names>H</given-names></name><name><surname>Suzuki</surname><given-names>M</given-names></name><name><surname>Saito</surname><given-names>M</given-names></name><name><surname>Yoshihara</surname><given-names>Y</given-names></name><name><surname>Sakano</surname><given-names>H</given-names></name></person-group><year>2003</year><article-title>Negative feedback regulation ensures the one receptor-one olfactory neuron rule in mouse</article-title><source>Science</source><volume>302</volume><fpage>2088</fpage><lpage>2094</lpage><pub-id pub-id-type="doi">10.1126/science.1089122</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sheader</surname><given-names>K</given-names></name><name><surname>Vaughan</surname><given-names>S</given-names></name><name><surname>Minchin</surname><given-names>J</given-names></name><name><surname>Hughes</surname><given-names>K</given-names></name><name><surname>Gull</surname><given-names>K</given-names></name><name><surname>Rudenko</surname><given-names>G</given-names></name></person-group><year>2005</year><article-title>Variant surface glycoprotein RNA interference triggers a precytokinesis cell cycle arrest in African trypanosomes</article-title><source>Proceedings of the National Academy of Sciences of the United States of America</source><volume>102</volume><fpage>8716</fpage><lpage>8721</lpage><pub-id pub-id-type="doi">10.1073/pnas.0501886102</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shi</surname><given-names>H</given-names></name><name><surname>Djikeng</surname><given-names>A</given-names></name><name><surname>Mark</surname><given-names>T</given-names></name><name><surname>Wirtz</surname><given-names>E</given-names></name><name><surname>Tschudi</surname><given-names>C</given-names></name><name><surname>Ullu</surname><given-names>E</given-names></name></person-group><year>2000</year><article-title>Genetic interference in <italic>Trypanosoma brucei</italic> by heritable and inducible double-stranded RNA</article-title><source>RNA</source><volume>6</volume><fpage>1069</fpage><lpage>1076</lpage><pub-id pub-id-type="doi">10.1017/S1355838200000297</pub-id></element-citation></ref><ref id="bib33a"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smith</surname><given-names>TK</given-names></name><name><surname>Vasileva</surname><given-names>N</given-names></name><name><surname>Gluenz</surname><given-names>E</given-names></name><name><surname>Terry</surname><given-names>S</given-names></name><name><surname>Portman</surname><given-names>N</given-names></name><name><surname>Kramer</surname><given-names>S</given-names></name><name><surname>Carrington</surname><given-names>M</given-names></name><name><surname>Michaeli</surname><given-names>S</given-names></name><name><surname>Gull</surname><given-names>K</given-names></name><name><surname>Rudenko</surname><given-names>G</given-names></name></person-group><year>2009</year><article-title>Blocking variant surface glycoprotein synthesis in <italic>Trypanosoma brucei</italic> triggers a general arrest in translation initiation</article-title><source>PLoS ONE</source><volume>4</volume><fpage>e7532</fpage><pub-id pub-id-type="doi">10.1371/journal.pone.0007532</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>van Deursen</surname><given-names>FJ</given-names></name><name><surname>Shahi</surname><given-names>SK</given-names></name><name><surname>Turner</surname><given-names>CM</given-names></name><name><surname>Hartmann</surname><given-names>C</given-names></name><name><surname>Matthews</surname><given-names>KR</given-names></name><name><surname>Clayton</surname><given-names>CE</given-names></name><name><surname>Guerra-Giraldez</surname><given-names>C</given-names></name></person-group><year>2001</year><article-title>Characterisation of the growth and differentiation in vivo and in vitro of bloodstream-form <italic>Trypanosoma brucei</italic> strain TREU 927</article-title><source>Molecular and Biochemical Parasitology</source><volume>112</volume><fpage>163</fpage><lpage>171</lpage><pub-id pub-id-type="doi">10.1016/S0166-6851(00)00359-5</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vassella</surname><given-names>E</given-names></name><name><surname>Reuner</surname><given-names>B</given-names></name><name><surname>Yutzy</surname><given-names>B</given-names></name><name><surname>Boshart</surname><given-names>M</given-names></name></person-group><year>1997</year><article-title>Differentiation of African trypanosomes is controlled by a density sensing mechanism which signals cell cycle arrest via the cAMP pathway</article-title><source>Journal of Cell Science</source><volume>110</volume><fpage>2661</fpage><lpage>2671</lpage></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wirtz</surname><given-names>E</given-names></name><name><surname>Hartmann</surname><given-names>C</given-names></name><name><surname>Clayton</surname><given-names>C</given-names></name></person-group><year>1994</year><article-title>Gene expression mediated by bacteriophage T3 and T7 RNA polymerases in transgenic trypanosomes</article-title><source>Nucleic Acids Research</source><volume>22</volume><fpage>3887</fpage><lpage>3894</lpage><pub-id pub-id-type="doi">10.1093/nar/22.19.3887</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wirtz</surname><given-names>E</given-names></name><name><surname>Leal</surname><given-names>S</given-names></name><name><surname>Ochatt</surname><given-names>C</given-names></name><name><surname>Cross</surname><given-names>GA</given-names></name></person-group><year>1999</year><article-title>A tightly regulated inducible expression system for conditional gene knock-outs and dominant-negative genetics in <italic>Trypanosoma brucei</italic></article-title><source>Molecular and Biochemical Parasitology</source><volume>99</volume><fpage>89</fpage><lpage>101</lpage><pub-id pub-id-type="doi">10.1016/S0166-6851(99)00002-X</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xong</surname><given-names>HV</given-names></name><name><surname>Vanhamme</surname><given-names>L</given-names></name><name><surname>Chamekh</surname><given-names>M</given-names></name><name><surname>Chimfwembe</surname><given-names>CE</given-names></name><name><surname>Van Den Abbeele</surname><given-names>J</given-names></name><name><surname>Pays</surname><given-names>A</given-names></name><name><surname>Van Meirvenne</surname><given-names>N</given-names></name><name><surname>Hamers</surname><given-names>R</given-names></name><name><surname>De Baetselier</surname><given-names>P</given-names></name><name><surname>Pays</surname><given-names>E</given-names></name></person-group><year>1998</year><article-title>A VSG expression site-associated gene confers resistance to human serum in Trypanosoma rhodesiense</article-title><source>Cell</source><volume>95</volume><fpage>839</fpage><lpage>846</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)81706-7</pub-id></element-citation></ref></ref-list></back><sub-article article-type="article-commentary" id="SA1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.02324.017</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Ahringer</surname><given-names>Julie</given-names></name><role>Reviewing editor</role><aff><institution>University of Cambridge</institution>, <country>United Kingdom</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see <ext-link ext-link-type="uri" xlink:href="http://elifesciences.org/review-process">review process</ext-link>). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.</p></boxed-text><p>Thank you for sending your work entitled “Expression site attenuation mechanistically links antigenic variation and development in <italic>Trypanosoma brucei</italic>” for consideration at <italic>eLife</italic>. Your article has been favorably evaluated by a Senior editor, a Reviewing editor and 3 reviewers.</p><p>The Reviewing editor and the other reviewers discussed their comments before reaching this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.</p><p>We found your work very interesting, potentially revealing new insight into a central process of parasite survival in the host – the ability to switch surface antigens and evade the host immune response. This would be a valuable new view on this central process, revealing parallels with permanent monoallelic gene controls amongst gene families in mammals. However, we also agreed that there were potential problems with the work, outlined below, which we would like you to address. The two most major issues are first, whether your experimental strategy really does mimic VSG switching, and the extent to which this might causes an artefact. Second, there is concern related to the suggested trigger for VSG switching: expression of a new VSG. It was also felt that in places conclusions are over-stated or the most current literature not taken into account.</p><p>1) Since ectopic T7-based expression of <italic>VSG</italic> is non-physiological and this triggers a global reduction in transcription, it is unclear to what extent certain phenotypes actually reflect physiologically relevant processes as proposed. The authors work hard to convince the reader that the events observed are consistent with processes associated with <italic>VSG</italic> switching and with differentiation of replicative to non-replicative cells. However, these data might also be explained by over-expression of <italic>VSG121</italic> being toxic to the cells, at least in the conditions used. For example, the growth, replication and gene expression effects that are observed might be explained by the cells becoming very sick upon <italic>VSG121</italic> induction. Why this might be is unclear, but one possibility is that very high levels of mRNA for <italic>VSG121</italic>, or perhaps very high levels of two VSGs, overwhelm the transcription and translation apparatus of the cell. If this were the case, it would explain why the cells stop growing and the effects seen. The authors should comment on this.</p><p>The observed return to growth after 5 days, associated with re-expression of <italic>VSG221</italic> (in the ES), is of particular concern. Could this represent the selection for 'revertants' that suppress ectopic expression of <italic>VSG121</italic>? The authors note (in second paragraph of the Results section entitled “Expression site attenuation and growth retardation are fully reversible processes”) that 'the trypanosomes became responsive to re-introduction of tetracycline', which might suggest that permanent mutations that prevent <italic>VSG121</italic> expression have not been selected. However, the wording used is rather vague, and it is not at all clear whether this is their meaning. In addition, we are provided with no evidence to support the putative claim that <italic>VSG121</italic> can be re-induced at this stage. The authors must comment on this further: if revertants are being selected for that no longer express <italic>VSG121</italic>, it suggests significant problems with the experimental approach.</p><p>A main argument that the authors make to suggest that the <italic>VSG121</italic> expression is an accurate mimic of <italic>VSG</italic> switching and differentiation, is that they see a general decrease in transcription, consistent with a previous report by <xref ref-type="bibr" rid="bib2">Amiguet-Vercher et al. (2004)</xref>. In more recent work, using whole-genome gene expression analyses (Kabani et al, 2009, BMC Genomics; Capewell et al, 2013, PLoS ONE), there is little evidence for such global reduction in transcription: though translation decreases in short stumpy cells relative to long slender, only a very small number of genes show reduced levels of mRNA (e.g., 41 in the Capewell study). Thus, the global effects described here upon <italic>VSG121</italic> induction may not reflect the developmental change from long slender to short stumpy cells, but instead toxic effects of <italic>VSG121</italic> overexpression. Thus, the association between <italic>VSG</italic> switching and differentiation may not be warranted. The authors must discuss these data in the context of their model.</p><p>It is currently not convincing that the <italic>VSG</italic> expression site is a 'global regulator' (end of the Introduction) or 'global control module' (end of the Discussion) of antigenic variation, proliferation and development. Without studies in a fully differentiation-competent 'pleomorphic' strain, strong conclusions can't be drawn. These sections should be toned down to reflect the uncertainty.</p><p>2) The strategy used to induce 'switching' involves expression of second VSG, and the authors suggest that such double VSG expression is the trigger for switching – e.g., in the final paragraph of the Introduction “Thus, the VSG itself mediates a feedback loop that controls ... monoallelic gene expression”; “an in situ switch would involve activation of a new ES before silencing of the old one' (first paragraph of the Discussion); and the authors draw parallel with mammalian OR silencing (third paragraph of the Discussion) ”...expression of an ectopic or transgene is sufficient to mediate a feedback inhibition....”. If this is the case, the authors must explain some anomalies. First, this model predicts that two VSGs cannot be simultaneously expressed, as one will trigger suppression of another. However, double <italic>VSG</italic> expressers have been reported, and it has been shown that such double expressers are stable in vitro and in vivo, and do not impair growth: Baltz et al. (1986), Nature; and Munoz-Jordan et al. (1996), Science. How can these data be explained, in the context of the model that the authors propose? Second, the authors' model appears to suggest that expression of a second VSG begins a progressive attenuation of the ES from the telomere, allowing the cells to 'probe for ES functionality'. However, how can this actually happen, since in the normal context a second VSG can only be expressed in conjunction with the upstream <italic>ESAGs</italic>, since they share a common promoter in the ES? In other words, it seems that the only circumstances in which <italic>ESAG</italic>s are not co-expressed with the <italic>VSG</italic> is when an ES is activated that lacks these genes; if this is the case, it is only in these circumstances that G1 dormancy and reversible differentiation occurs (these are induced by LOSS of some ESAGs, as shown by this work). If a new <italic>VSG</italic> is expressed from an ES with a full complement of <italic>ESAGs</italic>, these phenotypes would not be seen, further suggesting that they are an artefact of ectopic <italic>VSG121</italic> expression from outside an ES.</p><p>3) Expression site transcription may control developmental competence via at least three genes co-transcribed with the VSG but it's difficult to see how each gene knockdown acts redundantly to bring about this effect. Could the authors say more about the putative functions of these <italic>ESAGs</italic> relative to those not linked to this phenotype? Is a SIF signal thought to downregulate these ESAGs and in-turn render the cells more competent for differentiation or is <italic>ESAG</italic> downregulation thought to bypasses SIF signalling?</p><p>4) The ESAG sensing model states that <italic>ESAGs 1, 2</italic> and to some extent <italic>8</italic> are important while the other <italic>ESAGs</italic> are not. However, <italic>ESAG 5</italic>, present in all known ES was not tested. The data would be strengthened if ESAG5 RNAi was included.</p><p>5) The authors’ results quantitating transcripts using hybridisation of dot-blots or Northern blots rather than by qPCR was not completely convincing. In the first Results section the authors say “It is immediately apparent that mRNAs.. decreased faster...” These quantifications should ideally be repeated using qRT-PCR<italic>. ESAG1</italic> and <italic>ESAG2</italic> are members of very large gene families, which contain copies outside of ESs, also transcribed by Pol II. Using qPCR, the authors could design primers specific for the <italic>ESAG</italic> copies present in the <italic>VSG221</italic> ES (and not detect non-ES derived <italic>ESAG</italic>s).</p><p>[Editors' note: further clarifications were requested prior to acceptance, as described below.]</p><p>1) One point in particular remains unclear, which is an important issue: the authors say that “it is certainly possible to express two <italic>VSG</italic> ES at the same time, albeit not for long and not at the same level” and then that “cells must adapt to the production of the two VSGs in order to survive. They do this by balancing their expression levels – exactly as our model would predict”. This seems contradictory. Would the model not predict attenuation of the downstream <italic>VSG</italic> in the experiments reported by Munoz-Jordan et al. (1996)?</p><p>2) In the absence of knowing the functions of <italic>ESAGs 1, 2</italic> and <italic>8</italic>, the evidence that <italic>ESAGs1, 2</italic> and <italic>8</italic> serve as signals for ES attenuation still a bit speculative. I think that the Abstract should read that these “appear to serve” or “could serve” as a signal for ES attenuation.</p></body></sub-article><sub-article article-type="reply" id="SA2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.02324.018</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p><italic>1) Since ectopic T7-based expression of</italic> VSG <italic>is non-physiological and this triggers a global reduction in transcription, it is unclear to what extent certain phenotypes actually reflect physiologically relevant processes as proposed. The authors work hard to convince the reader that the events observed are consistent with processes associated with VSG switching and with differentiation of replicative to non-replicative cells. However, these data might also be explained by over-expression of</italic> VSG121 <italic>being toxic to the cells, at least in the conditions used. For example, the growth, replication and gene expression effects that are observed might be explained by the cells becoming very sick upon</italic> VSG121 <italic>induction. Why this might be is unclear, but one possibility is that very high levels of mRNA for</italic> VSG121<italic>, or perhaps very high levels of two VSGs, overwhelm the transcription and translation apparatus of the cell. If this were the case, it would explain why the cells stop growing and the effects seen. The authors should comment on this</italic>.</p><p>A) The overexpression of <italic>VSG</italic> per se is non-toxic. In <italic>DOT1B</italic> knockout cells, tetracycline-induced <italic>VSG121</italic> expression occurs with identical kinetics and to the same level as in wild type cells (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). Importantly, in these mutant cells, no growth phenotype or any transcriptional shutdown occurs (<xref ref-type="fig" rid="fig4">Figure 4</xref>). This means that the surplus <italic>VSG</italic> mRNA or VSG protein does not overwhelm the transcription or translation apparatus of the cells. Thus, the highly specific growth and gene expression phenotype observed in wild type cells is a consequence of expression site attenuation, which does not occur in the <italic>DOT1B</italic> knockout cells.</p><p>B) As a control, we have overexpressed a GFP transgene to similarly high levels. This was indeed toxic to the trypanosomes. The cells started to die within 24 hours and revealed grossly abnormal morphologies. Thus, the GFP overexpressors behaved fundamentally different from trypanosomes after induction of ectopic <italic>VSG</italic> expression.</p><p>C) The T7-based gene expression system was intentionally preferred over a polymerase I-based expression system to minimize interference with the endogenous transcription machinery.</p><p><italic>The observed return to growth after 5 days, associated with re-expression of</italic> VSG221 <italic>(in the ES), is of particular concern. Could this represent the selection for 'revertants' that suppress ectopic expression of</italic> VSG121<italic>?</italic></p><p>We cannot formally exclude that spontaneous mutations are responsible for the reproducible suppression of ectopic <italic>VSG121</italic> expression. However, this possibility is extremely unlikely as several new experiments suggest that an epigenetic mechanism causes <italic>VSG121</italic> silencing 5 days after induction:</p><p>A) We have now induced <italic>VSG121</italic> expression in a population for 72h followed by limiting dilution to 1 cell/ml and cloning on a 96-well plate. A non-induced culture was diluted and cloned in the same way and served as a control. Seven days later, 18 and 14 clones were isolated from the induced and non-induced population, respectively. By protein dot blot we found that <italic>VSG221</italic> expression was fully restored in all clones. It is extremely unlikely that 18 independent mutation events have by chance and at the same time ‘decommissioned’ the T7 expression system. Therefore, we assume that an epigenetic mechanism is responsible for full re-activation of the attenuated ES and silencing of the ectopic <italic>VSG121</italic> copy.</p><p>B) We analysed <italic>VSG</italic> expression at single cell resolution using immunofluorescence analysis (<xref ref-type="fig" rid="fig1s1">Figure 1–figure supplement 1</xref>). All cells in the population were cell surface-positive for <italic>VSG121</italic> within 24 hours after tetracycline induction. This excludes that the return to growth was due to the presence of non-inducible cells in the original population.</p><p>C) Furthermore, we have expressed the <italic>VSG121</italic> gene using a constitutive T7 promoter, i.e., in the absence of tetracycline. All resulting clonal populations revealed reduced levels of ectopic <italic>VSG121</italic> expression, comparable to inducible <italic>VSG121</italic>-expressors after ES-re-activation (after 5 days). Importantly, in those cell lines the tetracycline system was still fully functional, as shown by tetracycline induction of an unrelated transgene. These observations strongly argue against selection of revertants that prevent <italic>VSG121</italic> expression by interfering with the T7-system.</p><p>D) Within 5 days the attenuated ES-linked <italic>VSG221</italic> is gradually de-repressed and we suggest that it is the increasing amount of reappearing <italic>VSG221</italic> that decreases the levels of the ectopic <italic>VSG121</italic>. Once the <italic>VSG221</italic> ES has been fully re-activated, the ribosomal spacer copy of <italic>VSG121</italic> has been silenced to pre-induction levels (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). However, in the <italic>DOT1B</italic> knockout cells no suppression of the ectopic copy is observed, even after 10 days of induction (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). This suggests that depletion of <italic>DOT1B</italic> interferes with an epigenetic silencing mechanism. Similar effects were observed when the in situ switching kinetics was monitored in a <italic>DOT1B-</italic>depleted strain (<xref ref-type="bibr" rid="bib14">Figueiredo et al. 2008</xref>).</p><p><italic>The authors note (in second paragraph of the Results section entitled “Expression site attenuation and growth retardation are fully reversible processes”) that 'the trypanosomes became responsive to re-introduction of tetracycline', which might suggest that permanent mutations that prevent</italic> VSG121 <italic>expression have not been selected. However, the wording used is rather vague, and it is not at all clear whether this is their meaning. In addition, we are provided with no evidence to support the putative claim that</italic> VSG121 <italic>can be re-induced at this stage</italic>.</p><p>We apologize for this lack of clarity. The observations are now detailed in the text. In fact, re-induction works to the same degree as in non-induced parasites in more than 20 % of the population. The other part revealed different degrees of VSG-induction, which is compatible with gradual reversion of epigenetic silencing, rather than outgrowth of a mutant.</p><p><italic>The authors must comment on this further: if revertants are being selected for that no longer express</italic> VSG121<italic>, it suggests significant problems with the experimental approach</italic>.</p><p>The above line of evidence makes it very unlikely that random mutation events are responsible for the decrease of <italic>VSG121</italic> expression.</p><p><italic>A main argument that the authors make to suggest that the</italic> VSG121 <italic>expression is an accurate mimic of VSG switching and differentiation, is that they see a general decrease in transcription, consistent with a previous report by</italic> <xref ref-type="bibr" rid="bib2"><italic>Amiguet-Vercher et al. (2004)</italic></xref><italic>. In more recent work, using whole-genome gene expression analyses (Kabani et al, 2009, BMC Genomics; Capewell et al, 2013, PLoSONE), there is little evidence for such global reduction in transcription: though translation decreases in short stumpy cells relative to long slender, only a very small number of genes show reduced levels of mRNA (e.g., 41 in the Capewell study). Thus, the global effects described here upon</italic> VSG121 <italic>induction may not reflect the developmental change from long slender to short stumpy cells, but instead toxic effects of</italic> VSG121 <italic>overexpression. Thus, the association between VSG switching and differentiation may not be warranted. The authors must discuss these data in the context of their model</italic>.</p><p>A) As done by Amiguet-Vercher et al. we analysed the global RNA synthesis rate at single cell resolution by incorporation of BrUTP into nascent transcripts.</p><p>B) Kabani et al. and Capewell et al. analysed the mRNA expression profiles of the developmental stages using microarray and digital SAGE approaches, respectively. These techniques involve normalisation to the total RNA input in each sample throughout the analysis, as they aim to identify differentially regulated mRNAs. Thus, these publications contain no information on the overall transcriptional activity or the amount of total RNA in the cells – lower global transcriptional activity or reduced overall RNA amounts would not be detected.</p><p><italic>It is currently not convincing that the</italic> VSG <italic>expression site is a 'global regulator' (end of the Introduction) or 'global control module' (end of the Discussion) of antigenic variation, proliferation and development. Without studies in a fully differentiation-competent 'pleomorphic' strain, strong conclusions can't be drawn. These sections should be toned down to reflect the uncertainty</italic>.</p><p>Our observations are indeed based on experiments with monomorphic cells. The fact that developmental competence can be triggered in a strain that is supposed to be partly refractory to developmental progression is mechanistically intriguing. However, we agree that our conclusions would be strengthened by experiments with pleomorphic cells.</p><p>Therefore, we have now done the same overexpression in a pleomorphic cell line. Tetracycline-induced expression of a second VSG in fact leads to growth attenuation and the formation of stumpy forms. We have not included these experiments in the present manuscript as they are in part still ongoing and will be published elsewhere. However, we now mention the result in the Discussion.</p><p><italic>2) The strategy used to induce 'switching' involves expression of second VSG, and the authors suggest that such double VSG expression is the trigger for switching – e.g., in the final paragraph of the Introduction “Thus, the VSG itself mediates a feedback loop that controls ... monoallelic gene expression”; “an in situ switch would involve activation of a new ES before silencing of the old one' (first paragraph of the Discussion); and the authors draw parallel with mammalian OR silencing (third paragraph of the Discussion) ”...expression of an ectopic or transgene is sufficient to mediate a feedback inhibition....”. If this is the case, the authors must explain some anomalies. First, this model predicts that two VSGs cannot be simultaneously expressed, as one will trigger suppression of another. However, double</italic> VSG <italic>expressers have been reported, and it has been shown that such double expressers are stable in vitro and in vivo, and do not impair growth: Baltz et al. (1986), Nature; and Munoz-Jordan et al. (1996), Science. How can these data be explained, in the context of the model that the authors propose?</italic></p><p>A) Baltz et al. (1986) describe an observation in <italic>T. equiperdum</italic>, a species that has lost the insect life cycle stage. The report does not include any information on the quantities with which both VSGs are co-expressed. In our model, we simulate a situation in which a second <italic>VSG</italic> ES becomes fully transcriptionally active, resulting in the peak expression of two VSGs at wild type levels. This initial and transient spike in VSG production then quickly triggers a feedback loop that attenuates the active ES. Thus, it is certainly possible to express two <italic>VSG</italic> ES at the same time, albeit not for long and not at the same level. Importantly, Figueiredo et al. (2008) showed that trypanosomes lacking the histone methyltransferase <italic>DOT1B</italic> transcribe two ES simultaneously for up to 40 days. However, at no time were both ES 100 % active. Thus, a situation in which a second ES shows 20 % activity whilst retaining expression from the old one is possible, although such a situation would not be stable in vivo under host immune pressure. This may explain the observations of Baltz et al. (1986) and is absolutely compatible with our model.</p><p>B) Munoz-Jordan et al. (1996) generated VSG double-expressors by inserting a second <italic>VSG</italic> into the actively transcribed ES, just upstream of the endogenous <italic>VSG</italic> gene. We have repeated these experiments and carefully quantified the <italic>VSG</italic> levels in several VSG double-expressors and found that both <italic>VSGs</italic> are expressed at a 50/50 ratio, not exceeding a total VSG amount of 100 % when compared to wild type cells. The production of such double-expressor cell lines requires antibiotic selection for 7 days after transfection. During this period the cells must adapt to the production of the two <italic>VSGs</italic> in order to survive. They do this by balancing their expression levels – exactly as our model would predict.</p><p><italic>Second, the authors' model appears to suggest that expression of a second VSG begins a progressive attenuation of the ES from the telomere, allowing the cells to 'probe for ES functionality'. However, how can this actually happen, since in the normal context a second VSG can only be expressed in conjunction with the upstream</italic> ESAGs<italic>, since they share a common promoter in the ES? In other words, it seems that the only circumstances in which</italic> ESAG<italic>s are not co-expressed with the</italic> VSG <italic>is when an ES is activated that lacks these genes; if this is the case, it is only in these circumstances that G1 dormancy and reversible differentiation occurs (these are induced by LOSS of some</italic> ESAGs<italic>, as shown by this work). If a new VSG is expressed from an ES with a full complement of</italic> ESAGs<italic>, these phenotypes would not be seen, further suggesting that they are an artefact of ectopic</italic> VSG121 <italic>expression from outside an ES</italic>.</p><p>The reviewer is absolutely right by stating that ES attenuation and cell dormancy would not occur during a ‘regular’ <italic>VSG</italic> switching event. If a new <italic>VSG</italic> ES is activated that contains a full and functional complement of <italic>ESAGs</italic>, none of those would become limiting when the old ES is attenuated. This in situ switch would rapidly be completed without any effects on cell proliferation. This is what we have defined in our model as a 'successful switch' (<xref ref-type="fig" rid="fig8">Figure 8</xref>). In contrast, if the newly activated ES does not contain a fully functional or host-compatible set of ESAGs, the trypanosomes would respond to ES attenuation with dormancy and gain of developmental competence. The parasites either adapt to the new ES (as is the case with the unusual <italic>T. b. rhodesiense</italic> SRA-containing ES; see below), they develop in the tsetse vector, or ‘simply’ reactivate the old ES. This is what we have defined as an 'unsuccessful switch' (<xref ref-type="fig" rid="fig8">Figure 8</xref>). In our experiments we simulate such an ‘unsuccessful switch’ by expressing a second <italic>VSG</italic> without any <italic>ESAGs</italic>. We discuss this in the Discussion.</p><p><italic>3) Expression site transcription may control developmental competence via at least three genes co-transcribed with the</italic> VSG <italic>but it's difficult to see how each gene knockdown acts redundantly to bring about this effect. Could the authors say more about the putative functions of these</italic> ESAGs <italic>relative to those not linked to this phenotype?</italic></p><p>Most <italic>ESAGs</italic> do not show any significant homologies to other genes present in the genome databases; so it is problematic to speculate about their functions. However, <italic>ESAG1</italic> is predicted to contain a membrane-spanning domain, as well as cytoplasmic endosomal/lysosomal sorting motifs and it apparently localises to the flagellar pocket. This suggests that <italic>ESAG1</italic> might function as a receptor protein (<xref ref-type="bibr" rid="bib28">Pays et al. 2001</xref>). Likewise, <italic>ESAG2</italic> is found in the flagellar pocket, but this protein is GPI-anchored and heavily modified with linear p-NAL glycan chains. Thus, <italic>ESAG2</italic> could function in the elaborate endosome pathway (Nolan et al. 1999). It is tempting to speculate that <italic>ESAG1</italic> and 2 act in concert, as this would explain the redundant RNAi phenotypes. In contrast, <italic>ESAG8</italic> is a nucleolar protein that is also distributed in the cytoplasm (Hoek et al. 2000) and interacts with a Puf family member (Hoek et al. 2002). This suggests that <italic>ESAG8</italic> could play a role in the regulation of mRNA stability, maybe during development. <italic>ESAG6/7</italic> form a transferrin receptor required for iron uptake and thus have a crucial function in metabolism. <italic>ESAG3</italic> contains a secretion signal peptide but apparently lacks a membrane-spanning domain and a GPI-anchor (<xref ref-type="bibr" rid="bib28">Pays et al. 2001</xref>). We now mention some potential functions in the Discussion.</p><p><italic>Is a SIF signal thought to downregulate these</italic> ESAGs <italic>and in-turn render the cells more competent for differentiation or is ESAG downregulation thought to bypasses SIF signalling?</italic></p><p>We are currently working on the question whether SIF directly induces ES silencing or actively decreases the amount of <italic>ESAG</italic> mRNA. The SIF mediated pathway certainly is the dominant differentiation pathway and involves a complex signaling cascade (Mony et al. 2013). Our results show, however, that ES silencing and concomitant <italic>ESAG</italic> depletion can indeed bypass this pathway.</p><p><italic>4) The</italic> ESAG <italic>sensing model states that</italic> ESAGs 1, 2 <italic>and to some extent</italic> 8 <italic>are important while the other</italic> ESAGs <italic>are not. However,</italic> ESAG 5<italic>, present in all known ES was not tested. The data would be strengthened if</italic> ESAG5 <italic>RNAi was included</italic>.</p><p>We had done the <italic>ESAG5</italic> RNAi, but did not observe any phenotype and hence had not include the data. We now mention the result in the Results section entitled “Signaling of expression site attenuation involves three ESAGs.”</p><p><italic>5) The authors’ results quantitating transcripts using hybridisation of dot-blots or Northern blots rather than by qPCR was not completely convincing. In the first Results section the authors say “It is immediately apparent that mRNAs.. decreased faster...” These quantifications should ideally be repeated using qRT-PCR.</italic> ESAG1 <italic>and</italic> ESAG2 <italic>are members of very large gene families, which contain copies outside of ESs, also transcribed by Pol II. Using qPCR, the authors could design primers specific for the</italic> ESAG <italic>copies present in the</italic> VSG221 <italic>ES (and not detect non-ES derived</italic> ESAGs<italic>)</italic>.</p><p>We agree that our experiments do not distinguish between ES and non-ES transcripts. As suggested by the reviewer we have now tried qPCR, however have not been able to unequivocally distinguish between the ES-encoded and non-ES mRNA species. In fact, the <italic>ESAG1</italic> and <italic>2</italic> family members display very high sequence homologies, which may explain this result.</p><p>The percentage of non-ES derived <italic>ESAG1</italic> transcripts was reported to be at most 20 % of total <italic>ESAG1</italic> mRNA (<xref ref-type="bibr" rid="bib7">Carruthers et al. 1996</xref>). This means that the vast majority of <italic>ESAG</italic> transcripts is generated by the active ES. Thus, a decrease in mRNA abundance of more than 20 % must be due to reduced transcripts from the ES. We measured a decrease of <italic>ESAG1</italic> and <italic>2</italic> mRNA of 60 % and 40 %, respectively.</p><p>Importantly, <italic>ESAG8</italic> is specific for the ES. Therefore, the <italic>ESAG8</italic> knock-down only affects the ES-linked gene.</p><p>[Editors' note: further clarifications were requested prior to acceptance, as described below.]</p><p><italic>1) One point in particular remains unclear, which is an important issue: the authors say that “it is certainly possible to express two VSG ES at the same time, albeit not for long and not at the same level” and then that “cells must adapt to the production of the two VSGs in order to survive. They do this by balancing their expression levels – exactly as our model would predict”. This seems contradictory. Would the model not predict attenuation of the downstream</italic> VSG <italic>in the experiments reported by Munoz-Jordan et al. (1996)?</italic></p><p>This is correct. We actually had done the experiment but did not mention the results. The paragraph beginning “<italic>“This model further explains the expression levels in stable VSG double-expressors…”</italic> is now included in the Discussion.</p><p><italic>2) In the absence of knowing the functions of ESAGs 1, 2 and 8, the evidence that ESAGs1, 2 and 8 serve as signals for ES attenuation still a bit speculative. I think that the Abstract should read that these “appear to serve” or “could serve” as a signal for ES attenuation</italic>.</p><p>We have changed the Abstract accordingly.</p></body></sub-article></article> |