Permalink
Cannot retrieve contributors at this time
Fetching contributors…
| <?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d1 20130915//EN" "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1d1" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="hwp">eLife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">03949</article-id><article-id pub-id-type="doi">10.7554/eLife.03949</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research article</subject></subj-group><subj-group subj-group-type="heading"><subject>Biophysics and structural biology</subject></subj-group><subj-group subj-group-type="heading"><subject>Cell biology</subject></subj-group></article-categories><title-group><article-title>Reconstitution of self-organizing protein gradients as spatial cues in cell-free systems</article-title></title-group><contrib-group><contrib contrib-type="author" corresp="yes" id="author-16237"><name><surname>Zieske</surname><given-names>Katja</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="corresp" rid="cor1">*</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-1823"><name><surname>Schwille</surname><given-names>Petra</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="corresp" rid="cor2">*</xref><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><institution content-type="dept">Department of Cellular and Molecular Biophysics</institution>, <institution>Max Planck Institute of Biochemistry</institution>, <addr-line><named-content content-type="city">Martinsried, Munich</named-content></addr-line>, <country>Germany</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Balasubramanian</surname><given-names>Mohan</given-names></name><role>Reviewing editor</role><aff><institution>University of Warwick</institution>, <country>United Kingdom</country></aff></contrib></contrib-group><author-notes><corresp id="cor1"><label>*</label>For correspondence: <email>zieske@biochem.mpg.de</email> (KZ);</corresp><corresp id="cor2"><label>*</label>For correspondence: <email>schwille@biochem.mpg.de</email> (PS)</corresp></author-notes><pub-date date-type="pub" publication-format="electronic"><day>01</day><month>10</month><year>2014</year></pub-date><pub-date pub-type="collection"><year>2014</year></pub-date><volume>3</volume><elocation-id>e03949</elocation-id><history><date date-type="received"><day>10</day><month>07</month><year>2014</year></date><date date-type="accepted"><day>30</day><month>09</month><year>2014</year></date></history><permissions><copyright-statement>© 2014, Zieske and Schwille</copyright-statement><copyright-year>2014</copyright-year><copyright-holder>Zieske and Schwille</copyright-holder><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife03949.pdf"/><abstract><object-id pub-id-type="doi">10.7554/eLife.03949.001</object-id><p>Intracellular protein gradients are significant determinants of spatial organization. However, little is known about how protein patterns are established, and how their positional information directs downstream processes. We have accomplished the reconstitution of a protein concentration gradient that directs the assembly of the cell division machinery in <italic>E.coli</italic> from the bottom-up. Reconstituting self-organized oscillations of MinCDE proteins in membrane-clad soft-polymer compartments, we demonstrate that distinct time-averaged protein concentration gradients are established. Our minimal system allows to study complex organizational principles, such as spatial control of division site placement by intracellular protein gradients, under simplified conditions. In particular, we demonstrate that FtsZ, which marks the cell division site in many bacteria, can be targeted to the middle of a cell-like compartment. Moreover, we show that compartment geometry plays a major role in Min gradient establishment, and provide evidence for a geometry-mediated mechanism to partition Min proteins during bacterial development.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.001">http://dx.doi.org/10.7554/eLife.03949.001</ext-link></p></abstract><abstract abstract-type="executive-summary"><object-id pub-id-type="doi">10.7554/eLife.03949.002</object-id><title>eLife digest</title><p>When a cell divides, it is important that its contents are separated in the right place to make sure that both daughter cells have everything that they need to survive. To do this, the molecular ‘machinery’ that physically divides the cell needs to know where to assemble.</p><p>In the bacterium <italic>E. coli</italic>, the location of cell division depends on a group of proteins called the Min proteins. These proteins are not evenly distributed over the cell. Instead, they oscillate back and forth to set up concentration gradients, with the concentration of Min proteins being lowest in the middle of the cell and highest at the ends. The machinery that divides the cell assembles at the point where the concentration of Min proteins is lowest. However, it is not clear exactly how the protein gradients are set up in the cell, and whether these gradients are indeed sufficient to position the cell division machinery.</p><p>To explore this process, Zieske et al. engineered artificial cells that mimicked some of the basic properties of living cells. In these artificial cells, the Min proteins organized themselves into gradients that were similar to those found in living cells. This gradient then caused another protein called FtsZ—which is involved in cell division—to accumulate in the middle of the artificial cell. Zieske et al. also showed that the shape of the artificial cell influenced the shape of the protein gradient.</p><p>This research shows that the interplay between the shape of a bacterial cell and a defined set of proteins could control the position of cell division. The simplified system that Zieske et al. have developed could also be used to study other aspects of cell organization and cell division.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.002">http://dx.doi.org/10.7554/eLife.03949.002</ext-link></p></abstract><kwd-group kwd-group-type="author-keywords"><title>Author keywords</title><kwd>protein gradient</kwd><kwd>FtsZ</kwd><kwd>cytoskeleton</kwd><kwd>cell division</kwd><kwd>cell-free reconstitution</kwd><kwd>min proteins</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>E. coli</italic></kwd></kwd-group><funding-group><award-group id="par-1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100001659</institution-id><institution>Deutsche Forschungsgemeinschaft</institution></institution-wrap></funding-source><award-id>Collaborative Research Centre 1032</award-id><principal-award-recipient><name><surname>Schwille</surname><given-names>Petra</given-names></name></principal-award-recipient></award-group><funding-statement>The funder had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name><meta-value>2</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>A minimal cell-like system with defined geometry has been used to investigate the establishment and spatial control of a protein gradient that positions the bacterial cell division machinery.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Intracellular concentration gradients of proteins in micrometer-sized cells have long been thought to be unsustainable due to diffusion. However, the past decade revealed the existence of multiple intracellular gradients in eukaryotes and prokaryotes and their significance in providing positional information within the cellular compartment (<xref ref-type="bibr" rid="bib21">Kiekebusch and Thanbichler, 2014</xref>). Although these protein gradients are now emerging as significant general motifs to spatially organize cells, little is known about how protein patterns are established by local unmixing, and maintained on a molecular level. What are the ultimate cues and mechanisms to localize gradient forming proteins? Are protein gradients modulated by boundary conditions of the cell and how are downstream proteins directed by the positional information of protein gradients?</p><p>Cellular reconstitution methods enable us to study biological processes under defined conditions, and have significantly contributed to our understanding of molecular interactions and kinetics of proteins in simplified environments. To systematically investigate the mutual dependence between biochemical networks and three-dimensional cellular organization several techniques to confine proteins in micro compartments have recently been devised. One approach to achieve three-dimensional confinement of proteins and cytoplasmic extracts is by their encapsulation in water-oil droplets or vesicles. (<xref ref-type="bibr" rid="bib35">Pinot et al., 2009</xref>, <xref ref-type="bibr" rid="bib36">2012</xref>; <xref ref-type="bibr" rid="bib14">Good et al., 2013</xref>; <xref ref-type="bibr" rid="bib16">Hazel et al., 2013</xref>) These systems add tremendously to our understanding of how a constrained reaction space, and varying surface-to-volume ratios affect (bio) chemical reactions. Applying subtle mechanical forces to these systems, they may be also deformed into non-spherical shapes. However, if more complex geometries need to be realized, or if the compartments need to be mechanically stabilized, biochemical systems may also be reconstituted on and in spatially tailored microfabricated environments (<xref ref-type="bibr" rid="bib13">Garner et al., 2007</xref>; <xref ref-type="bibr" rid="bib22">Laan et al., 2012</xref>). In particular, combinations of two- and three-dimensionally engineered substrates with lipid membranes have been applied to study the role of simple membrane geometries on membrane interacting protein networks in vitro (<xref ref-type="bibr" rid="bib41">Schweizer et al., 2012</xref>; <xref ref-type="bibr" rid="bib50">Zieske and Schwille, 2013</xref>). However, although such in vitro experiments are now being successfully applied to identify the minimal components and interactions of protein networks, we are still far from understanding the mutual interdependence of protein functionalities and physical parameters in generating nonhomogeneous protein distributions for providing positional information within the cellular compartment. Therefore, further development of bottom-up approaches are required to tackle the minimal requirements for nonhomogeneous protein localization. Studying gradient formation in a simplified and controlled environment, detached from the complexity of living cells, should shed light on the role of individual biochemical and physical parameters for regulated protein localization in space and time.</p><p>Among the most fundamental and significant gradients in cells are those that set the spatial cues for cytokinesis. In many bacteria, and also in eukaryotes that undergo symmetric division, protein gradients with the lowest concentration in the middle of the cell and the highest concentration at the cell poles have been identified. These gradients target the division site through polar inhibition of the division machinery assembly. For instance, in fission yeast, a Pom1 gradient regulates the onset of mitosis (<xref ref-type="bibr" rid="bib4">Celton-Morizur et al., 2006</xref>; <xref ref-type="bibr" rid="bib32">Padte et al., 2006</xref>; <xref ref-type="bibr" rid="bib28">Martin and Berthelot-Grosjean, 2009</xref>; <xref ref-type="bibr" rid="bib30">Moseley et al., 2009</xref>). Similarly, in many bacteria, the assembly of the conserved ring-forming cell division protein FtsZ is inhibited at the cell poles by protein gradients of FtsZ inhibitors. In <italic>Caulobacter crescentus</italic>, a gradient of the cytokinesis inhibiting protein MipZ is established, (<xref ref-type="bibr" rid="bib46">Thanbichler and Shapiro, 2006</xref>) whereas in <italic>Bacillus subtilis</italic>, an inhibitory complex of MinC and MinD is attached to the cell poles by MinJ and DivIVA. (<xref ref-type="bibr" rid="bib10">Edwards and Errington, 1997</xref>; <xref ref-type="bibr" rid="bib3">Bramkamp et al., 2008</xref>; <xref ref-type="bibr" rid="bib34">Patrick and Kearns, 2008</xref>) Comparably, <italic>Escherichia coli</italic> employs the membrane-targeted MinC/MinD complex to inhibit FtsZ assembly at the cell poles. (<xref ref-type="bibr" rid="bib26">Lutkenhaus, 2007</xref>) Interestingly however, MinC and MinD in <italic>E.coli</italic> do not form a static gradient, but the Min protein patterns oscillate from pole to pole. (<xref ref-type="bibr" rid="bib39">Raskin and de Boer, 1999b</xref>; <xref ref-type="bibr" rid="bib38">Raskin and de Boer, 1999a</xref>) These dynamic oscillations require ATP as an energy source for the ATPase MinD and MinE, which accelerates hydrolysis of ATP by MinD. (<xref ref-type="bibr" rid="bib8">de Boer et al., 1991</xref>; <xref ref-type="bibr" rid="bib19">Hu and Lutkenhaus, 2001</xref>) On time-average, the oscillations result in an effective concentration gradient of the MinC/MinD complex.</p><p>While MinD and MinE have been identified as a minimal set of proteins that is able to self-organize into dynamic pattern on flat supported membranes, (<xref ref-type="bibr" rid="bib25">Loose et al., 2008</xref>) the minimal requirements for gradient formation, and the mechanisms of forwarding positional information to downstream processes are still controversial and only begun to be elucidated. Labeling MinE and co-reconstituting MinE with MinD in cell-shaped compartments, we demonstrated that pole-to-pole oscillations of the Min system can be reconstituted in vitro (<xref ref-type="bibr" rid="bib50">Zieske and Schwille, 2013</xref>). However, time-averaged Min protein gradients in vitro have not been reported to date and thus, direct evidence for the establishment of steady protein gradients by self-organizing oscillations of MinD and MinE without additional proteins is still missing.</p><p>Moreover, it is still ambiguous how cell geometry affects gradient formation. On the one hand, live cell experiments with cell shape mutants, as well as in vitro reconstitutions, have shown that compartment geometry affects pattern formation of the Min proteins (<xref ref-type="bibr" rid="bib6">Corbin et al., 2002</xref>; <xref ref-type="bibr" rid="bib47">Varma et al., 2008</xref>; <xref ref-type="bibr" rid="bib39">Raskin and de Boer, 1999b</xref>; <xref ref-type="bibr" rid="bib50">Zieske and Schwille, 2013</xref>). On the other hand, protein gradients should be robust against morphological changes during cell development and growth. Living bacteria typically double their length during one live cycle and gradually constrict during cell division. Thus, they undergo significant changes in cell geometry, which should not disturb the establishment and functional role of Min protein gradients. Whether cell shape affects pattern formation only if the geometry of a cell is artificially perturbed, or whether a cell might use its own geometry as a readout and control parameter to shape protein gradients, still has to be determined. Thus, the identification of principal cues for gradient establishment, and their modification by spatial parameters, such as the three-dimensional geometry of a cell, remains an outstanding challenge.</p><p>In this study, we were able to establish, from a system of soluble and initially well-mixed proteins, an effective steady protein concentration gradient, potent of targeting the assembly of cell division proteins to the middle of artificial membrane-clad compartments. In particular, FtsZ, which marks the cell division site and represents the cytoskeletal backbone for the divisome machinery in many bacteria, can be targeted to the middle of a cell-like compartment by a gradient of Min proteins. Moreover, we demonstrate that orientation and partitioning of Min protein gradients is controlled by compartment geometry. Notably, our synthetic system opens a new way to study complex organization principles in a simplified environment and provides novel insights into the basic biophysical and biochemical requirements for gradient formation.</p></sec><sec id="s2" sec-type="results"><title>Results</title><sec id="s2-1"><title>Reconstitution of protein gradients in cell-shaped compartments</title><p>To determine the minimal requirements for gradient formation, we investigated the spatially self-organizing Min system as a prototype for gradient formation in a synthetic environment (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). We first enclosed purified MinD and MinE proteins from the bacterium <italic>E. coli</italic> and ATP in membrane clad soft polymer compartments of picoliter sample volume and cell-shaped geometry (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref>, <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). Consistent with previous results and live-cell studies, MinE and MinD dynamically oscillate from pole-to-pole. Previous controls with purified Min proteins on flat bilayers and the non-hydrolysable ATP analog ATPγS confirmed that the dynamic protein patterns were thereby powered by ATP (<xref ref-type="bibr" rid="bib25">Loose et al., 2008</xref>).<fig-group><fig id="fig1" position="float"><object-id pub-id-type="doi">10.7554/eLife.03949.003</object-id><label>Figure 1.</label><caption><title>Protein gradients self-organize in soft-polymer containers.</title><p>(<bold>A</bold>) Experimental setup. Purified proteins of the MinC/D/E system were reconstituted in membrane-clad soft-polymer compartments and imaged by confocal microscopy. Profiles and electron micrographs of the compartments are shown in <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref> and a more detailed description of the assay to reconstitute Min protein oscillations is presented in <xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>. <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref> demonstrates how the intensity profiles of MinD and MinE along the length axis of the compartments are modulated with time. To mimic a bacterial membrane we used <italic>E. coli</italic> polar lipids to generate supported lipid membranes. A more detailed description of how lipid composition influences pattern formation of Min proteins is presented in <xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4</xref>. (<bold>B</bold>) In cell-shaped compartments, eGFP-MinC (yellow) follows the oscillations of MinD and MinE (red). Comparable results were obtained in more than a hundred soft-polymer compartments. Confocal time-lapse images with the image plane at the bottom of the compartment. Protein concentrations: 1 µM MinD, 0.9 µM MinE, 0.1 µM MinE.Atto655 (red), 0.05 µM eGFP-MinC (yellow). Time between individual frames: 30 s. Scale bar: 5 µm. (<bold>C</bold>) The time-averaged concentration profile of MinC along the long axis of a compartment has a distinct concentration minimum in the middle of the compartment. The time averaged distribution of protein concentrations was calculated by acquiring time-lapse-images with the focal plane at the middle of the compartment and averaging the intensity of the acquired frames. (<bold>D</bold>) Time-averaged fluorescent signal of eGFP-MinD with image plane in the middle of a compartment. An intensity offset is subtracted to better visualize the gradient along the boundary of the compartment. 0.9 µM MinD, 0.1 µM eGFP-MinD, 1 µM MinE. Scale bar: 5 µm. Stable pole-to-pole oscillations which result in the time-averaged gradient of MinD are severely affected if the membrane targeting sequence of MinE is deleted (<xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.003">http://dx.doi.org/10.7554/eLife.03949.003</ext-link></p></caption><graphic xlink:href="elife03949f001"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.004</object-id><label>Figure 1—figure supplement 1.</label><caption><title>Micro compartments in a soft-polymer chip.</title><p>(<bold>A</bold>) Scanning electron micrographs of a multi-compartment PDMS chip. Arrays of compartments with different geometries, for example, different lengths, provide the possibility to study geometry dependent effects of protein self-organization on one chip. Each compartment serves as reaction container to reconstitute protein networks. Scale bar: 20 µm. (Note that the scale bars in the electron micrographs only applies to the x-direction of the picture. The sample was tilted in the other direction to create the three-dimensional impression of electron micrographs.) (<bold>B</bold>) Same sample as descibed in (<bold>A</bold>), with higher magnification. Scale bar: 1 µm. (<bold>C</bold>) Confocal x/z-scan of a membrane clad compartments with a flat bottom (left) vs a more tapered compartment (right). The membrane was labeled with DiI to visualize the profile of the membrane compartments. The width of the compartments is about 10 µm at the upper region. Small variations in the corresponding shapes of the compartments occurred during the fabrication process, but still supported oscillations and gradient formation of the Min proteins. (<bold>D</bold>) Confocal images of FtsZ-mts in compartments with a flat bottom (left) and in a more tapered compartment. Scale bar: 5 µm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.004">http://dx.doi.org/10.7554/eLife.03949.004</ext-link></p></caption><graphic xlink:href="elife03949fs001"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.005</object-id><label>Figure 1—figure supplement 2.</label><caption><title>Experimental setup.</title><p>(<bold>A</bold>) A thick layer of PDMS was poured on top of a wafer with about 10 µm high resist microstructures. Glass cover slips were manually pressed in the liquid PDMS, such that an about 30 µm thin layer of PDMS remained below the glass surface and a thick layer of PDMS covered the glass surface on top. After curing the PDMS at 80°C the thick layer of PDMS on top was peeled off. Then the glass cover slip with the thin, micro structured layer of PDMS attached was peeled off together with the help of a razor blade. (<bold>B</bold>) After cleaning and plasma treading, a plastic ring was glued on top of the PDMS microstructures. Supported lipid membranes, which adapt to the topography of the underlying PDMS support, were produced using a vesicle fusion technique. Then proteins, ATP and/or GTP (depending on experiment) of defined concentration were added to a buffer volume of 200 µl on top of the supported lipid membranes. At this step of the protocol dynamic Min patterns formed on top of the membrane. These patterns did not oscillate but formed travelling waves. A Confocal image of Min waves on the upper level of the membrane support is shown in (<bold>C</bold>). Yellow: eGFP-MinD, red: MinE.Atto655. (<bold>D</bold>) Subsequently the buffer reservoir was manually reduced using a pipette, such that the buffer remained only in the micro fabricated chambers. Due to the confinement in small sample volumes with cell shaped geometry, the Min protein patterns oscillated within these chambers. The top of the chambers was open with a buffer/air interface. To limit evaporation of the buffer a lid was placed on top of the plastic ring. The upper level of the PDMS supports (outside of the compartments) was dry and residual biomolecules, such as remaining lipids and Min proteins were immobile, as determined by FRAP experiments.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.005">http://dx.doi.org/10.7554/eLife.03949.005</ext-link></p></caption><graphic xlink:href="elife03949fs002"/></fig><fig id="fig1s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.006</object-id><label>Figure 1—figure supplement 3.</label><caption><title>Protein gradients in vitro are established by dynamic redistribution of proteins.</title><p>(<bold>A</bold>–<bold>D</bold>) Concentration profiles of MinD along the length axis of a cell-shaped container were measured in intervals of 5 s. The whole oscillation cycle takes about 1 min. (<bold>A</bold>) Initially MinD forms a cap at the left pole of the compartment (light blue). Then the concentration of the MinD at the left pol decreases whereas it increases at the opposite pole. (<bold>B</bold>) The trail of the MinD zone at the right pol moves towards the right pole. (<bold>C</bold>) The concentration of MinD at the right pol decreases whereas it increases at the left pole. (<bold>D</bold>) The trail of the MinD cap at the left pole moves towards the left pole. (<bold>E</bold>) MinD (black) and MinE (red) concentration profiles during an oscillation from the left to the right pole. Dotted line: reference line to better visualize the movement of the MinE peak and MinD tail to the right pole.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.006">http://dx.doi.org/10.7554/eLife.03949.006</ext-link></p></caption><graphic xlink:href="elife03949fs003"/></fig><fig id="fig1s4" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.007</object-id><label>Figure 1—figure supplement 4.</label><caption><title>Lipid composition dependent formation of protein gradients.</title><p>(<bold>A</bold>) Pattern of MinD and MinE (labeled with Atto655) on supported lipid membranes with different amounts of cardiolipin. Scale bar: 50 µm. (<bold>B</bold>) Dependence of the Min pattern wavelength on cardiolipin concentration. (<bold>C</bold>) Dependence of temporal period on cardiolipin concentration. (<bold>D</bold>) Dependence of wave velocity on cardiolipin concentration. (<bold>E</bold>) Pole-to-pole oscillations emerge both in DOPC-membranes supplemented with cardiolipin and in DOPC-membranes supplemented with PG instead. Scale bar: 5 µm, DOPC: 1, 2-dioleoyl-<italic>sn</italic>-glycero-3-phosphocholine, CA: <italic>E. coli</italic> cardiolipin, PG: <italic>E. coli</italic> L-α-phosphatidylglycerol (Avanti polar lipids, Alabaster, AL).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.007">http://dx.doi.org/10.7554/eLife.03949.007</ext-link></p></caption><graphic xlink:href="elife03949fs004"/></fig><fig id="fig1s5" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.008</object-id><label>Figure 1—figure supplement 5.</label><caption><title>Deletion of the membrane targeting sequence of MinE affects pattern formation in micro compartments.</title><p>1 µM MinD and 1 µM MinE(Δ3–8) (5% labeled with Alexa Fluor 647) were reconstituted in micro compartments. (<bold>A</bold>) Snap shots of Min protein pattern at the bottom of the compartment (upper panel) and at the walls of the compartments (lower panel focus level in the middle of the compartment). (<bold>B</bold>) Time-lapse series of Min pattern within a compartment. Scale bar: 10 µm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.008">http://dx.doi.org/10.7554/eLife.03949.008</ext-link></p></caption><graphic xlink:href="elife03949fs005"/></fig></fig-group></p><p>Compared to living cells, the temporal scale for the oscillation period is conserved in the synthetic system. However, both the compartments and the spatial scales of the protein waves are about ten times bigger as compared to living cells. Why the Min patterns in vivo are about ten times larger than in vitro is quantitatively not fully understood. Different protein ratios, ionic strength of the buffer and membrane composition have been shown to affect the spatial scales (<xref ref-type="bibr" rid="bib25">Loose et al., 2008</xref>; <xref ref-type="bibr" rid="bib48">Vecchiarelli et al., 2014</xref>). Furthermore the membrane potential (<xref ref-type="bibr" rid="bib45">Strahl and Hamoen, 2010</xref>) and molecular crowding in a living cell could influence Min protein patterns. An advantage of the larger spatial scales in vitro is the possibility to study with much greater detail how the concentration profiles of MinD and MinE, which result in the formation of MinD gradients, are modulated during an oscillation period. Following the MinD and MinE concentration profiles along the compartment length over time, we found that the dynamic profiles are characterized by the following succession of events: First, attachment and increase in concentration of MinD at one site of the compartment, then delayed attachment of MinE to MinD and increase in MinE intensity at the trail of MinD (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref>). Although the size of bacterial cells and photo bleaching is limiting for characterizing the Min profiles in vivo in such detail as it is possible in vitro, the intensity peak of MinE at the trail of the Min pattern was also observed in <italic>E. coli</italic> and is generally referred to as ‘MinE ring’. (<xref ref-type="bibr" rid="bib40">Raskin and de Boer, 1997</xref>; <xref ref-type="bibr" rid="bib12">Fu et al., 2001</xref>) After formation of the MinE peak MinD/E were disassembled from the membrane at the trail of the MinD zone, which was accompanied by assembly of a new MinD/E zone at the other pole of the compartment (<xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref>). This disassembly of Min protein patterns at the trailing zone during each oscillation is comparable to the disassembly at the trailing edge of travelling Min patterns on flat membranes. The main difference of Min proteins profiles on flat membranes and in microcompartments is that the concentration profiles on flat membranes only change their localization while traveling across the membrane. In contrast, during oscillations in compartments new membrane attached Min protein patterns need to be repeatedly established and disassembled every half oscillation period, which results in a remarkable remodelling of the concentration profiles during the oscillation cycle and an asymmetry in their rise and decay phases at the poles.</p><p>To determine the mean spatial distribution of MinD, we averaged the fluorescence signal of MinD within the cell-shaped compartments over time using confocal time-lapse movies. Remarkably, MinD formed indeed a clear nonhomogeneous concentration profile, with the lowest concentration in the middle of the compartment (<xref ref-type="fig" rid="fig1">Figure 1D</xref>). Thus, we conclude that using the Min system, the establishment of an effective protein gradient indeed requires only a lipid membrane, an appropriate reaction space, and two proteins that self-organize under the consumption of energy, in the form of ATP.</p><p>While the requirements for Min gradient formation are now understood to a point, at which these gradients can be reconstituted in vitro, less is known about the importance of the structural properties of the gradient forming proteins. Although MinD has been shown to interact with membranes in vitro and MinE interacts with MinD (<xref ref-type="bibr" rid="bib17">Hu et al., 2002</xref>), MinE also harbours a short membrane targeting sequence at its N-terminus (<xref ref-type="bibr" rid="bib33">Park et al., 2011</xref>). Mutations in the membrane targeting domain of MinE result in defects in cell division and in distinct phenotypes, such as filamentous cells or a minicelling phenotype, respectively (<xref ref-type="bibr" rid="bib33">Park et al., 2011</xref>). However how the membrane targeting of MinE contributes to a normally functioning Min system is not fully understood. To gain a deeper insight in how the membrane targeting sequence of MinE contributes to gradient formation of the Min system we purified and labelled a MinE mutant without its membrane targeting sequence (MinE without amino acids three to eight, herein referred to as MinE(Δ3–8)) and reconstituted it with MinD in microcompartments. Interestingly, MinE(Δ3–8) resulted in a severe phenotype in the bottom-up system. The Min system was still able to self-organize into dynamic pattern, but instead of a stable pole-to-pole oscillation, the Min system formed dynamic patches with irregular shape and without a constant axis of movement (<xref ref-type="fig" rid="fig1s5">Figure 1—figure supplement 5</xref>). Thus, although MinE(Δ3–8) still counteracted MinD, no stable MinD gradients were generated. Depending on the degree of affecting the membrane targeting sequence of MinE, the effective generation of a gradient and its localization along the long axis of the cell might therefore be altered to different degrees, which might account for the distinct phenotypes in vivo, such as filamentous cells or mini cells.</p><p>While the structural properties and the diffusion-reaction driven self-organization of MinD and MinE determine the non-equilibrium distribution of the Min system, a third protein, MinC, is proposed to be the actual mediator to forward positional information of the Min gradient to downstream targets. In particular, MinC is proposed to inhibit FtsZ–the cytoskeletal framework of divisome assembly (<xref ref-type="bibr" rid="bib20">Hu et al., 1999</xref>; <xref ref-type="bibr" rid="bib18">Hu and Lutkenhaus, 2000</xref>; <xref ref-type="bibr" rid="bib43">Shen and Lutkenhaus, 2009</xref>, <xref ref-type="bibr" rid="bib42">2010</xref>). To investigate the spatial distribution of eGFP-MinC in our minimal system, we co-reconstituted MinD and MinE oscillations with MinC in micro compartments. We found that eGFP-MinC oscillated from pole-to-pole by coupling to MinD/E patterns, which strongly resembles the dynamics of MinC in vivo (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). Based on time-lapse movies, we then analyzed the time-averaged distribution of eGFP-MinC and found the concentration profile of MinC also exhibit a pronounced minimum in the middle of the compartment (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). This experiment revealed that the effective non-equilibrium distribution of the complete Min system, with the highest concentration of MinC at the cell poles, is fully recapitulated,in our simple cell-free setting.</p><p>Note that the <italic>E. coli</italic> lipid extract for generating membranes in these experiments is a mixture of mainly three different lipids, (phosphatidylethanolamine [PE, neutral], phosphatidylglycerol [PG, negatively charged] and cardiolipin [CA, negatively charged]) and that the membranes have a net negative charge. Recently it has been shown that a minimal lipid bilayer for pattern Min formation on flat supports only requires two different lipids. Moreover, cardiolipin, which has previously been proposed as a structural polar cue, which might help in triggering the pole to-pole oscillations of Min proteins, was not required for Min pattern formation on planar supports. Instead, the negative charge has been suggested to play a primary role in formation of surface waves on planar membranes. (<xref ref-type="bibr" rid="bib48">Vecchiarelli et al., 2014</xref>) To address whether membrane charge and not the chemical membrane composition is also sufficient for gradient forming pole-to-pole oscillations, we established the minimal membrane composition for Min protein oscillations in our synthetic system. First, we confirmed the aforementioned results that membrane charge is a strong determinant for Min pattern formation on flat supported membranes (<xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4A–D</xref>). Then we reconstituted the Min proteins in compartments with two different minimal membrane mixtures: First, with 70% neutrally charged DOPC and 30% negatively charged cardiolipin, and then with 70% DOPC and 30% negatively charged PG. In both cases, the proteins retained their ability of pattern formation and pole-to-pole oscillations (<xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4E</xref>). Thus, we conclude that Min gradients can be established without any structural cues in the membrane. In contrast, simple physical parameters, such as electrostatic interactions between the membrane and the proteins, are strong determinants for gradient formation. For high amounts of negatively charged lipids, the length scales of the protein patterns decrease (<xref ref-type="fig" rid="fig1s4">Figure 1—figure supplement 4B</xref> and [<xref ref-type="bibr" rid="bib48">Vecchiarelli et al., 2014</xref>]). Thus, the spatial scales of the Min proteins on highly negatively charged membranes would be too small to form stable pole-to-pole oscillations in compartments, which were engineered for protein length scales on <italic>E.coli</italic> membranes. The implication that Min protein oscillations are perturbed if the membrane charge increases is in agreement with live cell studies of GFP-MinD in PE-lacking <italic>E.coli</italic> cells, which demonstrate that Min protein pattern are affected if the membrane charge is increased (<xref ref-type="bibr" rid="bib29">Mileykovskaya et al., 2003</xref>) and provides further evidence that a balanced ratio of charged and non-charged lipids is of critical importance for the live cycle of <italic>E.coli</italic>.</p></sec><sec id="s2-2"><title>Localization of downstream targets by reconstituted protein gradients</title><p>Intracellular protein gradients play a pivotal role in cellular organization through providing positional information for downstream proteins. However, although protein gradients are now emerging as general motives to organize cells, tools to study gradient-mediated organization of three-dimensional space are limited. To directly investigate whether the established Min gradient indeed provides an efficient cue to position downstream targets, we attempted the assembly and positioning of FtsZ to the middle of a synthetic compartment in a co-reconstitution assay. To keep the system as minimal as possible, we avoided the native membrane adaptors of FtsZ, FtsA and ZipA, and used a FtsZ hybrid protein, fused to YFP and a membrane targeting sequence (FtsZ-mts) (<xref ref-type="bibr" rid="bib31">Osawa et al., 2008</xref>; <xref ref-type="bibr" rid="bib2">Arumugam et al., 2014</xref>). In spite of this simplification, we found that highly FtsZ-mts enriched regions were clearly visible in the center of the compartments, while FtsZ-mts localization was strongly reduced at the polar regions (<xref ref-type="fig" rid="fig2">Figure 2</xref>). Negative controls with FtsZ-mts bundles on flat supported bilayers confirmed that all thee Min proteins are required to deplete FtsZ-mts from the membrane (<xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>) (<xref ref-type="bibr" rid="bib2">Arumugam et al., 2014</xref>). This unequivocally demonstrates that an effective time-averaged protein gradient can indeed regulate the localization of down-stream targets to predefined localizations, such as the middle of a compartment.<fig-group><fig id="fig2" position="float"><object-id pub-id-type="doi">10.7554/eLife.03949.009</object-id><label>Figure 2.</label><caption><title>Reconstituted protein gradients coordinate localization of downstream targets in cell-shaped compartments.</title><p>(<bold>A</bold>) Confocal image of the tubulin homolog FtsZ-mts on the bottom of membrane-clad compartments. FtsZ-mts assembles into bundles which are aligned perpendicular to the length axis of the compartments. Scale bar: 10 µm. (<bold>B</bold>) Images with the focal plane at the bottom, middle and top of the compartment, respectively. The buffer was not yet reduced to a level below the upper level of the chip. Therefore membrane and FtsZ-mts network are still intact on the upper level of the chip. Scale bar: 5 µm. (<bold>C</bold> and <bold>D</bold>) When the gradient forming Min system (red: MinE.Atto655) and FtsZ-mts (blue) are reconstituted together, the Min gradient coordinates the localization of FtsZ-mts to the middle of the compartments. Scale bar: 5 µm. (<bold>C</bold>) Time between frames: 20 s. Negative controls in <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref> confirm that MinD and MinE are required to form dynamic patterns and that MinC is needed in addition to deplete FtsZ-mts from the membrane. (<bold>E</bold>) Schematic image of reconstituted FtsZ-mts positioning.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.009">http://dx.doi.org/10.7554/eLife.03949.009</ext-link></p></caption><graphic xlink:href="elife03949f002"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.010</object-id><label>Figure 2—figure supplement 1.</label><caption><title>MinD MinE and ATP are required to form dynamic patterns and MinC is needed to deplete FtsZ from the membrane.</title><p>(<bold>A</bold>) Flat supported lipid membrane with reconstituted FtsZ-mts. Scale: 5 µm. (<bold>B</bold>) FtsZ-mts and MinE. Scale: 5 µm. (<bold>C</bold>) FtsZ-mts, MinE and MinD scale (overview): 20 µm, scale (zoom in): 5 µm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.010">http://dx.doi.org/10.7554/eLife.03949.010</ext-link></p></caption><graphic xlink:href="elife03949fs006"/></fig></fig-group></p><p>In contrast to the living cell, the FtsZ-mts distribution in the middle of synthetic compartments appears to be rather broad. The major reason for the wide FtsZ-mts distribution is most likely the ten times larger Min protein pattern in vitro, as compared to living cells. The wide MinC minimum allows multiple FtsZ-mts bundles to localize in a wide region in the middle of the compartment.</p><p>Note that FtsZ-mts bundles in the central region aligned perpendicular to the long axis of the compartments (<xref ref-type="fig" rid="fig2">Figure 2A,B,D</xref>). This finding is in agreement with previous results that demonstrated a preferential alignment of FtsZ-mts along negatively curved membranes on grooved glass as membrane support. (<xref ref-type="bibr" rid="bib1">Arumugam et al., 2012</xref>).</p></sec><sec id="s2-3"><title>The MinC-G10D mutant interacts with the MinD/E system, but does not inhibit FtsZ-mts at compartment poles</title><p>Positional information of the MinD gradient in vivo and in our synthetic system is mediated by the FtsZ inhibitor MinC which directly interacts with FtsZ (<xref ref-type="bibr" rid="bib20">Hu et al., 1999</xref>). MinC has a C-terminal and an N-terminal domain, (<xref ref-type="bibr" rid="bib18">Hu and Lutkenhaus, 2000</xref>; <xref ref-type="bibr" rid="bib7">Cordell et al., 2001</xref>) which are both involved in FtsZ inhibition. The C-terminal domain of MinC is responsible for binding to MinD and dimerization of MinC. Furthermore, it binds to the conserved C-terminus of FtsZ and was suggested to compete with FtsA and ZipA to inhibit FtsZ ring formation. (<xref ref-type="bibr" rid="bib18">Hu and Lutkenhaus, 2000</xref>; <xref ref-type="bibr" rid="bib43">Shen and Lutkenhaus, 2009</xref>). Note, that FtsZ-mts comprises amino acids 1–366 of <italic>E. coli</italic> FtsZ, but instead of the C-terminally conserved tail, it comprises YFP and a membrane targeting sequence. The proposed interference of the C-terminal domain with FtsZ is therefore not involved in the system described above, which suggest that the inhibitory activity of the C-terminal domain is not required in a minimal system to inhibit FtsZ at compartment poles. In the context of a living cell, the inhibitory activity of the C-terminal domain of MinC might provide an additional mechanism for disrupting FtsZ, rendering the Min system more robust.</p><p>The N-terminal domain of MinC inhibits FtsZ polymerization by binding to an alpha-helix of FtsZ at the interface of FtsZ subunits in a filament (<xref ref-type="bibr" rid="bib20">Hu et al., 1999</xref>; <xref ref-type="bibr" rid="bib42">Shen and Lutkenhaus, 2010</xref>). Since the FtsZ-binding region for the C-terminal domain of MinC is not present in FtsZ-mts, the major inhibitory activity contributing to FtsZ-inhibition in our synthetic system should originate from the N-terminal domain of MinC. To test this hypothesis, we used a MinC mutant (MinC-G10D) with lower inhibitory activity of its N-terminal domain (<xref ref-type="bibr" rid="bib20">Hu et al., 1999</xref>; <xref ref-type="bibr" rid="bib43">Shen and Lutkenhaus, 2009</xref>, <xref ref-type="bibr" rid="bib42">2010</xref>). The MinC-G10D mutant has reduced ability to inhibit FtsZ in vivo and in vitro, but interacts with MinD (<xref ref-type="bibr" rid="bib20">Hu et al., 1999</xref>). We first characterized MinC-G10D by co-reconstituting it at different concentrations with FtsZ-mts, MinD and fluorescently labeled MinE on flat supported membranes. Consistent with the behavior of wild type MinC, we found that the self-organizing Min protein patterns were unperturbed at low concentrations of MinC-G10D, and that the Min patterns were weakened by high concentrations of MinC-G10D (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). The weakening of Min patterns for high concentrations of MinC is likely due to an overlap of the binding sites for MinC and MinE on MinD (<xref ref-type="bibr" rid="bib27">Ma et al., 2004</xref>; <xref ref-type="bibr" rid="bib49">Wu et al., 2011</xref>), which might result in a competition of MinC with MinE for binding sites on MinD at large MinC concentrations. The weakening of Min Protein patterns therefore suggests that MinC-G10D binds to MinD. However, in contrast to MinC the MinC-G10D mutant was inefficient in depolymerizing FtsZ-mts on flat membranes, as well as at the poles, when co-reconstituted in microcompartments (<xref ref-type="fig" rid="fig3">Figure 3B,C</xref>, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>). These observations confirm that the inhibitory activity in the synthetic system originates from the N-terminal domain of MinC and that the inhibitory activity of the N-terminal domain is sufficient to inhibit FtsZ-polymerization at compartment poles in the context of a minimal system.<fig-group><fig id="fig3" position="float"><object-id pub-id-type="doi">10.7554/eLife.03949.011</object-id><label>Figure 3.</label><caption><title>MinC-G10D does not inhibit polymerization of FtsZ-mts.</title><p>(<bold>A</bold>–<bold>C</bold>) FtsZ-mts (blue), MinD, MinE (5% labeled with Atto655: red) were reconstituted with the MinC-G10D mutant. Concentrations of MinD, MinE and FtsZ-mts are constant for all images. (<bold>A</bold>) Confocal images of Min protein pattern (MinE.Atto655: red) on flat supported membranes at different concentrations of MinC-G10D. High concentrations of MinC-G10D disturb Min protein patterns. The contrast between images is not comparable and is increased for higher concentrations of MinC-G10D, because the MinE intensity at the membrane decreased with higher concentrations of MinC-G10D. Scale bar: 50 µm. (<bold>B</bold>) Confocal images of the Min system (MinE.Atto655:red) and FtsZ-mts (blue) on flat membranes at different concentrations of MinC-G10D demonstrate that MinC-G10D is inefficient in disturbing FtsZ-mts networks. Scale bar: 2 µm. (<bold>C</bold>, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1</xref>) In cell-shaped micro compartments with MinD, MinE, FtsZ-mts and 50 nM MinC-G10D the Min system (MinE.Atto655: red) oscillates from pole-to-pole. However MinC-G10D does not inhibit polymerization of FtsZ-mts (blue) at the compartment poles. Time between frames: 90 s, scale bar: 10 µm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.011">http://dx.doi.org/10.7554/eLife.03949.011</ext-link></p></caption><graphic xlink:href="elife03949f003"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.012</object-id><label>Figure 3—figure supplement 1.</label><caption><title>MinC-G10D does not inhibit polymerization of FtsZ-mts at compartment poles.</title><p>Confocal images of three compartments with FtsZ-mts (blue), MinD, MinE (5% labeled with Atto655: red) and 50 nM MinC-G10D in microcompartments. The FtsZ-mts bundels are not inhibited at compartment poles. Scale bar: 5 µm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.012">http://dx.doi.org/10.7554/eLife.03949.012</ext-link></p></caption><graphic xlink:href="elife03949fs007"/></fig></fig-group></p></sec><sec id="s2-4"><title>Establishment of protein gradients is dependent on compartment geometry</title><sec id="s2-4-1"><title>Gradient formation and FtsZ localization dependent on compartment length</title><p>Experiments with aberrantly shaped cells, such as round and filamentous <italic>E. coli</italic>, have shown that dynamic pattern formation depends on compartment geometry. However, the mode of pole-to-pole oscillations should be stable over a substantial variation in length. As cells grow and double their length before division, stable pole-to-pole oscillations of the Min proteins need to be established over a spatial range of at least two times the length of the daughter cells. We therefore hypothesized that stable pole-to-pole oscillations should be found in microstructures of different length, where the range should vary at least by a factor of two, if this length-dependent robustness is intrinsic to the Min system. To test this hypothesis, we reconstituted the oscillations of MinD and MinE in micro-compartments of systematically varying length from 12 µm to 245 µm and investigated the stability of Min patterns at different compartment lengths. In compartments with a constant width of 10 µm, the Min system oscillated along the long axis of the compartments (<xref ref-type="bibr" rid="bib50">Zieske and Schwille, 2013</xref>) (<xref ref-type="other" rid="video1">Video 1</xref>). We observed oscillations with multiple minima and maxima in long compartments, and found that every oscillation mode occurred at a defined range of the compartment length (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). In most of the short compartments with an aspect ratio (length to width) below 4.5, we observed pole-to-pole oscillations, in rare cases they prevailed up to aspect ratios of 5.5.<media content-type="glencoe play-in-place height-250 width-310" id="video1" mime-subtype="avi" mimetype="video" xlink:href="elife03949v001.avi"><object-id pub-id-type="doi">10.7554/eLife.03949.013</object-id><label>Video 1.</label><caption><title>Reconstituted Min protein oscillations in microcompartments of different length.</title><p>This video shows a confocal time lapse movie of reconstituted MinD/MinE pattern in cell-shaped micro-compartments. 10% MinE are labeled with Alexa 488. The movie follows the dynamics of Min protein pattern for 17 min.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.013">http://dx.doi.org/10.7554/eLife.03949.013</ext-link></p></caption></media><fig-group><fig id="fig4" position="float"><object-id pub-id-type="doi">10.7554/eLife.03949.014</object-id><label>Figure 4.</label><caption><title>Compartment length dependent protein oscillations.</title><p>(<bold>A</bold>) Experiments such as in <xref ref-type="other" rid="video1">Video 1</xref> were analyzed for the oscillation mode in the corresponding compartments and categorized as (i) oscillations with aberration from the long axis of the compartment, (ii) pole-to-pole oscillations, (iii) double oscillations, (iv) higher oscillation mode (at least triple oscillations). (<bold>B</bold>) Oscillation period of pole to pole oscillations in dependence of compartment length. Simultaneous time-lapse acquisition of Min protein patterns in multiple compartments allowed highly comparable experimental conditions. In total, 27 to 29 compartments of seven different aspect ratios (1.2, 1.5, 2.0, 2.5, 3.5, 4.5, 5.5) on the same time lapse movie were analyzed. Out of 27 compartments with an aspect ratio of 1.2, one compartment harboured oscillation that deviated from the length axis. Out of 28 compartments with an aspect ratio of 4.5 we observed 16 compartments, and out of 29 compartments with an aspect ratio of 5.5 we observed 27 compartments with double oscillations or oscillations which switched between pole-to-pole oscillations and double oscillations. All remaining compartments harboured pole-to-pole oscillations for which the mean oscillation period and standard deviation was calculated. For an aspect ratio of 5.5 the two data points are directly plotted, due to the small sample size. <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref> demonstrates that the oscillation period increases over time.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.014">http://dx.doi.org/10.7554/eLife.03949.014</ext-link></p></caption><graphic xlink:href="elife03949f004"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.015</object-id><label>Figure 4—figure supplement 1.</label><caption><title>Kymograph of MinE oscillations.</title><p>Over time the Min protein oscillations become slower. This effect is most likely due to a decrease in the buffer level originating from the evaporation of buffer. 1 µM MinE (5% labeled with Atto.655), 1 µM MinD. Scale bar: 10 µm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.015">http://dx.doi.org/10.7554/eLife.03949.015</ext-link></p></caption><graphic xlink:href="elife03949fs008"/></fig></fig-group></p><p>In particular, these experiments demonstrate that pole-to-pole oscillations are stable (i.e., no other oscillation mode occurs in those compartments) over a significant length range of 15 µm–35 µm. In other words, although the length of these cavities varies by about a factor of 2.3, the oscillatory behaviour is conserved. This result shows that no auxiliary proteins besides the MinDE protein system are required to adopt the Min wavelength to the varying length of a growing bacterium, demonstrating the power of this system as a robust spatial cue.</p><p>In the shortest of these compartments, with an aspect ratio of 1.2, we occasionally observed an aberration of the oscillation axis from the long axis (<xref ref-type="other" rid="video2">Video 2</xref>), which is indicative of a transition from stable pole to-pole oscillations to the patterns observed in round compartments and cells (<xref ref-type="bibr" rid="bib50">Zieske and Schwille, 2013</xref>). <xref ref-type="fig" rid="fig4">Figure 4A</xref> provides an overview of the oscillation modes with respect to the length-to-width ratio of the compartment.<media content-type="glencoe play-in-place height-250 width-310" id="video2" mime-subtype="avi" mimetype="video" xlink:href="elife03949v002.avi"><object-id pub-id-type="doi">10.7554/eLife.03949.016</object-id><label>Video 2.</label><caption><title>Min protein pattern in short compartments.</title><p>This movie shows confocal time-lapse movies of a MinD and MinE patterns (doped with 10% MinE.Alexa488) in 12 µm long and 10 µm wide compartments. Six time-lapse movies with compartments in which the Min patterns aberrate from a stable pole-to-pole axis are stitched together. The protein patterns are followed over a time of about 17 min.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.016">http://dx.doi.org/10.7554/eLife.03949.016</ext-link></p></caption></media></p><p>While the length dependent increase of oscillation modes was well conserved in our experiments, the oscillation period was prone to small perturbation. In particular, we observed a slight increase of the oscillation period over time, which might be a result of buffer evaporation (<xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>). Thus, oscillation periods between less than a minute and 4 min were measured. This time scale is well in agreement with measurements of 0.5–2 min for the oscillation period in living cells (<xref ref-type="bibr" rid="bib39">Raskin and de Boer, 1999b</xref>).</p><p>The strong fluctuation of oscillation periods in living cells, as well as between different samples of the synthetic system, render a systematic characterization of cell length dependent protein oscillations challenging. To overcome these problems and to better characterize the dependence on compartment length, we acquired time-lapse movies, capturing numerous compartments simultaneously. Then, we compared Min oscillations in micro compartments with different aspect ratios up to 5.5, which were acquired at the same time on the same chip. Imaging multiple compartments on the same chip allowed us to analyse Min oscillations in about 200 compartments under the same experimental conditions at the same time. We found that the oscillation period between aspect ratios of 1.5 and 5.5 increased from 79 s to about 165 s. For higher aspect ratios we only observed higher oscillation modes. For very low aspect ratios of 1.2 the mean value for the oscillation period was slightly higher than for 1.5 (<xref ref-type="fig" rid="fig4">Figure 4B</xref>). Note that in very small cells a stochastic switching of Min protein pattern between the poles have been observed (<xref ref-type="bibr" rid="bib11">Fischer-Friedrich et al., 2010</xref>) and that a longer oscillation period for very small compartments might represent a transition from normal pole-to-pole oscillation to different dynamics in very small compartments.</p><p>To address how downstream processes of the Min gradient are affected by the length dependent oscillation modes in compartments of different length, we investigated FtsZ-mts localization in these compartments. We found that higher oscillation modes resulted in multiple minima of the MinC profile and consequently in multiple distinct regions of FtsZ-mts assembly (<xref ref-type="fig" rid="fig5">Figure 5</xref>).<fig id="fig5" position="float"><object-id pub-id-type="doi">10.7554/eLife.03949.017</object-id><label>Figure 5.</label><caption><title>Compartment length affects FtsZ localization.</title><p>(<bold>A</bold>) In compartments with double oscillations of the Min system (red: MinE.Atto655), FtsZ-mts (blue) localizes to two regions along the cell length. Scale bar: 5 µm. (<bold>B</bold>) Localization of FtsZ-mts along the length axis of an artificial cell for pole-to-pole oscillations (black), double oscillations (red) and triple oscillations (blue) in comparison to expected values (dotted lines), considering the symmetries of oscillation modes of Min protein along the long axis of a compartment. For pole-to-pole oscillations in 55 µm long compartments: n = 3 (For 55 µm the majority of structures revealed double oscillations and only in a minor fraction of these long structured occured pole-to-pole oscillations). For all other values, n >9.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.017">http://dx.doi.org/10.7554/eLife.03949.017</ext-link></p></caption><graphic xlink:href="elife03949f005"/></fig></p></sec><sec id="s2-4-2"><title>Gradient formation dependent on compartment width</title><p>How does the cell diameter affect cell organization, and in particular gradient formation? Tools to answer this question for the chosen system in vivo are limited, because in living <italic>E.coli</italic> bacteria it is challenging to systematically modify the width of a cell. Thus, it is unknown whether the constant diameter of cells plays a significant role as a geometric cue for septum positioning. Compared to living cells, our in vitro system is much more flexible in pre-setting a defined geometry and reaction volume, enabling us to address for the first time the role of cell width for Min gradient formation and thus, as a geometrical cue for cell organization. In compartments with a small width of 10 µm, only oscillations along the long axis were supported (<xref ref-type="other" rid="video1">Video 1</xref>, <xref ref-type="fig" rid="fig6">Figure 6A</xref>). Interestingly however, larger widths also resulted in oscillations along the short axis of a compartment (<xref ref-type="fig" rid="fig6">Figure 6B</xref>, <xref ref-type="other" rid="video3">Video 3</xref>). Even larger widths resulted in more complex oscillation patterns (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>, <xref ref-type="other" rid="video4">Video 4</xref>). These experiments revealed that a fixed small width of the cell is important for Min gradient formation along the long axis.<fig-group><fig id="fig6" position="float"><object-id pub-id-type="doi">10.7554/eLife.03949.018</object-id><label>Figure 6.</label><caption><title>Compartment width affects gradient formation.</title><p>(<bold>A</bold>) Pole to pole oscillations occur is narrow compartments. Scale bar: 20 µm. (<bold>B</bold>) In wider compartments the proteins oscillate parallel to the length axis of the compartment. Scale bar: 20 µm. In compartments with an even larger width more complex patterns occur as depicted in <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>. (<bold>C</bold>) Confocal images and kymographs of MinE pattern in compartments with different degrees of ‘constriction’ depict pole-to-pole oscillation in compartments with a constant width (upper panel). In compartments with a narrow width in the middle of the compartment double ascillations occur. In separated compartments independent pole-to-pole oscillations are observed. (<bold>D</bold>) Oscillation modes in compartments with different lengths and stepwise narrowing width at the middle of the compartment. Left: Compartments without constriction or only slight decrease of the width in the middle harbor pole-to-pole oscillations (asymmetric oscillations, yellow arrows). Compartments with a narrow width in the middle harbor double oscillations (symmetric oscillations, orange arrows). A series of time-lapse images as well as kymographs of the third and fourth compartment, in which the transition from pole-to-pole to double oscillation occurs are shown in <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2</xref>. <xref ref-type="other" rid="video5">Video 5</xref> shows the dynamic pattern of the third and fourth compartment in this image. Middle: In longer compartments double-oscillations occur due to the increased length, even if the width along the length of the compartment is constant. Right: In very short cells the constriction of the compartments results in two connected compartments, with length axis perpendicular to the length axis in non-constricting compartments. Thus the Min proteins oscillate along the new length axis, which is perpendicular to the oscillation axis in non-constricting short compartments (blue arrows). 1 µM MinE (doped with 10% MinE.Atto655), 1 µM MinD, Scale bar: 20 µm <xref ref-type="fig" rid="fig6s3">Figure 6—figure supplement 3</xref> demonstrates that oscillations happen between each ‘constricting septum’ if the compartment harbors two septa.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.018">http://dx.doi.org/10.7554/eLife.03949.018</ext-link></p></caption><graphic xlink:href="elife03949f006"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.019</object-id><label>Figure 6—figure supplement 1.</label><caption><title>Min proteins self-assemble into complex pattern in large compartments.</title><p>Confocal time-lapse images of MinD and MinE (doped with 10% MinE.Atto655) in large compartments with a width of 50 µm. Scale bar: 20 µm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.019">http://dx.doi.org/10.7554/eLife.03949.019</ext-link></p></caption><graphic xlink:href="elife03949fs009"/></fig><fig id="fig6s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.020</object-id><label>Figure 6—figure supplement 2.</label><caption><title>Min proteins patterns switch from asymmetric pole-to-pole oscillations to symmetric double oscillation when the neck in the middle of a compartment decreases.</title><p>(<bold>A</bold>) Confocal time-lapse images of MinD and MinE (doped with 10% MinE.Atto655) in compartments with decresing width of the neck from compartment 1 to 2. The depicted compartments at time step ‘80 s’ correspond to the third and fourth compartment in the left column of <xref ref-type="fig" rid="fig6">Figure 6D</xref>. Scale bar: 10 µm. (<bold>B</bold>) Kymographs of the compartments shown in (<bold>A</bold>). The arrows indicate the time (80 s) which corresponds to the frame in <xref ref-type="fig" rid="fig6">Figure 6D</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.020">http://dx.doi.org/10.7554/eLife.03949.020</ext-link></p></caption><graphic xlink:href="elife03949fs010"/></fig><fig id="fig6s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.03949.021</object-id><label>Figure 6—figure supplement 3.</label><caption><title>Min oscillations in compartments with multiple septa.</title><p>(<bold>A</bold>) Confocal image of MinD/E pattern in a compartment with two septa. The figure demonstrates that Min oscillations occur between each ‘constricting septum’. 5% MinE is labeled with Atto655. (<bold>B</bold>) The lipid membrane was labeled with DiI to visualize the surrounding of the compartment. The confocal images were taken with the focus level on the bottom, in the middle (5 µm above the bottom) and the upper level of membrane clad compartments (10 µm above the bottom of the compartment. (<bold>C</bold>) x/z-scans depict the profile of the compartment at the septum and at an unconstricted region. (<bold>A</bold>–<bold>C</bold>) Scale bar: 10 µm.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.021">http://dx.doi.org/10.7554/eLife.03949.021</ext-link></p></caption><graphic xlink:href="elife03949fs011"/></fig></fig-group><media content-type="glencoe play-in-place height-250 width-310" id="video3" mime-subtype="avi" mimetype="video" xlink:href="elife03949v003.avi"><object-id pub-id-type="doi">10.7554/eLife.03949.022</object-id><label>Video 3.</label><caption><title>Compartment width dependent orientation of Min oscillations.</title><p>This movie demonstrates how the oscillation axis switches depending on the width of the sample compartment. The confocal time-lapse movies of MinD and MinE patterns (doped with 10% MinE.Atto655) follows the dynamic oscillations over a time of 6 min.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.022">http://dx.doi.org/10.7554/eLife.03949.022</ext-link></p></caption></media><media content-type="glencoe play-in-place height-250 width-310" id="video4" mime-subtype="avi" mimetype="video" xlink:href="elife03949v004.avi"><object-id pub-id-type="doi">10.7554/eLife.03949.023</object-id><label>Video 4.</label><caption><title>Complex Min protein pattern in large compartments.</title><p>This movie shows a confocal time-lapse movie of a MinD and MinE patterns (doped with 10% MinE.Alexa488) in 50 µm wide compartments. The protein patterns are followed over a time of 6 min.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.023">http://dx.doi.org/10.7554/eLife.03949.023</ext-link></p></caption></media></p></sec><sec id="s2-4-3"><title>Geometry modulated partitioning of min proteins during septum closure</title><p>A dramatic local change in cell width occurs during every cell division in <italic>E. coli</italic> in the middle of the cell due to septum closure. Theoretical modeling suggested that this change in geometry might account for an equal partitioning of Min proteins to both daughter cells. (<xref ref-type="bibr" rid="bib9">Di Ventura and Sourjik, 2011</xref>) In other words, septum constriction is hypothesized to provide a geometrical cue to switch from the pole-to-pole oscillations of Min proteins to a symmetric double oscillation, which enables the daughter cells to trap equal amounts of Min proteins. In live cells it is challenging to directly observe the partitioning of proteins, because the constricting septum of <italic>E. coli</italic> becomes smaller than the optical resolution limit during the proposed process. At the same time, the Min protein system is a highly dynamic system, rendering time-lapse imaging with current superresolution techniques difficult. To experimentally test the proposed partitioning of Min proteins during septum constriction, compartments that mimicked morphologically different stages of bacterial cell division were designed. Using cell-shaped compartments with a systematically varying width of the artificial septum, we analyzed whether different patterns occurred in more ‘constricted’ compartments, as compared to ‘non-constricted’ compartments.</p><p>We found that double oscillations occurred indeed in compartments with a small neck in the middle of the compartment. As a negative control, normal pole-to-pole oscillations were sustained in compartments with the same length, but constant cell width. Finally, geometries mimicking the full septum closure, that is, separation in two cells, induced independent pole-to-pole oscillations in each ‘daughter’ compartment (<xref ref-type="fig" rid="fig6">Figure 6C</xref>, <xref ref-type="fig" rid="fig6s2 fig6s3">Figure 6—figure supplement 2 and 3</xref>, <xref ref-type="other" rid="video5">Video 5</xref>). This finding presents the first direct experimental evidence that equal Min protein distribution during cell division is a result of geometrical cues. Furthermore, it strikingly confirms theoretical modeling predictions, where septum constriction supports partitioning of the Min proteins (<xref ref-type="bibr" rid="bib9">Di Ventura and Sourjik, 2011</xref>).<media content-type="glencoe play-in-place height-250 width-310" id="video5" mime-subtype="avi" mimetype="video" xlink:href="elife03949v005.avi"><object-id pub-id-type="doi">10.7554/eLife.03949.024</object-id><label>Video 5.</label><caption><title>Min protein pattern in compartments with a small neck in the middle of the compartment.</title><p>This movie shows a confocal time-lapse movie of a MinD and MinE patterns (doped with 10% MinE.ATTO655) in compartments with a small neck in the middle. The width of the neck in the lower compartment is smaller as compared to the upper compartments and induces a switch from pole-to-pole oscillation to double oscillations. Time of the movie: 2 min.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.03949.024">http://dx.doi.org/10.7554/eLife.03949.024</ext-link></p></caption></media></p><p>To address the role of cell length for equal partitioning of Min proteins during septum closure, we performed similar experiments using cell shaped compartments with different length. We demonstrated that a switch from asymmetric pole-to-pole oscillations to symmetric double oscillations occurred at a certain cell length. However, in longer compartments, double oscillations occurred already in unconstricted cells und thus, a constriction in the middle of the cell had no additional effect on pattern formation. In very short cells, on the other hand, a constriction in the middle of the compartment resulted in a new length axis of the two compartments perpendicular to the length axis of the unconstricted ‘mother’ compartment (<xref ref-type="fig" rid="fig6">Figure 6D</xref>). Thus, a re-orientation of the pattern occurred during constriction, from oscillations along the long axis in the unconstricted compartment, to perpendicular new length axes. These findings demonstrate that an optimal range of cell length exists were Min gradients represent an efficient cue for septum formation. In addition, the Min partitioning to both daughter cells can be controlled by changing the local compartment width during septum closure in the middle of the cell.</p></sec></sec></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>We demonstrated that coordinated spatial control by intracellular protein gradients can be reconstituted in cell-free systems, and that these gradients are modulated by geometric parameters. The reconstitution of self-organizing protein systems in membrane clad soft-polymer compartments represents a simple approach to study membrane interacting proteins in a defined sample volume and geometry. Applying this system, we particularly tackled three major questions. First, what are the minimal requirements for protein gradient formation? Second, can the organized localization to predefined sites be achieved by reading out the positional information of a minimal protein gradient system? And finally, what are the geometric boundary conditions to generate and modulate protein gradients?</p><p>To address the minimal requirements for gradient formation, we considered the Min protein system as a prototype for a gradient forming system and accomplished the reconstitution of a time-averaged nonhomogeneous concentration profile with the lowest concentration in the middle of the compartment. We demonstrated that the minimal requirements for Min gradient formation comprised only a negatively charged membrane, a cell-shaped compartment, ATP as an energy source, and the two antagonistic proteins MinD and MinE.</p><p>To investigate whether the reconstituted gradient provides an efficient cue to organize cellular space by positioning down-stream targets, we co-reconstituted the MinD/E system with the cell division protein FtsZ-mts and the FtsZ inhibitor MinC. This cell-free bottom-up system recapitulated remarkably cell-like properties, such as coordinated spatial coordinated localization of FtsZ-mts to the middle of a cell-like compartment. Interestingly, although it is proposed that MinC has two inhibitory domains which act on FtsZ–FtsZ interactions and on the ternary system FtsZ-FtsA/ZipA, respectively (<xref ref-type="bibr" rid="bib43">Shen and Lutkenhaus, 2009</xref>, <xref ref-type="bibr" rid="bib42">2010</xref>), our data suggest that MinC can already inhibit FtsZ-localization at compartment poles by only disrupting FtsZ–FtsZ interactions. While we do not exclude that the interaction of MinC with the conserved C-terminal domain, which interacts with FtsA and ZipA, is a parallel mechanism to inhibit FtsZ polymerization at cell poles and possibly make FtsZ structures more sensitive to the action of the Min system, our results show that the minimal biochemical requirements to displace FtsZ from compartment poles by the Min system do not involve the disruption of FtsZ-membrane binding sites.</p><p>Moreover, we demonstrated that very long compartments harbored a MinC protein concentration profile with multiple minima. While a normal growing wild type cells typically comprises a Min concentration gradient with only one minimum for division protein assembly, multiple minima resulting in more than one sides for cell division, are potentially advantageous in filamentous cells. If transient unfavorable environmental conditions inhibit cell division but not cell elongation, divisions at multiple sides could ensure the re-establishment of a normal cell length when conditions, which support division, reoccur.</p><p>To systematically address how compartment geometry modulates Min protein gradients, we reconstituted Min protein patterns in compartments with systematically varying shape. Varying the length of the compartments, we found that robust pole-to-pole oscillations occur in compartments, even if the length of these compartments was varied by a factor of 2.3. In a live cell, this robustness of the Min oscillations with respect to cell length should be highly significant, because the length of living cells is not constant over time, and during the life cycle of <italic>E. coli</italic>, the cell doubles in length. The observation that the Min protein patterns in vitro deviate from a stable axis in very short compartments, and that higher order oscillations systematically occur the longer the compartment is, confirm that the MinD/E patterns in synthetic compartments are strikingly similar to the Min pattern of round, wild type and filamentous cells in vivo (<xref ref-type="bibr" rid="bib12">Fu et al., 2001</xref>; <xref ref-type="bibr" rid="bib15">Hale et al., 2001</xref>; <xref ref-type="bibr" rid="bib6">Corbin et al., 2002</xref>; <xref ref-type="bibr" rid="bib44">Shih et al., 2005</xref>; <xref ref-type="bibr" rid="bib39">Raskin and de Boer, 1999b</xref>).</p><p>Interestingly, when we increased the width of the compartments, the Min proteins oscillated along the short axis of the compartment. The cause of oscillations switching along the length axis to oscillations along the short axis is not known. However, the width at which this switching occurs might be correlated with the wavelength of the Min protein patterns and therefore related to the mechanism for determining the wavelength of the Min system. It is also unknown whether a similar gradient along the short axis of the cell is used in living cells, and which factors might contribute on the bacterial scale to regulate gradients along the short axis.</p><p>However, note that FtsZ involving cell-division in certain bacteria, such as <italic>Laxus oneistus</italic>, occurs along the long axis. (<xref ref-type="bibr" rid="bib37">Polz et al., 1992</xref>; <xref ref-type="bibr" rid="bib23">Leisch et al., 2012</xref>) Although the spatial cues to determine the position of their division plane are unknown, it is intriguing to speculate that gradients along the short axis might also provide an effective cue to spatially organize space along the short axis Thus, protein gradients might also orient the cell division plane in cells which divide along the length axis of the cell.</p><p>In line with our in vitro results, Min oscillations along the short axis of a bacterial cell might be accomplished by an increased width as compared to an <italic>E.coli</italic> cell, or by smaller scales of Min protein patterns through modified reaction and/or diffusion rates of the proteins. However, also other systems which generate gradients along the length axis of a bacterial cell, such as activity gradients of phosphorylated proteins (<xref ref-type="bibr" rid="bib5">Chen et al., 2011</xref>), might provide mechanisms to generate gradients along the short axis.</p><p>In addition to varying the overall width of a compartment, we mimicked septum closure in the middle of the compartments and thereby simulated morphologically different stages of bacterial cell division. While it has been controversial how the pool of Min proteins is distributed to the two daughter cells after cell division, we provide experimental evidence for the theoretical model that Min protein partitioning is a result of geometric variation during septum constriction (<xref ref-type="bibr" rid="bib9">Di Ventura and Sourjik, 2011</xref>).</p><p>In summary, we reconstituted a cell-free bottom-up system which recapitulates cell-like properties, such as coordinated spatial control for division site placement by intracellular protein gradients. In particular, our results unravel the minimal requirements for localization of the cell division protein FtsZ. Moreover, our findings demonstrate that the interplay of geometrical cell boundaries and self-organizing Min proteins determine the orientation of Min gradients, the number of potential FtsZ assembly sites, as well as Min protein partitioning during cell division. Thus, our synthetic system opens a way to study complex organization principles in a simplified environment, and provides novel insights into the basic biophysical and biochemical requirements for gradient formation.</p></sec><sec id="s4" sec-type="materials|methods"><title>Material and methods</title><sec id="s4-1"><title>PDMS micro-compartments</title><p>Using photolithographic techniques, resist micro-patterns were produced on Si wafers mainly as described in reference (<xref ref-type="bibr" rid="bib50">Zieske and Schwille, 2013</xref>). Photoresist patterns (ma-P 1275, micro resist technology GmbH, Germany) of about 10 µm height on top of Si wafers (Si-Mat, Kaufering, Germany) were produced by photolithography. The chrome mask was purchased from Compugraphics Jena GmbH. To better mimic the curvature of the cellular membrane, we left a small gap between photoresist and mask during exposure of the mask to UV light, resulting in more tilted walls as compared to the contact mode. For reconstitution of Min protein oscillations along the length axis of a compartment, the mask patterns had a width of 10 µm. The Si wafers were coated with chlorotrimethylsilane (Sigma–Aldrich, St. Louis, MO) to prevent sticking of PDMS to the wafer. PDMS (Sylgard184, Dow Corning, Midland, MI) was mixed at a ratio (monomer to cross-linker) of 10:1 and degased under vacuum. The PDMS mixture was then poured on top of the wafer. Standard glass coverslides where then manually pressed into the liquid PDMS on top of the wafer, leaving a PDMS layer of about 30 µm between the wafer and the glass coverslide. After curing the PDMS at 80°C overnight, the bulk PDMS layer was peeled off. With the help of a razor blade, the glass coverslide with the about 30 µm thin, micro structured PDMS layer was carefully separated from the wafer and used as sample support (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>). The microstructured PDMS/glass devices were stored at room temperature until further use. Before the microstructured PDMS was used as a membrane support, it was sonicated for 5 min in ethanol, washed with water, air dried, and treated with air plasma.</p></sec><sec id="s4-2"><title>Design of microcompartments</title><p>The two-dimensional geometry at the upper level of the compartment is determined by the patterns on a chrome mask. The profiles of the micro compartments can be designed with a flat bottom or a tapered bottom (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1C</xref>). The Min protein oscillations and Min gradient formation were supported by both profiles. However, the image quality was better when the bottom of the compartments was flat. The advantage of a tapered bottom was that these structures allowed FtsZ-mts to align perpendicularly to the length axis of the compartments (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1D</xref>). Thus, all compartments containing FtsZ-mts (<xref ref-type="fig" rid="fig2 fig3 fig5">Figures 2,3,5</xref>) had a tapered bottom. To keep the boundary conditions comparable, the MinCDE oscillations and gradients in <xref ref-type="fig" rid="fig1">Figure 1</xref> were reconstituted in tapered compartments as well.</p><p>To better visualize the oscillation mode and measure the oscillation period of MinD/E pattern, compartments with a flat bottom were employed (<xref ref-type="fig" rid="fig4">Figure 4</xref>, <xref ref-type="other" rid="video1 video2">Video 1 and 2</xref>). Note that the oscillation mode in flat compartments (<xref ref-type="fig" rid="fig4">Figure 4A</xref>) is in agreement with FtsZ localization in tapered compartments (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). Compartments with constrictions and compartments for determining width dependent Min patterns had a flat bottom, as well (<xref ref-type="fig" rid="fig6">Figure 6</xref>, <xref ref-type="other" rid="video3 video4 video5">Video 3–5</xref>).</p><p>Experiments with MinD/E pattern in compartments with constricting septum (<xref ref-type="fig" rid="fig6">Figure 6</xref> and <xref ref-type="fig" rid="fig6s1 fig6s2 fig6s3">Figure 6—figure supplement 1–3</xref>): The walls of the compartments were slightly tilted and the bottom of the compartment was flat. The width at the unconstricted region was about 12 µm at the top and 10 µm at the bottom of the compartments. The septal region of compartments, in which the switch of the oscillation modes occurred, had a width of about 2 µm at the top. The resolution limit in z-direction and the tilted PDMS-surface through which the laser beam had to pass, render an exact description of the profile at the septum challenging, However a confocal x/z-scan of the septum is depicted in <xref ref-type="fig" rid="fig6s3">Figure 6—figure supplement 3C</xref>. Also note that a meniscus due to the surface tension of the buffer might render the actual cross-sectional area of the buffer smaller than the profile of the structure suggests.</p></sec><sec id="s4-3"><title>Supported lipid membranes</title><p><italic>E. coli</italic> lipid membrane within the micro compartment was prepared as described previously (<xref ref-type="bibr" rid="bib50">Zieske and Schwille, 2013</xref>). Two-dimensional motility of the lipids within the membranes was confirmed by labelling the membrane with 0.1% DiI (FAST DiI, Invitrogen, Carlsbad, CA) and performing FRAP experiments. DiI labeled membranes were also applied to acquire compartment profiles.</p></sec><sec id="s4-4"><title>Protein reconstitution assay</title><p>Proteins, ATP and/or GTP (depending on experiment) of defined concentration were added to a buffer reservoir of 200 µl on top of membrane clad supports. Dynamic Min patterns and/or FtsZ-mts bundles formed by self-organization on top of the membrane. At this step the Min patterns did not oscillate but formed travelling waves. Afterwards the buffer above the microstructures was removed by pipetting. Restricted to a small buffer compartments within the micro structures the Min protein patterns start to oscillate in cell-shaped geometries. To limit evaporation a lid was placed on top of the plastic ring surrounding numerous microstructures. The top of individual chambers was open with a buffer/air interface (<xref ref-type="fig" rid="fig1s2">Figure 1—figure supplement 2</xref>).</p></sec><sec id="s4-5"><title>Proteins</title><p>MinC, eGFP-MinC, MinD, eGFP-MinD and MinE were purified with N-terminal His-tags as previously described (<xref ref-type="bibr" rid="bib25">Loose et al., 2008</xref>, <xref ref-type="bibr" rid="bib24">2011</xref>). Purification of FtsZ-mts was originally described by the Erickson-group (<xref ref-type="bibr" rid="bib31">Osawa et al., 2008</xref>). MinE was labeled with Alexa Fluor 488 C5 Maleimide (Molecular Probes, Carlsbad, CA) or ATTO655 Maleimide (ATTO-TEC, Siegen, Germany) according to the manufactures manual.</p><p>The plasmid for overexpression of MinC codes for an open reading frame for MinC connected to an N-terminal hexahistidine tag by a linker (<xref ref-type="bibr" rid="bib24">Loose et al., 2011</xref>). The MinC-G10D mutant was obtained by site-directed mutagenesis (QuikChange II, Agilent Technologies, Santa Clara, CA) of this plasmid to obtain pET28a-MinC(G10D).</p><p>MinE without membrane targeting sequence (MinE(Δ3–8)) was generated by deleting the coding sequence for aminoacids 3–8 of MinE of the overexpression plasmid for MinE (<xref ref-type="bibr" rid="bib25">Loose et al., 2008</xref>) using a ‘GeneArt, Seamless Cloning and Assembly Enzyme Mix’ (Invitrogen, Life Technologies, Carlsbad, CA) and primers TTCCGCGATGCGAATTCGGATCCGCGACC and AATTCGCATCGCGGAAGAAAAACACAGCCAACA to obtain pET28a-MinE(Δ3–8). MinC-G10D and MinE(Δ3–8) were purified like MinE. Purified MinE(Δ3–8) was labeled with Alexa647 maleimide (Molecular Probes, Carlsbad, CA) according to the manufactures manual.</p><p>The sample buffer in all experiments contained 25 mM Tris–HCl pH 7.5, 150 mM KCl, 5–15 mM MgCl<sub>2</sub>. (5 mM MgCl<sub>2</sub> if only the MinD and MinE were reconstituted, 15 mM MgCl<sub>2</sub> if FtsZ-mts was reconstituted) When Min proteins where included in the experiments, the buffer was supplemented with 2.5 mM ATP. When FtsZ-mts was used 3 mM GTP was added to the buffer. Protein concentrations used in this study were as follows. MinC or eGFP-MinC: 0.05 µM, MinE: 1 µM, MinD: 1 µM (depending on the experiment MinD was supplemented with 10% eGFP-MinD), FtsZ-mts: 1 µM. When MinE was imaged 10% of MinE were substituted with the labeled version of MinE.</p><p>Note that these concentrations refer to the average concentrations in the sample buffer before the buffer volume was reduced below the upper level of the micro compartments.</p></sec><sec id="s4-6"><title>Microscopy</title><p>Microscopy: Image acquisition was performed on a ZEISS (Jena, Germany) LSM780 confocal laser scanning microscope (inverted microscope) equipped with a ZEISS Plan-APO 25×/NA 0.8 objective and ZeissC-Apochromat 40×/1.20 objective.</p><p>For acquiring images of Min pattern and FtsZ bundles the focal plane was typically adjusted to the bottom of the compartments (if not stated otherwise). Note that the bottom area of the microstructures is smaller than the top area. Therefore the sizes of structures on the pictures might appear smaller than indicated in the text (text always refers to upper rim of microstructures).</p><p>The relative intensity profiles along the length axis of compartments can be more accurately determined if the focus plane is in the middle of the compartment, because at this plane the relative intensity profiles at different time steps are less prone to errors due to slight focal shift. Thus, data in <xref ref-type="fig" rid="fig1">Figure 1D</xref> and <xref ref-type="fig" rid="fig1s3">Figure 1—figure supplement 3</xref> were extracted from time-lapse images with the focal plane in the middle of the compartments.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Michaela Schaper for help with cloning, Senthil Arumugam for discussions and providing FtsZ-mts and Martin Loose for comments on previous versions of the manuscript. KZ is supported by ‘The International Max Planck Research School for Molecular and Cellular Life Sciences’ (IMPRS-LS). KZ and PS are associated with CeNS (Center for nanoscience) of the Ludwig-Maximilians University Munich.</p></ack><sec sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>KZ, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con2"><p>PS, Conception and design, Drafting or revising the article</p></fn></fn-group></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Arumugam</surname><given-names>S</given-names></name><name><surname>Chwastek</surname><given-names>G</given-names></name><name><surname>Fischer-Friedrich</surname><given-names>E</given-names></name><name><surname>Ehrig</surname><given-names>C</given-names></name><name><surname>Monch</surname><given-names>I</given-names></name><name><surname>Schwille</surname><given-names>P</given-names></name></person-group><year>2012</year><article-title>Surface topology engineering of membranes for the mechanical investigation of the tubulin homologue FtsZ</article-title><source>Angewandte Chemie</source><volume>51</volume><fpage>11858</fpage><lpage>11862</lpage><pub-id pub-id-type="doi">10.1002/anie.201204332</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Arumugam</surname><given-names>S</given-names></name><name><surname>Petrasek</surname><given-names>Z</given-names></name><name><surname>Schwille</surname><given-names>P</given-names></name></person-group><year>2014</year><article-title>MinCDE exploits the dynamic nature of FtsZ filaments for its spatial regulation</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>111</volume><fpage>E1192</fpage><lpage>E1200</lpage><pub-id pub-id-type="doi">10.1073/pnas.1317764111</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bramkamp</surname><given-names>M</given-names></name><name><surname>Emmins</surname><given-names>R</given-names></name><name><surname>Weston</surname><given-names>L</given-names></name><name><surname>Donovan</surname><given-names>C</given-names></name><name><surname>Daniel</surname><given-names>RA</given-names></name><name><surname>Errington</surname><given-names>J</given-names></name></person-group><year>2008</year><article-title>A novel component of the division-site selection system of <italic>Bacillus subtilis</italic> and a new mode of action for the division inhibitor MinCD</article-title><source>Molecular Microbiology</source><volume>70</volume><fpage>1556</fpage><lpage>1569</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2958.2008.06501.x</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Celton-Morizur</surname><given-names>S</given-names></name><name><surname>Racine</surname><given-names>V</given-names></name><name><surname>Sibarita</surname><given-names>JB</given-names></name><name><surname>Paoletti</surname><given-names>A</given-names></name></person-group><year>2006</year><article-title>Pom1 kinase links division plane position to cell polarity by regulating Mid1p cortical distribution</article-title><source>Journal of Cell Science</source><volume>119</volume><fpage>4710</fpage><lpage>4718</lpage><pub-id pub-id-type="doi">10.1242/jcs.03261</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname><given-names>YE</given-names></name><name><surname>Tropini</surname><given-names>C</given-names></name><name><surname>Jonas</surname><given-names>K</given-names></name><name><surname>Tsokos</surname><given-names>CG</given-names></name><name><surname>Huang</surname><given-names>KC</given-names></name><name><surname>Laub</surname><given-names>MT</given-names></name></person-group><year>2011</year><article-title>Spatial gradient of protein phosphorylation underlies replicative asymmetry in a bacterium</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>108</volume><fpage>1052</fpage><lpage>1057</lpage><pub-id pub-id-type="doi">10.1073/pnas.1015397108</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Corbin</surname><given-names>BD</given-names></name><name><surname>Yu</surname><given-names>XC</given-names></name><name><surname>Margolin</surname><given-names>W</given-names></name></person-group><year>2002</year><article-title>Exploring intracellular space: function of the Min system in round-shaped <italic>Escherichia coli</italic></article-title><source>The EMBO Journal</source><volume>21</volume><fpage>1998</fpage><lpage>2008</lpage><pub-id pub-id-type="doi">10.1093/emboj/21.8.1998</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cordell</surname><given-names>SC</given-names></name><name><surname>Anderson</surname><given-names>RE</given-names></name><name><surname>Lowe</surname><given-names>J</given-names></name></person-group><year>2001</year><article-title>Crystal structure of the bacterial cell division inhibitor MinC</article-title><source>The EMBO Journal</source><volume>20</volume><fpage>2454</fpage><lpage>2461</lpage><pub-id pub-id-type="doi">10.1093/emboj/20.10.2454</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>de Boer</surname><given-names>PA</given-names></name><name><surname>Crossley</surname><given-names>RE</given-names></name><name><surname>Hand</surname><given-names>AR</given-names></name><name><surname>Rothfield</surname><given-names>LI</given-names></name></person-group><year>1991</year><article-title>The MinD protein is a membrane ATPase required for the correct placement of the <italic>Escherichia coli</italic> division site</article-title><source>The EMBO Journal</source><volume>10</volume><fpage>4371</fpage><lpage>4380</lpage></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Di Ventura</surname><given-names>B</given-names></name><name><surname>Sourjik</surname><given-names>V</given-names></name></person-group><year>2011</year><article-title>Self-organized partitioning of dynamically localized proteins in bacterial cell division</article-title><source>Molecular Systems Biology</source><volume>7</volume><fpage>457</fpage><pub-id pub-id-type="doi">10.1038/msb.2010.111</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Edwards</surname><given-names>DH</given-names></name><name><surname>Errington</surname><given-names>J</given-names></name></person-group><year>1997</year><article-title>The <italic>Bacillus subtilis</italic> DivIVA protein targets to the division septum and controls the site specificity of cell division</article-title><source>Molecular Microbiology</source><volume>24</volume><fpage>905</fpage><lpage>915</lpage><pub-id pub-id-type="doi">10.1046/j.1365-2958.1997.3811764.x</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fischer-Friedrich</surname><given-names>E</given-names></name><name><surname>Meacci</surname><given-names>G</given-names></name><name><surname>Lutkenhaus</surname><given-names>J</given-names></name><name><surname>Chate</surname><given-names>H</given-names></name><name><surname>Kruse</surname><given-names>K</given-names></name></person-group><year>2010</year><article-title>Intra- and intercellular fluctuations in Min-protein dynamics decrease with cell length</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>107</volume><fpage>6134</fpage><lpage>6139</lpage><pub-id pub-id-type="doi">10.1073/pnas.0911708107</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fu</surname><given-names>X</given-names></name><name><surname>Shih</surname><given-names>YL</given-names></name><name><surname>Zhang</surname><given-names>Y</given-names></name><name><surname>Rothfield</surname><given-names>LI</given-names></name></person-group><year>2001</year><article-title>The MinE ring required for proper placement of the division site is a mobile structure that changes its cellular location during the <italic>Escherichia coli</italic> division cycle</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>98</volume><fpage>980</fpage><lpage>985</lpage><pub-id pub-id-type="doi">10.1073/pnas.98.3.980</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Garner</surname><given-names>EC</given-names></name><name><surname>Campbell</surname><given-names>CS</given-names></name><name><surname>Weibel</surname><given-names>DB</given-names></name><name><surname>Mullins</surname><given-names>RD</given-names></name></person-group><year>2007</year><article-title>Reconstitution of DNA segregation driven by assembly of a prokaryotic actin homolog</article-title><source>Science</source><volume>315</volume><fpage>1270</fpage><lpage>1274</lpage><pub-id pub-id-type="doi">10.1126/science.1138527</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Good</surname><given-names>MC</given-names></name><name><surname>Vahey</surname><given-names>MD</given-names></name><name><surname>Skandarajah</surname><given-names>A</given-names></name><name><surname>Fletcher</surname><given-names>DA</given-names></name><name><surname>Heald</surname><given-names>R</given-names></name></person-group><year>2013</year><article-title>Cytoplasmic volume modulates spindle size during embryogenesis</article-title><source>Science</source><volume>342</volume><fpage>856</fpage><lpage>860</lpage><pub-id pub-id-type="doi">10.1126/science.1243147</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hale</surname><given-names>CA</given-names></name><name><surname>Meinhardt</surname><given-names>H</given-names></name><name><surname>de Boer</surname><given-names>PA</given-names></name></person-group><year>2001</year><article-title>Dynamic localization cycle of the cell division regulator MinE in <italic>Escherichia coli</italic></article-title><source>The EMBO Journal</source><volume>20</volume><fpage>1563</fpage><lpage>1572</lpage><pub-id pub-id-type="doi">10.1093/emboj/20.7.1563</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hazel</surname><given-names>J</given-names></name><name><surname>Krutkramelis</surname><given-names>K</given-names></name><name><surname>Mooney</surname><given-names>P</given-names></name><name><surname>Tomschik</surname><given-names>M</given-names></name><name><surname>Gerow</surname><given-names>K</given-names></name><name><surname>Oakey</surname><given-names>J</given-names></name><name><surname>Gatlin</surname><given-names>JC</given-names></name></person-group><year>2013</year><article-title>Changes in cytoplasmic volume are sufficient to drive spindle scaling</article-title><source>Science</source><volume>342</volume><fpage>853</fpage><lpage>856</lpage><pub-id pub-id-type="doi">10.1126/science.1243110</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hu</surname><given-names>Z</given-names></name><name><surname>Gogol</surname><given-names>EP</given-names></name><name><surname>Lutkenhaus</surname><given-names>J</given-names></name></person-group><year>2002</year><article-title>Dynamic assembly of MinD on phospholipid vesicles regulated by ATP and MinE</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>99</volume><fpage>6761</fpage><lpage>6766</lpage><pub-id pub-id-type="doi">10.1073/pnas.102059099</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hu</surname><given-names>Z</given-names></name><name><surname>Lutkenhaus</surname><given-names>J</given-names></name></person-group><year>2000</year><article-title>Analysis of MinC reveals two independent domains involved in interaction with MinD and FtsZ</article-title><source>Journal of Bacteriology</source><volume>182</volume><fpage>3965</fpage><lpage>3971</lpage><pub-id pub-id-type="doi">10.1128/JB.182.14.3965-3971.2000</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hu</surname><given-names>Z</given-names></name><name><surname>Lutkenhaus</surname><given-names>J</given-names></name></person-group><year>2001</year><article-title>Topological regulation of cell division in <italic>E. coli</italic>. spatiotemporal oscillation of MinD requires stimulation of its ATPase by MinE and phospholipid</article-title><source>Molecular Cell</source><volume>7</volume><fpage>1337</fpage><lpage>1343</lpage><pub-id pub-id-type="doi">10.1016/S1097-2765(01)00273-8</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hu</surname><given-names>Z</given-names></name><name><surname>Mukherjee</surname><given-names>A</given-names></name><name><surname>Pichoff</surname><given-names>S</given-names></name><name><surname>Lutkenhaus</surname><given-names>J</given-names></name></person-group><year>1999</year><article-title>The MinC component of the division site selection system in <italic>Escherichia coli</italic> interacts with FtsZ to prevent polymerization</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>96</volume><fpage>14819</fpage><lpage>14824</lpage><pub-id pub-id-type="doi">10.1073/pnas.96.26.14819</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kiekebusch</surname><given-names>D</given-names></name><name><surname>Thanbichler</surname><given-names>M</given-names></name></person-group><year>2014</year><article-title>Spatiotemporal organization of microbial cells by protein concentration gradients</article-title><source>Trends in Microbiology</source><volume>22</volume><fpage>65</fpage><lpage>73</lpage><pub-id pub-id-type="doi">10.1016/j.tim.2013.11.005</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Laan</surname><given-names>L</given-names></name><name><surname>Pavin</surname><given-names>N</given-names></name><name><surname>Husson</surname><given-names>J</given-names></name><name><surname>Romet-Lemonne</surname><given-names>G</given-names></name><name><surname>van Duijn</surname><given-names>M</given-names></name><name><surname>Lopez</surname><given-names>MP</given-names></name><name><surname>Vale</surname><given-names>RD</given-names></name><name><surname>Julicher</surname><given-names>F</given-names></name><name><surname>Reck-Peterson</surname><given-names>SL</given-names></name><name><surname>Dogterom</surname><given-names>M</given-names></name></person-group><year>2012</year><article-title>Cortical dynein controls microtubule dynamics to generate pulling forces that position microtubule asters</article-title><source>Cell</source><volume>148</volume><fpage>502</fpage><lpage>514</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2012.01.007</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Leisch</surname><given-names>N</given-names></name><name><surname>Verheul</surname><given-names>J</given-names></name><name><surname>Heindl</surname><given-names>NR</given-names></name><name><surname>Gruber-Vodicka</surname><given-names>HR</given-names></name><name><surname>Pende</surname><given-names>N</given-names></name><name><surname>Den Blaauwen</surname><given-names>T</given-names></name><name><surname>Bulgheresi</surname><given-names>S</given-names></name></person-group><year>2012</year><article-title>Growth in width and FtsZ ring longitudinal positioning in a gammaproteobacterial symbiont</article-title><source>Current Biology</source><volume>22</volume><fpage>R831</fpage><lpage>R832</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2012.08.033</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Loose</surname><given-names>M</given-names></name><name><surname>Fischer-Friedrich</surname><given-names>E</given-names></name><name><surname>Herold</surname><given-names>C</given-names></name><name><surname>Kruse</surname><given-names>K</given-names></name><name><surname>Schwille</surname><given-names>P</given-names></name></person-group><year>2011</year><article-title>Min protein patterns emerge from rapid rebinding and membrane interaction of MinE</article-title><source>Nature Structural & Molecular Biology</source><volume>18</volume><fpage>577</fpage><lpage>583</lpage><pub-id pub-id-type="doi">10.1038/nsmb.2037</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Loose</surname><given-names>M</given-names></name><name><surname>Fischer-Friedrich</surname><given-names>E</given-names></name><name><surname>Ries</surname><given-names>J</given-names></name><name><surname>Kruse</surname><given-names>K</given-names></name><name><surname>Schwille</surname><given-names>P</given-names></name></person-group><year>2008</year><article-title>Spatial regulators for bacterial cell division self-organize into surface waves in vitro</article-title><source>Science</source><volume>320</volume><fpage>789</fpage><lpage>792</lpage><pub-id pub-id-type="doi">10.1126/science.1154413</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lutkenhaus</surname><given-names>J</given-names></name></person-group><year>2007</year><article-title>Assembly dynamics of the bacterial MinCDE system and spatial regulation of the Z ring</article-title><source>Annual Review of Biochemistry</source><volume>76</volume><fpage>539</fpage><lpage>562</lpage><pub-id pub-id-type="doi">10.1146/annurev.biochem.75.103004.142652</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ma</surname><given-names>L</given-names></name><name><surname>King</surname><given-names>GF</given-names></name><name><surname>Rothfield</surname><given-names>L</given-names></name></person-group><year>2004</year><article-title>Positioning of the MinE binding site on the MinD surface suggests a plausible mechanism for activation of the <italic>Escherichia coli</italic> MinD ATPase during division site selection</article-title><source>Molecular Microbiology</source><volume>54</volume><fpage>99</fpage><lpage>108</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2958.2004.04265.x</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Martin</surname><given-names>SG</given-names></name><name><surname>Berthelot-Grosjean</surname><given-names>M</given-names></name></person-group><year>2009</year><article-title>Polar gradients of the DYRK-family kinase Pom1 couple cell length with the cell cycle</article-title><source>Nature</source><volume>459</volume><fpage>852</fpage><lpage>856</lpage><pub-id pub-id-type="doi">10.1038/nature08054</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Mileykovskaya</surname><given-names>E</given-names></name><name><surname>Fishov</surname><given-names>I</given-names></name><name><surname>Fu</surname><given-names>X</given-names></name><name><surname>Corbin</surname><given-names>BD</given-names></name><name><surname>Margolin</surname><given-names>W</given-names></name><name><surname>Dowhan</surname><given-names>W</given-names></name></person-group><year>2003</year><article-title>Effects of phospholipid composition on MinD-membrane interactions in vitro and in vivo</article-title><source>The Journal of Biological Chemistry</source><volume>278</volume><fpage>22193</fpage><lpage>22198</lpage><pub-id pub-id-type="doi">10.1074/jbc.M302603200</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moseley</surname><given-names>JB</given-names></name><name><surname>Mayeux</surname><given-names>A</given-names></name><name><surname>Paoletti</surname><given-names>A</given-names></name><name><surname>Nurse</surname><given-names>P</given-names></name></person-group><year>2009</year><article-title>A spatial gradient coordinates cell size and mitotic entry in fission yeast</article-title><source>Nature</source><volume>459</volume><fpage>857</fpage><lpage>860</lpage><pub-id pub-id-type="doi">10.1038/nature08074</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Osawa</surname><given-names>M</given-names></name><name><surname>Anderson</surname><given-names>DE</given-names></name><name><surname>Erickson</surname><given-names>HP</given-names></name></person-group><year>2008</year><article-title>Reconstitution of contractile FtsZ rings in liposomes</article-title><source>Science</source><volume>320</volume><fpage>792</fpage><lpage>794</lpage><pub-id pub-id-type="doi">10.1126/science.1154520</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Padte</surname><given-names>NN</given-names></name><name><surname>Martin</surname><given-names>SG</given-names></name><name><surname>Howard</surname><given-names>M</given-names></name><name><surname>Chang</surname><given-names>F</given-names></name></person-group><year>2006</year><article-title>The cell-end factor pom1p inhibits mid1p in specification of the cell division plane in fission yeast</article-title><source>Current Biology</source><volume>16</volume><fpage>2480</fpage><lpage>2487</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2006.11.024</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Park</surname><given-names>KT</given-names></name><name><surname>Wu</surname><given-names>W</given-names></name><name><surname>Battaile</surname><given-names>KP</given-names></name><name><surname>Lovell</surname><given-names>S</given-names></name><name><surname>Holyoak</surname><given-names>T</given-names></name><name><surname>Lutkenhaus</surname><given-names>J</given-names></name></person-group><year>2011</year><article-title>The Min oscillator uses MinD-dependent conformational changes in MinE to spatially regulate cytokinesis</article-title><source>Cell</source><volume>146</volume><fpage>396</fpage><lpage>407</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2011.06.042</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Patrick</surname><given-names>JE</given-names></name><name><surname>Kearns</surname><given-names>DB</given-names></name></person-group><year>2008</year><article-title>MinJ (YvjD) is a topological determinant of cell division in <italic>Bacillus subtilis</italic></article-title><source>Molecular Microbiology</source><volume>70</volume><fpage>1166</fpage><lpage>1179</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2958.2008.06469.x</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pinot</surname><given-names>M</given-names></name><name><surname>Chesnel</surname><given-names>F</given-names></name><name><surname>Kubiak</surname><given-names>JZ</given-names></name><name><surname>Arnal</surname><given-names>I</given-names></name><name><surname>Nedelec</surname><given-names>FJ</given-names></name><name><surname>Gueroui</surname><given-names>Z</given-names></name></person-group><year>2009</year><article-title>Effects of confinement on the self-organization of microtubules and motors</article-title><source>Current Biology</source><volume>19</volume><fpage>954</fpage><lpage>960</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2009.04.027</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pinot</surname><given-names>M</given-names></name><name><surname>Steiner</surname><given-names>V</given-names></name><name><surname>Dehapiot</surname><given-names>B</given-names></name><name><surname>Yoo</surname><given-names>BK</given-names></name><name><surname>Chesnel</surname><given-names>F</given-names></name><name><surname>Blanchoin</surname><given-names>L</given-names></name><name><surname>Kervrann</surname><given-names>C</given-names></name><name><surname>Gueroui</surname><given-names>Z</given-names></name></person-group><year>2012</year><article-title>Confinement induces actin flow in a meiotic cytoplasm</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>109</volume><fpage>11705</fpage><lpage>11710</lpage><pub-id pub-id-type="doi">10.1073/pnas.1121583109</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Polz</surname><given-names>MF</given-names></name><name><surname>Felbeck</surname><given-names>H</given-names></name><name><surname>Novak</surname><given-names>R</given-names></name><name><surname>Nebelsick</surname><given-names>M</given-names></name><name><surname>Ott</surname><given-names>JA</given-names></name></person-group><year>1992</year><article-title>Chemoautotrophic, sulfur-oxidizing symbiotic bacteria on marine nematodes: morphological and biochemical characterization</article-title><source>Microbial Ecology</source><volume>24</volume><fpage>313</fpage><lpage>329</lpage><pub-id pub-id-type="doi">10.1007/BF00167789</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Raskin</surname><given-names>DM</given-names></name><name><surname>de Boer</surname><given-names>PA</given-names></name></person-group><year>1999a</year><article-title>MinDE-dependent pole-to-pole oscillation of division inhibitor MinC in <italic>Escherichia coli</italic></article-title><source>Journal of Bacteriology</source><volume>181</volume><fpage>6419</fpage><lpage>6424</lpage></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Raskin</surname><given-names>DM</given-names></name><name><surname>de Boer</surname><given-names>PA</given-names></name></person-group><year>1999b</year><article-title>Rapid pole-to-pole oscillation of a protein required for directing division to the middle of <italic>Escherichia coli</italic></article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>96</volume><fpage>4971</fpage><lpage>4976</lpage><pub-id pub-id-type="doi">10.1073/pnas.96.9.4971</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Raskin</surname><given-names>DM</given-names></name><name><surname>de Boer</surname><given-names>PA</given-names></name></person-group><year>1997</year><article-title>The MinE ring: an FtsZ-independent cell structure required for selection of the correct division site in <italic>E. coli</italic></article-title><source>Cell</source><volume>91</volume><fpage>685</fpage><lpage>694</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)80455-9</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schweizer</surname><given-names>J</given-names></name><name><surname>Loose</surname><given-names>M</given-names></name><name><surname>Bonny</surname><given-names>M</given-names></name><name><surname>Kruse</surname><given-names>K</given-names></name><name><surname>Monch</surname><given-names>I</given-names></name><name><surname>Schwille</surname><given-names>P</given-names></name></person-group><year>2012</year><article-title>Geometry sensing by self-organized protein patterns</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>109</volume><fpage>15283</fpage><lpage>15288</lpage><pub-id pub-id-type="doi">10.1073/pnas.1206953109</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shen</surname><given-names>B</given-names></name><name><surname>Lutkenhaus</surname><given-names>J</given-names></name></person-group><year>2010</year><article-title>Examination of the interaction between FtsZ and MinCN in <italic>E. coli</italic> suggests how MinC disrupts Z rings</article-title><source>Molecular Microbiology</source><volume>75</volume><fpage>1285</fpage><lpage>1298</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2958.2010.07055.x</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shen</surname><given-names>B</given-names></name><name><surname>Lutkenhaus</surname><given-names>J</given-names></name></person-group><year>2009</year><article-title>The conserved C-terminal tail of FtsZ is required for the septal localization and division inhibitory activity of MinC(C)/MinD</article-title><source>Molecular Microbiology</source><volume>72</volume><fpage>410</fpage><lpage>424</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2958.2009.06651.x</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shih</surname><given-names>YL</given-names></name><name><surname>Kawagishi</surname><given-names>I</given-names></name><name><surname>Rothfield</surname><given-names>L</given-names></name></person-group><year>2005</year><article-title>The MreB and Min cytoskeletal-like systems play independent roles in prokaryotic polar differentiation</article-title><source>Molecular Microbiology</source><volume>58</volume><fpage>917</fpage><lpage>928</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2958.2005.04841.x</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Strahl</surname><given-names>H</given-names></name><name><surname>Hamoen</surname><given-names>LW</given-names></name></person-group><year>2010</year><article-title>Membrane potential is important for bacterial cell division</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>107</volume><fpage>12281</fpage><lpage>12286</lpage><pub-id pub-id-type="doi">10.1073/pnas.1005485107</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thanbichler</surname><given-names>M</given-names></name><name><surname>Shapiro</surname><given-names>L</given-names></name></person-group><year>2006</year><article-title>MipZ, a spatial regulator coordinating chromosome segregation with cell division in <italic>Caulobacter</italic></article-title><source>Cell</source><volume>126</volume><fpage>147</fpage><lpage>162</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2006.05.038</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Varma</surname><given-names>A</given-names></name><name><surname>Huang</surname><given-names>KC</given-names></name><name><surname>Young</surname><given-names>KD</given-names></name></person-group><year>2008</year><article-title>The Min system as a general cell geometry detection mechanism: branch lengths in Y-shaped <italic>Escherichia coli</italic> cells affect Min oscillation patterns and division dynamics</article-title><source>Journal of Bacteriology</source><volume>190</volume><fpage>2106</fpage><lpage>2117</lpage><pub-id pub-id-type="doi">10.1128/JB.00720-07</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Vecchiarelli</surname><given-names>AG</given-names></name><name><surname>Li</surname><given-names>M</given-names></name><name><surname>Mizuuchi</surname><given-names>M</given-names></name><name><surname>Mizuuchi</surname><given-names>K</given-names></name></person-group><year>2014</year><article-title>Differential affinities of MinD and MinE to anionic phospholipid influence Min patterning dynamics in vitro</article-title><source>Molecular Microbiology</source><volume>93</volume><fpage>453</fpage><lpage>463</lpage><pub-id pub-id-type="doi">10.1111/mmi.12669</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wu</surname><given-names>W</given-names></name><name><surname>Park</surname><given-names>KT</given-names></name><name><surname>Holyoak</surname><given-names>T</given-names></name><name><surname>Lutkenhaus</surname><given-names>J</given-names></name></person-group><year>2011</year><article-title>Determination of the structure of the MinD-ATP complex reveals the orientation of MinD on the membrane and the relative location of the binding sites for MinE and MinC</article-title><source>Molecular Microbiology</source><volume>79</volume><fpage>1515</fpage><lpage>1528</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2958.2010.07536.x</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zieske</surname><given-names>K</given-names></name><name><surname>Schwille</surname><given-names>P</given-names></name></person-group><year>2013</year><article-title>Reconstitution of pole-to-pole oscillations of min proteins in microengineered polydimethylsiloxane compartments</article-title><source>Angewandte Chemie</source><volume>52</volume><fpage>459</fpage><lpage>462</lpage><pub-id pub-id-type="doi">10.1002/anie.201207078</pub-id></element-citation></ref></ref-list></back><sub-article article-type="article-commentary" id="SA1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.03949.025</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Balasubramanian</surname><given-names>Mohan</given-names></name><role>Reviewing editor</role><aff><institution>University of Warwick</institution>, <country>United Kingdom</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see <ext-link ext-link-type="uri" xlink:href="http://elifesciences.org/review-process">review process</ext-link>). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.</p></boxed-text><p>Thank you for sending your work entitled “Reconstitution of self-organizing protein gradients as spatial cues in cell-free systems” for consideration at <italic>eLife</italic>. Your article has been favorably evaluated by Richard Losick (Senior editor) and 3 reviewers, one of whom is a member of our Board of Reviewing Editors.</p><p>The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.</p><p>As you will see the referees have raised a number of points, a large number of which pertain to providing more details of experimental details and to some additional controls. However, one major concern that we would like you to further address is the role of MinC in FtsZ ring positioning in your studies. For example, is it possible to assemble more focused rings if full length MinC were used? The experiments should also be performed with the MinC-G10D mutant to correlate the results of the <italic>in vitro</italic> experiments with <italic>in vivo</italic> experiments. We would like you to consider and respond to the other comments made by the referees, if possible with experiments or with explanations to rebut the points raised. With the appropriate changes, your work will make a very important contribution to the fields of bacterial cell biology and cytokinesis in general.</p><p><italic>Reviewer 1</italic>:</p><p>The authors take a bottom up approach to reconstitute the oscillatory motion of the MinCDE system. They also present evidence demonstrating the sufficiency of the system in positioning FtsZ in the medial region within cylindrical compartments. They also show that while the Min gradient is independent of the chemical nature of the lipid bilayer, geometric cues play a rather critical role in its patterning. The work is major achievement in reconstituting minimal systems. This also provides major insights into determinants of spatial organization in biological systems.</p><p>MinDE oscillations are shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>. While it’s clear that MinD and MinE are sufficient to set the oscillations and achieve the maximum concentration of MinD at poles, additional negative controls will add to the experiment.</p><p>1) Additional controls like any other membrane bound protein OR a MinD mutant defective in MinE binding will be a good addition.</p><p>2) Since oscillations are set by MinD's ATP hydrolysis, a non-hydrolysable ATP analog addition will also serve as a good control.</p><p>3) To test the importance MinE's membrane association, the authors could use a MinE deleted of its MTS.</p><p>It's shown that cardiolipin is not necessary and negative charge is sufficient to set MinDE oscillations. However, how important is negative charge in MinD patterning is not addressed.</p><p>The authors could try different lipid ratios to test if MinDE location and oscillations are affected.</p><p>The authors show that the MinCDE proteins are sufficient for positioning FtsZ to the medial region and excluding it from the pole ends. Again a few additional experiments to test the importance of MinE's membrane association & interaction with MinD in regulating FtsZ positioning could be added.</p><p>1) They could use a MinE MTS deletion and MinD interaction mutants.</p><p>2) It would also be interesting to see the effect of at least 2 mutations affecting membrane binding that Lutkenhaus lab had identified (Cell, Volume 146, Issue 3, 5 August 2011, Pages 396-407) in MinE on the oscillations and FtsZ positioning.</p><p>3) Although it shown that cardiolipin is not necessary for the oscillations, it is possible that cardiolipin has direct effects on FtsZ filaments. It may therefore play a role in FtsZ ring organization and positioning. To test if cardiolipin plays a role in medial localization of FtsZ, one could test FtsZ position in the presence of other lipids as done in earlier experiments.</p><p>Does the period of pole-to-pole oscillation change with increasing lengths? This is not indicated in the paper.</p><p>An interesting experiment that the authors do is to mimic the septating cell and find double oscillations similar to the <italic>in vivo</italic> conditions. An extreme extension of the same could be to mimic an ftsZ84ts strain after shift up shift down, where multiple septa are formed. Would oscillations happen between each constricting septa.</p><p>In the discussion, the authors speculate that gradients across the short axis might determine the division axis in a bacterium like Laxus oneistus. This is a very interesting idea given the presence of Min system in this bacterium. However, the authors should a statement speculating what factors could lead to gradients in short axis even in widths as small as 0.5 um as against the large widths (>10um) in the experiments performed.</p><p><italic>Reviewer 2</italic>:</p><p>The fascinating oscillation of MinD/E in <italic>E. coli</italic> was discovered 15 years ago and has been of major interest to experimentalists, physicists and mathematicians ever since. In 2008 the Schwille lab reported a major advance by reconstituting the MinD/E system on planar lipid bilayers, where the two proteins interacted to generate moving waves. Their proposed reaction-diffusion model has provided insight into the mechanism, and they have explored the system in several subsequent papers. In 2013 Zieske and Schwille described creation of cylindrical PDMS chambers coated with lipid, in which the also reconstituted the MinD/E. Here the waves mimicked the oscillations obtained in <italic>E. coli</italic>.</p><p>The present paper used this PDMS chamber reconstitution in a much more thorough exploration. They determined that the charge of the lipid is the most important parameter, and they explored the co-localization of MinD and MinE (the previous study labeled and imaged only MinE). Most important they added FtsZ to the system, and showed that the oscillating Min compressed its localization to the middle of the chamber, similar to the mechanism <italic>in vivo</italic>. This is an important advance, which I think merits publication. I do have a couple of general issues that I think need to be addressed. Also, I found the paper to be lacking a surprising number of essential experimental details, which marred the presentation and made understanding difficult. In addition to the specific issues I raise, the authors should make a much stronger effort for a complete and polished presentation.</p><p>1) One general issue is that the chambers seem to operate with the same aspect ratio as they do in <italic>E. coli,</italic> yet they are on a ten times larger scale. I think this begs some detailed comparison with the system in <italic>E. coli</italic>, especially in terms of speed of movement of the waves, and oscillation period. The graphs in 1s1e, showing co-localization of MinD and E, are potentially interesting. Can these be compared with <italic>E. coli</italic>? Can it be related to the localization on planar lipid bilayers?</p><p>2) Another issue is the limited restriction of FtsZ in the present system. In <italic>E. coli</italic> the Min system seems to limit FtsZ to a single sharp Z ring localized precisely in the mid cell. In the present system it is a fuzzy patch 5+ µm wide. Is this because of the 10X larger scale? This deficiency of the present system at least needs to be noted.</p><p>3) A final general concern is that the previous Arum gam study concluded that curvatures ∼1 µm diameter caused optimal perpendicular alignment of pfs, while the alignment was lost for diameters ∼3-5 µm. Yet in the 10 µm chambers here they appear nicely aligned. Also, from the Schweizer study one can conclude that the direction of oscillation was established by width and length of flat lipid patches, so the curvature of the present chambers is probably not playing a role in the present oscillations. These two points should be addressed briefly.</p><p>Technical and editorial concerns:</p><p>4) I was confused about the construction of the chambers. From the EM they appear to be hemi cylinders, although the circular profile of the cylinder might not be exact. My confusion is what goes on top? Is there a cover slip? In this case the profile is a half circle with a flat top. The Methods have a somewhat obscure statement “the cured bulk PDMS was carefully peeled off and then the glass cover slide with an about 30 μm high microstructured PDMS layer were peeled off with the help of a razor blade.” (The two peeled are confusing.) That sounds like the PDMS is separated, but I would imagine it has to be sealed again with a cover slip. Is the cover slip separately coated with lipid? And then finally sealed? In the caption to <xref ref-type="fig" rid="fig2">Figure 2B</xref> the statement means nothing to me: “The buffer was not yet reduced to a level below the upper level of the chip. Therefore membrane and FtsZ-mts network are still intact on the upper level of the chip.” The Zieske ref provides a clue. It suggests that the PDMS chambers are simply open on top, no cover slip. A liquid-air interface. This needs more detailed description, including when and how the liquid was lowered (this for each figure). If the setup is like Zieske, I think a diagram like that 1b should be added, and perhaps also a cross section of the chamber (indicating its hemicircular shape, if that is reasonably established.</p><p>It is stated that a 25X/0.8 lens was used for some images – this would be suitable for the air-water interface. A 40X/1.20 objective was used for some images. This would be water immersion, very different from the liquid air interface. These experimental details should be given for each image.</p><p>5) In <xref ref-type="fig" rid="fig4">Figure 4C</xref> there are various constrictions in the center of the trough. We need some indication of the shape of the constriction relative to the hemi-cylinder and presumably flat surface of the liquid-air interface on top. Can any estimate be given for the diameter at the constriction?</p><p>“phosphatidylethanolamine (PE), phosphatidylglycerol (PG) and cardiolipin (CA), which have a net negative charge.” I think only the last two are negatively charged.</p><p>6) I found an apparent contradiction in the sizes and scale bars. The width of the compartments is claimed in Results to be ∼10 µm. From the scale bars in Figure s1 I'd make them to be 2 or 5 µM (1a and 1b). Also in <xref ref-type="fig" rid="fig1">Figure 1b and d</xref> I'd make them 2 and 5 µm. In <xref ref-type="other" rid="video1">movie 1</xref> the scale bar says 50 pixels. This needs to be given in microns, and made to agree with all the above. All of these problems may be related to the confusion about the chamber shape, see above, and the level of focus. This needs to be clarified and stated for all cases.</p><p>7) More details are needed for how the time-averaged fluorescence intensity is calculated, or more specifically the value for a given time. One possibility would be to take a single image focused on the middle of the compartment (but see my questions above about the shape of the compartment - would that be the top surface at the air water interface, or lower?). Alternatively one would do a Z stack and determine the total concentration at each point on the long axis, and somehow average over the hemi-circle.</p><p>8) In <xref ref-type="fig" rid="fig2">Figure 2c</xref>, what Min is labeled? In <xref ref-type="fig" rid="fig3">Figure 3B</xref> what Min is labeled? I suppose an intelligent reader can deduce that FtsZ is blue, but this should be taken care of by the authors. Is the FtsZ-mts the same or similar to the construct of Osawa and Erickson? If so a reference is needed. If not details of the construct should be given, e.g., what is the sequence of mts?</p><p><italic>Reviewer 3</italic>:</p><p>This is another paper in an ongoing series from the Schwille lab to reproduce dynamic pattern formation in an <italic>in vitro</italic> system that mimics <italic>in vivo</italic> behavior. This paper flows from results presented in 2 prior papers. One describes the oscillation of MinD and MinE in a cylindrical compartment (<xref ref-type="bibr" rid="bib50">Zieske & Schwille, 2013</xref>). Another is a paper that shows that FtsZ filaments are dynamically positioned on a flat surface where Min proteins are at a minimum (<xref ref-type="bibr" rid="bib2">Arumugam et al, 2014</xref>). In this follow up paper the authors exploit the system developed in the 2013 paper to show that the Min proteins can position FtsZ within micro compartments that have the shape of a cell. This positioning of FtsZ in these micro compartments is another step in the bottom up approach to reconstitute bacterial cell division. It is a nice demonstration although it is predictable based upon there prior two publications. It would be improved if the authors characterized the MinC contribution to FtsZ localization in more detail to confirm the effect of MinC.</p></body></sub-article><sub-article article-type="reply" id="SA2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.03949.026</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p>Throughout the manuscript, we now provided more experimental details and controls. In particular we now provide figures of the compartment profiles (<xref ref-type="fig" rid="fig1s1">Figure 1–figure supplement 1</xref>) and added a new figure (<xref ref-type="fig" rid="fig1s2">Figure 1–figure supplement 2</xref>), which visualizes the fabrication process of the samples.</p><p><italic>As you will see the referees have raised a number of points, a large number of which pertain to providing more details of experimental details and to some additional controls. However, one major concern that we would like you to further address is the role of MinC in FtsZ ring positioning in your studies. For example, is it possible to assemble more focused rings if full length MinC were used? The experiments should also be performed with the MinC-G10D mutant to correlate the results of the in vitro experiments with in vivo experiments. We would like you to consider and respond to the other comments made by the referees, if possible with experiments or with explanations to rebut the points raised. With the appropriate changes, your work will make a very important contribution to the fields of bacterial cell biology and cytokinesis in general</italic>.</p><p>We now provide more experimental details and additional controls, as suggested by the reviewers. The employed MinC construct harbors all MinC domains. We used the plasmid described previously (Loose M, <italic>et al.</italic>, <italic>Nat Struct Mol Biol.</italic> 18, 577-83 (2011)) for overexpression of MinC. This plasmid codes for an open reading frame for MinC connected to an N-terminal hexahistidine tag by a linker.</p><p>Reviewer 1:</p><p><italic>[…] MinDE oscillations are shown in</italic> <xref ref-type="fig" rid="fig1"><italic>Figure 1</italic></xref><italic>. While it’s clear that MinD and MinE are sufficient to set the oscillations and achieve the maximum concentration of MinD at poles, additional negative controls will add to the experiment</italic>.</p><p><italic>1) Additional controls like any other membrane bound protein OR a MinD mutant defective in MinE binding will be a good addition</italic>.</p><p>We have now performed a set of additional negative controls, which are shown in a new figure (<xref ref-type="fig" rid="fig2s1">Figure 2–figure supplement 1</xref>). Reconstituting MinE with another membrane bound protein (FtsZ-mts, which attached to membranes by the MinD membrane targeting sequence) confirmed that MinE was not recruited to the membrane when reconstituted with a different protein than MinD (<xref ref-type="fig" rid="fig2s1">Figure2–figure supplement 1B</xref>).</p><p><italic>2) Since oscillations are set by MinD's ATP hydrolysis, a non-hydrolysable ATP analog addition will also serve as a good control</italic>.</p><p>The suggested experiment has been performed by our group previously. It has been shown that purified and fluorescently labeled MinD and MinE do not form patterns on membranes in vitro if the nonhydrolysable ATP analog ATPγS was used instead of ATP (Loose M, <italic>et al.</italic>, <italic>Science</italic> 320, 789-792 (2008)). We now mention this experiment in the main text: “Previous controls with purified Min proteins on flat bilayers and the non-hydrolysable ATP analog ATPγS confirmed that the dynamic protein patterns were thereby powered by ATP (Loose M, <italic>et al.</italic>, <italic>Science</italic> 320, 789-792 (2008)).”</p><p><italic>3) To test the importance MinE's membrane association, the authors could use a MinE deleted of its MTS</italic>.</p><p>We now demonstrate the importance of MinE’s membrane association by using MinE deleted of its membrane targeting sequence. In particular, we demonstrated that the Min system is unable to form a stable gradient with the concentration minimum in the middle of the cell without MinE’s membrane association (<xref ref-type="fig" rid="fig1s5">Figure 1–figure supplement 5</xref>).</p><p><italic>It's shown that cardiolipin is not necessary and negative charge is sufficient to set MinDE oscillations. However, how important is negative charge in MinD patterning is not addressed.</italic></p><p><italic>The authors could try different lipid ratios to test if MinDE location and oscillations are affected</italic>.</p><p>In <xref ref-type="fig" rid="fig1s4">Figure 1–figure supplement 4</xref> we demonstrate that different lipid ratios affect the spatial scales of Min protein patterns. Since the microcompartments were adjusted to the spatial scales of Min pattern on <italic>E. coli</italic> membranes, no stable oscillations would be formed in the compartments. We now discussed this point and the importance of the right amount of negative charge in the main text. “For high amounts of negatively charged lipids, the length scales of the protein patterns decrease (<xref ref-type="fig" rid="fig1s4">Figure 1–figure supplement 4</xref> and (Vecchiarelli AG, <italic>et al.</italic> Mol Microbiol. 93, 453-63 (2014)). Thus, the spatial scales of the Min proteins on highly negatively charged membranes would be too small to form stable pole-to-pole oscillations in compartments, which were engineered for protein length scales on <italic>E. coli</italic> membranes. The implication that Min protein oscillations are perturbed if the membrane charge increases is in agreement with live cell studies of GFP-MinD in PE-lacking <italic>E. coli</italic> cells, which demonstrate that Min protein pattern are affected if the membrane charge is (<xref ref-type="bibr" rid="bib29">Mileykovskaya et al., 2003</xref>) and provides further evidence that a balanced ratio of charged and non-charged lipids is of critical importance for the live cycle of <italic>E. coli</italic>.”</p><p><italic>The authors show that the MinCDE proteins are sufficient for positioning FtsZ to the medial region and excluding it from the pole ends. Again a few additional experiments to test the importance of MinE's membrane association & interaction with MinD in regulating FtsZ positioning could be added</italic>.</p><p><italic>1) They could use a MinE MTS deletion and MinD interaction mutants</italic>.</p><p><italic>2) It would also be interesting to see the effect of at least 2 mutations affecting membrane binding that Lutkenhaus lab had identified (Cell, Volume 146, Issue 3, 5 August 2011, Pages 396-407) in MinE on the oscillations and FtsZ positioning</italic>.</p><p>We agree that the role of MinE’s membrane association and its interaction with MinD are highly interesting areas which should be addressed with reconstitution techniques in order to complement existing experiments of the Lutkenhaus lab (Cell, Volume 146, Issue 3, 5 August 2011, Pages 396-407). Using a MinE MTS deletion, we now demonstrate that bottom-up experiments are indeed able to provide new insights into the importance of the MTS (<xref ref-type="fig" rid="fig1s5">Figure 1–figure supplement 5</xref>).</p><p>However, a study involving a thorough biochemical characterization, reconstitution and analysis of mutants in a synthetic system to address the role of individual aminoacids and functional domains of these proteins represents a whole project with data for a full paper on its own. We are working on such a project, but the finalization of this project requires much more time. We thank the reviewer for addressing the potential of our bottom-up system to study Min mutants, and we are positive that questions regarding the importance of individual functional domains of MinE will be addressed in a future manuscript.</p><p><italic>3) Although it shown that cardiolipin is not necessary for the oscillations, it is possible that cardiolipin has direct effects on FtsZ filaments. It may therefore play a role in FtsZ ring organization and positioning. To test if cardiolipin plays a role in medial localization of FtsZ, one could test FtsZ position in the presence of other lipids as done in earlier experiments</italic>.</p><p>In <italic>Escherichia coli</italic> FtsZ is attached to the membrane by FtsA and ZipA. Here, we used an FtsZ fusion with a membrane targeting sequence (mts). While the mts fulfills the role to attach FtsZ filaments to the membrane, it is unclear how the characterization of the membrane interaction of the mts in dependence of the lipid composition can be compared to the natural membrane anchors (FtsA and ZipA) of FtsZ. The possibility to gain insights into a physiologically relevant role of lipid composition for medial FtsZ is therefore limited with our bottom-up system.</p><p>To address the question of the reviewer, reconstitution assays involving Min proteins and the natural membrane anchoring proteins of FtsZ need to be developed. This work is in progress in the lab.</p><p><italic>Does the period of pole-to-pole oscillation change with increasing lengths? This is not indicated in the paper</italic>.</p><p>We now included data how the oscillation period changes with increasing length (<xref ref-type="fig" rid="fig4">Figure 4b</xref>) to address this question, described in the section starting “While the length dependent increase of oscillation modes was well conserved in our experiments, the oscillation period was prone to small perturbation…”</p><p><italic>An interesting experiment that the authors do is to mimic the septating cell and find double oscillations similar to the in vivo conditions. An extreme extension of the same could be to mimic an ftsZ84ts strain after shift up shift down, where multiple septa are formed. Would oscillations happen between each constricting septa</italic>.</p><p>We addressed the reviewers question experimentally and designed compartments with two septa. <xref ref-type="fig" rid="fig6s3">Figure 6–figure supplement 3</xref> now demonstrates that oscillations happen between each “constricting septum”.</p><p><italic>In the discussion, the authors speculate that gradients across the short axis might determine the division axis in a bacterium like Laxus oneistus. This is a very interesting idea given the presence of Min system in this bacterium. However, the authors should a statement speculating what factors could lead to gradients in short axis even in widths as small as 0.5 um as against the large widths (>10um) in the experiments performed</italic>.</p><p>The Min patterns <italic>in vivo</italic> are about ten times smaller than <italic>in vitro</italic>. We now included more information on parameters could account for the difference in the scales in living bacteria vs. <italic>in vitro</italic> systems. “Compared to living cells, the temporal scale for the oscillation period is conserved in the synthetic system. However, both the compartments and the spatial scales of the protein waves are about ten times bigger as compared to living cells. Why the Min patterns <italic>in vivo</italic> are about ten times larger than <italic>in vitro</italic> is quantitatively not fully understood. Different protein ratios, ionic strength of the buffer and membrane composition have been shown to affect the spatial scales (<xref ref-type="bibr" rid="bib25">Loose et al., 2008</xref>, <xref ref-type="bibr" rid="bib48">Vecchiarelli et al., 2014</xref>). Furthermore, the membrane potential (<xref ref-type="bibr" rid="bib45">Strahl and Hamoen, 2010</xref>) and molecular crowding in a living cell could influence Min protein patterns.”</p><p>Furthermore, we speculate that on a bacterial scale gradients along the short axis might be regulated by parameters such as cell width, reaction- and diffusion rates:</p><p>“It is also unknown whether a similar gradient along the short axis of the cell is used in living cells, and which factors might contribute on the bacterial scale to regulate gradients along the short axis. In line with our <italic>in vitro</italic> results, Min oscillations along the short axis of a bacterial cell might be accomplished by an increased width as compared to an <italic>E. coli</italic> cell, or by smaller scales of Min protein patterns through modified reaction and/or diffusion rates of the proteins. However, also other systems which generate gradients along the length axis of bacteria cell, such as activity gradients of phosphorylated proteins (<xref ref-type="bibr" rid="bib5">Chen et al. 2011</xref>), might provide mechanisms to generate gradients along the short axis of a bacterial cell.”</p><p>Reviewer 2:</p><p><italic>[…] The present paper used this PDMS chamber reconstitution in a much more thorough exploration. They determined that the charge of the lipid is the most important parameter, and they explored the co-localization of MinD and MinE (the previous study labeled and imaged only MinE). Most important they added FtsZ to the system, and showed that the oscillating Min compressed its localization to the middle of the chamber, similar to the mechanism in vivo. This is an important advance, which I think merits publication. I do have a couple of general issues that I think need to be addressed. Also, I found the paper to be lacking a surprising number of essential experimental details, which marred the presentation and made understanding difficult. In addition to the specific issues I raise, the authors should make a much stronger effort for a complete and polished presentation</italic>.</p><p>The revised manuscript now contains more experimental details, a new figure that depicts the process of sample preparation (<xref ref-type="fig" rid="fig1s2">Figure 1–figure supplement 2</xref>) and images to give more insight into the geometry of the micro compartments (<xref ref-type="fig" rid="fig1s1">Figure 1–figure supplement 1C</xref>).</p><p><italic>1) One general issue is that the chambers seem to operate with the same aspect ratio as they do in</italic> E. coli<italic>, yet they are on a ten times larger scale. I think this begs some detailed comparison with the system in</italic> E. coli<italic>, especially in terms of speed of movement of the waves, and oscillation period</italic>.</p><p>The spatial scale of the patterns is about ten times larger <italic>in vitro</italic>. The temporal scale of the oscillations is comparable <italic>in vivo</italic> and <italic>in vitro</italic>. Thus, the oscillation period is comparable <italic>in vivo</italic> and <italic>in vitro</italic> and the speed of the pattern is about ten times larger. We now included comparisons of the temporal and spatial scales in the synthetic system vs. <italic>E. coli</italic>:</p><p>Comparison of spatial scales with <italic>E. coli</italic>: “Compared to living cells, the temporal scale for the oscillation period is conserved in the synthetic system. However, both the compartments and the spatial scales of the protein waves are about ten times bigger as compared to living cells. Why the Min patterns <italic>in vivo</italic> are about ten times larger than <italic>in vitro</italic> is quantitatively not fully understood. Different protein ratios, ionic strength of the buffer and membrane composition have been shown to affect the spatial scales (<xref ref-type="bibr" rid="bib25">Loose et al., 2008</xref>, <xref ref-type="bibr" rid="bib48">Vecchiarelli et al., 2014</xref>). Furthermore the membrane potential (<xref ref-type="bibr" rid="bib45">Strahl and Hamoen, 2010</xref>) and molecular crowding in a living cell could influence Min protein patterns.”</p><p>Comparison of temporal scales with <italic>E. coli</italic>: “oscillation periods between less than a minute and 4 minutes were measured. This time scale is well in agreement with measurements of 0.5 to 2 minutes for the oscillation period in living cells (<xref ref-type="bibr" rid="bib39">Raskin and de Boer, 1999</xref>).”</p><p><italic>The graphs in 1s1e, showing co-localization of MinD and E, are potentially interesting</italic>. <italic>Can these be compared with E. coli? Can it be related to the localization on planar lipid bilayers?</italic></p><p>We now compared the results with <italic>E. coli</italic>: “Although the size of bacterial cells and photo bleaching is limiting for characterizing the Min profiles <italic>in vivo</italic> in such detail as it is possible <italic>in vitro</italic>, the intensity peak of MinE at the trail of the Min pattern was also observed in <italic>E. coli</italic> and is generally referred to as ‘MinE ring’.”</p><p>Part of the dynamics in microcompartments can be related to Min dynamics on planar bilayers: “This disassembly of Min protein patterns at the trailing zone during each oscillation is comparable to the disassembly at the trailing edge of travelling Min patterns on flat membranes. The main difference of Min proteins profiles on flat membranes and in microcompartments is that the concentration profiles on flat membranes only change their localization while traveling across the membrane. In contrast, during oscillations in compartments new membrane attached Min protein patterns need to be repeatedly established and disassembled every half oscillation period, which results in a remarkable remodelling of the concentration profiles during the oscillation cycle and an asymmetry in their rise and decay phases at the poles.”</p><p><italic>2) Another issue is the limited restriction of FtsZ in the present system. In</italic> E. coli <italic>the Min system seems to limit FtsZ to a single sharp Z ring localized precisely in the mid cell. In the present system it is a fuzzy patch 5+ µm wide. Is this because of the 10X larger scale? This deficiency of the present system at least needs to be noted</italic>.</p><p>We added the following paragraph: “In contrast to the living cell, the FtsZ-mts distribution in the middle of synthetic compartments appears to be rather broad. The major reason for the wide FtsZ-mts distribution is most likely the ten times larger Min protein pattern <italic>in vitro,</italic> as compared to living cells. The wide MinC minimum allows multiple FtsZ-mts bundles to localize in a wide region in the middle of the compartment.”</p><p><italic>3) A final general concern is that the previous Arum gam study concluded that curvatures ∼1 µm diameter caused optimal perpendicular alignment of pfs, while the alignment was lost for diameters ∼3-5 µm. Yet in the 10 µm chambers here they appear nicely aligned. Also, from the Schweizer study one can conclude that the direction of oscillation was established by width and length of flat lipid patches, so the curvature of the present chambers is probably not playing a role in the present oscillations. These two points should be addressed briefly</italic>.</p><p>For the Min protein oscillations, the curvature indeed does not play a role. However, note that the geometrical requirements for aligning oscillating Min patterns in compartments and travelling Min pattern on flat membranes are different. The previous Schweizer et al. study did not demonstrate oscillating Min pattern, but investigated the alignment of traveling Min waves instead. As demonstrated in <xref ref-type="fig" rid="fig6s1">Figure 6–figure supplement 1</xref> oscillatory Min patterns are not aligned in compartments with a width of about 40 μm while traveling waves are still aligned at a membrane widths as big as 100 μm.</p><p>We are sorry for the previously insufficient description of the chambers. We now included profiles of the chambers, which show that the chambers are 10 μm on the top and are tapered towards the bottom (<xref ref-type="fig" rid="fig1s1">Figure 1–figure supplement 1C</xref>). We now also demonstrate that FtsZ-mts is aligned in tapered compartments as compared to compartments with a flat bottom (<xref ref-type="fig" rid="fig1s1">Figure 1–figure supplement 1D</xref>).</p><p><italic>Technical and editorial concerns</italic>:</p><p><italic>4) I was confused about the construction of the chambers. From the EM they appear to be hemi cylinders, although the circular profile of the cylinder might not be exact. My confusion is what goes on top? Is there a cover slip? In this case the profile is a half circle with a flat top</italic>.</p><p>We now revised the presentation of the construction of the chambers and added much more information. To better describe the profile of the chambers we now supplemented <xref ref-type="fig" rid="fig1s1">Figure 1–figure supplement 1</xref> with a profile image of the chambers (<xref ref-type="fig" rid="fig1s1">Figure 1–figure supplement 1C</xref>). To provide a more detailed description of the construction of the chambers, the fabrication process is now depicted in a new figure (<xref ref-type="fig" rid="fig1s2">Figure 1–figure supplement 2</xref>) and explained in the corresponding figure caption and in the Materials and methods section. We now also point out that the microstructured PDMS compartments are open on the top and clad with membrane at the bottom and the sides. “The top of the chambers was open with a buffer/air interface.”</p><p><italic>The Methods have a somewhat obscure statement “the cured bulk PDMS was carefully peeled off and then the glass cover slide with an about 30 μm high microstructured PDMS layer were peeled off with the help of a razor blade.” (The two peeled are confusing.) That sounds like the PDMS is separated, but I would imagine it has to be sealed again with a cover slip. Is the cover slip separately coated with lipid? And then finally sealed</italic>?</p><p>There are indeed two layers of PDMS involved in the fabrication process (a thick bulk PDMS layer and a thin PDMS layer harboring the microstructures), but we see that the description might have been confusing.</p><p>To clarify the fabrication process of the PDMS microstructures, we now included a photograph and a schematic image of the Wafer/PDMS/glass cover slip/PDMS sandwich (<xref ref-type="fig" rid="fig1s2">Figure 1–figure supplement 2</xref>).</p><p>In the Methods section, we changed the description and included a reference that points to the figure describing the fabrication process in more detail. “After curing the PDMS at 80°C overnight, the bulk PDMS layer was peeled off. With the help of a razor blade, the glass coverslide with the about 30μm thin, micro structured PDMS layer was carefully separated from the wafer and used as sample support (<xref ref-type="fig" rid="fig1s2">Figure 1–figure supplement 2</xref>).”</p><p><italic>In the caption to</italic> <xref ref-type="fig" rid="fig2"><italic>Figure 2B</italic></xref> <italic>the statement means nothing to me: “The buffer was not yet reduced to a level below the upper level of the chip. Therefore membrane and FtsZ-mts network are still intact on the upper level of the chip.” The Zieske ref provides a clue. It suggests that the PDMS chambers are simply open on top, no cover slip. A liquid-air interface. This needs more detailed description, including when and how the liquid was lowered (this for each figure). If the setup is like Zieske, I think a diagram like that 1b should be added, and perhaps also a cross section of the chamber (indicating its hemicircular shape, if that is reasonably established</italic>.</p><p>The reduction of the buffer to enclose proteins in compartments is now described in detail in <xref ref-type="fig" rid="fig1s2">Figure 1–figure supplement 2D</xref>. This figure also contains a schematic diagram and a description at which step during the sample preparation and how the buffer reservoir was reduced. “Subsequently the buffer reservoir was manually reduced using a pipette, such that the buffer remained only in the micro fabricated chambers.”</p><p>The procedure when and how the liquid was lowered was the same for each figure with micro chambers, except from the figures where it is indicated that “The buffer was not yet reduced to a level below the upper level of the chip.” Cross sections of the chambers are now added in <xref ref-type="fig" rid="fig1s1">Figure 1–figure supplement 1C</xref>.</p><p><italic>It is stated that a 25X/0.8 lens was used for some images – this would be suitable for the air-water interface. A 40X/1.20 objective was used for some images. This would be water immersion, very different from the liquid air interface. These experimental details should be given for each image</italic>.</p><p>The microscope we used was an inverted confocal microscope. Thus, the objective was not positioned on top of the sample, but the objective in our setup was positioned below the sample and the protein patterns were imaged through the transparent glass/PDMS layer. For such an arrangement of the setup both objectives are appropriate.</p><p>The use of one objective or the other was dependent on the availability of two LSM780 setups at the institute which were equipped with different objectives. In particular, either of the two objectives could be used for all experiments performed for this study.</p><p>We now included the information that the microscope is inverted to prevent confusions: “Image acquisition was performed on a ZEISS (Jena, Germany) LSM780 confocal laser scanning microscope (inverted microscope)…”</p><p><italic>5) In</italic> <xref ref-type="fig" rid="fig4"><italic>Figure 4C</italic></xref> <italic>there are various constrictions in the center of the trough. We need some indication of the shape of the constriction relative to the hemi-cylinder and presumably flat surface of the liquid-air interface on top. Can any estimate be given for the diameter at the constriction</italic>?</p><p>We now included a picture of the septum profile in <xref ref-type="fig" rid="fig6s3">Figure 6–figure supplement 3</xref>. Moreover, the microstructure is now described in more detail in the Materials and methods section “Design of microcompartments”.</p><p><italic>“phosphatidylethanolamine (PE), phosphatidylglycerol (PG) and cardiolipin (CA), which have a net negative charge.” I think only the last two are negatively charged</italic>.</p><p>This sentence was meant to point out that a mixture of these three lipids is negatively charged in the sum. To prevent misunderstandings, we changed the sentence to “Note that the <italic>E. coli</italic> lipid extract for generating membranes in these experiments is a mixture of mainly three different lipids, (phosphatidylethanolamine (PE, neutral), phosphatidylglycerol (PG, negatively charged) and cardiolipin (CA, negatively charged)) and that the membranes have a net negative charge.”</p><p><italic>6) I found an apparent contradiction in the sizes and scale bars. The width of the compartments is claimed in Results to be ∼10 µm. From the scale bars in Figure s1 I'd make them to be 2 or 5 µM (1a and 1b). Also in</italic> <xref ref-type="fig" rid="fig1"><italic>Figure 1b and d</italic></xref> <italic>I'd make them 2 and 5 µm</italic>.</p><p>The scale bar for the electron micrographs is only valid for the x-axis of the picture. We are now mentioning this in the figure caption. “Note that the scale bars in the electron micrographs only applies to the x-direction of the picture. The sample was tilted in the other direction to create the three-dimensional impression of electron micrographs.”</p><p>The micro structures are tapered towards the bottom of the structures. The “10μm” refer to the upper rim of the structures. Thus, in images with the focal plane at the bottom of the compartment, the borders appear narrower than 10 μm. To prevent confusions about the scales of the microstructures we now included profiles in <xref ref-type="fig" rid="fig1s1">Figure 1–figure supplement 1C</xref>.</p><p><italic>In</italic> <xref ref-type="other" rid="video1"><italic>movie 1</italic></xref> <italic>the scale bar says 50 pixels. This needs to be given in microns, and made to agree with all the above. All of these problems may be related to the confusion about the chamber shape, see above, and the level of focus. This needs to be clarified and stated for all cases</italic>.</p><p>Corrected. More details about the chamber shape are now given throughout the manuscript.</p><p><italic>7) More details are needed for how the time-averaged fluorescence intensity is calculated, or more specifically the value for a given time. One possibility would be to take a single image focused on the middle of the compartment (but see my questions above about the shape of the compartment - would that be the top surface at the air water interface, or lower?). Alternatively one would do a Z stack and determine the total concentration at each point on the long axis, and somehow average over the hemi-circle</italic>.</p><p>We now included the following sentence: “The time averaged distribution of protein concentrations was calculated by acquiring time-lapse-images with the focal plane at the middle of the compartment and averaging the intensity of the acquired frames.”</p><p><italic>8) In</italic> <xref ref-type="fig" rid="fig2"><italic>Figure 2c</italic></xref><italic>, what Min is labeled</italic>?</p><p>The labeled protein is now mentioned in the figure caption: “When the gradient forming Min system (red: MinE.Atto655) and FtsZ (blue) are reconstituted together, the Min gradient coordinates the localization of FtsZ-mts to the middle of the compartments.”</p><p><italic>In</italic> <xref ref-type="fig" rid="fig3"><italic>Figure 3B</italic></xref> <italic>what Min is labeled? I suppose an intelligent reader can deduce that FtsZ is blue, but this should be taken care of by the authors</italic>.</p><p>The corresponding proteins for the red and blue color are now indicated in the figure caption: “In compartments with double oscillations of the Min system (red: MinE.Atto655), FtsZ-mts (blue) localizes to two regions along the cell length.”</p><p><italic>Is the FtsZ-mts the same or similar to the construct of Osawa and Erickson? If so a reference is needed. If not details of the construct should be given, e.g., what is the sequence of mts</italic>?</p><p>The FtsZ-mts construct is the same construct of Osawa and Erickson. We apologize for the lack of the original reference. We now added the reference in the main text (“To keep the system as minimal as possible, we avoided the native membrane adaptors of FtsZ, FtsA and ZipA, and used a FtsZ hybrid protein, fused to YFP and a membrane targeting sequence (FtsZ-mts) (<xref ref-type="bibr" rid="bib31">Osawa et al., 2008</xref>)”) as well as in the Materials and methods section (“Purification of FtsZ-YFP-mts was originally described by the Erickson group (<xref ref-type="bibr" rid="bib31">Osawa et al., 2008</xref>))”.</p><p>Reviewer 3:</p><p><italic>[…] In this follow up paper the authors exploit the system developed in the 2013 paper to show that the Min proteins can position FtsZ within micro compartments that have the shape of a cell. This positioning of FtsZ in these micro compartments is another step in the bottom up approach to reconstitute bacterial cell division. It is a nice demonstration although it is predictable based upon there prior two publications. It would be improved if the authors characterized the MinC contribution to FtsZ localization in more detail to confirm the effect of MinC</italic>.</p><p>We are grateful for the reviewers’ suggestions to improve the characterization of how exactly MinC positions FtsZ, in particular, by testing the MinC-G10D mutant in vitro (see below). We believe that these additional experiments greatly improved the manuscript. The MinC-G10D mutant (<xref ref-type="fig" rid="fig3">Figure 3</xref>) was unable to position FtsZ-mts, indicating that mainly the N-terminal domain of MinC is involved in inhibiting FtsZ in our <italic>in vitro</italic> system. Furthermore, we now included additional controls to confirm the effect of MinC (<xref ref-type="fig" rid="fig2s1">Figure2–figure supplement 1</xref>).</p></body></sub-article></article> |