Permalink
Switch branches/tags
Nothing to show
Find file
Fetching contributors…
Cannot retrieve contributors at this time
2 lines (1 sloc) 162 KB
<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d1 20130915//EN" "JATS-archivearticle1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.1d1"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="hwp">eLife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">04132</article-id><article-id pub-id-type="doi">10.7554/eLife.04132</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research article</subject></subj-group><subj-group subj-group-type="heading"><subject>Cell biology</subject></subj-group></article-categories><title-group><article-title>A stress assembly that confers cell viability by preserving ERES components during amino-acid starvation</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-16854"><name><surname>Zacharogianni</surname><given-names>Margarita</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-16855"><name><surname>Aguilera Gomez</surname><given-names>Angelica</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-16856"><name><surname>Veenendaal</surname><given-names>Tineke</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-16857"><name><surname>Smout</surname><given-names>Jan</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-8107"><name><surname>Rabouille</surname><given-names>Catherine</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="corresp" rid="cor1">&#x2a;</xref><xref ref-type="other" rid="par-2"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution content-type="dept">Hubrecht Institute</institution>, <institution>Royal Netherlands Academy of Arts and Sciences</institution>, <addr-line><named-content content-type="city">Utrecht</named-content></addr-line>, <country>Netherlands</country></aff><aff id="aff2"><label>2</label><institution>University Medical Center Utrecht</institution>, <addr-line><named-content content-type="city">Utrecht</named-content></addr-line>, <country>Netherlands</country></aff><aff id="aff3"><label>3</label><institution content-type="dept">Department of Cell Biology</institution>, <institution>University Medical Center Utrecht</institution>, <addr-line><named-content content-type="city">Utrecht</named-content></addr-line>, <country>Netherlands</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Nunnari</surname><given-names>Jodi</given-names></name><role>Reviewing editor</role><aff><institution>University of California, Davis</institution>, <country>United States</country></aff></contrib></contrib-group><author-notes><corresp id="cor1"><label>&#x2a;</label>For correspondence: <email>c.rabouille@hubrecht.eu</email></corresp></author-notes><pub-date publication-format="electronic" date-type="pub"><day>11</day><month>11</month><year>2014</year></pub-date><pub-date pub-type="collection"><year>2014</year></pub-date><volume>3</volume><elocation-id>e04132</elocation-id><history><date date-type="received"><day>23</day><month>07</month><year>2014</year></date><date date-type="accepted"><day>10</day><month>11</month><year>2014</year></date></history><permissions><copyright-statement>Copyright &#xa9; 2014, Zacharogianni et al</copyright-statement><copyright-year>2014</copyright-year><copyright-holder>Zacharogianni et al</copyright-holder><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife04132.pdf"/><abstract><object-id pub-id-type="doi">10.7554/eLife.04132.001</object-id><p>Nutritional restriction leads to protein translation attenuation that results in the storage and degradation of free mRNAs in cytoplasmic assemblies. In this study, we show in Drosophila S2 cells that amino-acid starvation also leads to the inhibition of another major anabolic pathway, the protein transport through the secretory pathway, and to the formation of a novel reversible non-membrane bound stress assembly, the Sec body that incorporates components of the ER exit sites. Sec body formation does not depend on membrane traffic in the early secretory pathway, yet requires both Sec23 and Sec24AB. Sec bodies have liquid droplet-like properties, and they act as a protective reservoir for ERES components to rebuild a functional secretory pathway after re-addition of amino-acids acting as a part of a survival mechanism. Taken together, we propose that the formation of these structures is a novel stress response mechanism to provide cell viability during and after nutrient stress.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.001">http://dx.doi.org/10.7554/eLife.04132.001</ext-link></p></abstract><abstract abstract-type="executive-summary"><object-id pub-id-type="doi">10.7554/eLife.04132.002</object-id><title>eLife digest</title><p>Proteins are needed by living cells to perform vital tasks and are made from building blocks called amino-acids. However, if a cell is starved of amino-acids, protein assembly comes to a halt, and if cells are deprived of amino acids for a long time, the cell may die.</p><p>To survive short periods of amino-acid starvation, the cell has developed many protective mechanisms. For example, it can start to break down existing proteins, allowing the cell to scavenge and reuse the amino-acids to make other proteins that are more important for short-term survival. The cell may also temporarily halt certain processes: for example, newly constructed proteins may no longer be transported from the cell structure where they are made&#x2014;called the endoplasmic reticulum&#x2014;to their final destinations in the cell. However, the protein transport apparatus is also made of proteins and needs to be protected from being broken down so that once starvation ends, the cell can more quickly return to normal working order.</p><p>Zacharogianni et al. identify a strategy cells use to store and protect part of their protein transport apparatus during times of stress. Starving fruit fly cells of amino-acids causes the cells to form protective stress assemblies incorporating the proteins associated with the &#x2018;exit sites&#x2019; that release proteins from the endoplasmic reticulum. These assemblies are called Sec bodies, and when amino-acid starvation ends, these bodies release the exit site components unharmed. This allows the cell to quickly resume protein transport and so speeds the cell's recovery. If the Sec bodies do not form, the cells are more likely to die during amino-acid starvation.</p><p>The Sec bodies are distinct from previously identified stress assemblies that form in the cell during stress, but they share features with them, such as being liquid droplets. Some of these assemblies have been linked to degenerative diseases like amyotrophic lateral sclerosis (ALS). Further research will be necessary to determine if there are any similar harmful side effects associated with the formation of Sec bodies.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.002">http://dx.doi.org/10.7554/eLife.04132.002</ext-link></p></abstract><kwd-group kwd-group-type="author-keywords"><title>Author keywords</title><kwd>protein transport through the secretory pathway</kwd><kwd>amino-acid starvation</kwd><kwd>ER exit sites</kwd><kwd>COPII</kwd><kwd>liquid droplets</kwd><kwd>stress granules</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>D. melanogaster</italic></kwd></kwd-group><funding-group><award-group id="par-1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100003246</institution-id><institution content-type="university">Nederlandse Organisatie voor Wetenschappelijk Onderzoek</institution></institution-wrap></funding-source><award-id>822-020-016</award-id><principal-award-recipient><name><surname>Aguilera Gomez</surname><given-names>Angelica</given-names></name></principal-award-recipient></award-group><award-group id="par-2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/501100001722</institution-id><institution content-type="university">Royal Netherlands Academy of Arts and Sciences</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Rabouille</surname><given-names>Catherine</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name><meta-value>2.0</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>Amino-acid starvation leads to the formation of a reversible stress assembly, the Sec body, which is a pro-survival reservoir for components of the ER exit sites.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec sec-type="intro" id="s1"><title>Introduction</title><p>Cell response to nutritional restriction includes stimulation of degradation pathways, such as autophagy, as well as attenuating anabolic pathways, such as protein translation (<xref ref-type="bibr" rid="bib13">Castilho et al., 2014</xref>).</p><p>Another key anabolic pathway is protein transport through the secretory pathway. In mammals, one third of the proteome encounters this pathway (<xref ref-type="bibr" rid="bib54">Stevens and Arkin, 2000</xref>; <xref ref-type="bibr" rid="bib1">Almen et al., 2009</xref>), such as the proteins delivered to the extracellular medium, the plasma membrane, or other cellular membrane compartments with the exception of mitochondria and the nucleus. After their synthesis at the endoplasmic reticulum, proteins exit the ER at specialized ER exit sites (ERES) defined by a cup-shaped ER overlaying COPII-coated vesicles in which newly synthesized proteins are packaged. They then reach the Golgi apparatus where they are further modified, sorted, and dispatched to their correct final localization. The COPII coat assembly requires 6 proteins, including the transmembrane protein Sec12 that acts as a GEF for the small GTPase Sar1. GTP-bound Sar1 recruits Sec23/Sec24, the inner COPII coat that in turn recruits Sec13/31, the outer coat (<xref ref-type="bibr" rid="bib5">Bard et al., 2006</xref>; <xref ref-type="bibr" rid="bib16">d'Enfert et al., 1991</xref>; <xref ref-type="bibr" rid="bib44">Oka et al., 1991</xref>; <xref ref-type="bibr" rid="bib49">Rothman and Wieland, 1996</xref>; <xref ref-type="bibr" rid="bib50">Schekman and Orci, 1996</xref>). In addition, the large hydrophilic protein Sec16 has been found to play a major role in the COPII assembly and regulation (<xref ref-type="bibr" rid="bib27">Ivan et al., 2008</xref>; <xref ref-type="bibr" rid="bib24">Hughes et al., 2009</xref>) (<xref ref-type="bibr" rid="bib15">Connerly et al., 2005</xref>; <xref ref-type="bibr" rid="bib36">Kung et al., 2012</xref>; <xref ref-type="bibr" rid="bib7">Bharucha et al., 2013</xref>) and Sec16 mutation or loss of function leads to a severe impairment in trafficking through the secretory pathway.</p><p>Stress strongly affects the functional organization of the secretory pathway. For instance, energy deprivation and osmotic shock also block secretion at the level of the ER exit and the cis Golgi, a response mostly triggered by impaired dynamics of the COPI coat, which mediates retrograde transport (<xref ref-type="bibr" rid="bib28">Jamieson and Palade, 1968</xref>; <xref ref-type="bibr" rid="bib14">Cluett et al., 1993</xref>; <xref ref-type="bibr" rid="bib38">Lee and Linstedt, 1999</xref>). Interestingly, GBF1, the GEF of Arf, the small GTPase required for COPI assembly, is phosphorylated and consequently inactivated by AMPK under conditions of nutrient starvation and energy depletion, leading to a block in secretion (<xref ref-type="bibr" rid="bib40">Miyamoto et al., 2008</xref>). Furthermore, biosynthesis of PI4P in yeast that was shown to play a key role in coordinating trafficking from the Golgi with cell growth seems to also be sensitive to nutrient conditions (<xref ref-type="bibr" rid="bib47">Piao et al., 2012</xref>). Last, ER stress that elicits the so-called &#x2018;unfolded protein response&#x2019; (<xref ref-type="bibr" rid="bib51">Shamu et al., 1994</xref>) directly impedes on the functional organization of ERES in Drosophila S2 cells (<xref ref-type="bibr" rid="bib34">Kondylis et al., 2011</xref>) and reduces COPII subunits assembly in human cells (<xref ref-type="bibr" rid="bib2">Amodio et al., 2009</xref>). Furthermore, we have recently reported that serum starvation of Drosophila S2 cells also results in a distinct change in the ERES organization, namely Sec16 cytoplasmic dispersion away from ERES, in a conserved ERK7-dependent mechanism (<xref ref-type="bibr" rid="bib60">Zacharogianni et al., 2011</xref>) that leads to protein secretion inhibition.</p><p>In this study, we focus on amino-acid starvation that leads to the formation of a novel, non-membrane bound cytoplasmic stress assembly that contains ERES components and that we call &#x2018;Sec bodies&#x2019; [<xref ref-type="fig" rid="fig1">Figure 1A</xref> and (<xref ref-type="bibr" rid="bib60">Zacharogianni et al., 2011</xref>)]. Sec bodies do not represent terminal aggregates. They are reversible, act as a reservoir for ERES components to reconstruct a functional secretory pathway upon re-feeding and are critical for cell survival during stress and upon stress relief. Furthermore, they display properties similar to those of Stress Granules, which place them in the rapidly growing class of cytoplasmic mesoscale assemblies and more specifically, the category of liquid droplets.<fig-group><fig id="fig1" position="float"><object-id pub-id-type="doi">10.7554/eLife.04132.003</object-id><label>Figure 1.</label><caption><title>Amino-acid starvation induces the formation of a novel stress assembly in Drosophila S2 cells.</title><p>(<bold>A</bold>) Immunofluorescence (IF) visualization of Delta-myc (using an anti-Delta antibody) in S2 cells in Schneider's (normal growth conditions) or incubated with Krebs Ringer Bicarbonate buffer (KRB) for 4 hr (amino-acid starvation). Note that in Schneider's Delta reaches the plasma membrane whereas it is retained intracellularly in starved cells. (<bold>B</bold>) IF visualization of endogenous Sec16 in Drosophila S2 cells grown in Schneider's and incubated in KRB for 4 hr. Note the formation of Sec bodies (arrows). (<bold>C</bold>) IF visualization of Sec31, Sec23 and co-visualization of GFP-Sec23, mCherry-Sec24AB, Sec24CD-GFP, Sar1-GFP with Sec16 in S2 cells in Schneider's and KRB for 4 hr. (<bold>D</bold>) IF co-visualization of dGRASP/Sec24CD-GFP, GRIP/Sec16, and Fringe-GFP/Sec16 in S2 cells grown in Schneider's and incubated in KRB for 4 hr. (<bold>E</bold>) Kinetics of Sec body formation in S2 cells incubated in KRB over indicated time (up to 6 hr) expressed as the percentage of cells exhibiting ERES, intermediates (see &#x2018;Materials and methods&#x2019;), and Sec bodies. Scale bars: 10 &#x3bc;m (<bold>A</bold>&#x2013;<bold>D</bold>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.003">http://dx.doi.org/10.7554/eLife.04132.003</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132f001"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04132.004</object-id><label>Figure 1&#x2014;figure supplement 1.</label><caption><title>Sec body formation and autophagy.</title><p>(<bold>A</bold>&#x2013;<bold>A&#x2032;</bold>) Quantification of Atg5 punctae formation in S2 cells incubated with rapamycin (<bold>A</bold>) and incubated with KRB with or without wortmannin (<bold>A&#x2032;</bold>) for indicated time points. Note that as expected, autophagy (marked by Atg5) is stimulated by rapamycin and starvation (KRB) and inhibited by wortmannin. (<bold>B</bold>&#x2013;<bold>B&#x2032;</bold>) Quantification of Sec body formation (marked with Sec16) in cells incubated in KRB with and without wortmannin (<bold>B</bold>) and with and without bafilomycin (<bold>B&#x2032;</bold>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.004">http://dx.doi.org/10.7554/eLife.04132.004</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132fs001"/></fig><fig id="fig1s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04132.005</object-id><label>Figure 1&#x2014;figure supplement 2.</label><caption><title>Sec body formation and single amino-acids.</title><p>Quantification of the prevention of Sec body formation by specific amino-acids upon incubation in KRB for 4 hr. This is expressed as the percentage of cells exhibiting the normal growth Sec16 localization at ERES. All amino-acids are added at 15 mM except for 3 (gray bars) that were also tested at their concentration in Schneider&#x27;s medium. Note that at 15 mM, histidine, aspartate, and asparagine significantly decreases Sec body formation.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.005">http://dx.doi.org/10.7554/eLife.04132.005</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132fs002"/></fig><fig id="fig1s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04132.006</object-id><label>Figure 1&#x2014;figure supplement 3.</label><caption><title>Sec body formation in vivo.</title><p>Projection of four equatorial confocal planes of Sec16 and Spectrin (<bold>D</bold>) in the follicular epithelium covering an egg-chamber from an ovary dissected from a virgin fly fattened for 3 days and incubated ex-vivo in KRB for 4 hr, and from an ovary dissected from a 36-hr starved virgin female. Note that in both cases, Sec16 is found in large punctae reminiscent of Sec bodies. Scale bars: 10 &#x03BC;m.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.006">http://dx.doi.org/10.7554/eLife.04132.006</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132fs003"/></fig><fig id="fig1s4" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04132.007</object-id><label>Figure 1&#x2014;figure supplement 4.</label><caption><title>Sec body formation and mammalian cells.</title><p>IF visualization of Sec16 in immortalized MEFs incubated in growth medium (DMEM) or KRB plus bafilomycin for 7 hr. Note that Sec16 is remodeled into larger structures. Scale bar: 10 &#x03BC;m.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.007">http://dx.doi.org/10.7554/eLife.04132.007</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132fs004"/></fig><fig id="fig1s5" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04132.008</object-id><label>Figure 1&#x2014;figure supplement 5.</label><caption><title>Human Sec16A is incorporated to Sec bodies in starved Drosophila S2 cells.</title><p>IF visualization of human Sec16A-V5 transfected in Drosophila S2 cells. Note that it partially localizes to ERES in fed cells but is efficiently incorporated in Sec bodies upon starvation. Scale bar: 10 &#x03BC;m.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.008">http://dx.doi.org/10.7554/eLife.04132.008</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132fs005"/></fig></fig-group></p></sec><sec sec-type="results" id="s2"><title>Results</title><sec id="s2-1"><title>Amino-acid starvation of Drosophila S2 cells induces the remodeling of ERES components into Sec bodies</title><p>Amino-acid starvation of Drosophila S2 cells (i.e., cell incubation in Krebs Ringers Bicarbonate buffer, KRB, (<xref ref-type="bibr" rid="bib21">Gaccioli et al., 2006</xref>)) leads to inhibition of protein transport through the secretory pathway, as shown by monitoring the plasma membrane localization of the transmembrane reporter Delta (<xref ref-type="bibr" rid="bib32">Kondylis and Rabouille, 2003</xref>). In cells grown in Schneider's, Delta reaches the plasma membrane, whereas in KRB, it is retained intracellularly (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Amino-acid starvation also results in the formation of novel Sec16-positive spherical structures (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). In addition to Sec16, these structures also contain COPII subunits Sec23, the two Sec24 orthologs Sec24AB (CG1472, Hau) (<xref ref-type="bibr" rid="bib42">Norum et al., 2010</xref>) and Sec24CD (CG10882, Sten) (<xref ref-type="bibr" rid="bib20">Forster et al., 2010</xref>), and Sec31, and we therefore name them &#x2018;Sec bodies&#x2019;. Conversely, Sec bodies do not contain Sar1 (<xref ref-type="fig" rid="fig1">Figure 1C</xref>), COPI components and clathrin (not shown). They also do not contain dGRASP (that amino-acid starvation drives to complete dispersion in the cytoplasm), the TGN GRIP-domain protein dGCC185, and the Golgi integral membrane protein, Fringe-GFP (<xref ref-type="fig" rid="fig1">Figure 1D</xref>), although these two latter proteins are often found in close proximity to Sec bodies. The morphology of the ER, on the other hand, does not seem affected by amino-acid starvation (not shown).</p><p>Quantitation of this starvation phenotype reveals that although Sec bodies are present in 20% of cells after 1 hr of amino-acid starvation, it takes between 4 hr and 6 hr to get 90% of the cells displaying the typical Sec body pattern (<xref ref-type="fig" rid="fig1">Figure 1E</xref>), that is 7 &#xb1; 3 Sec bodies/cell, including 1 to 5 with a diameter comprised between 0.6 and 0.8 &#x3bc;m. Interestingly, 4&#x2013;6 hr corresponds to the end of the autophagy peak, a degradative pathway stimulated by starvation (<xref ref-type="bibr" rid="bib31">Klionsky et al., 2012</xref>) (<xref ref-type="fig" rid="fig1s1">Figure 1&#x2014;figure supplement 1A&#x2032;</xref>) as assessed by the appearance of Atg5 punctae (<xref ref-type="fig" rid="fig1s1">Figure 1&#x2014;figure supplement 1A,A&#x2032;</xref>). In this regard, pharmacological inhibition of autophagy (by wortmanin or bafilomycin) results in a premature formation of Sec bodies (<xref ref-type="fig" rid="fig1s1">Figure 1&#x2014;figure supplement 1B,B&#x2032;</xref>), consistent with the notion that Sec bodies form in response to a reduced level of intracellular amino-acid concentration.</p><p>Given the Sec body content in COPII subunits, we used immuno-electron microscopy (IEM) to test whether they are not simply a collection of COPII vesicles. Sec bodies are electron dense structures and non-membrane bound, although small membrane profiles can occasionally be observed in their core and often ER is in close proximity (<xref ref-type="fig" rid="fig2">Figure 2A</xref>, arrows). Sec body formation is associated with the loss of the typical early secretory pathway morphology (<xref ref-type="bibr" rid="bib33">Kondylis and Rabouille, 2009</xref>). ERES and Golgi stacks are no longer visible.<fig id="fig2" position="float"><object-id pub-id-type="doi">10.7554/eLife.04132.009</object-id><label>Figure 2.</label><caption><title>Sec bodies are non-membrane bound structures.</title><p>(<bold>A</bold>) Immuno-electron microscopy (IEM) visualization of Sec16 (10 nm colloidal gold) in Sec bodies in ultrathin sections of S2 cells incubated in KRB for 4 hr. Arrows point to membrane in close proximity of Sec bodies. E, endosomes; n, nucleus; m, mitochondria. (<bold>B</bold>) Visualization of Sec bodies (Sec16, green) and lipid droplets (marked by oil-red-O, red). Note that 95% of Sec bodies do not co-localize with lipid droplets. (<bold>C</bold>&#x2013;<bold>C&#x2032;</bold>) Visualization of Sec bodies (Sec16, red) and Atg5-GFP punctae (<bold>C</bold>) and GFP-Atg8 (<bold>C&#x2032;</bold>) after 4 hr starvation. Note that 82% of Sec bodies do not co-localize with Atg5 or Atg8 punctae. Scale bars: 500 nm (<bold>A</bold>); 10 &#x3bc;m (<bold>B</bold>, <bold>C</bold>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.009">http://dx.doi.org/10.7554/eLife.04132.009</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132f002"/></fig></p><p>Sec body formation is specific for amino-acid starvation as heat shock, ER stress (tunicamycin and DTT treatment), glucose starvation, oxidative stress (arsenate treatment), hypoxia (1% O<sub>2</sub> for 19 hr), and respiration uncoupling (CCCP for 4 hr) do not lead to this response (not shown). Furthermore, to assess whether Sec bodies form in response to the withdrawal of specific amino-acids, cells were incubated in KRB in the presence of individual amino-acids. Histidine, aspartate, and asparagine (at 15 mM) strongly prevent Sec body formation but others also do so, albeit more mildly (<xref ref-type="fig" rid="fig1s2">Figure 1&#x2014;figure supplement 2</xref>), suggesting that the signaling pathway is complex. Taken together, we demonstrate that amino-acid starvation leads to the remodeling of ERES components into Sec bodies.</p><p>Sec bodies seemingly also form in vivo, for instance in ovaries starved either ex vivo or dissected from starved female flies (<xref ref-type="fig" rid="fig1s3">Figure 1&#x2014;figure supplement 3</xref>). We also asked whether they form in mammalian cells. Although we do observe some degrees of remodeling of COPII components upon mammalian cell starvation, it remains unclear whether the resulting structures are Sec bodies (<xref ref-type="fig" rid="fig1s4">Figure 1&#x2014;figure supplement 4</xref>). However, when human Sec16A is transfected in S2 cells, it is efficiently recruited to Sec bodies along with the endogenous components (<xref ref-type="fig" rid="fig1s5">Figure 1&#x2014;figure supplement 5</xref>). This suggests that in mammalian cells, Sec body formation is perhaps less pronounced due to different signaling events and not to the properties of the ERES components themselves (at least Sec16).</p></sec><sec id="s2-2"><title>Sec bodies are a novel stress assembly</title><p>The IEM analysis shows that Sec bodies are not endosomes or lipid droplets, as their ultrastructure is very different from these organelles [see (<xref ref-type="bibr" rid="bib56">Teixeira et al., 2003</xref>), for lipid droplet ultrastructure in Drosophila]. This is confirmed by the fact that Sec bodies are negative for neutral lipids stained by oil red O that stains lipid droplet content (<xref ref-type="fig" rid="fig2">Figure 2B</xref>).</p><p>As mentioned above, amino-acid starvation is known to induce autophagy, but we demonstrate that Sec bodies are not autophagosomes, as they do not co-localize with Atg5 or Atg8 (<xref ref-type="fig" rid="fig2">Figure 2C</xref>). Furthermore, as Sec bodies do not contain dGRASP, they are clearly different from the recently described yeast &#x2018;compartment for unconventional protein secretion&#x2019; (CUPS) (<xref ref-type="bibr" rid="bib10">Bruns et al., 2011</xref>).</p><p>Amino-acid starvation also results in protein translation inhibition/stalling that leads to the accumulation of untranslated mRNAs. Those are stored in Stress Granules (<xref ref-type="bibr" rid="bib30">Kedersha et al., 1999</xref>; <xref ref-type="bibr" rid="bib4">Anderson and Kedersha, 2008</xref>), or degraded in Processing Bodies (P-Bodies), both cytoplasmic ribonucleoprotein particles (RNPs) comprising mRNAs, RNA binding proteins, RNA processing machineries (P-bodies), and translation initiation factors (Stress Granules). We therefore tested whether Sec bodies are related to these structures. We visualized Stress Granules using endogenous FMR1 (Fragile X mental retardation protein 1), an RNA binding protein, and elF4E, a translation initiation factor, and P-bodies with Tral (Trailer Hitch), a like-SM protein. In normal growth conditions, FMR1, elF4E, and Tral are largely diffuse in the cytoplasm and Tral is also found in small punctae representing steady-state P-bodies (<xref ref-type="fig" rid="fig3">Figure 3A</xref>) (<xref ref-type="bibr" rid="bib18">Eulalio et al., 2007</xref>). Upon amino-acid starvation, as expected, Stress Granules form and P-Bodies enlarge (<xref ref-type="fig" rid="fig3">Figure 3A</xref>) (<xref ref-type="bibr" rid="bib52">Shimada et al., 2011</xref>) in agreement with reported phenotypes in many cell types, (<xref ref-type="bibr" rid="bib12">Buchan et al., 2008</xref>; <xref ref-type="bibr" rid="bib55">Stoecklin and Kedersha, 2013</xref>). In S2 cells, they form a dual structure, Stress Granule/P-Bodies (SG/PB), in which FMR1 strictly co-localizes with Tral (<xref ref-type="fig" rid="fig3">Figure 3A</xref>).<fig id="fig3" position="float"><object-id pub-id-type="doi">10.7554/eLife.04132.010</object-id><label>Figure 3.</label><caption><title>Sec bodies are distinct from Stress Granules and P-bodies.</title><p>(<bold>A</bold>) IF visualization of endogenous FMR1, eIF4E (green), and Tral (red) in cells growing in Schneider's and incubated in KRB for 4 hr. Note that upon starvation, Stress Granules (FMR1, eIF4E) form and P-Bodies (Tral) enlarge to co-localize in SG/PBs. (<bold>B</bold>) IF visualization of Sec16 (Sec bodies) and FMR1 (SG/PB) in cells incubated in KRB for 4 hr. Sec bodies and SG/PBs are distinct structures but have a spatial relationship. (<bold>C</bold>) IEM visualization of FRM1 and Tral in ultrathin sections of S2 cell incubated with KRB for 4 hr. Note that the Tral and FMR1 positive SG/PBs (asterisk) are clearly different from Sec bodies (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). Scale bars: 10 &#x3bc;m (<bold>A</bold>, <bold>B</bold>); 500 nm (<bold>C</bold>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.010">http://dx.doi.org/10.7554/eLife.04132.010</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132f003"/></fig></p><p>Sec bodies and SG/PBs form under the same conditions and in the same time frame, and although they have a spatial relationship and are often found adjacent to each other, Sec bodies are clearly distinct from SG/PBs (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). To confirm that they are indeed different structures, we also performed IEM of FMR1 and Tral in starved cells (<xref ref-type="fig" rid="fig3">Figure 3C</xref>) and compared them to Sec bodies (<xref ref-type="fig" rid="fig2">Figure 2A</xref>). The FMR1/Tral positive structures are less electron dense, round and regular, and they appear to be often surrounded by mitochondria, which is not the case for Sec bodies.</p><p>Taken together, these results show that Sec bodies are a novel stress assembly triggered by amino-acid starvation that is distinct from compartments and structures that are also formed upon this condition.</p></sec><sec id="s2-3"><title>Sec bodies form at ERES</title><p>We then asked how Sec bodies form. Time-lapse imaging of live cells using GFP-Sec23 reveals that once the cells sense amino-acid depletion, a pool of ERES rapidly disappears by releasing their components in the cytoplasm, and the remaining ones are rapidly transformed into smaller round structures. These small structures do not seem to efficiently fuse with one another. Instead, they seem to act as a seed and grow by recruiting ERES components from the cytoplasm where they were released to reach the typical Sec body size (<xref ref-type="fig" rid="fig4">Figure 4A</xref>, and <xref ref-type="other" rid="video1">Video 1</xref>).<fig id="fig4" position="float"><object-id pub-id-type="doi">10.7554/eLife.04132.011</object-id><label>Figure 4.</label><caption><title>Sec bodies form at ERES but COPII- and COPI-coated vesicle formation is not required.</title><p>(<bold>A</bold>) Stills of a GFP-Sec23 time-lapse video of a cell incubated in KRB (t &#x3d; 0) for 60 min showing Sec body formation. (<bold>B</bold>&#x2013;<bold>B&#x2033;</bold>) IF visualization of miniSec16-V5 (<bold>B</bold>, <bold>B&#x2032;</bold>) and &#x394;NC2-3-Sec16-V5 (<bold>B</bold>, <bold>B&#x2033;</bold>) in S2 cells incubated in Schneider's (<bold>B</bold>) and KRB for 4 hr. Endogenous Sec16 is in red. Note that the cup-shaped ER forms a cradle for Sec bodies (<bold>B&#x2032;</bold>, insert). (<bold>C</bold>) IF visualization of Sec16 and GFP-Sec23 in mock and Sar1-depleted S2 cells grown in Schneider's and incubated in KRB for 4 hr. Note that the ERES are enlarged in Sar1-depleted cells (arrows) and Sec bodies form in both conditions to the same extent. (<bold>D</bold>) IF visualizations of Sec16 and Delta-myc in S2 cells incubated with brefeldin A (BFA) in Schneider's and KRB for 3 hr. Note that Delta transport is inhibited in both cases as Delta is retained intracellularly. (<bold>E</bold>) IF visualization of Sec16 in S2 cells grown in Schneider's and incubated in KRB for 4 hr in the presence or absence of brefeldin A (BFA). Note that pre-incubation with the drug does not affect Sec body formation during starvation. Scale bars: 10 &#x3bc;m.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.011">http://dx.doi.org/10.7554/eLife.04132.011</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132f004"/></fig><media id="video1" content-type="glencoe play-in-place height-250 width-310" xlink:href="elife04132v001.mov" mimetype="video" mime-subtype="mov"><object-id pub-id-type="doi">10.7554/eLife.04132.012</object-id><label>Video 1.</label><caption><title>Time-lapse movie of Sec body formation.</title><p>GFP-Sec23 time-lapse video of two cells incubated in KRB (t &#x3d; 0) for 1 hr. One frame was taken every 3 min and the videos are displayed at 7 frame/s (related to <xref ref-type="fig" rid="fig4">Figure 4A</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.012">http://dx.doi.org/10.7554/eLife.04132.012</ext-link></p></caption></media></p><p>To assess, as suggested by the time-lapse, whether Sec bodies form at ERES, we used a truncated version of Sec16, miniSec16 (690-1954), which comprises the minimal Sec16 sequence required for ERES localization (<xref ref-type="bibr" rid="bib27">Ivan et al., 2008</xref>) (<xref ref-type="fig" rid="fig4">Figure 4B</xref>) but is not incorporated into Sec bodies upon amino-acid starvation (<xref ref-type="fig" rid="fig4">Figure 4B&#x2032;</xref>). Instead, miniSec16 remains associated to the cup-shaped ER of the ERES and seems to cradle the forming Sec bodies (marked by endogenous Sec16; <xref ref-type="fig" rid="fig4">Figure 4B&#x2032;</xref>). This indicates that Sec bodies form where ERES were present, in line with their observed proximity to ER membrane (arrows in <xref ref-type="fig" rid="fig2">Figure 2A</xref>).</p><p>The time-lapse also suggested that the Sec body enlargement is mediated by recruitment of ERES components that have been dispersed in the cytoplasm. To test this further, we used a Sec16 deletion mutant (&#x394;NC2-3) that does not localize to ERES and is mostly cytoplasmic (<xref ref-type="fig" rid="fig4">Figure 4B</xref>) because it lacks the region that mediates its recruitment to ERES (NC2-3) (<xref ref-type="bibr" rid="bib27">Ivan et al., 2008</xref>). We found that it is efficiently recruited to Sec bodies, showing that Sec16 can be recruited from the cytoplasm and contributes to Sec body enlargement (<xref ref-type="fig" rid="fig4">Figure 4B&#x2033;</xref>). Furthermore, this result indicates that the localization to ERES prior to starvation is not necessary for incorporation to Sec bodies. Importantly, the recruitment of this cytosolic mutant is not due to its interaction with endogenous Sec16 as the NC2-3 also contains the Sec16 oligomerization domain (<xref ref-type="bibr" rid="bib27">Ivan et al., 2008</xref>). This suggests that a distinct Sec16 domain responds to amino-acid starvation.</p><p>Taken together, these results show that Sec bodies form (at least initially) where ERES were located and increase in size by recruiting ERES components dispersed in the cytoplasm.</p></sec><sec id="s2-4"><title>Sec body assembly does not require active transport through the early secretory pathway but depends on specific ERES components</title><p>We then ask whether membrane traffic through the early secretory pathway is required for Sec body formation. To test if COPII vesicle formation is required, we depleted Sar1 by RNAi before starvation. Sar1 depletion is evidenced by a strong reduction (40 &#xb1; 5%) in cell proliferation and ERES enlargement (<xref ref-type="bibr" rid="bib27">Ivan et al., 2008</xref>) (<xref ref-type="fig" rid="fig4">Figure 4C</xref>, arrows). However, Sec body formation was found to be as efficient as in control (mock depleted) cells (<xref ref-type="fig" rid="fig4">Figure 4C</xref>). Second, we pharmacologically inhibited protein trafficking with Brefeldin A (<xref ref-type="fig" rid="fig4">Figure 4D</xref>) and found that this treatment before and during starvation does not affect Sec body formation (<xref ref-type="fig" rid="fig4">Figure 4E</xref>). This demonstrates that transport in the early secretory pathway via COPI and COPII vesicle formation is not required for the formation of Sec bodies.</p><p>Given the Sec body content in ERES components (<xref ref-type="fig" rid="fig1">Figure 1</xref>), we then tested using RNAi if they are necessary for Sec body formation. Depleting Sec16 did not yield satisfactory conclusions as we have shown that Sec16 is critical for the organization of ERES in Drosophila S2 cells (<xref ref-type="bibr" rid="bib27">Ivan et al., 2008</xref>) and Sec16 depletion led to the aggregation of most of the COPII components even in cells grown in full medium (see <xref ref-type="fig" rid="fig2">Figure 2A&#x2013;C&#x2033;</xref> of <xref ref-type="bibr" rid="bib27">Ivan et al., 2008</xref>). However, in the few depleted cells where an observation could be made, Sec bodies did not form (not shown).</p><p>We then depleted the two Sec24 gene products that are both expressed in S2 cells (see DRSC, Drosophila RNAi screening center, <ext-link xmlns:xlink="http://www.w3.org/1999/xlink" ext-link-type="uri" xlink:href="http://www.flyrnai.org/">http://www.flyrnai.org/</ext-link>) (see &#x2018;Materials and methods&#x2019; for depletion controls). When Sec24AB-depleted cells are starved, the normal Sec body formation (marked by Sec16, <xref ref-type="fig" rid="fig5">Figure 5A</xref>) is impaired (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). The distribution of diameters of the resulting structures shows that they are twofold smaller and twice as many, when compared to Sec bodies in mock-depleted cells (<xref ref-type="fig" rid="fig5">Figure 5E</xref>). In agreement with Sec24 forming a complex with Sec23, Sec23 depletion also results in the same phenotype (<xref ref-type="fig" rid="fig5">Figure 5C,E</xref>). These smaller structures are not classical Sec bodies. By IF, some of them appear to have a horseshoe shape. By IEM, they appear as a collection of Sec16 positive vesicular and tubular membrane profiles, some small, some large probably corresponding to ERES mixed with Golgi fragments, and a third category that we name &#x2018;intermediates&#x2019; as they are reminiscent of Sec bodies by their round shape but that contain membrane and are smaller in size when compared to Sec bodies found in mock-depleted cells (<xref ref-type="fig" rid="fig5s1">Figure 5&#x2014;figure supplement 1</xref>).<fig-group><fig id="fig5" position="float"><object-id pub-id-type="doi">10.7554/eLife.04132.013</object-id><label>Figure 5.</label><caption><title>Sec23 and Sec24AB are key factors for Sec body formation.</title><p>(<bold>A</bold>&#x2013;<bold>D</bold>) IF visualization of Sec16 in mock (<bold>A</bold>), Sec24AB (<bold>B</bold>), Sec23 (<bold>C</bold>), and Sec24CD (<bold>D</bold>) depleted S2 cells in Schneider's and incubated in KRB for 4 hr. Note that Sec body formation is inhibited upon Sec24AB and Sec23, but not upon Sec24CD depletion. Boxed areas are shown at higher magnification. (<bold>E</bold>) Distribution of Sec body size (shown as frequency of observed Sec body diameter) in mock, Sec24AB, Sec24CD, and Sec23-depleted and starved cells (as in <bold>A</bold>) (dsGFP: 45 cells, 341 Sec bodies; dsSec24AB: 43 cells, 585 Sec bodies; dsSec24CD: 35 cells, 245 Sec bodies; dsSec23: 36 cells, 504 Sec bodies). Note that the Sec body's mean diameter decreases by 1.8-fold upon Sec24AB and Sec23 depletion and that Sec bodies are twice as many. Scale bars: 10 &#x3bc;m.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.013">http://dx.doi.org/10.7554/eLife.04132.013</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132f005"/></fig><fig id="fig5s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04132.014</object-id><label>Figure 5&#x2014;figure supplement 1.</label><caption><title>The smaller structures generated in starved Sec24AB-depleted cells are not Sec bodies.</title><p>(<bold>A</bold>) Sec16 positive horseshoe shape structures observed by IF. B: Gallery of Sec16 positive IEM profiles: smaller clusters of membrane, larger ones probably corresponding to ERES mixed with Golgi fragments, intermediate structures (round shape but with membrane in their core and of smaller size than typical Sec bodies). Scale bars: 2 &#x03BC;m (<bold>A</bold>) and 500 nm (<bold>B</bold>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.014">http://dx.doi.org/10.7554/eLife.04132.014</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132fs006"/></fig></fig-group></p><p>Interestingly, Sec24CD depletion (<xref ref-type="fig" rid="fig5">Figure 5D,E</xref>) does not lead to the same phenotype as Sec24AB depletion and Sec bodies form seemingly normally, showing specificity for one Sec24 homologue.</p><p>Taken together, this indicates a key and novel role for Sec23, Sec24AB (and perhaps Sec16) in Sec body formation, which is distinct from their classical role in ER exit via COPII vesicle formation that is not required (<xref ref-type="fig" rid="fig4">Figure 4C&#x2013;E</xref>).</p></sec><sec id="s2-5"><title>Sec bodies display liquid droplet-like properties: role of low complexity sequences</title><p>Given that the Sec bodies are non-membrane bound, we then asked how their components are prevented from freely diffusing in the cytoplasm. One class of stress related cytoplasmic structures are liquid droplets that are described to result from phase separation-induced liquid demixing in the cytoplasm (<xref ref-type="bibr" rid="bib8">Brangwynne et al., 2009</xref>, <xref ref-type="bibr" rid="bib9">2011</xref>; <xref ref-type="bibr" rid="bib26">Hyman and Simons, 2012</xref>). They are defined as non-membrane bound, spherical, reversible structures, the components of which diffuse easily within the droplet but are in slower exchange with the cytoplasm. Furthermore, liquid droplets are known to contain proteins that are prone to engage in weak protein&#x2013;RNA or protein&#x2013;protein interactions as their components display a high level of low complexity sequences (LCS, defined as regions of low amino-acid diversity) (<xref ref-type="bibr" rid="bib29">Kato et al., 2012</xref>) (<xref ref-type="supplementary-material" rid="SD1-data">Figure 6&#x2014;Source data 1</xref>). P-granules in <italic>C. elegans</italic>, nucleoli, but also Stress Granules and P-bodies have been shown to have liquid droplet properties (<xref ref-type="bibr" rid="bib8">Brangwynne et al., 2009</xref>, <xref ref-type="bibr" rid="bib9">2011</xref>; <xref ref-type="bibr" rid="bib26">Hyman and Simons, 2012</xref>). We therefore set out to assess whether Sec bodies are also liquid droplets.</p><p>First, we used SEG, a bioinformatics tool that determines the LCS content of proteins recruited to the Sec bodies. Interestingly, we found that Sec16 and the two Sec24 gene products, Sec24AB, Sec24CD (<xref ref-type="fig" rid="fig6">Figure 6A</xref>) display a significantly higher LCS content when compared to other proteins related to the early secretory pathway and to the entire Drosophila proteome (our analysis, see &#x2018;Materials and methods&#x2019;, <xref ref-type="fig" rid="fig6">Figure 6A&#x2032;</xref>; <xref ref-type="supplementary-material" rid="SD1-data">Figure 6&#x2014;Source data 1</xref>). Sec16 LCSs are situated throughout its sequence with the notable exception of its conserved central domain (CCD, aa 1090&#x2013;1590) (<xref ref-type="fig" rid="fig6">Figure 6A</xref>). On the other hand, Sec24AB and Sec24CD LCSs are mostly situated at the N-terminus of the protein sequence in a manner that is partially conserved throughout evolution (<xref ref-type="fig" rid="fig6s1">Figure 6&#x2014;figure supplement 1</xref>). Furthermore, as recently suggested (<xref ref-type="bibr" rid="bib17">Das et al., 2014</xref>), LCSs correspond to a high level of unstructured sequences and we show that it is indeed the case for Sec24AB, Sec24CD, and Sec16 (using HHpred, <ext-link xmlns:xlink="http://www.w3.org/1999/xlink" ext-link-type="uri" xlink:href="http://toolkit.tuebingen.mpg.de/hhpred/">http://toolkit.tuebingen.mpg.de/hhpred/</ext-link>), <xref ref-type="fig" rid="fig6s2">Figure 6&#x2014;figure supplement 2</xref> and not shown, respectively).<fig-group><fig id="fig6" position="float"><object-id pub-id-type="doi">10.7554/eLife.04132.015</object-id><label>Figure 6.</label><caption><title>Sec body proteins contain low complexity sequences that are necessary for Sec body recruitment.</title><p>(<bold>A</bold>&#x2013;<bold>A&#x2032;</bold>) Schematic representation of the Low Complexity Sequences (blue bars) in Sec16, Sec24AB, Sec24CD, and Sec23 (A). The red bars mark the boundaries of the Sec16 domains. Genome wide analysis of Low Complexity Sequence (LCS) in the Drosophila proteome, in proteins related to the secretory pathway and proteins related to Stress Granules/P-bodies (<bold>A&#x2032;</bold>). <bold>B</bold>: IF localization of sfGFP-tagged full-length Sec24B, Sec24AB LCS, and Sec24AB nonLCS in S2 cells in Schneider's and KRB for 4 hr, together with endogenous Sec16 (red). Scale bars: 10 &#x3bc;m.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.015">http://dx.doi.org/10.7554/eLife.04132.015</ext-link></p><p><supplementary-material id="SD1-data"><object-id pub-id-type="doi">10.7554/eLife.04132.016</object-id><label>Figure 6&#x2014;Source data 1.</label><caption><title>Table showing the LCS content of proteins related to Stress Granules and P-bodies as well as the early secretory pathway (related to <xref ref-type="fig" rid="fig6">Figure 6A,A&#x2032;</xref>).</title><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.016">http://dx.doi.org/10.7554/eLife.04132.016</ext-link></p></caption><media xlink:href="elife04132s001.pdf" mimetype="application" mime-subtype="pdf"/></supplementary-material></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132f006"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04132.017</object-id><label>Figure 6&#x2014;figure supplement 1.</label><caption><title>LCS content of Sec24 in different species.</title><p>(<bold>A</bold>) A restricted phylogenic tree of the Sec24 sequences analyzed in (<bold>B</bold>) Note that <italic>S. pombe</italic> and <italic>S. cerevisiae</italic> Sec24 are similar to each other and to <italic>H. sapiens</italic> Sec24C and D, and <italic>D. melanogaster</italic> Sec24CD. However, they are distant to <italic>D. melanogaster</italic> Sec24AB, <italic>H. sapiens</italic> Sec24A and <italic>B</italic>. Furthermore, <italic>D. melanogaster</italic> Sec24AB is distant to <italic>D. melanogaster</italic> Sec24CD. (<bold>B</bold>) LCS analysis and schematics in Sec24 sequences of different organisms. Note that most sequences contain a significant percentage of LCS in the N-terminal third of the protein with the exception of <italic>S. pombe</italic>, <italic>A. melifera</italic> and <italic>G. gallus</italic> (related to <xref ref-type="fig" rid="fig6">Figure 6A</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.017">http://dx.doi.org/10.7554/eLife.04132.017</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132fs007"/></fig><fig id="fig6s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04132.018</object-id><label>Figure 6&#x2014;figure supplement 2.</label><caption><title>Secondary structure prediction of Drosophila Sec24AB using HH pred.</title><p>C/c denotes the unstructured, H/h the alpha helices, and E/e, the beta sheets. Note their absence in the 405 amino-acids of the N-terminus corresponding to LCS.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.018">http://dx.doi.org/10.7554/eLife.04132.018</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132fs008"/></fig><fig id="fig6s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04132.019</object-id><label>Figure 6&#x2014;figure supplement 3.</label><caption><title>Sec24AB LCS is not sufficient to drive Sec body formation.</title><p>S2 cells were depleted of endogenous Sec24AB. When starved (KRB), this resulted in the formation of small structures (as in <xref ref-type="fig" rid="fig5">Figure 5</xref>). The transfection of Sec24AB LCS-sfGFP in these depleted cells did not rescue the formation of Sec bodies. Scale bars: 10 &#x03BC;m.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.019">http://dx.doi.org/10.7554/eLife.04132.019</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132fs009"/></fig></fig-group></p><p>Remarkably, two of the LCS enriched proteins Sec24AB and Sec16 are also required for Sec body assembly, suggesting that this feature might be necessary. However, not all ERES residing and LCS rich proteins are necessary for Sec body formation, as Sec24CD that contains the same amount of LCS, is not.</p><p>We then tested whether LCSs were necessary for protein recruitment to Sec bodies and/or sufficient for their formation. We focused on Sec24AB as the LCSs are clustered to the first 415 amino-acids at the N-terminus (Sec24AB LCS) and compared their Sec body recruitment to this of its nonLCS region (aa 416&#x2013;1184) (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). LCS-sfGFP is largely recruited to ERES under normal growth conditions although not as efficiently as full-length Sec24AB. Under starvation conditions, it localizes to Sec bodies as full-length Sec24AB and seems to lead to their enlargement. This demonstrates that the LCS rich region of Sec24AB is sufficient to mediate recruitment to Sec bodies. Conversely, the nonLCS region is mostly cytoplasmic and remains largely so upon starvation, although a small pool is recruited to the Sec bodies. This shows that the LCS rich N-terminus region of Sec24AB plays a key role in recruitment of Sec24 to Sec bodies.</p><p>We then tested whether the Sec24AB LCS was sufficient to drive Sec body formation. To do so, cells were depleted of endogenous Sec24AB (resulting in the formation of Sec16 positive smaller structures) followed by the expression of Sec24AB LCS. If this is sufficient, we expect that Sec bodies would form. However, although Sec24AB LCS is recruited to the smaller structures, Sec bodies did not significantly form (<xref ref-type="fig" rid="fig6s3">Figure 6&#x2014;figure supplement 3</xref>). This suggests that either the nonLCS region of Sec24AB participates to Sec body formation, even though on its own, it is only slightly recruited, or that one or multiple other factors are involved in driving Sec body formation.</p></sec><sec id="s2-6"><title>Sec bodies have FRAP properties compatible with liquid droplets</title><p>Second, we assessed whether the FRAP properties of Sec bodies are compatible with liquid droplets, that is, assemblies made through phase separation. When a fraction of such an assembly (GFP marked) is photobleached, the recovery is quick as the molecules within mix instantaneously. However, when entirely photobleached, the recovery is slower as the exchange with the surrounding cytoplasm is not as efficient. We used Sec16-sfGFP and GFP-Sec23 that are efficiently incorporated to Sec bodies. When Sec bodies are partially bleached, the recovery is very fast for both GFP-Sec23 and Sec16-sfGFP, and the maximum intensity is approximately 50% of the original one. After complete photobleaching, however, Sec bodies recover more slowly and only to 10% of the initial fluorescence intensity, showing an inefficient exchange with the surrounding cytoplasm (<xref ref-type="fig" rid="fig7">Figure 7A,A&#x2032;</xref>; <xref ref-type="other" rid="video2">Video 2</xref> and <xref ref-type="other" rid="video3">Video 3</xref>). This is comparable to FRAP properties of Stress Granules that are well-documented liquid droplets. When entirely bleached, Stress Granules recover more than Sec bodies and when partially bleached, they recover slightly less (<xref ref-type="fig" rid="fig7">Figure 7B,B&#x2032;</xref>; <xref ref-type="other" rid="video4">Video 4</xref> and <xref ref-type="other" rid="video5">Video 5</xref>. This indicates that the Sec23 and Sec16 diffuse more quickly within Sec bodies than FMR1 in Stress Granules, but that their phase transition barrier is higher.<fig id="fig7" position="float"><object-id pub-id-type="doi">10.7554/eLife.04132.020</object-id><label>Figure 7.</label><caption><title>Sec bodies have FRAP properties consistent with liquid droplets.</title><p>(<bold>A</bold>&#x2013;<bold>A&#x2032;</bold>) Percentage of fluorescence recovery after photobleaching (FRAP) over time of individual Sec bodies, marked by GFP-Sec23 (<xref ref-type="other" rid="video2">Video 2</xref>), and &#x394;NC1-Sec16-sfGFP (<xref ref-type="other" rid="video3">Video 3</xref>) in S2 cells incubated in KRB for 4 hr. The triangles in B show the FRAP of Sec bodies that have been entirely bleached (n &#x3d; 3, arrowheads in <bold>B&#x2032;</bold>). The circles show the FRAP of Sec bodies (n &#x3d; 3, arrows in <bold>B&#x2032;</bold>) that have been partially bleached. The dashed circles in <bold>B&#x2032;</bold> indicate the Sec bodies that have been entirely bleached and assessed in stills taken from <xref ref-type="other" rid="video2 video3">Video 2 and 3</xref>. (<bold>B</bold>&#x2013;<bold>B&#x2032;</bold>) Percentage of fluorescence recovery after photobleaching (FRAP) over time of individual Stress Granules marked by FMR1-sfGFP (<xref ref-type="other" rid="video4 video5">Video 4 and 5</xref>) in S2 cells incubated in KRB for 4 hr. The triangles in C show the FRAP of Stress Granules that have been entirely bleached (n &#x3d; 3, arrowheads in <bold>C&#x2032;</bold>). The circles show the FRAP of Stress Granules (n &#x3d; 3, arrows in <bold>B&#x2032;</bold>) that have been partially bleached. The dashed circles in <bold>B&#x2032;</bold> indicate the Stress Granules that have been bleached and assessed in stills taken from <xref ref-type="other" rid="video4 video5">Video 4 and 5</xref>. Scale bars: 10 &#x3bc;m.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.020">http://dx.doi.org/10.7554/eLife.04132.020</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132f007"/></fig><media id="video2" content-type="glencoe play-in-place height-250 width-310" xlink:href="elife04132v002.mov" mimetype="video" mime-subtype="mov"><object-id pub-id-type="doi">10.7554/eLife.04132.021</object-id><label>Video 2.</label><caption><title>FRAP of one half-bleached Sec body and one fully bleached.</title><p>FRAP video of two GFP-Sec23 positive Sec bodies, one photobleached partially and one entirely, recorded every 10 ms for at least 20 s, and then every minute. The video is displayed at 7 frame/s (related to <xref ref-type="fig" rid="fig7">Figure 7B&#x2032;</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.021">http://dx.doi.org/10.7554/eLife.04132.021</ext-link></p></caption></media><media id="video3" content-type="glencoe play-in-place height-250 width-310" xlink:href="elife04132v003.mov" mimetype="video" mime-subtype="mov"><object-id pub-id-type="doi">10.7554/eLife.04132.022</object-id><label>Video 3.</label><caption><title>FRAP of a fully bleached Sec body.</title><p>FRAP video of one &#x394;NC1-Sec16-sfGFP positive Sec body entirely bleached, recorded every 10 ms for at least 20 s, and then every minute. The video is displayed at 7 frames/s (related to <xref ref-type="fig" rid="fig7">Figure 7B&#x2032;</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.022">http://dx.doi.org/10.7554/eLife.04132.022</ext-link></p></caption></media><media id="video4" content-type="glencoe play-in-place height-250 width-310" xlink:href="elife04132v004.mov" mimetype="video" mime-subtype="mov"><object-id pub-id-type="doi">10.7554/eLife.04132.023</object-id><label>Video 4.</label><caption><title>FRAP of a fully bleached Stress Granule.</title><p>FRAP video of one FMP1-sfGFP positive Stress Granule entirely bleached, recorded every 10 ms for at least 20 s, and then every minute. The video is displayed at 7 frames/s (related to <xref ref-type="fig" rid="fig7">Figure 7B&#x2032;</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.023">http://dx.doi.org/10.7554/eLife.04132.023</ext-link></p></caption></media><media id="video5" content-type="glencoe play-in-place height-250 width-310" xlink:href="elife04132v005.mov" mimetype="video" mime-subtype="mov"><object-id pub-id-type="doi">10.7554/eLife.04132.024</object-id><label>Video 5.</label><caption><title>FRAP of a partially bleached Stress Granule.</title><p>FRAP video of one FMP1-sfGFP positive Stress Granule partially bleached, recorded every 10 ms for at least 20 s, and then every minute. The video is displayed at 7 frames/s (related to <xref ref-type="fig" rid="fig7">Figure 7B&#x2032;</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.024">http://dx.doi.org/10.7554/eLife.04132.024</ext-link></p></caption></media></p><p>Taken together, the spherical morphology, specific FRAP properties, and the presence of LCSs are features compatible with Sec bodies being liquid droplets.</p></sec><sec id="s2-7"><title>Sec bodies are reversible</title><p>Third, we assessed the Sec body reversibility, a key feature of liquid droplets and we tested it using cells that were starved for 4 hr and further incubated in Schneider's. This results in the full recovery of their typical ERES pattern in less than 30 min (<xref ref-type="fig" rid="fig8">Figure 8A</xref>; <xref ref-type="other" rid="video6">Video 6</xref>; <xref ref-type="fig" rid="fig8s1">Figure 8&#x2014;figure supplement 1</xref>; <xref ref-type="fig" rid="fig8">Figure 8E</xref>). This convincingly shows that Sec bodies are not terminal aggregates. Furthermore, these ERES are functional as they support efficient transport in the secretory pathway (<xref ref-type="fig" rid="fig8">Figure 8B</xref>) to allow proliferation (<xref ref-type="fig" rid="fig9">Figure 9B</xref>, solid dark blue line).<fig-group><fig id="fig8" position="float"><object-id pub-id-type="doi">10.7554/eLife.04132.025</object-id><label>Figure 8.</label><caption><title>Sec bodies are functionally reversible and act as reservoir for ERES components during starvation.</title><p>(<bold>A</bold>) Stills of a GFP-Sec23 time-lapse video (<xref ref-type="other" rid="video6">Video 6</xref>) of two cells recovering in Schneider's after 4 hr in KRB (t &#x3d; 0, up to 60 min). Note that Sec bodies are reversed into ERES. (<bold>B</bold>) IF localization of Delta in cells that were starved (KRB) or not (Schneider's) followed further incubation in Schneider's for 2 hr. (<bold>C</bold>) Quantification of the percentage of cells with Delta at the plasma membrane in cells that were either starved (KRB) or not (Schneider's) followed by reversion in Schneider's. Delta was induced for 30, 60, 90, and 120 min while cells were reverted in Schneider's. (<bold>D</bold>&#x2013;<bold>D&#x2032;</bold>) IF visualization of Sec16 in cells starved in KRB supplemented or not with cycloheximide (CHX, <bold>B</bold>), and in starved cells further incubated in Schneider's supplemented or not with CHX (<bold>C&#x2032;</bold>). Note that neither Sec body formation nor reversal is affected by the presence of CHX. (<bold>E</bold>) Quantification of the Sec body reversal as described in <bold>B&#x2032;</bold> expressed as the percentage of cells exhibiting Sec bodies.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.025">http://dx.doi.org/10.7554/eLife.04132.025</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132f008"/></fig><fig id="fig8s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04132.026</object-id><label>Figure 8&#x2014;figure supplement 1.</label><caption><title>IF localization of Sec16 in cells recovering in Schneider's for 10&#x2013;30 min after 4 hr in KRB.</title><p>At 30 min, 90% of ERES are rebuilt. Note that the intensity of fluorescence of Sec16 is higher than in the cells that were maintained in Schneider&#x27;s, reflecting the storage of the ERES components in Sec bodies. Scale bars: 10 &#x03BC;m.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.026">http://dx.doi.org/10.7554/eLife.04132.026</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132fs010"/></fig></fig-group><media id="video6" content-type="glencoe play-in-place height-250 width-310" xlink:href="elife04132v006.mov" mimetype="video" mime-subtype="mov"><object-id pub-id-type="doi">10.7554/eLife.04132.027</object-id><label>Video 6.</label><caption><title>Sec bodies are reversible.</title><p>GFP-Sec23 time-lapse video of two cells recovering in Schneider's after 4 hr in KRB (t &#x3d; 0, up to 66 min). One frame was taken every 3 min and the video is displayed at 7 frame/s (related to <xref ref-type="fig" rid="fig8">Figure 8A</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.027">http://dx.doi.org/10.7554/eLife.04132.027</ext-link></p></caption></media><fig id="fig9" position="float"><object-id pub-id-type="doi">10.7554/eLife.04132.028</object-id><label>Figure 9.</label><caption><title>Sec body formation is a pro-survival mechanism.</title><p>(<bold>A</bold>) Western blot of Sec31, Sec23, and tubulin (loading control) of lysates from GFP, Sec16, Sec23, and Sec24AB-depleted cells grown in Schneider's (S) and incubated with KRB for 4 hr (K). (<bold>B</bold>) Graph of cell viability (expressed as percentage of alive cells). The number of starting cells at t &#x3d; 0, either non- (control, dark blue lines), mock- (dsGFP, light blue lines), Sec24AB (green lines), Sec24CD (violet lines), and double Sec24 AB and CD (orange lines) depleted, is set at 100%. These cells are incubated in Schneider's (dashed lines) and KRB (solid lines) for 4 hr and further incubated in Schneider's up to 16 hr. Note that the mock depletion (dsGFP, light blue dashed lines) is slightly detrimental to cell survival upon amino-acid starvation when compared to non-depleted (control, dark blue dashed line). (<bold>C</bold>) Quantification of the percentage of cells with Delta at the plasma membrane in mock-, Sec23, and Sec24AB-depleted cells that were either starved (KRB) or not (Schneider's) followed by reversion in Schneider's. Delta was induced for 90 min while cells were reverted in Schneider's. Error bars in B represent standard error of the mean and in C standard deviation.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04132.028">http://dx.doi.org/10.7554/eLife.04132.028</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04132f009"/></fig></p><p>Overall, although we have not been able to determine with certainty whether Sec bodies contain RNAs as all liquid droplets so far characterized do, we propose that amino-acid starvation leads to the formation of a novel stress assembly with liquid droplet features, the Sec bodies.</p></sec><sec id="s2-8"><title>Sec bodies act as a reservoir for COPII components and are necessary for cell viability during amino-acid starvation and recovery after stress relief</title><p>Remarkably, addition of protein translation inhibitor cycloheximide during the reversal does not affect the ERES re-building (<xref ref-type="fig" rid="fig8">Figure 8D&#x2032;,E</xref>). This suggests that Sec bodies act as a reservoir for ERES components allowing their re-mobilization upon stress relief to rebuild a functional secretory pathway. Of note, cycloheximide addition during starvation also does not affect Sec body formation (<xref ref-type="fig" rid="fig8">Figure 8D&#x2032;</xref>).</p><p>To test further whether Sec bodies act as a mechanism for ERES components during starvation preventing their degradation, we first monitored the level of ERES components during starvation. Remarkably, amino-acid starvation leads to an increased level of Sec16, Sec23, and Sec31 (<xref ref-type="fig" rid="fig9">Figure 9A</xref>; <xref ref-type="fig" rid="fig9">Figure 9A&#x2032;</xref>, compare lanes 1 and 2). We can rule out that this is due to an increase in protein translation during starvation as it is efficiently inhibited after 20 min (not shown). It is therefore likely that Sec body formation leads to a stabilization of the ERES components and therefore protect them against degradation.</p><p>We then asked whether this protection is inhibited when Sec bodies do not form. Upon Sec16, Sec23 and Sec 24AB depletion, we observed two things: the first is that under normal growth conditions, the level of Sec31 is higher than in mock-depleted cells (<xref ref-type="fig" rid="fig9">Figure 9A</xref>, compare lanes 3, 5 and 7 to lane 1). The second is that in depleted cells, this level is not maintained upon starvation. Sec31 level is decreased instead of being stabilized as in mock-depleted cells. Sec23 behaves similarly to Sec31. In Sec24AB-depleted cells, however, its level is reduced even in cells incubated in full medium, suggesting that Sec23 turnover depends on the presence of Sec24AB. Altogether, this experiment suggests that starvation leads to ERES component stabilization that is inhibited when Sec bodies do not form. This supports the notion that Sec bodies act as a reservoir for ERES components to rebuild a functional secretory pathway upon stress relief.</p><p>In this context, we investigated the relevance of Sec body formation in cell survival upon starvation and fitness upon stress relief. To do so, we exploited the fact that only one of the two Sec24 proteins is required for Sec body formation. Indeed, Sec bodies do not form in starved Sec24AB-depleted cells, whereas they do in Sec24CD-depleted cells (see <xref ref-type="fig" rid="fig5">Figure 5</xref>). As mentioned above, depletion of either of the Sec24 isoforms is effective but does not affect proliferation very much when cells are grown in normal medium (<xref ref-type="fig" rid="fig9">Figure 9B</xref>, dashed lines and see &#x2018;Materials and methods&#x2019;). However, upon amino-acid starvation, the number of Sec24AB-depleted cells decreases twice as much as the mock- (ds GFP) and Sec24CD-depleted cells (<xref ref-type="fig" rid="fig9">Figure 9B</xref>, compare solid green to light blue, violet lines). As expected, the double depleted Sec24AB and CD cells also decline more quickly (<xref ref-type="fig" rid="fig9">Figure 9B</xref>, solid orange line). When reverted to full medium, control and Sec24CD-depleted cells started to proliferate again, whereas the number of Sec24AB-depleted cells continues to diminish (<xref ref-type="fig" rid="fig9">Figure 9B</xref>).</p><p>As the absence of Sec bodies leads to a decreased stabilization of COPII components, one reason behind the cell lethality upon re-feeding could be the inefficient protein transport through the secretory pathway. To test this, we monitored the transport of Delta to the plasma membrane of starved mock-, and Sec24AB-depleted cells upon re-feeding for 90 min (<xref ref-type="fig" rid="fig9">Figure 9C</xref>). Mock-depleted cells efficiently transport Delta whether starved or not (<xref ref-type="fig" rid="fig9">Figure 9C</xref>; <xref ref-type="fig" rid="fig8">Figure 8C</xref>). Conversely, the efficiency of transport of Sec24AB-depleted cells after starvation is largely compromised, suggesting that formation of Sec bodies is critical for proper transport resumption. However, this result could simply be due to the depleted Sec24AB whose absence compromises transport even in cells kept in Schneider&#x2019;s.</p><p>Nevertheless, Delta transport in Sec24AB-depleted cells kept in Schneider's was found almost as efficient as mock-depleted cells, suggesting that Sec24CD compensates Sec24AB depletion. This indicates that the inhibition of Sec body formation, not the absence of Sec24AB, is detrimental to anterograde transport resumption.</p><p>Taken together, these results show that Sec body formation is instrumental to efficient resumption of protein transport through the secretory pathway that contributes to cell survival and growth after re-feeding.</p></sec></sec><sec sec-type="discussion" id="s3"><title>Discussion</title><sec id="s3-1"><title>Sec bodies: a novel stress assembly linked to secretion inhibition</title><p>Here, we describe a novel, reversible, and non-membrane bound structure, the Sec body that forms in response to nutrient stress. Sec bodies comprise proteins that in normal growth conditions function as ERES components, including subunits of the COPII coat, namely Sec23, Sec24AB, Sec24CD, and Sec31 as well as Sec16, the upstream ERES organizer. A noticeable exception is the small GTPase Sar1. One reason for this could be that Sar1 is devoid of LCS and this is currently under further investigation.</p><p>Interestingly, the components of the other coats were seemingly not incorporated into Sec bodies but also did not form other structures, suggesting that remodeling of the ERES is sufficient to ensure inhibition of protein transport through the secretory pathway. In this regard, Sec body formation constitutes also a novel mechanism for attenuation/inhibition of protein transport through the secretory pathway. Cells can disperse ERES and Golgi components into the cytoplasm, as reported during mitosis the Golgi is fragmented (<xref ref-type="bibr" rid="bib39">Lucocq and Warren, 1987</xref>; <xref ref-type="bibr" rid="bib19">Farhan et al., 2010</xref>; <xref ref-type="bibr" rid="bib60">Zacharogianni et al., 2011</xref>).</p><p>The dramatic remodeling of the ERES that we describe here appears to be specific for amino-acid starvation, possibly underlining the acute and severe nature of this particular stress. It is also different from the response to serum starvation that requires ERK7 (<xref ref-type="bibr" rid="bib60">Zacharogianni et al., 2011</xref>). ERK7 appears to be involved to a small extent in the amino-acid starvation response, possibly facilitating the initial dispersion of a fraction of the ERES into the cytoplasm, as when depleted, it prevents Sec body formation upon amino-acid starvation by about 20% (<xref ref-type="bibr" rid="bib60">Zacharogianni et al., 2011</xref>). However, other signaling pathways, yet unidentified, are clearly at stake.</p><p>Interestingly, one of Sec body components is Sec16, a protein with a localization that is also modulated upon serum starvation. Furthermore, Sec16 is also phosphorylated in response to EGF signaling in human cells (<xref ref-type="bibr" rid="bib19">Farhan et al., 2010</xref>). It could therefore be emerging as one of platform integrating nutrient and growth factors availability.</p><p>Sec bodies are novel stress structures and we have shown that they are not autophagosomes (or substrates of autophagy), not lipid droplets and not CUPS as they are devoid of dGRASP that is found quantitatively re-distributed in the cytoplasm upon amino-acid starvation, suggesting a modification involving its lipid anchor or modification of its N-terminus. Sec bodies are also different from large reversible structures containing COPII components that have been described in yeast in a number of specific COPII mutants <italic>Sec12-4</italic> and <italic>Sec16-2</italic> (<xref ref-type="bibr" rid="bib53">Shindiapina and Barlowe, 2010</xref>). These structures are thought to result from an imbalance between cargo incorporation in COPII-coated vesicles and the coat formation, and lowering the cargo load by inhibiting protein translation prevented their appearance. Sec body formation is, however, insensitive to translation inhibition by cycloheximide and is therefore different from these yeast structures. Last, we also show that Sec bodies are distinct from Stress Granules and P-bodies that also form upon amino-acid starvation. Therefore, Sec bodies are novel structures.</p></sec><sec id="s3-2"><title>Stress induces the formation of stress assemblies</title><p>Formation of mesoscale protein assemblies like Stress Granules, P-bodies or, more recently, Sec bodies is emerging as a general response to stress and especially nutrient stress, and is gaining increasing attention (<xref ref-type="bibr" rid="bib25">Hyman and Brangwynne, 2011</xref>; <xref ref-type="bibr" rid="bib58">Wilson and Gitai, 2013</xref>). For instance, in yeast under nutrient limiting conditions, metabolic enzymes and stress response proteins form reversible foci (<xref ref-type="bibr" rid="bib41">Narayanaswamy et al., 2009</xref>), such as purinosomes containing enzymes of the purine biosynthetic pathway (<xref ref-type="bibr" rid="bib3">An et al., 2008</xref>; <xref ref-type="bibr" rid="bib43">O'Connell et al., 2012</xref>), proteasome storage granules upon glucose restriction (<xref ref-type="bibr" rid="bib37">Laporte et al., 2008</xref>; <xref ref-type="bibr" rid="bib45">Peters et al., 2013</xref>), or, as recently described, glutamine synthetase filaments (<xref ref-type="bibr" rid="bib46">Petrovska et al., 2014</xref>).</p><p>In challenging conditions, areas of localized biochemistry in the cytoplasm can be advantageous, as reagents and possibly energy can be focused to these specific areas. The reorganization of the cytoplasm through non-membrane bound protein assemblies could confer this rapid and spatio-temporally defined compartmentalization. In this regard, we have found that Sec bodies confer a fitness advantage to the cells under starvation (see below). However, some stress assemblies (especially cytoplasmic RNP granules) can form dysfunctional RNA&#x2013;protein assemblies that become irreversible and toxic for the cell. For instance, Stress Granule components have a strong relationship with degenerative diseases, such as ALS and laminopathies (<xref ref-type="bibr" rid="bib48">Ramaswami et al., 2013</xref>). Whether Sec body components could also form such deleterious aggregates remains to be established.</p></sec><sec id="s3-3"><title>Some stress assemblies have liquid droplet properties</title><p>Some of these mesoscale assemblies have liquid-like properties. These so-called liquid droplets are generally spherical and dynamic and form via phase separation (liquid demixing) of their components from the cytoplasm like a drop of oil in water. Their components display different rates of diffusion within the assembly and in the surrounding cytoplasm (<xref ref-type="bibr" rid="bib25">Hyman and Brangwynne, 2011</xref>). They form via transient and weak protein&#x2013;protein and protein&#x2013;RNA interactions mediated by low amino-acid diversity stretches (low complexity sequences, LCS), prone to engage in such interactions. Stress granules and P-bodies have been shown to be liquid droplets, and we show here that Sec bodies exhibit clear liquid droplet features as underlined by their spherical morphology, their reversibility, FRAP properties, and LCS content.</p><p>In this regard, the presence of LCSs both in Sec16 and Sec24 is intriguing considering their role in cells under normal growth conditions where they act in sequence with many others to form the COPII coat. How the LCSs are shielded to make proteins competent for their function in COPII coat formation in growing cells remains to be investigated but the interaction with both cargo and Sec23 might be instrumental to their functioning as coat subunits. We show here that the LCS rich domain of Sec24AB is sufficient and necessary for Sec body incorporation upon amino-acid starvation, but not sufficient to induce Sec body formation. This has similarity to Tia1, a key protein necessary for Stress Granule formation that has an LCS-prion like domain that is necessary to form stress granules (<xref ref-type="bibr" rid="bib22">Gilks et al., 2004</xref>).</p><p>As mentioned above, the structures that fall in the liquid droplet category have been described to form through weak protein&#x2013;RNA interactions. Although Sec bodies do not appear to contain RNAs, we propose that they are nonetheless liquid droplets. The absence of RNA might account for the very low and slow recovery we observed after complete photobleaching of whole Sec bodies when compared to Stress Granules that recovers to a higher degree. Shuttling of mRNA in and out of Stress Granules could drive more exchange between the structure and the surrounding cytoplasm, and this probably does not occur in Sec bodies. However, instead of protein&#x2013;RNA interactions, Sec body components could establish weak protein&#x2013;protein interactions helped by molecular modifications that could trigger conformational changes and perhaps exposure of their LCS.</p></sec><sec id="s3-4"><title>Sec bodies and cell survival</title><p>Importantly, one of the key features of a liquid droplet is to be efficiently reversible, and we show that Sec bodies are rapidly and completely reversible upon stress relief. This shows that they act as a reservoir of the ERES components that can be quickly remobilized to re-build a functional organelle, so that protein transport through the secretory pathway can resume once stress is relieved in order to support cell proliferation. Furthermore, Sec bodies have a role in protecting ERES components from degradation during starvation. That strengthens the fact that Sec bodies are neither autophagosomes nor a substrate of autophagy, unlike Stress Granules, which are reported to be cleared by autophagy (<xref ref-type="bibr" rid="bib11">Buchan et al., 2013</xref>). Last, we show that Sec body formation is critical for the cell viability during amino-acid starvation. It suggests a pro-survival mechanism, perhaps through the recruitment and inactivation of pro-apoptotic factors. This remains to be investigated.</p><p>Taken together, amino-acid starvation inhibits both protein translation and protein transport through the secretory pathway and, similarly for both processes, results in the concomitant formation of cytoplasmic stress assemblies where key components necessary for cell survival are stored: untranslated mRNAs in Stress Granules and ERES components in Sec bodies.</p></sec></sec><sec sec-type="materials|methods" id="s4"><title>Materials and methods</title><sec id="s4-1"><title>Cell culture, amino-acid starvation, RNAi, transfection, and drug treatments</title><p>Drosophila S2 cells were cultured in Schneider's medium supplemented with 10% insect tested fetal bovine serum (referred to as Schneider's) at 26&#xb0;C as previously described (<xref ref-type="bibr" rid="bib32">Kondylis and Rabouille, 2003</xref>; <xref ref-type="bibr" rid="bib35">Kondylis et al., 2007</xref>). Amino-acid starvation was carried out by incubating the cells for 4 hr (or otherwise stated) in Krebs Ringers' Bicarbonate buffer (KRB, 10 mM glucose, 0.5 mM magnesium chloride, 4.53 mM potassium chloride, 120.7 mM sodium chloride, 0.7 mM dibasic sodium phosphate, 1.5 mM monobasic sodium phosphate, 15 mM sodium bicarbonate, 5.4 mM calcium chloride) at pH 7.4. We verified that simply adding 10% FBS to the buffer did not prevent the Sec body and Stress Granule formation. Single amino-acids were added at 15 mM (unless otherwise indicated).</p><p>Wild-type S2 cells or stably transfected were depleted by RNAi, as previously described (<xref ref-type="bibr" rid="bib32">Kondylis and Rabouille, 2003</xref>; <xref ref-type="bibr" rid="bib35">Kondylis et al., 2007</xref>). Cells were analyzed after incubation with dsRNAs for 5 days (or 4 days in the case of Sar1 depletion). Transient transfections were performed using the Effectene transfection reagent (301425; Qiagen, Germany) according to the manufacturer's instructions. When cells were transfected with pMT constructs, expression was induced 48 hr after transfection with 1 mM CuSO<sub>4</sub> for 1.5 hr. The newly synthesized proteins were allowed to localize for 1 hr after CuSO<sub>4</sub> washout. When cells were transfected with the pUAS constructs, transfection was done 48 hr prior to the experiment.</p><p>Drugs were used at the following concentrations: cycloheximide (10 &#x3bc;M), wortmanin (1 &#x3bc;M), bafilomycin (100 nM), rapamycin (2 &#xb5;M), and brefeldin A (50 &#xb5;M). When a drug treatment was followed by starvation, the cells were pretreated for 30 min in Schneider's following starvation in the presence of the drug.</p></sec><sec id="s4-2"><title>Antibodies</title><p>The following antibodies have been used in these experiments: rabbit polyclonal anti-Sec16 (<xref ref-type="bibr" rid="bib27">Ivan et al., 2008</xref>), 1:800 IF, 1:2000 WB; rabbit polyclonal anti-Sec23 (Pierce PA1-069A), 1:200 IF, 1:1000 WB; rabbit polyclonal anti-Sec31 (<xref ref-type="bibr" rid="bib6">Bentley et al., 2010</xref>) 1:200 IF; mouse monoclonal anti-V5 (life technologies R960), 1:500 IF; mouse monoclonal anti-FMR1 (DSHB supernanant clone 5A11), 1:10 IF; rabbit polyclonal anti-Tral, 1:200 IF; rabbit anti-dGRASP, 1:500 IF (with methanol fixation); mouse monoclonal anti-&#x3b1;-spectrin (DSHB supernatant clone 3A9), 1:20 IF; rat polyclonal anti-eIF4E, 1:200 IF (with methanol fixation); mouse monoclonal anti-Delta, (DHSB clone C594.9B), 1:500 IF.</p></sec><sec id="s4-3"><title>DNA constructs and RNAi</title><p>The pRmeGFP-Sec23, pRmSar1-eGFP, pMTmini-Sec16 (NC2.3-CCD)-V5, pMT&#x394;NC2.3-V5 constructs were described in the reference <xref ref-type="bibr" rid="bib27">Ivan et al. (2008)</xref>. The pMT&#x394;NC1-&#x394;Cter-Sec16-V5 and the pMT&#x394;NC1-&#x394;64-Sec16-V5 were described in the reference <xref ref-type="bibr" rid="bib60">Zacharogianni et al. (2011)</xref>. The pMT-Atg5-V5 is a gift from Fulvio Reggiori. The pUASt-GFP-Sec24CD (Sten) and the pUASt-mCherry-Sec24AB were a kind gift from Stefan Luschnig. The Fringe-GFP construct is described in the reference <xref ref-type="bibr" rid="bib35">Kondylis et al. (2007)</xref>.</p><p>To generate &#x394;NC1Sec16sfGFP, sfGFP was amplified using the forward (ggccgcggatggtgagcaagggcgagga) and reverse (gggtttaaacttacttgtacagctcgtccatg) primers and cloned into PMTV5-B-&#x394;NC1Sec16 (<xref ref-type="bibr" rid="bib60">Zacharogianni et al., 2011</xref>) using SacII and PmeI restriction sites.</p><p>Human Sec16A-V5 was cloned in the pMT-V5-HisB vector using the primers forward (tagccaccggtaccatgcctgggctcgaccga) and reverse (tacggaattcaagttcagcaccaggtgcttcctct) to include the KpnI and EcoRI restriction sites.</p><p>To generate FMR1-sfGFP, sfGFP was first amplified using the forward (catgttcgaaatggtgagcaagggcgag) and reverse (catgaccggtcttgtacagctcgtccatgc) primers containing the restriction sites for BstBI and AgeI, respectively and cloned into PMT-V5-His to replace the V5 tag, leading to PMT-sfGFP.</p><p>To generate super folder GFP (sfGFP) tagged pMT-Sec24AB, pMT-Sec24AB LCS, and pMT-Sec24AB nonLCS, Sec24Ab LCS (1-415 aa) were amplified from cDNA of <italic>Drosophila</italic> S2 cells using the forward (gatggaattccaccatgtcgacttacaat) and reverse (gtcagggccctctggagcagtggttc), and Sec24AB nonLCS (416&#x2013;1184 aa) regions using forward (cagtgaattcatgctaaacgtggctca) and reverse (gtcagggccctctttttgcaacacatt) primers. Fragments were cloned into pMT-sfGFP using EcoRI and ApaI restriction sites.</p><p>FMR1 cDNA was then amplified from the total cDNA of S2-cells using the forward (catgggtacccaccatggaagatctcctcgtgga) and the reverse (catggaattcaaggacgtgc cattgaccag) primers and inserted in pMT-sfGFP-His using KpnI and EcoRI restriction sites.</p><p>The following primers were used to amplify cDNA templates using for RNAi<table-wrap id="tblu1" position="anchor"><table frame="hsides" rules="groups"><thead><tr><th/><th>Forward</th><th>Reverse</th></tr></thead><tbody><tr><td>Sec24AB</td><td>Taatacgactcactataggggccaaccggtttcaatcag</td><td>taatacgactcactatagggaggaggtagctggggttgac</td></tr><tr><td>ec24CD</td><td>Taatacgactcactatagggccctagagtgctccggctat</td><td>taatacgactcactatagggcgctctccttcgctgttc,</td></tr><tr><td>Sec16</td><td>ttaatacgactcactatagggagagccagaggatcagcatc</td><td>ttaatacgactcactatagggagagcgatcccacagcagtc,</td></tr><tr><td>Sec23</td><td>Ttaatacgactcactataggggtgcaggatatgctcggaat</td><td>ttaatacgactcactataggggtggagctgggattcaatgt,</td></tr><tr><td>Sar1</td><td>Ttaatacgactcactatagggatgttcacttgggactggttc</td><td>ttaatacgactcactatagggagaatctctcgagcccacttcaa</td></tr></tbody></table></table-wrap></p><p>The DNA fragments were used for in vitro transcription using the T7 Megascript kit (AMBION) to generate the dsRNAs used for RNAi.</p><p>The efficiency of Sec24AB and CD depletion was estimated by transfecting mCherry-Sec24AB in Sec24AB-depleted cells and Sec24CD-GFP to Sec24CD-depleted cells and comparing the level of transfection (number of cells expressing the fluorescent protein) to this of non-depleted cells. In a typical experiment, 24.1 &#xb1; 2.0% non-depleted cells were transfected with mCherry-Sec24AB vs 2.5 &#xb1; 1% in Sec24AB-depleted cells, and 27.3 &#xb1; 2.4% non-depleted cells were transfected with GFP-Sec24CD vs 2.6 &#xb1; 0.7% in Sec24CD-depleted cells, showing that the 90% of the cells are depleted. The depletion of Sec23 and Sec16 were also 90% (as measured by Western blot, not shown).</p></sec><sec id="s4-4"><title>Immunofluorescence (IF) and immuno-electron microscopy (IEM)</title><p>S2 cells were plated on glass coverslips, treated, fixed in 4% PFA in PBS for and processed for Immunofluorescence as previously described (<xref ref-type="bibr" rid="bib32">Kondylis and Rabouille, 2003</xref>). Alternatively (as indicated for specific antibodies and dyes), the cells were fixed in ice-cold methanol for 5 min washed with PBS and processed for IF as above. Samples were viewed under a Leica SPE confocal microscope using a 63&#xd7; lens and 1.5&#x2013;3&#xd7; zoom. 17&#x2013;22 confocal planes are projected to image the whole cells. IEM was performed as described previously (<xref ref-type="bibr" rid="bib32">Kondylis and Rabouille, 2003</xref>; <xref ref-type="bibr" rid="bib57">van Donselaar et al., 2007</xref>).</p></sec><sec id="s4-5"><title>Delta transport assay</title><p>To monitor Delta transport through the secretory pathway in starved Delta-S2 cells (<xref ref-type="bibr" rid="bib32">Kondylis and Rabouille, 2003</xref>). Delta expression was induced by adding 1 mM CuSO<sub>4</sub> to Schneider's medium for 30 min before incubating the cells in KRB or further in Schneider's (control) (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). To monitor Delta transport upon reversion, cells were incubated 4 hr in Schneider's or KRB. After 4 hr, the media were changed to Schneider's supplemented with 1 mM CuSO<sub>4</sub> for 10&#x2013;120 min (<xref ref-type="fig" rid="fig8">Figure 8B,C</xref>).</p><p>To monitor Delta transport in Delta S2-depleted cells, 0.75 million cells were mock- (dsGFP), Sec24AB-, and Sec23-depleted for 5 days in a 6-well plate cell. Cells were then were split in 2 and plated on glass coverslips in a 12-well plate. They were allowed to attach for 1 hr and the media were changed for either Schneider's or KRB. After 4 hr, the media were changed to Schneider's supplemented with 1 mM CuSO<sub>4</sub> for 90 min (<xref ref-type="fig" rid="fig9">Figure 9C</xref>).</p><p>Cells were fixed and processed for IF using Delta antibody. Transport efficiency was calculated as percentage of cells expressing Delta at the plasma membrane over the total number of cells expressing Delta. Between 30 and 60 cells were analyzed per condition.</p></sec><sec id="s4-6"><title>Autophagy</title><p>S2 cells transiently expressing Drosophila Atg5-V5 and mouse GFP-Atg8 were incubated for increasing length of time in Schneider's supplemented or not with rapamycin and in KRB supplemented or not with wortmannin and bafilomycin. The percentage of cells showing Atg5-V5 punctae was determined. Experiments were done in triplicate.</p></sec><sec id="s4-7"><title>Time-lapse and FRAP</title><p>Time lapse of Sec body formation and disassembly was performed on S2 cells stably expressing GFP-Sec23. For Sec body formation, cells were incubated in KRB (t &#x3d; 0) at 26&#xb0;C. For Sec body disassembly, cells were starved for 4 hr and further incubated in Schneider's (t &#x3d; 0) at 26&#xb0;C. Cells were viewed with a Leica AF7000 Fluorescence microscope. 10 z planes with a z step of 0.7 &#x3bc;m of were recorded every 3 min.</p><p>The FRAP experiments were performed on cells expressing GFP-Sec23, &#x394;NC1-Sec16-sfGFP, or FMR1-sfGFP for 1.5 hr (expression induced with CuSO<sub>4</sub>) followed by incubation in Schneider's for 1 hr and starvation in KRB for 4 hr. Sec bodies and Stress Granules were entirely or partially (half) photobleached using a 488 nm laser at 100% laser power for 750 msec. FRAP was recorded using a PerkinElmer Ultraview VoX spinning disk microscope with the volocity software. Fluorescence recovery was recorded every 10 ms for the first 14 s after bleaching, and thereafter every 10 s for 2 min.</p></sec><sec id="s4-8"><title>Low complexity sequence analysis</title><p>The amount of LCS was determined for each protein and isoform annotated in FlyBase release FB2014_02 using SEG (<ext-link xmlns:xlink="http://www.w3.org/1999/xlink" ext-link-type="uri" xlink:href="ftp://ftp.ncbi.nih.gov/pub/seg/">ftp://ftp.ncbi.nih.gov/pub/seg/</ext-link>) (<xref ref-type="bibr" rid="bib59">Wootton and Federhen, 1996</xref>). The LCS content of each protein was tested for enrichment by a hypergeometric test against the whole proteome. For the proteins that have multiple isoforms the longest isoform was chosen for comparison.</p></sec><sec id="s4-9"><title>Western blot</title><p>Cells were lysed in 50 mM Tris&#x2013;HCl pH 7.5, 150 mM NaCl, 1% Triton X&#x2010;100, 50 mM NaF, 1 mM Na<sub>3</sub>VO<sub>4</sub>, 25 mM Na2&#x2010;&#x3b2;&#x2010;glycerophosphate supplemented with a protease inhibitors tablet (Roche). The lysate were cleared by centrifugation 4&#xb0;C for 15 min at 14,000 rpm, and proteins were separated on SDS-PAGE followed by western blot.</p></sec><sec id="s4-10"><title>Mammalian cell starvation</title><p>HEK-293T, MEFs, and COS7 cells were cultured in standard DMEM and incubated in KRB supplemented with 100 nM bafilomycin for 7 hr (up to 16 hr for Cos cells) to mimic the optimal conditions found for S2 cells.</p></sec><sec id="s4-11"><title>Cell survival and fitness upon and after amino-acid starvation</title><p>0.75 million cells were non-, mock- (dsGFP), Sec24AB, Sec24CD, and Sec24AB and CD depleted for 5 days in a 6-well plate. They proliferated to reach 2.5, 1.9, 1.8, 1.85, and 1.9 million, respectively and this was set at 100% (t &#x3d; 0). These cells were then either starved in KRB for 4 hr or further incubated in Schneider's, their number monitored and expressed as a percentage of t &#x3d; 0. The medium was changed to Schneider's and their proliferation monitored further up to 16 hr. Experiments were performed in triplicates.</p></sec><sec id="s4-12"><title>Flies</title><p><italic>Oregon R</italic><sup><italic>&#x2b;</italic></sup> virgin females were fattened on standard food supplemented with yeast for 3 days. They were subsequently either dissected to harvest the ovaries for the ex vivo treatments (incubation in Schneider's and KRB for 4 hr) or transferred to humidified empty vials for 36 hr before dissection. IF were performed as described in the reference <xref ref-type="bibr" rid="bib23">Giuliani et al. (2014)</xref>.</p></sec><sec id="s4-13"><title>Quantification and statistics</title><p>Three independent experiments were performed for quantification of the Sec body phenotype as scored by immunofluorescence. At least three fields were analyzed comprising at least 100 cells per condition. Averages and standard deviations reflect variation throughout the experiments. For Sec bodies we considered cells with at least one large, round (&#x3e;0.5 &#x3bc;m) structure as exhibiting Sec bodies. Cells with smaller round structures and/or haze were considered intermediate. For all measurements p-values were calculated with Excel.</p></sec><sec id="s4-14"><title>Sec body diameter</title><p>Sec body diameter was measured using the Leica LAS software. At least 35 cells were analyzed per condition, in each of which all fluorescent foci (at least 500) were measured. Distribution curves were made using Excel.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank the Rabouille's lab members and Fulvio Reggiori for their input and constructive discussions, and Peter van der Sluijs and Adam Grieve for critically reading the manuscript. We thank Akira Nakamura for Tral and elF4E antibodies, Stefan Luschnig for the tagged Sec24 constructs, and Andrew Bailey for help with the hypoxia experiment. We thank Anko de Graaff and the Hubrecht Imaging Center for supporting the imaging. The spinning disk microscope is funded by equipment grant 834.11.002 from the Dutch Organization of Scientific Research (NWO). Part of this research is funded by NWO 822-020-016 to CR.</p></ack><sec sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>MZ, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con2"><p>AAG, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con3"><p>JS, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con4"><p>CR, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con5"><p>TV, Acquisition of data, Analysis and interpretation of data</p></fn></fn-group></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Almen</surname><given-names>MS</given-names></name><name><surname>Nordstrom</surname><given-names>KJ</given-names></name><name><surname>Fredriksson</surname><given-names>R</given-names></name><name><surname>Schioth</surname><given-names>HB</given-names></name></person-group><year>2009</year><article-title>Mapping the human membrane proteome: a majority of the human membrane proteins can be classified according to function and evolutionary origin</article-title><source>BMC Biology</source><volume>7</volume><fpage>50</fpage><pub-id pub-id-type="doi">10.1186/1741-7007-7-50</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Amodio</surname><given-names>G</given-names></name><name><surname>Renna</surname><given-names>M</given-names></name><name><surname>Paladino</surname><given-names>S</given-names></name><name><surname>Venturi</surname><given-names>C</given-names></name><name><surname>Tacchetti</surname><given-names>C</given-names></name><name><surname>Moltedo</surname><given-names>O</given-names></name><name><surname>Franceschelli</surname><given-names>S</given-names></name><name><surname>Mallardo</surname><given-names>M</given-names></name><name><surname>Bonatti</surname><given-names>S</given-names></name><name><surname>Remondelli</surname><given-names>P</given-names></name></person-group><year>2009</year><article-title>Endoplasmic reticulum stress reduces the export from the ER and alters the architecture of post-ER compartments</article-title><source>The International Journal of Biochemistry &#x26; Cell Biology</source><volume>41</volume><fpage>2511</fpage><lpage>2521</lpage><pub-id pub-id-type="doi">10.1016/j.biocel.2009.08.006</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>An</surname><given-names>S</given-names></name><name><surname>Kumar</surname><given-names>R</given-names></name><name><surname>Sheets</surname><given-names>ED</given-names></name><name><surname>Benkovic</surname><given-names>SJ</given-names></name></person-group><year>2008</year><article-title>Reversible compartmentalization of de novo purine biosynthetic complexes in living cells</article-title><source>Science</source><volume>320</volume><fpage>103</fpage><lpage>106</lpage><pub-id pub-id-type="doi">10.1126/science.1152241</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Anderson</surname><given-names>P</given-names></name><name><surname>Kedersha</surname><given-names>N</given-names></name></person-group><year>2008</year><article-title>Stress granules: the Tao of RNA triage</article-title><source>Trends in Biochemical Sciences</source><volume>33</volume><fpage>141</fpage><lpage>150</lpage><pub-id pub-id-type="doi">10.1016/j.tibs.2007.12.003</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bard</surname><given-names>F</given-names></name><name><surname>Casano</surname><given-names>L</given-names></name><name><surname>Mallabiabarrena</surname><given-names>A</given-names></name><name><surname>Wallace</surname><given-names>E</given-names></name><name><surname>Saito</surname><given-names>K</given-names></name><name><surname>Kitayama</surname><given-names>H</given-names></name><name><surname>Guizzunti</surname><given-names>G</given-names></name><name><surname>Hu</surname><given-names>Y</given-names></name><name><surname>Wendler</surname><given-names>F</given-names></name><name><surname>Dasgupta</surname><given-names>R</given-names></name><name><surname>Perrimon</surname><given-names>N</given-names></name><name><surname>Malhotra</surname><given-names>V</given-names></name></person-group><year>2006</year><article-title>Functional genomics reveals genes involved in protein secretion and Golgi organization</article-title><source>Nature</source><volume>439</volume><fpage>604</fpage><lpage>607</lpage><pub-id pub-id-type="doi">10.1038/nature04377</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bentley</surname><given-names>M</given-names></name><name><surname>Nycz</surname><given-names>DC</given-names></name><name><surname>Joglekar</surname><given-names>A</given-names></name><name><surname>Fertschai</surname><given-names>I</given-names></name><name><surname>Malli</surname><given-names>R</given-names></name><name><surname>Graier</surname><given-names>WF</given-names></name><name><surname>Hay</surname><given-names>JC</given-names></name></person-group><year>2010</year><article-title>Vesicular calcium regulates coat retention, fusogenicity, and size of pre-Golgi intermediates</article-title><source>Molecular Biology of the Cell</source><volume>21</volume><fpage>1033</fpage><lpage>1046</lpage><pub-id pub-id-type="doi">10.1091/mbc.E09-10-0914</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bharucha</surname><given-names>N</given-names></name><name><surname>Liu</surname><given-names>Y</given-names></name><name><surname>Papanikou</surname><given-names>E</given-names></name><name><surname>McMahon</surname><given-names>C</given-names></name><name><surname>Esaki</surname><given-names>M</given-names></name><name><surname>Jeffrey</surname><given-names>PD</given-names></name><name><surname>Hughson</surname><given-names>FM</given-names></name><name><surname>Glick</surname><given-names>BS</given-names></name></person-group><year>2013</year><article-title>Sec16 influences transitional ER sites by regulating rather than organizing COPII</article-title><source>Molecular Biology of the Cell</source><volume>24</volume><fpage>3406</fpage><lpage>3419</lpage><pub-id pub-id-type="doi">10.1091/mbc.E13-04-0185</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brangwynne</surname><given-names>CP</given-names></name><name><surname>Eckmann</surname><given-names>CR</given-names></name><name><surname>Courson</surname><given-names>DS</given-names></name><name><surname>Rybarska</surname><given-names>A</given-names></name><name><surname>Hoege</surname><given-names>C</given-names></name><name><surname>Gharakhani</surname><given-names>J</given-names></name><name><surname>Julicher</surname><given-names>F</given-names></name><name><surname>Hyman</surname><given-names>AA</given-names></name></person-group><year>2009</year><article-title>Germline P granules are liquid droplets that localize by controlled dissolution/condensation</article-title><source>Science</source><volume>324</volume><fpage>1729</fpage><lpage>1732</lpage><pub-id pub-id-type="doi">10.1126/science.1172046</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brangwynne</surname><given-names>CP</given-names></name><name><surname>Mitchison</surname><given-names>TJ</given-names></name><name><surname>Hyman</surname><given-names>AA</given-names></name></person-group><year>2011</year><article-title>Active liquid-like behavior of nucleoli determines their size and shape in Xenopus laevis oocytes</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>108</volume><fpage>4334</fpage><lpage>4339</lpage><pub-id pub-id-type="doi">10.1073/pnas.1017150108</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bruns</surname><given-names>C</given-names></name><name><surname>McCaffery</surname><given-names>JM</given-names></name><name><surname>Curwin</surname><given-names>AJ</given-names></name><name><surname>Duran</surname><given-names>JM</given-names></name><name><surname>Malhotra</surname><given-names>V</given-names></name></person-group><year>2011</year><article-title>Biogenesis of a novel compartment for autophagosome-mediated unconventional protein secretion</article-title><source>The Journal of Cell Biology</source><volume>195</volume><fpage>979</fpage><lpage>992</lpage><pub-id pub-id-type="doi">10.1083/jcb.201106098</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Buchan</surname><given-names>JR</given-names></name><name><surname>Kolaitis</surname><given-names>RM</given-names></name><name><surname>Taylor</surname><given-names>JP</given-names></name><name><surname>Parker</surname><given-names>R</given-names></name></person-group><year>2013</year><article-title>Eukaryotic stress granules are cleared by autophagy and Cdc48/VCP function</article-title><source>Cell</source><volume>153</volume><fpage>1461</fpage><lpage>1474</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2013.05.037</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Buchan</surname><given-names>JR</given-names></name><name><surname>Muhlrad</surname><given-names>D</given-names></name><name><surname>Parker</surname><given-names>R</given-names></name></person-group><year>2008</year><article-title>P bodies promote stress granule assembly in <italic>Saccharomyces cerevisiae</italic></article-title><source>The Journal of Cell Biology</source><volume>183</volume><fpage>441</fpage><lpage>455</lpage><pub-id pub-id-type="doi">10.1083/jcb.200807043</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Castilho</surname><given-names>BA</given-names></name><name><surname>Shanmugam</surname><given-names>R</given-names></name><name><surname>Silva</surname><given-names>RC</given-names></name><name><surname>Ramesh</surname><given-names>R</given-names></name><name><surname>Himme</surname><given-names>BM</given-names></name><name><surname>Sattlegger</surname><given-names>E</given-names></name></person-group><year>2014</year><article-title>Keeping the eIF2 alpha kinase Gcn2 in check</article-title><source>Biochimica Et Biophysica Acta</source><volume>1843</volume><fpage>1948</fpage><lpage>1968</lpage><pub-id pub-id-type="doi">10.1016/j.bbamcr.2014.04.006</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Cluett</surname><given-names>EB</given-names></name><name><surname>Wood</surname><given-names>SA</given-names></name><name><surname>Banta</surname><given-names>M</given-names></name><name><surname>Brown</surname><given-names>WJ</given-names></name></person-group><year>1993</year><article-title>Tubulation of Golgi membranes in vivo and in vitro in the absence of brefeldin A.</article-title><source>The Journal of Cell Biology</source><volume>120</volume><fpage>15</fpage><lpage>24</lpage><pub-id pub-id-type="doi">10.1083/jcb.120.1.15</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Connerly</surname><given-names>PL</given-names></name><name><surname>Esaki</surname><given-names>M</given-names></name><name><surname>Montegna</surname><given-names>EA</given-names></name><name><surname>Strongin</surname><given-names>DE</given-names></name><name><surname>Levi</surname><given-names>S</given-names></name><name><surname>Soderholm</surname><given-names>J</given-names></name><name><surname>Glick</surname><given-names>BS</given-names></name></person-group><year>2005</year><article-title>Sec16 is a determinant of transitional ER organization. Current biology</article-title><source>Current Biology</source><volume>15</volume><fpage>1439</fpage><lpage>1447</lpage></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>d'Enfert</surname><given-names>C</given-names></name><name><surname>Wuestehube</surname><given-names>LJ</given-names></name><name><surname>Lila</surname><given-names>t</given-names></name><name><surname>schekman</surname><given-names>R</given-names></name></person-group><year>1991</year><article-title>Sec12p-dependent membrane binding of the small GTP-binding protein Sar1p promotes formation of transport vesicles from the ER</article-title><source>The Journal of Cell Biology</source><volume>114</volume><fpage>663</fpage><lpage>670</lpage></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Das</surname><given-names>S</given-names></name><name><surname>Pal</surname><given-names>U</given-names></name><name><surname>Das</surname><given-names>S</given-names></name><name><surname>Bagga</surname><given-names>K</given-names></name><name><surname>Roy</surname><given-names>A</given-names></name><name><surname>Mrigwani</surname><given-names>A</given-names></name><name><surname>Maiti</surname><given-names>NC</given-names></name></person-group><year>2014</year><article-title>Sequence complexity of amyloidogenic regions in intrinsically disordered human proteins</article-title><source>PLOS ONE</source><volume>9</volume><fpage>e89781</fpage><pub-id pub-id-type="doi">10.1371/journal.pone.0089781</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Eulalio</surname><given-names>A</given-names></name><name><surname>Behm-Ansmant</surname><given-names>I</given-names></name><name><surname>Schweizer</surname><given-names>D</given-names></name><name><surname>Izaurralde</surname><given-names>E</given-names></name></person-group><year>2007</year><article-title>P-body formation is a consequence, not the cause, of RNA-mediated gene silencing</article-title><source>Molecular and Cellular Biology</source><volume>27</volume><fpage>3970</fpage><lpage>3981</lpage><pub-id pub-id-type="doi">10.1128/MCB.00128-07</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Farhan</surname><given-names>H</given-names></name><name><surname>Wendeler</surname><given-names>MW</given-names></name><name><surname>Mitrovic</surname><given-names>S</given-names></name><name><surname>Fava</surname><given-names>E</given-names></name><name><surname>Silberberg</surname><given-names>Y</given-names></name><name><surname>Sharan</surname><given-names>R</given-names></name><name><surname>Zerial</surname><given-names>M</given-names></name><name><surname>Hauri</surname><given-names>HP</given-names></name></person-group><year>2010</year><article-title>MAPK signaling to the early secretory pathway revealed by kinase/phosphatase functional screening</article-title><source>The Journal of Cell Biology</source><volume>189</volume><fpage>997</fpage><lpage>1011</lpage><pub-id pub-id-type="doi">10.1083/jcb.200912082</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Forster</surname><given-names>D</given-names></name><name><surname>Armbruster</surname><given-names>K</given-names></name><name><surname>Luschnig</surname><given-names>S</given-names></name></person-group><year>2010</year><article-title>Sec24-dependent secretion drives cell-autonomous expansion of tracheal tubes in Drosophila</article-title><source>Current Biology</source><volume>20</volume><fpage>62</fpage><lpage>68</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2009.11.062</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gaccioli</surname><given-names>F</given-names></name><name><surname>Huang</surname><given-names>CC</given-names></name><name><surname>Wang</surname><given-names>C</given-names></name><name><surname>Bevilacqua</surname><given-names>E</given-names></name><name><surname>Franchi-Gazzola</surname><given-names>R</given-names></name><name><surname>Gazzola</surname><given-names>GC</given-names></name><name><surname>Bussolati</surname><given-names>O</given-names></name><name><surname>Snider</surname><given-names>MD</given-names></name><name><surname>Hatzoglou</surname><given-names>M</given-names></name></person-group><year>2006</year><article-title>Amino acid starvation induces the SNAT2 neutral amino acid transporter by a mechanism that involves eukaryotic initiation factor 2alpha phosphorylation and cap-independent translation</article-title><source>The Journal of Biological Chemistry</source><volume>281</volume><fpage>17929</fpage><lpage>17940</lpage></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gilks</surname><given-names>N</given-names></name><name><surname>Kedersha</surname><given-names>N</given-names></name><name><surname>Ayodele</surname><given-names>M</given-names></name><name><surname>Shen</surname><given-names>L</given-names></name><name><surname>Stoecklin</surname><given-names>G</given-names></name><name><surname>Dember</surname><given-names>LM</given-names></name><name><surname>Anderson</surname><given-names>P</given-names></name></person-group><year>2004</year><article-title>Stress granule assembly is mediated by prion-like aggregation of TIA-1</article-title><source>Molecular Biology of the Cell</source><volume>15</volume><fpage>5383</fpage><lpage>5398</lpage><pub-id pub-id-type="doi">10.1091/mbc.E04-08-0715</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Giuliani</surname><given-names>G</given-names></name><name><surname>Giuliani</surname><given-names>F</given-names></name><name><surname>Volk</surname><given-names>T</given-names></name><name><surname>Rabouille</surname><given-names>C</given-names></name></person-group><year>2014</year><article-title>The Drosophila RNA-binding protein HOW controls the stability of dgrasp mRNA in the follicular epithelium</article-title><source>Nucleic Acids Research</source><volume>42</volume><fpage>1970</fpage><lpage>1986</lpage><pub-id pub-id-type="doi">10.1093/nar/gkt1118</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hughes</surname><given-names>H</given-names></name><name><surname>Budnik</surname><given-names>A</given-names></name><name><surname>Schmidt</surname><given-names>K</given-names></name><name><surname>Palmer</surname><given-names>KJ</given-names></name><name><surname>Mantell</surname><given-names>J</given-names></name><name><surname>Noakes</surname><given-names>C</given-names></name><name><surname>Johnson</surname><given-names>A</given-names></name><name><surname>Carter</surname><given-names>DA</given-names></name><name><surname>Verkade</surname><given-names>P</given-names></name><name><surname>Watson</surname><given-names>P</given-names></name><name><surname>Stephens</surname><given-names>DJ</given-names></name></person-group><year>2009</year><article-title>Organisation of human ER-exit sites: requirements for the localisation of Sec16 to transitional ER</article-title><source>Journal of Cell Science</source><volume>122</volume><fpage>2924</fpage><lpage>2934</lpage><pub-id pub-id-type="doi">10.1242/jcs.044032</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hyman</surname><given-names>AA</given-names></name><name><surname>Brangwynne</surname><given-names>CP</given-names></name></person-group><year>2011</year><article-title>Beyond stereospecificity: liquids and mesoscale organization of cytoplasm</article-title><source>Developmental Cell</source><volume>21</volume><fpage>14</fpage><lpage>16</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2011.06.013</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hyman</surname><given-names>AA</given-names></name><name><surname>Simons</surname><given-names>K</given-names></name></person-group><year>2012</year><article-title>Cell biology. Beyond oil and water&#x2013;phase transitions in cells</article-title><source>Science</source><volume>337</volume><fpage>1047</fpage><lpage>1049</lpage><pub-id pub-id-type="doi">10.1126/science.1223728</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ivan</surname><given-names>V</given-names></name><name><surname>de Voer</surname><given-names>G</given-names></name><name><surname>Xanthakis</surname><given-names>D</given-names></name><name><surname>Spoorendonk</surname><given-names>KM</given-names></name><name><surname>Kondylis</surname><given-names>V</given-names></name><name><surname>Rabouille</surname><given-names>C</given-names></name></person-group><year>2008</year><article-title>Drosophila Sec16 mediates the biogenesis of tER sites upstream of Sar1 through an arginine-rich motif</article-title><source>Molecular Biology of the Cell</source><volume>19</volume><fpage>4352</fpage><lpage>4365</lpage><pub-id pub-id-type="doi">10.1091/mbc.E08-03-0246</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jamieson</surname><given-names>JD</given-names></name><name><surname>Palade</surname><given-names>GE</given-names></name></person-group><year>1968</year><article-title>Intracellular transport of secretory proteins in the pancreatic exocrine cell. IV. Metabolic requirements</article-title><source>The Journal of Cell Biology</source><volume>39</volume><fpage>589</fpage><lpage>603</lpage><pub-id pub-id-type="doi">10.1083/jcb.39.3.589</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kato</surname><given-names>M</given-names></name><name><surname>Han</surname><given-names>TW</given-names></name><name><surname>Xie</surname><given-names>S</given-names></name><name><surname>Shi</surname><given-names>K</given-names></name><name><surname>Du</surname><given-names>X</given-names></name><name><surname>Wu</surname><given-names>LC</given-names></name><name><surname>Mirzaei</surname><given-names>H</given-names></name><name><surname>Goldsmith</surname><given-names>EJ</given-names></name><name><surname>Longgood</surname><given-names>J</given-names></name><name><surname>Pei</surname><given-names>J</given-names></name><name><surname>Grishin</surname><given-names>NV</given-names></name><name><surname>Frantz</surname><given-names>DE</given-names></name><name><surname>Schneider</surname><given-names>JW</given-names></name><name><surname>Chen</surname><given-names>S</given-names></name><name><surname>Li</surname><given-names>L</given-names></name><name><surname>Sawaya</surname><given-names>MR</given-names></name><name><surname>Eisenberg</surname><given-names>D</given-names></name><name><surname>Tycko</surname><given-names>R</given-names></name><name><surname>McKnight</surname><given-names>SL</given-names></name></person-group><year>2012</year><article-title>Cell-free formation of RNA granules: low complexity sequence domains form dynamic fibers within hydrogels</article-title><source>Cell</source><volume>149</volume><fpage>753</fpage><lpage>767</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2012.04.017</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kedersha</surname><given-names>NL</given-names></name><name><surname>Gupta</surname><given-names>M</given-names></name><name><surname>Li</surname><given-names>W</given-names></name><name><surname>Miller</surname><given-names>I</given-names></name><name><surname>Anderson</surname><given-names>P</given-names></name></person-group><year>1999</year><article-title>RNA-binding proteins TIA-1 and TIAR link the phosphorylation of eIF-2 alpha to the assembly of mammalian stress granules</article-title><source>The Journal of Cell Biology</source><volume>147</volume><fpage>1431</fpage><lpage>1442</lpage><pub-id pub-id-type="doi">10.1083/jcb.147.7.1431</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Klionsky</surname><given-names>DJ</given-names></name><name><surname>Abdalla</surname><given-names>FC</given-names></name><name><surname>Abeliovich</surname><given-names>H</given-names></name><name><surname>Abraham</surname><given-names>RT</given-names></name><name><surname>Acevedo-Arozena</surname><given-names>A</given-names></name><name><surname>Adeli</surname><given-names>K</given-names></name><name><surname>Agholme</surname><given-names>L</given-names></name><name><surname>Agnello</surname><given-names>M</given-names></name><name><surname>Agostinis</surname><given-names>P</given-names></name><name><surname>Aguirre-Ghiso</surname><given-names>JA</given-names></name><etal/></person-group><year>2012</year><article-title>Guidelines for the use and interpretation of assays for monitoring autophagy</article-title><source>Autophagy</source><volume>8</volume><fpage>445</fpage><lpage>544</lpage><pub-id pub-id-type="doi">10.4161/auto.19496</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kondylis</surname><given-names>V</given-names></name><name><surname>Rabouille</surname><given-names>C</given-names></name></person-group><year>2003</year><article-title>A novel role for dp115 in the organization of tER sites in Drosophila</article-title><source>The Journal of Cell Biology</source><volume>162</volume><fpage>185</fpage><lpage>198</lpage><pub-id pub-id-type="doi">10.1083/jcb.200301136</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kondylis</surname><given-names>V</given-names></name><name><surname>Rabouille</surname><given-names>C</given-names></name></person-group><year>2009</year><article-title>The Golgi apparatus: lessons from Drosophila</article-title><source>FEBS Letters</source><volume>583</volume><fpage>3827</fpage><lpage>3838</lpage><pub-id pub-id-type="doi">10.1016/j.febslet.2009.09.048</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kondylis</surname><given-names>V</given-names></name><name><surname>Tang</surname><given-names>Y</given-names></name><name><surname>Fuchs</surname><given-names>F</given-names></name><name><surname>Boutros</surname><given-names>M</given-names></name><name><surname>Rabouille</surname><given-names>C</given-names></name></person-group><year>2011</year><article-title>Identification of ER proteins involved in the functional organisation of the early secretory pathway in Drosophila cells by a targeted RNAi screen</article-title><source>PLOS ONE</source><volume>6</volume><fpage>e17173</fpage><pub-id pub-id-type="doi">10.1371/journal.pone.0017173</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kondylis</surname><given-names>V</given-names></name><name><surname>Van Nispen tot Pannerden</surname><given-names>HE</given-names></name><name><surname>Herpers</surname><given-names>B</given-names></name><name><surname>Friggi-Grelin</surname><given-names>F</given-names></name><name><surname>Rabouille</surname><given-names>C</given-names></name></person-group><year>2007</year><article-title>The golgi comprises a paired stack that is separated at G2 by modulation of the actin cytoskeleton through Abi and Scar/WAVE</article-title><source>Developmental Cell</source><volume>12</volume><fpage>901</fpage><lpage>915</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2007.03.008</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kung</surname><given-names>LF</given-names></name><name><surname>Pagant</surname><given-names>S</given-names></name><name><surname>Futai</surname><given-names>E</given-names></name><name><surname>D'Arcangelo</surname><given-names>JG</given-names></name><name><surname>Buchanan</surname><given-names>R</given-names></name><name><surname>Dittmar</surname><given-names>JC</given-names></name><name><surname>Reid</surname><given-names>RJ</given-names></name><name><surname>Rothstein</surname><given-names>R</given-names></name><name><surname>Hamamoto</surname><given-names>S</given-names></name><name><surname>Snapp</surname><given-names>EL</given-names></name><name><surname>Schekman</surname><given-names>R</given-names></name><name><surname>Miller</surname><given-names>EA</given-names></name></person-group><year>2012</year><article-title>Sec24p and Sec16p cooperate to regulate the GTP cycle of the COPII coat</article-title><source>The EMBO Journal</source><volume>31</volume><fpage>1014</fpage><lpage>1027</lpage><pub-id pub-id-type="doi">10.1038/emboj.2011.444</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Laporte</surname><given-names>D</given-names></name><name><surname>Salin</surname><given-names>B</given-names></name><name><surname>Daignan-Fornier</surname><given-names>B</given-names></name><name><surname>Sagot</surname><given-names>I</given-names></name></person-group><year>2008</year><article-title>Reversible cytoplasmic localization of the proteasome in quiescent yeast cells</article-title><source>The Journal of Cell Biology</source><volume>181</volume><fpage>737</fpage><lpage>745</lpage><pub-id pub-id-type="doi">10.1083/jcb.200711154</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee</surname><given-names>TH</given-names></name><name><surname>Linstedt</surname><given-names>AD</given-names></name></person-group><year>1999</year><article-title>Osmotically induced cell volume changes alter anterograde and retrograde transport, Golgi structure, and COPI dissociation</article-title><source>Molecular Biology of the Cell</source><volume>10</volume><fpage>1445</fpage><lpage>1462</lpage><pub-id pub-id-type="doi">10.1091/mbc.10.5.1445</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lucocq</surname><given-names>JM</given-names></name><name><surname>Warren</surname><given-names>G</given-names></name></person-group><year>1987</year><article-title>Fragmentation and partitioning of the Golgi apparatus during mitosis in HeLa cells</article-title><source>The EMBO Journal</source><volume>6</volume><fpage>3239</fpage><lpage>3246</lpage></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Miyamoto</surname><given-names>T</given-names></name><name><surname>Oshiro</surname><given-names>N</given-names></name><name><surname>Yoshino</surname><given-names>K</given-names></name><name><surname>Nakashima</surname><given-names>A</given-names></name><name><surname>Eguchi</surname><given-names>S</given-names></name><name><surname>Takahashi</surname><given-names>M</given-names></name><name><surname>Ono</surname><given-names>Y</given-names></name><name><surname>Kikkawa</surname><given-names>U</given-names></name><name><surname>Yonezawa</surname><given-names>K</given-names></name></person-group><year>2008</year><article-title>AMP-activated protein kinase phosphorylates Golgi-specific brefeldin A resistance factor 1 at Thr1337 to induce disassembly of Golgi apparatus</article-title><source>The Journal of Biological Chemistry</source><volume>283</volume><fpage>4430</fpage><lpage>4438</lpage><pub-id pub-id-type="doi">10.1074/jbc.M708296200</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Narayanaswamy</surname><given-names>R</given-names></name><name><surname>Levy</surname><given-names>M</given-names></name><name><surname>Tsechansky</surname><given-names>M</given-names></name><name><surname>Stovall</surname><given-names>GM</given-names></name><name><surname>O'Connell</surname><given-names>JD</given-names></name><name><surname>Mirrielees</surname><given-names>J</given-names></name><name><surname>Ellington</surname><given-names>AD</given-names></name><name><surname>Marcotte</surname><given-names>EM</given-names></name></person-group><year>2009</year><article-title>Widespread reorganization of metabolic enzymes into reversible assemblies upon nutrient starvation</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>106</volume><fpage>10147</fpage><lpage>10152</lpage><pub-id pub-id-type="doi">10.1073/pnas.0812771106</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Norum</surname><given-names>M</given-names></name><name><surname>Tang</surname><given-names>E</given-names></name><name><surname>Chavoshi</surname><given-names>T</given-names></name><name><surname>Schwarz</surname><given-names>H</given-names></name><name><surname>Linke</surname><given-names>D</given-names></name><name><surname>Uv</surname><given-names>A</given-names></name><name><surname>Moussian</surname><given-names>B</given-names></name></person-group><year>2010</year><article-title>Trafficking through COPII stabilises cell polarity and drives secretion during Drosophila epidermal differentiation</article-title><source>PLOS ONE</source><volume>5</volume><fpage>e10802</fpage><pub-id pub-id-type="doi">10.1371/journal.pone.0010802</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>O'Connell</surname><given-names>JD</given-names></name><name><surname>Zhao</surname><given-names>A</given-names></name><name><surname>Ellington</surname><given-names>AD</given-names></name><name><surname>Marcotte</surname><given-names>EM</given-names></name></person-group><year>2012</year><article-title>Dynamic reorganization of metabolic enzymes into intracellular bodies</article-title><source>Annual Review of Cell and Developmental Biology</source><volume>28</volume><fpage>89</fpage><lpage>111</lpage><pub-id pub-id-type="doi">10.1146/annurev-cellbio-101011-155841</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Oka</surname><given-names>T</given-names></name><name><surname>Nishikawa</surname><given-names>S</given-names></name><name><surname>Nakano</surname><given-names>A</given-names></name></person-group><year>1991</year><article-title>Reconstitution of GTP-binding Sar1 protein function in ER to Golgi transport</article-title><source>The Journal of Cell Biology</source><volume>114</volume><fpage>671</fpage><lpage>679</lpage><pub-id pub-id-type="doi">10.1083/jcb.114.4.671</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peters</surname><given-names>LZ</given-names></name><name><surname>Hazan</surname><given-names>R</given-names></name><name><surname>Breker</surname><given-names>M</given-names></name><name><surname>Schuldiner</surname><given-names>M</given-names></name><name><surname>Ben-Aroya</surname><given-names>S</given-names></name></person-group><year>2013</year><article-title>Formation and dissociation of proteasome storage granules are regulated by cytosolic pH</article-title><source>The Journal of Cell Biology</source><volume>201</volume><fpage>663</fpage><lpage>671</lpage><pub-id pub-id-type="doi">10.1083/jcb.201211146</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Petrovska</surname><given-names>I</given-names></name><name><surname>Nuske</surname><given-names>E</given-names></name><name><surname>Munder</surname><given-names>MC</given-names></name><name><surname>Kulasegaran</surname><given-names>G</given-names></name><name><surname>Malinovska</surname><given-names>L</given-names></name><name><surname>Kroschwald</surname><given-names>S</given-names></name><name><surname>Richter</surname><given-names>D</given-names></name><name><surname>Fahmy</surname><given-names>K</given-names></name><name><surname>Gibson</surname><given-names>K</given-names></name><name><surname>Verbavatz</surname><given-names>JM</given-names></name><name><surname>Alberti</surname><given-names>S</given-names></name></person-group><year>2014</year><article-title>Filament formation by metabolic enzymes is a specific adaptation to an advanced state of cellular starvation</article-title><source>eLife</source><pub-id pub-id-type="doi">10.7554/eLife.02409</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Piao</surname><given-names>H</given-names></name><name><surname>MacLean Freed</surname><given-names>J</given-names></name><name><surname>Mayinger</surname><given-names>P</given-names></name></person-group><year>2012</year><article-title>Metabolic activation of the HOG MAP kinase pathway by Snf1/AMPK regulates lipid signaling at the Golgi</article-title><source>Traffic</source><volume>13</volume><fpage>1522</fpage><lpage>1531</lpage><pub-id pub-id-type="doi">10.1111/j.1600-0854.2012.01406.x</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ramaswami</surname><given-names>M</given-names></name><name><surname>Taylor</surname><given-names>JP</given-names></name><name><surname>Parker</surname><given-names>R</given-names></name></person-group><year>2013</year><article-title>Altered ribostasis: RNA-protein granules in degenerative disorders</article-title><source>Cell</source><volume>154</volume><fpage>727</fpage><lpage>736</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2013.07.038</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rothman</surname><given-names>JE</given-names></name><name><surname>Wieland</surname><given-names>FT</given-names></name></person-group><year>1996</year><article-title>Protein sorting by transport vesicles</article-title><source>Science</source><volume>272</volume><fpage>227</fpage><lpage>234</lpage><pub-id pub-id-type="doi">10.1126/science.272.5259.227</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Schekman</surname><given-names>R</given-names></name><name><surname>Orci</surname><given-names>L</given-names></name></person-group><year>1996</year><article-title>Coat proteins and vesicle budding</article-title><source>Science</source><volume>271</volume><fpage>1526</fpage><lpage>1533</lpage><pub-id pub-id-type="doi">10.1126/science.271.5255.1526</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shamu</surname><given-names>CE</given-names></name><name><surname>Cox</surname><given-names>JS</given-names></name><name><surname>Walter</surname><given-names>P</given-names></name></person-group><year>1994</year><article-title>The unfolded-protein-response pathway in yeast</article-title><source>Trends in Cell Biology</source><volume>4</volume><fpage>56</fpage><lpage>60</lpage><pub-id pub-id-type="doi">10.1016/0962-8924(94)90011-6</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shimada</surname><given-names>Y</given-names></name><name><surname>Burn</surname><given-names>KM</given-names></name><name><surname>Niwa</surname><given-names>R</given-names></name><name><surname>Cooley</surname><given-names>L</given-names></name></person-group><year>2011</year><article-title>Reversible response of protein localization and microtubule organization to nutrient stress during Drosophila early oogenesis</article-title><source>Developmental biology</source><volume>355</volume><fpage>250</fpage><lpage>262</lpage><pub-id pub-id-type="doi">10.1016/j.ydbio.2011.04.022</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shindiapina</surname><given-names>P</given-names></name><name><surname>Barlowe</surname><given-names>C</given-names></name></person-group><year>2010</year><article-title>Requirements for transitional endoplasmic reticulum site structure and function in <italic>Saccharomyces cerevisiae</italic></article-title><source>Molecular Biology of the Cell</source><volume>21</volume><fpage>1530</fpage><lpage>1545</lpage><pub-id pub-id-type="doi">10.1091/mbc.E09-07-0605</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stevens</surname><given-names>TJ</given-names></name><name><surname>Arkin</surname><given-names>IT</given-names></name></person-group><year>2000</year><article-title>Do more complex organisms have a greater proportion of membrane proteins in their genomes?</article-title><source>Proteins</source><volume>39</volume><fpage>417</fpage><lpage>420</lpage><pub-id pub-id-type="doi">10.1002/(SICI)1097-0134(20000601)39:43.0.CO;2-Y</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Stoecklin</surname><given-names>G</given-names></name><name><surname>Kedersha</surname><given-names>N</given-names></name></person-group><year>2013</year><article-title>Relationship of GW/P-bodies with stress granules</article-title><source>Advances in Experimental Medicine and Biology</source><volume>768</volume><fpage>197</fpage><lpage>211</lpage><pub-id pub-id-type="doi">10.1007/978-1-4614-5107-5_12</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Teixeira</surname><given-names>L</given-names></name><name><surname>Rabouille</surname><given-names>C</given-names></name><name><surname>Rorth</surname><given-names>P</given-names></name><name><surname>Ephrussi</surname><given-names>A</given-names></name><name><surname>Vanzo</surname><given-names>NF</given-names></name></person-group><year>2003</year><article-title>Drosophila Perilipin/ADRP homologue Lsd2 regulates lipid metabolism</article-title><source>Mechanisms of Development</source><volume>120</volume><fpage>1071</fpage><lpage>1081</lpage><pub-id pub-id-type="doi">10.1016/S0925-4773(03)00158-8</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>van Donselaar</surname><given-names>E</given-names></name><name><surname>Posthuma</surname><given-names>G</given-names></name><name><surname>Zeuschner</surname><given-names>D</given-names></name><name><surname>Humbel</surname><given-names>BM</given-names></name><name><surname>Slot</surname><given-names>JW</given-names></name></person-group><year>2007</year><article-title>Immunogold labeling of cryosections from high-pressure frozen cells</article-title><source>Traffic</source><volume>8</volume><fpage>471</fpage><lpage>485</lpage></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wilson</surname><given-names>MZ</given-names></name><name><surname>Gitai</surname><given-names>Z</given-names></name></person-group><year>2013</year><article-title>Beyond the cytoskeleton: mesoscale assemblies and their function in spatial organization</article-title><source>Current Opinion in Microbiology</source><volume>16</volume><fpage>177</fpage><lpage>183</lpage><pub-id pub-id-type="doi">10.1016/j.mib.2013.03.008</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wootton</surname><given-names>JC</given-names></name><name><surname>Federhen</surname><given-names>S</given-names></name></person-group><year>1996</year><article-title>Analysis of compositionally biased regions in sequence databases</article-title><source>Methods in Enzymology</source><volume>266</volume><fpage>554</fpage><lpage>571</lpage></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zacharogianni</surname><given-names>M</given-names></name><name><surname>Kondylis</surname><given-names>V</given-names></name><name><surname>Tang</surname><given-names>Y</given-names></name><name><surname>Farhan</surname><given-names>H</given-names></name><name><surname>Xanthakis</surname><given-names>D</given-names></name><name><surname>Fuchs</surname><given-names>F</given-names></name><name><surname>Boutros</surname><given-names>M</given-names></name><name><surname>Rabouille</surname><given-names>C</given-names></name></person-group><year>2011</year><article-title>ERK7 is a negative regulator of protein secretion in response to amino-acid starvation by modulating Sec16 membrane association</article-title><source>The EMBO Journal</source><volume>30</volume><fpage>3684</fpage><lpage>3700</lpage><pub-id pub-id-type="doi">10.1038/emboj.2011.253</pub-id></element-citation></ref></ref-list></back><sub-article article-type="article-commentary" id="SA1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.04132.029</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Nunnari</surname><given-names>Jodi</given-names></name><role>Reviewing editor</role><aff><institution>University of California, Davis</institution>, <country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see <ext-link ext-link-type="uri" xlink:href="http://elifesciences.org/review-process">review process</ext-link>). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.</p></boxed-text><p>Thank you for sending your work entitled &#x201c;The Sec body, a novel ERES component-driven stress assembly that ensures cell viability during amino-acid starvation&#x201d; for consideration at <italic>eLife</italic>. Your article has been favorably evaluated by Vivek Malhotra (Senior editor), a Reviewing editor, and 2 reviewers, one of whom is a member of our Board of Reviewing Editors. Reviewer 1, Elizabeth Miller, has agreed to reveal her identity.</p><p>The Reviewing editor and the other reviewers discussed their comments before we reached this decision. The reviewer comments have been appended below. As you will see, the reviewers felt that the discovery of a starvation induced Drosophila Sec body that sequesters core COPII components represents a significant advance that will be of interest to a broad cell biological audience. While the characterization of the Sec body is of high quality, the reviewers felt that the functional significance of this structure needs to be addressed more fully before the manuscript is suitable for publication. The reviewers have two suggestions for experiments that would address this concern. Both reviewers suggest an analysis of mutations in the Sec body component Sec24AB that selectively perturbs Sec body formation, such as in the disordered region of postulated to contribute to lipid droplet Sec body properties. Such selective mutations will test the model presented in the manuscript and could be used to more accurately assess Sec body function. In addition and/or alternatively, reviewer 2 suggests that more precise assays should be used to test your model that Sec bodies are required to re-build the secretory pathway during recovery from starvation.</p><p><italic>Reviewer &#x23;1:</italic></p><p>The manuscript by Rabouille and colleagues describes an exciting new point of regulation of the COPII coat, the formation of &#x201c;Sec bodies&#x201d; upon amino acid starvation. To my mind, this is a significant discovery that adds insight into the relatively poorly understood mechanisms of regulation of ER export. The authors thoroughly investigate which components localize to large inclusions that accrue upon prolonged nutrient stress, identifying the core COPII coat components, Sec23/Sec24, Sec31 and Sec16 as both constituents of the structures and drivers of their formation. The timing of Sec body accumulation is monitored alongside autophagy events, which highlights an interesting property: Sec bodies appear after autophagy has declined, which is significant since COPII vesicles are now known to contribute directly to autophagosome formation. Hence, the timing of stress-related events would seem to involve a cascade of trafficking redirection followed by trafficking shutdown. This appealing model is supported by bioinformatic analysis of the COPII coat that identifies disordered regions that may contribute to &#x201c;liquid droplet&#x201d; properties of the COPII coat proteins themselves. The one experiment that I would suggest is to directly assess how one of these disordered regions contributes to inclusion formation: since Sec24AB is required for Sec body formation, deleting the disordered N-terminus should have a similar effect. This would be an elegant experiment since yeast experiments with N-terminally truncated Sec24 do not impact secretion in general (our unpublished data), supporting a regulatory role for this domain. In other respects, the study is solid, well-controlled and an exciting new discovery.</p><p><italic>Reviewer &#x23;2:</italic></p><p>This study describes a novel stress-induced structure called the Sec body and provides an initial characterization in Drosophila S2 cells. This structure forms in response to nutrient starvation and appears to be composed primarily of COPII components involved in ER exit. The structure is reversible, and is proposed to be an important storage depot that can be used to re-build the early secretory pathway (specifically ER exit sites) during recovery from starvation. The strengths of the study are its careful characterization of this structure by high quality microscopy studies and the exclusion of a wide range of alternative possible structures. The interest in this study is heightened by the appreciation in recent years of non-membrane-bound cellular structures that may be regulated sites of specialized biochemistry or storage. Description of the Sec body should add to this growing trend, and stimulate future work on this topic. The main drawbacks of the study that lessen its overall impact are the limitation of analysis to only Drosophila S2 cells (plus a little analysis in Drosophila tissue/larvae), and the unresolved issue of functional relevance.</p><p>Specific points:</p><p>1) As noted above, the existence of the Sec body outside of Drosophila is not established as yet, and this would seem to help broaden the impact and level of interest in this study. It is worth discussing the evolutionary conservation of this phenomenon (or if available, results from mammalian cells).</p><p>2) The importance of the Sec body is hinted at in the last experiment, but by itself, was not especially compelling. It would substantially strengthen the paper if biological relevance were established with either a more specific perturbation and/or a more specific assay for ER exit (as opposed to cell death). The concern is that the cell death outcome may not be causally related to the absence of the Sec body; rather, the Sec24AB knockdown could independently affect both Sec body formation and other cellular processes, the latter of which ultimately cause reduced viability. Below are some suggestions that might help improve this important last part of the paper. I&#x27;m not suggesting that all three are needed, but any one would strengthen the case for physiologic relevance/function of the Sec body.</p><p>a. The ideal experiment would involve a manipulation that disrupts Sec body formation without affecting other cellular processes. I&#x27;m sure the authors have considered this extensively, but is there a mutant of Sec24AB, perhaps in the LCS, that would preclude Sec body formation without affecting its function at ERES? Such a mutant that dissociates these two functions would be well investigating as it would allow Sec body function to be studied with higher precision.</p><p>b. An alternative strategy to more specifically probe Sec body function would be to use a more precise assay. If the Sec body is needed to re-establish the early secretory pathway, then secretion should be diminished upon recovery in Sec24AB knockdown cells relative to the situation before starvation, whereas secretion rates should be the same before versus after in Sec24CD knockdown cells (or control cells, where Sec body formation is normal).</p><p>c. One could see whether, in the Sec24AB knockdown cells, starvation induces degradation of other Sec body components. In other words, is one purpose of the Sec body to protect these key factors from degradation, as speculated?</p></body></sub-article><sub-article article-type="reply" id="SA2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.04132.030</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p>Reviewer &#x23;1:</p><p><italic>The manuscript by Rabouille and colleagues describes an exciting new point of regulation of the COPII coat, the formation of &#x201c;Sec bodies&#x201d; upon amino acid starvation. To my mind, this is a significant discovery that adds insight into the relatively poorly understood mechanisms of regulation of ER export. [&#x2026;] The one experiment that I would suggest is to directly assess how one of these disordered regions contributes to inclusion formation: since Sec24AB is required for Sec body formation, deleting the disordered N-terminus should have a similar effect. This would be an elegant experiment since yeast experiments with N-terminally truncated Sec24 do not impact secretion in general (our unpublished data), supporting a regulatory role for this domain. In other respects, the study is solid, well-controlled and an exciting new discovery</italic>.</p><p>We first thank Dr Liz Miller for her very supportive and positive review.</p><p>To test the role for LCS, we performed an experiment along the proposed lines. We expressed Sec24AB LCS-sfGFP (aa 1-415) and Sec24AB nonLCS-sfGFP (aa 416-1184) and compared their dynamics/behavior in starved cells to this of full length Sec24AB-sfGFP.</p><p>In normal growth conditions, both FL Sec24AB and its LCS localize to ERES, although the LCS is slightly more cytoplasmic. Conversely, the nonLCS is mostly cytoplasmic with a very small pool localized to ERES.</p><p>This is not completely in line with what the reviewer has said of yeast Sec24, that is, that removing part of the N-terminal of Sec24 would not do change its properties. Our experiments would suggest that Sec24AB-LCS behaves much more like the full length than the nonLCS (that corresponds to Sec24 N-terminal truncation of 1/3 of the protein). However, we do not know how long the N-terminal truncation of yeast Sec24 was. Second, our experimental set up is different as we express these chimeric proteins on top of the endogenous Sec24AB and this might change the behavior of the LCS. Third, yeast Sec24 is more similar to Drosophila Sec24CD (<xref ref-type="fig" rid="fig6s2">Figure 6&#x2013;figure supplement 2</xref>) and we assess here Sec24AB. Last, the amount of structured domains in the N-ter of yeast Sec24 seems higher than the Drosophila counterparts, which might confer different properties.</p><p>When cells are starved of amino-acids, FL Sec24AB is incorporated to Sec bodies (as shown in <xref ref-type="fig" rid="fig1">Figure1</xref>) and its LCS also, very efficiently (<xref ref-type="fig" rid="fig6">Figure 6B</xref>). Conversely, the nonLCS remains largely cytoplasmic and is not efficiently recruited to Sec bodies, although it is present in these structures. This shows that as predicted, the LCS region of Sec24AB is necessary and sufficient for its recruitment to Sec bodies (<xref ref-type="fig" rid="fig6">Figure 6B</xref>).</p><p>We then investigated whether Sec24AB LCS is sufficient to drive Sec body formation. To this end, we depleted cells of Sec24AB, expressed Sec24AB LCS in these depleted cells and asked whether it rescues Sec body formation.</p><p>As reported, Sec24AB depletion leads to smaller structures that are not Sec bodies (see below). However, expression of Sec24AB-LCS, although it localizes to the resulting smaller structures, does not lead to the typical large Sec body formation. This suggests that Sec24AB LCS does not drive Sec body formation. This is shown in <xref ref-type="fig" rid="fig6s3">Figure 6&#x2013;figure supplement 3</xref>.</p><p>Reviewer &#x23;2:</p><p><italic>This study describes a novel stress-induced structure called the Sec body and provides an initial characterization in Drosophila S2 cells. [&#x2026;] The interest in this study is heightened by the appreciation in recent years of non-membrane-bound cellular structures that may be regulated sites of specialized biochemistry or storage. Description of the Sec body should add to this growing trend, and stimulate future work on this topic. The main drawbacks of the study that lessen its overall impact are the limitation of analysis to only Drosophila S2 cells (plus a little analysis in Drosophila tissue/larvae), and the unresolved issue of functional relevance</italic>.</p><p><italic>Specific points:</italic></p><p><italic>1) As noted above, the existence of the Sec body outside of Drosophila is not established as yet, and this would seem to help broaden the impact and level of interest in this study. It is worth discussing the evolutionary conservation of this phenomenon (or if available, results from mammalian cells)</italic>.</p><p>We have addressed this point in three ways:</p><p>First, we starved three mammalian cell lines, immortalized MEFs, COS cells and HEK cells under similar conditions as S2 cells. We definitely see a remodeling of ERES components in starved MEFs when compared to fed cells (<xref ref-type="fig" rid="fig1s4">Figure 1&#x2013;figure supplement 4</xref>). However, whether this corresponds to Sec bodies is too early to say. HEK cells detach upon starvation and the response of COS cells is complex (and needs to be investigated further).</p><p>Second, Sec bodies formation is a combination of (at least) two factors. One factor is that the absence of amino-acids needs to be sensed and signaled. This is perhaps not similar in mammalian and Drosophila cells. The other factor is that ERES components respond to this signaling. Drosophila proteins that are incorporated in Sec bodies might have different properties from their mammalian counterparts.</p><p>To test this, we transfected human Sec16A (the long isoform) in S2 cells. In normal growth conditions, hSec16A localizes partially to ERES and it is efficiently incorporated in Sec bodies upon starvation. This suggests that hSec16A has molecular properties compatible with Sec body recruitment (<xref ref-type="fig" rid="fig1s5">Figure 1&#x2013;figure supplement 5</xref>).</p><p>Finally, we would like to stress that although the conservation of the response to amino-acid starvation needs to be demonstrated and is indisputably important, we feel that the results we got on Drosophila are of sufficient interest on their own to justify publication. Many phenomena are only shown in yeast, for instance the formation of filamentous structures enriched in glutamate synthase upon starvation that was recently published in <italic>Elife</italic>. Furthermore, the concept of liquid droplets has first been illustrated in model organisms (with the P granules in <italic>C. elegans</italic>) and has only be applied later to mammalian stress granules.</p><p><italic>2) The importance of the Sec body is hinted at in the last experiment, but by itself, was not especially compelling. It would substantially strengthen the paper if biological relevance were established with either a more specific perturbation and/or a more specific assay for ER exit (as opposed to cell death). The concern is that the cell death outcome may not be causally related to the absence of the Sec body; rather, the Sec24AB knockdown could independently affect both Sec body formation and other cellular processes, the latter of which ultimately cause reduced viability. Below are some suggestions that might help improve this important last part of the paper. I&#x27;m not suggesting that all three are needed, but any one would strengthen the case for physiologic relevance/function of the Sec body</italic>.</p><p>This is a fair point. In the original manuscript, based on the fact that protein synthesis was not needed for the reversion of Sec bodies to ERES, we have proposed that Sec bodies act as a reservoir for ERES components. This would allow ERES to be re-built immediately upon stress relief and be instrumental to cell viability.</p><p>We now show that ERES are indeed re-built within 20 minutes of growth medium addition and that they efficiently sustain anterograde transport of the plasma membrane reporter Delta, as efficiently as in non-starved cells (<xref ref-type="fig" rid="fig8">Figure 8 A-C</xref>; <xref ref-type="fig" rid="fig8s1">Figure 8&#x2013;figure supplement 1</xref>).</p><p>We have also monitored the protein level of COPII components Sec23 and Sec31, and showed that are stabilized upon starvation (<xref ref-type="fig" rid="fig9">Figure 9A</xref>, lanes 1 and 2). This illustrates the notion that Sec bodies act to prevent degradation that might occurs in growing conditions (of note, we do not have a mechanism behind this degradation/stabilization at this stage).</p><p>To strengthen our conclusion, we have followed two (b and c) of the reviewer&#x2019;s suggestions:</p><p><italic>a. The ideal experiment would involve a manipulation that disrupts Sec body formation without affecting other cellular processes. I&#x27;m sure the authors have considered this extensively, but is there a mutant of Sec24AB, perhaps in the LCS, that would preclude Sec body formation without affecting its function at ERES? Such a mutant that dissociates these two functions would be well investigating as it would allow Sec body function to be studied with higher precision</italic>.</p><p>This is a great suggestion, but we do not have such a mutant yet.</p><p><italic>b. An alternative strategy to more specifically probe Sec body function would be to use a more precise assay. If the Sec body is needed to re-establish the early secretory pathway, then secretion should be diminished upon recovery in Sec24AB knockdown cells relative to the situation before starvation, whereas secretion rates should be the same before versus after in Sec24CD knockdown cells (or control cells, where Sec body formation is normal)</italic>.</p><p>We agree that Sec body formation could be linked to other cell processes, some of them important for cell viability. But we have monitored transport from depleted cells in which Sec bodies do not form (Sec24AB depleted) that were first starved and reversed to full medium. Upon Sec24AB depletion, transport after the regimen of starvation/growth resumes less efficiently than in mock depleted cells (<xref ref-type="fig" rid="fig9">Figure 9C</xref>). Of course, it can be argued that we measure the absence of a COPII component necessary for transport.</p><p>However, Sec24AB-depleted cells kept in Schneider&#x2019;s are almost as efficient in Delta anterograde transport as mock-depleted cells. This is probably because Sec24CD compensates for the loss of AB. Therefore, the transport impairment of Sec24AB depleted cells after the regimen of starvation/growth is likely to be due to the absence of Sec body formation.</p><p>Taken together, we can state that Sec body formation allows a quicker resumption of transport through the secretory pathway when compared to situations where they do not form. This is likely to be a factor important for the cell viability upon stress relief. Why and how the cell population decreases rapidly during starvation remains to be investigated.</p><p><italic>c. One could see whether, in the Sec24AB knockdown cells, starvation induces degradation of other Sec body components. In other words, is one purpose of the Sec body to protect these key factors from degradation, as speculated?</italic></p><p>We have performed this experiment and show that upon conditions where Sec bodies do not form (upon Sec23, 24AB and Sec16 depletion), Sec body components are less stable than in cells where Sec bodies do form.</p><p>As mentioned above, the stabilization of Sec31 observed in mock-depleted cells (<xref ref-type="fig" rid="fig9">Figure 9A</xref>, lanes 1 and 2) is not observed upon depletion of Sec16, 23 and 24AB (compare lanes 2, 4, 6 and 8). Sec23 is also not stabilized in starved cells depleted of Sec16 (compare lanes 2 and 4). Altogether, this shows that Sec bodies do act as a protective mechanism for ERES components.</p><p>Curiously, the depletion of Sec16, 23 and 24AB seems to stabilize Sec31 in normal growth conditions. Sec23 is also stabilized in fed Sec16 depleted cells (compare lane 1 and 3). It might be due to a reduction of Sec31 and Sec23 turnover in the absence of other COPII components, perhaps suggesting that Sec31 and Sec23 turnover is enhanced by COPII coat formation. Alternatively, the depletion of a specific ERES component might lead to the compensatory upregulation of others.</p></body></sub-article></article>