elife04193.xml

<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d1 20130915//EN"  "JATS-archivearticle1.dtd"><article article-type="research-article" dtd-version="1.1d1" xmlns:xlink="http://www.w3.org/1999/xlink"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="hwp">eLife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">04193</article-id><article-id pub-id-type="doi">10.7554/eLife.04193</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research article</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>FGF14 modulates resurgent sodium current in mouse cerebellar Purkinje neurons</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-17141"><name><surname>Yan</surname><given-names>Haidun</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="aff" rid="aff2"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-17142"><name><surname>Pablo</surname><given-names>Juan L</given-names></name><xref ref-type="aff" rid="aff2"/><xref ref-type="aff" rid="aff3"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-17143"><name><surname>Wang</surname><given-names>Chaojian</given-names></name><xref ref-type="aff" rid="aff1"/><xref ref-type="aff" rid="aff2"/><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-11192"><name><surname>Pitt</surname><given-names>Geoffrey S</given-names></name><contrib-id contrib-id-type="orcid">http://orcid.org/0000-0003-2246-0289</contrib-id><xref ref-type="aff" rid="aff1"/><xref ref-type="aff" rid="aff2"/><xref ref-type="aff" rid="aff3"/><xref ref-type="corresp" rid="cor1">*</xref><xref ref-type="other" rid="par-1"/><xref ref-type="other" rid="par-2"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><institution content-type="dept">Department of Medicine</institution>, <institution>Duke University Medical Center</institution>, <addr-line><named-content content-type="city">Durham</named-content></addr-line>, <country>United States</country></aff><aff id="aff2"><institution content-type="dept">Ion Channel Research Unit</institution>, <institution>Duke University Medical Center</institution>, <addr-line><named-content content-type="city">Durham</named-content></addr-line>, <country>United States</country></aff><aff id="aff3"><institution content-type="dept">Department of Neurobiology</institution>, <institution>Duke University Medical Center</institution>, <addr-line><named-content content-type="city">Durham</named-content></addr-line>, <country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Westbrook</surname><given-names>Gary L</given-names></name><role>Reviewing editor</role><aff><institution>Vollum Institute</institution>, <country>United States</country></aff></contrib></contrib-group><author-notes><corresp id="cor1"><label>*</label>For correspondence: <email>geoffrey.pitt@duke.edu</email></corresp></author-notes><pub-date date-type="pub" publication-format="electronic"><day>30</day><month>09</month><year>2014</year></pub-date><pub-date pub-type="collection"><year>2014</year></pub-date><volume>3</volume><elocation-id>e04193</elocation-id><history><date date-type="received"><day>30</day><month>07</month><year>2014</year></date><date date-type="accepted"><day>29</day><month>09</month><year>2014</year></date></history><permissions><copyright-statement>© 2014, Yan et al</copyright-statement><copyright-year>2014</copyright-year><copyright-holder>Yan et al</copyright-holder><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife04193.pdf"/><abstract><object-id pub-id-type="doi">10.7554/eLife.04193.001</object-id><p>Rapid firing of cerebellar Purkinje neurons is facilitated in part by a voltage-gated Na<sup>+</sup> (Na<sub>V</sub>) ‘resurgent’ current, which allows renewed Na<sup>+</sup> influx during membrane repolarization. Resurgent current results from unbinding of a blocking particle that competes with normal channel inactivation. The underlying molecular components contributing to resurgent current have not been fully identified. In this study, we show that the Na<sub>V</sub> channel auxiliary subunit FGF14 ‘b’ isoform, a locus for inherited spinocerebellar ataxias, controls resurgent current and repetitive firing in Purkinje neurons. FGF14 knockdown biased Na<sub>V</sub> channels towards the inactivated state by decreasing channel availability, diminishing the ‘late’ Na<sub>V</sub> current, and accelerating channel inactivation rate, thereby reducing resurgent current and repetitive spiking. Critical for these effects was both the alternatively spliced FGF14b N-terminus and direct interaction between FGF14b and the Na<sub>V</sub> C-terminus. Together, these data suggest that the FGF14b N-terminus is a potent regulator of resurgent Na<sub>V</sub> current in cerebellar Purkinje neurons.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04193.001">http://dx.doi.org/10.7554/eLife.04193.001</ext-link></p></abstract><abstract abstract-type="executive-summary"><object-id pub-id-type="doi">10.7554/eLife.04193.002</object-id><title>eLife digest</title><p>The cerebellum is a region of the brain that is involved in motor control, and it contains a special type of nerve cells called Purkinje neurons. Messages travel along neurons as electrical signals carried by sodium ions, which have a positive electric charge. Normally, when a neuron is ‘at rest’, the plasma membrane that surrounds the neuron prevents the sodium ions outside the cell from entering. To send an electrical signal, voltage-sensitive proteins in the membrane called sodium channels open up. This allows the sodium ions to enter the cell by passing through a pore in the channel protein, thereby changing the voltage across the membrane.</p><p>Once sodium channels open, they rapidly become ‘locked’ in a closed state, which allows the membrane voltage to return to its original value before another signal can be sent. This locked state also prevents sodium channels from reopening quickly. As a consequence most neurons cannot send successive electrical signals rapidly. Purkinje neurons are unusual because they can send many electrical signals in quick succession—known as rapid firing—without having to be reset each time.</p><p>Rapid firing is possible in Purkinje neurons because the channel proteins can be reopened to allow more Na<sup>+</sup> to enter the cell, but it is not clear how this is controlled. Now, based on experiments on Purkinje neurons isolated from mice, Yan et al. have shown that a protein called FGF14 that binds to the sodium channel proteins can help them to reopen quickly in order to allow rapid firing.</p><p>Spinocerebellar ataxia is a degenerative disease caused by damage to the cerebellum that leads to loss of physical coordination. Some patients suffering from this disease carry mutations in the gene that makes the FGF14 protein. Therefore, understanding the role of FGF14 in the rapid firing of Purkinje neurons may aid the development of new treatments for this disease.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04193.002">http://dx.doi.org/10.7554/eLife.04193.002</ext-link></p></abstract><kwd-group kwd-group-type="author-keywords"><title>Author keywords</title><kwd>resurgent sodium current</kwd><kwd>cerebellum</kwd><kwd>spinocerebellar ataxia</kwd><kwd>cerebellar Purkinje neurons</kwd><kwd>electrophysiology</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>mouse</kwd></kwd-group><funding-group><award-group id="par-1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000050</institution-id><institution>National Heart, Lung, and Blood Institute</institution></institution-wrap></funding-source><award-id>R01 HL071165</award-id><principal-award-recipient><name><surname>Pitt</surname><given-names>Geoffrey S</given-names></name></principal-award-recipient></award-group><award-group id="par-2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000050</institution-id><institution>National Heart, Lung, and Blood Institute</institution></institution-wrap></funding-source><award-id>R01 HL112918</award-id><principal-award-recipient><name><surname>Pitt</surname><given-names>Geoffrey S</given-names></name></principal-award-recipient></award-group><funding-statement>The funder had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name><meta-value>2</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>The N-terminus of the FGF14b isoform promotes the inactivation of voltage-gated Na<sup>+</sup> channels to regulate the resurgent Na<sup>+</sup> channel current needed for high frequency action potentials.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1" sec-type="intro"><title>Introduction</title><p>Cerebellar Purkinje neurons, which provide the sole output from the cerebellar cortex, display a repetitive firing behavior driven by voltage-gated Na<sup>+</sup> channels (Na<sub>V</sub> channels). Fast repetitive firing in Purkinje neurons is promoted by unusual characteristics associated with Na<sub>V</sub> channel inactivation, whereby channels recover unusually rapidly from inactivation and in doing so pass a ‘resurgent’ sodium current, which helps drive the cell to fire a subsequent action potential. The molecular components underlying the peculiar properties of Na<sub>V</sub> channels in Purkinje neurons have not been definitively identified.</p><p>Several features of Na<sub>V</sub> currents in cerebellar Purkinje neurons, however, set them apart from Na<sub>V</sub> currents recorded in other neurons. First, more than half of the Na<sub>V</sub> current in Purkinje neurons is carried by Na<sub>V</sub>1.6, an isoform for which inactivation is less complete compared to other Na<sub>V</sub> channels (<xref ref-type="bibr" rid="bib23">Raman et al., 1997</xref>). Examination of Na<sub>V</sub> currents in cerebellar Purkinje neurons from <italic>Scn8a</italic><sup><italic>−/−</italic></sup> mice showed that, compared to the other resident Na<sub>V</sub> channels, the <italic>Scn8a</italic>-encoded Na<sub>V</sub>1.6 channels have a relatively large ‘late’ (non-inactivating) component and Na<sub>V</sub>1.6 channels have increased availability (depolarized V<sub>1/2</sub> for steady-state inactivation). Second, Na<sub>V</sub> channels in cerebellar Purkinje neurons display an unusual transient re-opening during repolarization, which is identified as ‘resurgent’ Na<sub>V</sub> current (<xref ref-type="bibr" rid="bib21">Raman and Bean, 1997</xref>). This resurgent current derives from an unblocking of open channels by a peptide moiety that can be eliminated by the intracellular application of trypsin or chymotrypsin proteases into the cytoplasm (<xref ref-type="bibr" rid="bib8">Grieco et al., 2005</xref>). The blocking particle acts only on open channels and competes with the inactivation process to prevent channels from entering an absorbed, inactivated state. During action potential repolarization, unblocking of these channels then allows Na<sup>+</sup> influx that can initiate a subsequent action potential (<xref ref-type="bibr" rid="bib13">Khaliq et al., 2003</xref>). Since the Na<sub>V</sub> current in Purkinje neurons carried by Na<sub>V</sub>1.6 is relatively resistant to inactivation, it is particularly susceptible to open block by the peptide moiety. Why Na<sub>V</sub>1.6 channels in cerebellar Purkinje neurons are relatively resistant to inactivation, however, is unknown.</p><p>Here, we focused on the role of the ion channel regulator FGF14, which is enriched in cerebellar granule and Purkinje neurons (<xref ref-type="bibr" rid="bib29">Wang et al., 2002</xref>). FGF14 is one of four fibroblast growth factor homologous factors (FHFs), members of the fibroblast growth factor (FGF) superfamily sharing a FGF-like core but having extended N- and C-termini not found in other FGFs. Individual FHFs undergo alternative splicing that generates distinct N-termini, none of which contain a signal sequence (<xref ref-type="bibr" rid="bib26">Smallwood et al., 1996</xref>; <xref ref-type="bibr" rid="bib20">Munoz-Sanjuan et al., 2000</xref>). Thus, unlike other FGFs they are not secreted and do not function as growth factors (<xref ref-type="bibr" rid="bib26">Smallwood et al., 1996</xref>). Instead, FHFs remain intracellular and modulate various ion channels. FHFs can bind directly to the cytoplasmic C-terminal domains (CTDs) of Na<sub>V</sub> channels (<xref ref-type="bibr" rid="bib17">Liu et al., 2001</xref>) and regulate Na<sub>V</sub> channel function (<xref ref-type="bibr" rid="bib18">Lou et al., 2005</xref>). Further, FGF14 is a potent regulator of both Na<sub>V</sub>1.1 and Na<sub>V</sub>1.6 (<xref ref-type="bibr" rid="bib18">Lou et al., 2005</xref>; <xref ref-type="bibr" rid="bib15">Laezza et al., 2009</xref>), the two dominant Na<sub>V</sub> channels in cerebellar Purkinje neurons (<xref ref-type="bibr" rid="bib23">Raman et al., 1997</xref>; <xref ref-type="bibr" rid="bib12">Kalume et al., 2007</xref>). FHFs also regulate voltage-gated Ca<sup>2+</sup> channels through a mechanism that does not appear to involve a direct interaction (<xref ref-type="bibr" rid="bib11">Hennessey et al., 2013</xref>; <xref ref-type="bibr" rid="bib33">Yan et al., 2013</xref>). An ataxia phenotype in <italic>Fgf14</italic><sup><italic>−/−</italic></sup> mice highlights the role of FGF14 in cerebellar physiology and the development of spinocerebellar ataxia type 27 (SCA27) in patients with either FGF14 haploinsufficiency or a dominant negative <italic>FGF14</italic> mutation (<xref ref-type="bibr" rid="bib29">Wang et al., 2002</xref>; <xref ref-type="bibr" rid="bib27">van Swieten et al., 2003</xref>; <xref ref-type="bibr" rid="bib5">Dalski et al., 2005</xref>) underscores the role of FGF14 in disease.</p><p>Using shRNA knockdown of endogenous FGF14 in cultured cerebellar Purkinje neurons and replacement with informative mutants that blocked binding of FGF14 to Na<sub>V</sub> CTDs and eliminated the FGF14 extended N-terminus, we found that FGF14, and especially the N-terminus of the FGF14b isoform exerts specific kinetic effects on cerebellar Na<sub>V</sub> channels that support repetitive firing and therefore provides new information on the pathophysiology of SCA27.</p></sec><sec id="s2" sec-type="results"><title>Results</title><p>To test whether FGF14 was a contributor to regulation of Na<sub>V</sub> current in cerebellar Purkinje neurons, we first confirmed its expression in cerebellum and demonstrated that FGF14 co-immunoprecipitates with Na<sub>V</sub>1.6 channels in mouse cerebellar lysates (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Although FGF14 was previously shown to co-immunoprecipitate with Na<sub>V</sub>1.6 in a heterologous expression system (<xref ref-type="bibr" rid="bib15">Laezza et al., 2009</xref>), co-immunoprecipitation between FGF14 and Na<sub>V</sub>1.6 channels has not been reported from brain.<fig id="fig1" position="float"><object-id pub-id-type="doi">10.7554/eLife.04193.003</object-id><label>Figure 1.</label><caption><title>FGF14 is a component of the Na<sub>V</sub>1.6 macromolecular complex in mouse cerebellum, but shRNA knockdown does not affect Na<sub>V</sub> current density in cultured cerebellar Purkinje neurons.</title><p>(<bold>A</bold>) Co-immunoprecipitation (IP) of Na<sub>V</sub>1.6 by FGF14 from mouse cerebellum and immunoblot (IB) with the indicated antibodies. M<sub>w</sub> markers are indicated on right. Arrowheads indicate Na<sub>V</sub>1.6 (top panel) and FGF14 (bottom panel). Intense signal in bottom panel below the FGF14 signal is immunoglobulin light chain. (<bold>B</bold>) Current–voltage relationships (normalized to cell capacitance) of transient Na<sub>V</sub> currents from cerebellar Purkinje neurons transfected with Scrambled control shRNA (Scrambled), FGF14 shRNA (shRNA), or FGF14 shRNA plus the shRNA-resistant FGF14b<sup>WT</sup> (shRNA/FGF14<sup>WT</sup>). The number of neurons tested, <italic>N</italic>, is in parentheses. Inset shows schematic of voltage protocol.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04193.003">http://dx.doi.org/10.7554/eLife.04193.003</ext-link></p></caption><graphic xlink:href="elife04193f001"/></fig></p><p>To evaluate the consequences of FGF14 haploinsufficiency in SCA27, we used a previously validated shRNA (<xref ref-type="bibr" rid="bib33">Yan et al., 2013</xref>) to knockdown endogenous FGF14 in cultured cerebellar Purkinje neurons. Knockdown of FGF14 did not affect Na<sub>V</sub> current density compared to the Na<sub>V</sub> current density recorded in neurons transfected with a control shRNA (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). Because knockout of <italic>Fgf14</italic> reduced spiking activity (<xref ref-type="bibr" rid="bib7">Goldfarb et al., 2007</xref>) but Na<sub>V</sub> current density was unaffected in <italic>Fgf14</italic> knockout or knockdown, we hypothesized that the absence of FGF14 must affect Na<sub>V</sub> kinetic properties in ways that prevent repetitive firing. We therefore examined Na<sub>V</sub> kinetic properties in more detail.</p><p>Voltage dependence of activation was unaffected by FGF14 knockdown (<xref ref-type="fig" rid="fig2">Figure 2A</xref>), but the V<sub>1/2</sub> of steady-state inactivation was shifted about −10 mV, thereby decreasing channel availability (<xref ref-type="fig" rid="fig2">Figure 2B</xref> and <xref ref-type="table" rid="tbl1">Table 1</xref>). When we co-expressed a FGF14b cDNA with synonymous substitutions rendering it resistant to the FGF14 shRNA (FGF14b<sup>WT</sup>), the V<sub>1/2</sub> of steady-state inactivation was restored to the control voltage; activation was unaffected (<xref ref-type="fig" rid="fig2">Figure 2A–B</xref> and <xref ref-type="table" rid="tbl1">Table 1</xref>). The ‘rescue’ of steady-state inactivation by expression of the shRNA-insensitive FGF14 provided additional demonstration of the specificity of our shRNA targeting strategy (and see similar rescue for additional parameters below). In addition to the decreased channel availability, we observed that FGF14 knockdown accelerated inactivation kinetics (<xref ref-type="fig" rid="fig2">Figure 2C–D</xref>). FGF14 knockdown also reduced the late Na<sub>V</sub> current (<xref ref-type="fig" rid="fig2">Figure 2E–F</xref>). Thus, by several different kinetic measures, FGF14 knockdown in cerebellar Purkinje neurons biased the endogenous Na<sub>V</sub> channels towards entering the inactivated state. We anticipated, therefore, that FGF14 knockdown should reduce Na<sub>V</sub> resurgent current amplitude, a key feature that allows cerebellar Purkinje neurons to fire repetitively. Indeed, the amplitude of the resurgent Na<sub>V</sub> current (<xref ref-type="fig" rid="fig2">Figure 2G–J</xref>) was markedly diminished using a well-established protocol to elicit Na<sub>V</sub> resurgent current (<xref ref-type="bibr" rid="bib21">Raman and Bean, 1997</xref>). As with the other kinetic properties of Na<sub>V</sub> currents (above), co-expression of FGF14b<sup>WT</sup> in the presence of the shRNA provided a complete rescue (<xref ref-type="fig" rid="fig2">Figure 2G–J</xref>). While FGF14 knockdown reduced the amplitude of resurgent Na<sub>V</sub> current, it did not significantly affect the time to peak (<xref ref-type="fig" rid="fig2">Figure 2K</xref>).<fig id="fig2" position="float"><object-id pub-id-type="doi">10.7554/eLife.04193.004</object-id><label>Figure 2.</label><caption><title>FGF14 knockdown in cerebellar Purkinje neurons affects multiple Na<sub>V</sub> channel biophysical properties.</title><p>(<bold>A</bold> and <bold>B</bold>) Voltage-dependence of Na<sub>V</sub> channel activation and steady-state inactivation in cerebellar Purkinje neurons transfected with Scrambled control shRNA (Scrambled), FGF14 shRNA (shRNA), or FGF14 shRNA plus the shRNA-resistant FGF14b<sup>WT</sup> (shRNA/FGF14<sup>WT</sup>). The number of neurons tested, <italic>N</italic>, is in parentheses. Inset shows schematic of voltage protocol. (<bold>C</bold>) Exemplar normalized Na<sub>V</sub> current traces elicited with a step depolarization to 0 mV from a holding potential of −90 mV and an exemplar single exponential fit (for Scrambled) for the time constant (τ) of inactivation (dotted line). (<bold>D</bold>) τ of inactivation at the indicated test voltages. The number of neurons tested, <italic>N</italic>, is in parentheses. **p &lt; 0.01. (<bold>E</bold>) Exemplar normalized TTX-sensitive late Na<sub>V</sub> currents at −20 mV (measured at 150 ms, arrowhead) from a holding potential of −90 mV. (<bold>F</bold>) Amplitude of late Na<sub>V</sub> current as a % of peak (transient) Na<sub>V</sub> current. The number of neurons tested, <italic>N</italic>, is in parentheses. **p &lt; 0.01. (<bold>G</bold>) Voltage-clamp protocol and exemplar TTX-sensitive resurgent Na<sub>V</sub> currents recorded from cerebellar Purkinje neurons transfected with Scrambled control shRNA. The transient current has been clipped. (<bold>H</bold>) Current–voltage relationship of Na<sub>V</sub> resurgent currents. The number of neurons tested, <italic>N</italic>, is in parentheses. **p &lt; 0.01. (<bold>I</bold>) Overlay of Na<sub>V</sub> resurgent currents for the indicated conditions recorded with the indicated voltage protocol. The transient current has been clipped. (<bold>J</bold>) Ratio of peak Na<sub>V</sub> resurgent current (at +20 mV) to transient Na<sub>V</sub> current (at −10 mV). The number of neurons tested, <italic>N</italic>, is in parentheses. **p &lt; 0.01. (<bold>K</bold>) Time to peak of Na<sub>V</sub> resurgent current over a broad range of voltages. The number of neurons tested, <italic>N</italic>, is in parentheses. **p &lt; 0.01.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04193.004">http://dx.doi.org/10.7554/eLife.04193.004</ext-link></p></caption><graphic xlink:href="elife04193f002"/></fig><table-wrap id="tbl1" position="float"><object-id pub-id-type="doi">10.7554/eLife.04193.005</object-id><label>Table 1.</label><caption><p>Na<sub>V</sub> current activation and inactivation parameters in cerebellar Purkinje neurons</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04193.005">http://dx.doi.org/10.7554/eLife.04193.005</ext-link></p></caption><table frame="hsides" rules="groups"><thead><tr><th/><th colspan="3">Activation</th><th colspan="3">Inactivation</th></tr><tr><th/><th>V<sub>1/2</sub> (mV)</th><th><italic>K</italic></th><th>n</th><th>V<sub>1/2</sub> (mV)</th><th><italic>K</italic></th><th>n</th></tr></thead><tbody><tr><td>Scrambled</td><td>−34.4 ± 1.5</td><td>4.0 ± 0.3</td><td>21</td><td>−49.7 ± 1.2</td><td>4.2 ± 0.1</td><td>19</td></tr><tr><td>shRNA</td><td>−35.0 ± 1.9</td><td>4.3 ± 0.5</td><td>22</td><td>−59.0 ± 1.2**</td><td>4.7 ± 0.2</td><td>20</td></tr><tr><td>shRNA/FGF14b<sup>WT</sup></td><td>−35.5 ± 1.5</td><td>3.9 ± 0.3</td><td>14</td><td>−52.0 ± 0.9</td><td>5.2 ± 0.3</td><td>9</td></tr><tr><td>shRNA/FGF14<sup>RA</sup></td><td>−33.2 ± 1.5</td><td>3.5 ± 0.2</td><td>12</td><td>−50.9 ± 1.4</td><td>4.4 ± 0.3</td><td>11</td></tr><tr><td>FGF14b<sup>WT</sup></td><td>−33.1 ± 1.4</td><td>4.5 ± 0.5</td><td>14</td><td>−50.6 ± 1.3</td><td>4.9 ± 0.3</td><td>10</td></tr><tr><td>FGF14∆<sup>NT</sup></td><td>−33.9 ± 2.0</td><td>3.9 ± 0.5</td><td>14</td><td>−59.1 ± 0.8**</td><td>4.7 ± 0.3</td><td>15</td></tr></tbody></table><table-wrap-foot><fn><p>Mean ± s.e.m. (n), **p &lt; 0.01 compared to Scrambled control.</p></fn></table-wrap-foot></table-wrap></p><p>To determine how FGF14 regulates Na<sub>V</sub> kinetics and Na<sub>V</sub> resurgent current, we turned our focus to the FGF14 N-terminus. The alternatively spliced N-termini of various FHFs have been shown to exert specific effects on Na<sub>V</sub> currents (<xref ref-type="bibr" rid="bib18">Lou et al., 2005</xref>; <xref ref-type="bibr" rid="bib24">Rush et al., 2006</xref>), including the regulation of inactivation kinetics (<xref ref-type="bibr" rid="bib15">Laezza et al., 2009</xref>; <xref ref-type="bibr" rid="bib6">Dover et al., 2010</xref>), but the role of the FGF14 N-termini have not been investigated in cerebellar Purkinje neurons. FGF14b is the predominant FGF14 splice variant expressed in brain (<xref ref-type="bibr" rid="bib28">Wang et al., 2000</xref>, <xref ref-type="bibr" rid="bib30">2011</xref>) and the FGF14 splice variant found in the cytoplasm; FGF14a is localized to the nucleus (<xref ref-type="bibr" rid="bib28">Wang et al., 2000</xref>). To test the specific roles of the FGF14b N-terminus, we expressed a FGF14 in which the N-terminus was deleted (FGF14Δ<sup>NT</sup>). Because the interaction site for the Na<sub>V</sub> CTD on FHFs lies within the conserved core domain (<xref ref-type="bibr" rid="bib31">Wang et al., 2012</xref>), deletion of the N-terminus does not affect interaction with the Na<sub>V</sub> CTD. Thus, the FGF14Δ<sup>NT</sup> exerts a dominant negative effect by competing with endogenous FGF14 for interaction with the Na<sub>V</sub> CTD (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). Current density (<xref ref-type="fig" rid="fig3">Figure 3B</xref>) and the V<sub>1/2</sub> of activation (<xref ref-type="fig" rid="fig3">Figure 3C</xref> and <xref ref-type="table" rid="tbl1">Table 1</xref>) were unaffected. However, expression of FGF14Δ<sup>NT</sup> shifted the V<sub>1/2</sub> of steady-state inactivation about −10 mV (<xref ref-type="fig" rid="fig3">Figure 3C</xref>), accelerated kinetics of inactivation (<xref ref-type="fig" rid="fig3">Figure 3D</xref>), reduced the late Na<sub>V</sub> current (<xref ref-type="fig" rid="fig3">Figure 3E</xref>), and diminished resurgent current (<xref ref-type="fig" rid="fig3">Figure 3F</xref>) to a degree similar to or even greater than shRNA knockdown. FGF14Δ<sup>NT</sup> diminished resurgent Na<sub>V</sub> current even more effectively than shRNA knockdown of FGF14. As a control, we overexpressed the FGF14b<sup>WT</sup> that had rescued the parameters affected by shRNA knockdown (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Overexpression of FGF14b<sup>WT</sup> here was without effect (<xref ref-type="fig" rid="fig3">Figure 3</xref> and <xref ref-type="table" rid="tbl1">Table 1</xref>). Not only did this serve as a control for FGF14Δ<sup>NT</sup>, but these data suggest that endogenous FGF14b is saturating. These data also suggest that FGF14b's main regulatory component for Purkinje neuron Na<sub>V</sub> currents lies within the FGF14b N-terminus.<fig id="fig3" position="float"><object-id pub-id-type="doi">10.7554/eLife.04193.006</object-id><label>Figure 3.</label><caption><title>Expression of the dominant negative FGF14Δ<sup>NT</sup> affects multiple Na<sub>V</sub> channel biophysical properties indicating essential roles for the FGF14 N-terminus.</title><p>(<bold>A</bold>) Schematic of endogenous wild type (WT) FGF14 binding to the C-terminus of the Na<sub>V</sub>1.6 α subunit (top) and magnified schematic of the expressed FGF14Δ<sup>NT</sup> preventing binding of the WT FGF14 (in box). (<bold>B</bold>) Current–voltage relationships (normalized to cell capacitance) of transient Na<sub>V</sub> currents from cerebellar Purkinje neurons transfected with FGF14b<sup>WT</sup> or FGF14Δ<sup>NT</sup>. The number of neurons tested, <italic>N</italic>, is in parentheses. The current–voltage relationship for Scrambled control shRNA (from <xref ref-type="fig" rid="fig1">Figure 1</xref>) is shown for comparison. (<bold>C</bold>) Voltage dependence of Na<sub>V</sub> channel activation and steady-state inactivation in cerebellar Purkinje neurons transfected with FGF14b<sup>WT</sup> or FGF14Δ<sup>NT</sup>. The number of neurons tested, <italic>N</italic>, is in parentheses. The curves for Scrambled control shRNA (from <xref ref-type="fig" rid="fig1">Figure 1</xref>) are shown for comparison. (<bold>D</bold>) τ of inactivation at the indicated test voltages. The number of neurons tested, <italic>N</italic>, is in parentheses. (<bold>E</bold>) Exemplar normalized TTX-sensitive late Na<sub>V</sub> currents at −20 mV (measured at 150 ms, arrowhead) from a holding potential of −90 mV. The number of neurons tested, <italic>N</italic>, is in parentheses. **p &lt; 0.01. (<bold>F</bold>) Overlay of Na<sub>V</sub> resurgent currents recorded from cerebellar Purkinje neurons transfected with FGF14Δ<sup>NT</sup> or FGF14b<sup>WT</sup> and ratio of peak Na<sub>V</sub> resurgent current (at +20 mV) to transient Na<sub>V</sub> current (at −10 mV). The number of neurons tested, <italic>N</italic>, is in parentheses. The average for FGF14 shRNA knockdown (<xref ref-type="fig" rid="fig1">Figure 1</xref>) is shown for comparison. **p &lt; 0.01.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04193.006">http://dx.doi.org/10.7554/eLife.04193.006</ext-link></p></caption><graphic xlink:href="elife04193f003"/></fig></p><p>The dominant negative effect exerted by FGF14Δ<sup>NT</sup> as it replaced the endogenous FGF14 on the Na<sub>V</sub> CTD implied that although FGF14 regulates Na<sub>V</sub> current through its N-terminus, it may require that FGF14 be in direct interaction with the channel. To test this hypothesis specifically, we designed a FGF14b that was unable to bind to the channel CTD and examined whether expression of this mutant could restore the diminished resurgent current resulting from shRNA knockdown of FGF14. Structural determination of a ternary complex containing FGF13, the Na<sub>V</sub>1.5 CTD, and calmodulin had identified key amino acids on the conserved FHF interaction surface that participated in the interaction with the conserved Na<sub>V</sub> CTD surface (<xref ref-type="bibr" rid="bib31">Wang et al., 2012</xref>). We focused on a highly conserved Arg in the FHF core domain (Arg57 in FGF13U, equivalent to Arg117 in FGF14b), which inserts into a deep pocket on the Na<sub>V</sub>1.5 CTD binding surface (<xref ref-type="fig" rid="fig4">Figure 4A</xref>). We therefore generated the homologous R117A mutant (FGF14b<sup>R/A</sup>) in the FGF14b shRNA-resistant cDNA background and tested whether FGF14b<sup>R/A</sup> could bind to the intact Na<sub>V</sub>1.6. Although immunoprecipitation of FGF14b<sup>WT</sup> from lysates of HEK293 cells transfected with FGF14b<sup>WT</sup> and Na<sub>V</sub>1.6 showed co-immunoprecipitation of Na<sub>V</sub>1.6, the mutant FGF14b<sup>R/A</sup> was unable to co-immunoprecipitate Na<sub>V</sub>1.6 (<xref ref-type="fig" rid="fig4">Figure 4B</xref>). Thus, mutation of R117A in FGF14b prevents interaction with Na<sub>V</sub>1.6. We therefore transfected the shRNA-resistant FGF14b<sup>R/A</sup> (or the shRNA-resistant FGF14b<sup>WT</sup>) along with the FGF14 shRNA into cultured cerebellar Purkinje neurons to determine the effect of FGF14 interaction with Na<sub>V</sub>1.6 on Na<sub>V</sub> currents. Expression of FGF14b<sup>R/A</sup> after shRNA knockdown of endogenous FGF14 had no effect on Na<sub>V</sub> current density (<xref ref-type="fig" rid="fig4">Figure 4C</xref>). In contrast to the rescue afforded by FGF14b<sup>WT</sup>, FGF14b<sup>R/A</sup> did not rescue the key parameters that lead to increased inactivation observed after FGF14 shRNA. Na<sub>V</sub> late current and the time constant of inactivation were not different from shRNA (<xref ref-type="fig" rid="fig4">Figure 4D–F</xref>). Consistent with these findings, we observed the expected reduction in resurgent Na<sub>V</sub> current (<xref ref-type="fig" rid="fig4">Figure 4G–H</xref>). Thus, the FGF14 N-terminus must exert its key effects through FGF14's direct interaction with the Na<sub>V</sub> C-terminus.<fig id="fig4" position="float"><object-id pub-id-type="doi">10.7554/eLife.04193.007</object-id><label>Figure 4.</label><caption><title>The FGF14b<sup>R/A</sup> mutant that prevents interaction with the Na<sub>V</sub> C-terminus cannot rescue Na<sub>V</sub> kinetic effects of FGF14 knockdown.</title><p>(<bold>A</bold>) Surface representation of the crystal structure of a ternary complex containing the Na<sub>V</sub>1.5 C-terminus domain (CTD, green), FGF13 (yellow), and calmodulin (purple); the interaction surfaces are colored gray (PDB ID: 4DCK). The critical R57 in FGF13 (equivalent to R117 in FGF14) is indicated in red, as is its binding pocket on the Na<sub>V</sub>1.5 CTD. (<bold>B</bold>) Co-immunoprecipitation (IP) of Na<sub>V</sub>1.6 and FGF14b<sup>WT</sup> or FGF14b<sup>R/A</sup> expressed in HEK293 cells, showing that the FGF14b<sup>R/A</sup> is unable to interact with the intact Na<sub>V</sub>1.6. Immunoblots (IB) were performed with the indicated antibodies. (<bold>C</bold>) Current–voltage relationship (normalized to cell capacitance) of transient Na<sub>V</sub> currents from cerebellar Purkinje neurons transfected with FGF14b<sup>R/A</sup>. The number of neurons tested, <italic>N</italic>, is in parentheses. The current–voltage relationship for FGF14 knockdown (shRNA) and knockdown rescued with shRNA-insensitive FGF14b<sup>WT</sup> (shRNA/FGF14b<sup>WT</sup>) from <xref ref-type="fig" rid="fig1">Figure 1</xref> are shown for comparison. (<bold>D</bold>) τ of inactivation at the indicated test voltages. The number of neurons tested, <italic>N</italic>, is in parentheses. (<bold>E</bold>) Exemplar normalized TTX-sensitive late Na<sub>V</sub> currents at −20 mV (measured at 150 ms, arrowhead) from a holding potential of −90 mV and (<bold>F</bold>) amplitude of late Na<sub>V</sub> current as a % of peak (transient) Na<sub>V</sub> current. The number of neurons tested, <italic>N</italic>, is in parentheses. Averages for shRNA and for shRNA/FGF14b<sup>WT</sup> (see <xref ref-type="fig" rid="fig1">Figure 1</xref>) are shown for comparison. (<bold>G</bold>) Overlay of Na<sub>V</sub> resurgent currents recorded from cerebellar Purkinje neurons transfected with FGF14b<sup>R/A</sup> or FGF14b<sup>WT</sup> and (<bold>H</bold>) ratio of peak Na<sub>V</sub> resurgent current (at +20 mV) to transient Na<sub>V</sub> current (at −10 mV). The number of neurons tested, <italic>N</italic>, is in parentheses. The average for FGF14 shRNA knockdown (<xref ref-type="fig" rid="fig1">Figure 1</xref>) is shown for comparison. **p &lt; 0.01.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04193.007">http://dx.doi.org/10.7554/eLife.04193.007</ext-link></p></caption><graphic xlink:href="elife04193f004"/></fig></p><p>Because the absence of the FGF14 or its N-terminus accelerated Na<sub>V</sub> channel inactivation, diminished late current, and decreased resurgent current, we anticipated that the resultant bias towards Na<sub>V</sub> inactivation would adversely affect excitability in cerebellar Purkinje neurons. We tested this hypothesis by determining the effects of the FGF14 and its N-terminus on action potential threshold and on the number of action potentials evoked with depolarizing current injections in current-clamp mode. Under our culture conditions (≤14 days in vitro), we found that 8–10% of cerebellar Purkinje neurons exhibit spontaneous action potentials (firing rate 5–20 Hz) with regular and irregular patterns. When neurons were cultured for extended periods (&gt;20 days in vitro), we observed that ∼50% of Purkinje neurons spontaneously fired—more similar to acutely isolated Purkinje neurons (<xref ref-type="bibr" rid="bib22">Raman and Bean, 1999</xref>) and cultured Purkinje neurons (<xref ref-type="bibr" rid="bib9">Gruol and Franklin, 1987</xref>). These data suggest that spontaneous activity depends upon the maturity of the neurons in culture. Because of the difficulty in achieving voltage clamp on Purkinje neurons ≥14 days in vitro, our voltage-clamp experiments were performed on the younger cells (<xref ref-type="fig" rid="fig2 fig3 fig4">Figures 2–4</xref>). Thus, we continued with immature neurons for these experiments, and focused on measuring evoked action potentials rather than spontaneous action potentials. Single action potentials were evoked by a 10-ms current injection with 5-pA increments to determine the current threshold to initiate an action potential. <xref ref-type="fig" rid="fig5">Figure 5A–B</xref> and <xref ref-type="table" rid="tbl2">Table 2</xref> show that FGF14 knockdown and expression of the dominant negative FGF14bΔ<sup>NT</sup> markedly increased the current threshold to produce an action potential; other action potential parameters were not affected. Rescue of FGF14 knockdown by co-expression of FGF14b<sup>WT</sup> restored the current threshold to control levels. Rescue with the non-interacting FGF14b<sup>R/A</sup> did not. We also analyzed the number of actions evoked during 600 ms current injection over a wide range of current amplitudes. The number of action potentials evoked was significantly larger in control (scrambled shRNA) neurons than in neurons transfected with FGF14 shRNA. Rescue with FGF14b<sup>WT</sup>, but not FGF14b<sup>R/A</sup>, restored the number of evoked action potentials to control levels. Expression of the dominant negative FGF14bΔ<sup>NT</sup> reduced the number of evoked action potentials to the level observed after FGF14 knockdown (<xref ref-type="fig" rid="fig5">Figure 5C–D</xref>). Thus, as observed for the individual Na<sub>V</sub> channel kinetic parameters, FGF14b, and its N-terminus specifically, is a critical regulator of neuronal firing and intrinsic membrane properties.<fig id="fig5" position="float"><object-id pub-id-type="doi">10.7554/eLife.04193.008</object-id><label>Figure 5.</label><caption><title>Action potential dynamics and repetitive spiking are dependent upon FGF14 and its N-terminus.</title><p>(<bold>A</bold>) Overlay of single action potentials evoked with a 10 ms current injection (current amplitude shown in parentheses). (<bold>B</bold>) Current threshold to induce action potentials for the indicated conditions. **p &lt; 0.01. The number of neurons tested, <italic>N</italic>, is in parentheses. Additional summary data are presented in <xref ref-type="table" rid="tbl2">Table 2</xref>. (<bold>C</bold>) Example evoked action potentials for the indicated treatments at two separate current injection amplitudes (shown in insets). The resting membrane potential is indicated. (<bold>D</bold>) The number of evoked action potentials for the indicated amplitude of current injection. The number of neurons tested, <italic>N</italic>, is in parentheses.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04193.008">http://dx.doi.org/10.7554/eLife.04193.008</ext-link></p></caption><graphic xlink:href="elife04193f005"/></fig><table-wrap id="tbl2" position="float"><object-id pub-id-type="doi">10.7554/eLife.04193.009</object-id><label>Table 2.</label><caption><p>Intrinsic membrane properties and single action potential (AP) characteristics measured in cerebellar Purkinje neurons</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04193.009">http://dx.doi.org/10.7554/eLife.04193.009</ext-link></p></caption><table frame="hsides" rules="groups"><thead><tr><th/><th>Scrambled</th><th>shRNA</th><th>shRNA/FGF14b<sup>WT</sup></th><th>shRNA/FGF14b<sup>RA</sup></th><th>FGF14∆<sup>NT</sup></th></tr></thead><tbody><tr><td>Input resistance (MΩ)</td><td>221.8 ± 15.8 (7)</td><td>238.0 ± 49.5 (11)</td><td>266.6 ± 24.5 (11)</td><td>225.9 ± 10.8 (6)</td><td>269.5 ± 30.2 (6)</td></tr><tr><td>Resting membrane potential (mV)</td><td>−54.5 ± 1.3 (21)</td><td>−55.8 ± 1.2 (19)</td><td>−54.4 ± 1.0 (16)</td><td>−55.4 ± 0.7 (10)</td><td>−54.9 ± 1.4 (11)</td></tr><tr><td>Current threshold (pA)</td><td>77.8 ± 6.4 (21)</td><td>142.1 ± 18.5 (19)**</td><td>78.8 ± 10.4 (16)</td><td>170.5 ± 16.7 (10)**</td><td>191.0 ± 22.1 (11)**</td></tr><tr><td>AP threshold (mV)</td><td>−35.6 ± 1.0 (21)</td><td>−32.8 ± 1.2 (19)</td><td>−34.5 ± 0.8 (16)</td><td>−32.8 ± 1.4 (10)</td><td>−32.7 ± 0.8 (11)</td></tr><tr><td>AP amplitude (mV)</td><td>78.8 ± 3.2 (21)</td><td>77.5 ± 2.8 (19)</td><td>78.9 ± 4.5 (16)</td><td>79.1 ± 4.3 (10)</td><td>73.1 ± 4.7 (11)</td></tr><tr><td>AP duration (ms)</td><td>2.3 ± 0.2 (21)</td><td>2.0 ± 0.1 (19)</td><td>2.2 ± 0.1 (16)</td><td>1.8 ± 0.1 (10)</td><td>2.1 ± 0.3 (11)</td></tr></tbody></table><table-wrap-foot><fn><p>Mean ± s.e.m. (n), **p &lt; 0.01 compared to Scrambled control.</p></fn></table-wrap-foot></table-wrap></p></sec><sec id="s3" sec-type="discussion"><title>Discussion</title><p>Although <italic>FGF14</italic> haploinsufficiency is associated with spinocerebellar ataxia (<xref ref-type="bibr" rid="bib5">Dalski et al., 2005</xref>) and intrinsic excitability of cerebellar Purkinje neurons is reduced in <italic>Fgf14</italic><sup><italic>−/−</italic></sup> mice (<xref ref-type="bibr" rid="bib25">Shakkottai et al., 2009</xref>), the detailed multifactorial molecular mechanisms by which FGF14 affects neuronal excitability were not previously known. We had found that FGF14 knockdown in cerebellar granule neurons reduced presynaptic voltage-gated Ca<sup>2+</sup> currents and thereby affected neurotransmission at the cerebellar granule neuron to Purkinje neuron synapse (<xref ref-type="bibr" rid="bib33">Yan et al., 2013</xref>). Here, we found that FGF14b in cerebellar Purkinje neurons affects multiple kinetic parameters of Na<sub>V</sub> channels, thereby reducing the resurgent Na<sub>V</sub> current that underlies repetitive firing. Together, the accelerated inactivation, reduced channel availability, and decreased late current observed after FGF14 knockdown bias Na<sub>V</sub> channels to the inactivated state. Thus, the blocking particle that competes with the inactivation gate for open Na<sub>V</sub> channels is disadvantaged. Consequently, the resurgent current, and the resulting ability to support repetitive firing in Purkinje neurons, is reduced as we observed. Thus, our data show that an essential regulatory feature of FGF14 in cerebellar Purkinje neurons is to slow Na<sub>V</sub> channel inactivation in order to foster resurgent current.</p><p>Resurgent current results from the actions on Na<sub>V</sub>1.6 of a putative blocking particle, which is thought to be the cytoplasmic C-terminal peptide of the Na<sub>V</sub> auxiliary Na<sub>V</sub>β4 subunit (<xref ref-type="bibr" rid="bib8">Grieco et al., 2005</xref>). Nevertheless, the actions of Na<sub>V</sub>β4 are not sufficient to generate resurgent Na<sub>V</sub> current (<xref ref-type="bibr" rid="bib3">Chen et al., 2008</xref>; <xref ref-type="bibr" rid="bib1">Aman et al., 2009</xref>), suggesting that other components of the Na<sub>V</sub> channel complex may be necessary for proper regulation of resurgent Na<sub>V</sub> current in cerebellar Purkinje neurons. Here, our knockdown experiments and expression of the dominant negative FGF14bΔ<sup>NT</sup> show that FGF14b, and specifically its N-terminus, strongly influence resurgent Na<sub>V</sub> current. FGF14 knockdown caused a ∼60% reduction. Expression of FGF14Δ<sup>NT</sup> was even more efficient, resulting in a ∼85% reduction, perhaps because overexpression of FGF14Δ<sup>NT</sup> was more efficient in replacing endogenous FGF14b than shRNA knockdown was in eliminating endogenous FGF14b. Thus, FGF14 may cooperate with Na<sub>V</sub>β4 to generate resurgent current, perhaps by biasing Na<sub>V</sub>1.6 channels towards inactivation and thereby disadvantaging the blocking particle. Our results examining effects on total Na<sub>V</sub> current must be assessed in the context of FGF14 effects not only on Na<sub>V</sub>1.6 channels but also on Na<sub>V</sub>1.1 channel, the other major source of Na<sub>V</sub> currents in cerebellar Purkinje neurons (<xref ref-type="bibr" rid="bib12">Kalume et al., 2007</xref>). Those Na<sub>V</sub> channels are also influence by FGF14 (<xref ref-type="bibr" rid="bib18">Lou et al., 2005</xref>). Thus, the effects on resurgent current that we attribute to FGF14 may result from FGF14's overall influence of Na<sub>V</sub> channel kinetics within Purkinje neurons.</p><p>Our results may also provide some insight into the more variable phenotypes and decreased penetrance in spinocerebellar ataxia patients with <italic>FGF14</italic> haploinsufficiency (<xref ref-type="bibr" rid="bib5">Dalski et al., 2005</xref>; <xref ref-type="bibr" rid="bib4">Coebergh et al., 2013</xref>) vs patients with a <italic>FGF14</italic> mutation (FGF14b<sup>F150S</sup>) found in a large Dutch spinocerebellar ataxia kindred (<xref ref-type="bibr" rid="bib27">van Swieten et al., 2003</xref>). Studies in hippocampal neurons suggest that the FGF14b<sup>F150S</sup> mutant exerts a dominant negative mechanism in which the axon initial segment is depleted of Na<sub>V</sub> channels and Na<sub>V</sub> current density is reduced (<xref ref-type="bibr" rid="bib14">Laezza et al., 2007</xref>). Here, we found no effect on Na<sub>V</sub> current density in cerebellar Purkinje neurons after FGF14 knockdown. A reduction in Na<sub>V</sub> current density (with the FGF14b<sup>F150S</sup> mutation) compared to an effect solely on Na<sub>V</sub> channel kinetics (with FGF14 haploinsufficiency) may explain the higher penetrance and decreased phenotypic variability in patients with the FGF14b<sup>F150S</sup> mutation.</p><p>An important aspect of this study examining effects on Na<sub>V</sub> channel kinetics was that our analyses were performed in Purkinje neurons. Studying FHFs in their native cellular context appears to be crucial for defining their specific roles. Previous investigations of FGF14-dependent regulation of neuronal Na<sub>V</sub> channels in heterologous expression systems led to different conclusions from experiments in neurons. For example, expression of Na<sub>V</sub>1.6 and FGF14b<sup>WT</sup> in ND7/23 cells almost eliminated Na<sub>V</sub> current density (<xref ref-type="bibr" rid="bib15">Laezza et al., 2009</xref>) while overexpression of FGF14b<sup>WT</sup> in hippocampal neurons increased Na<sub>V</sub> current density (<xref ref-type="bibr" rid="bib14">Laezza et al., 2007</xref>). Similarly, expression of FGF14Δ<sup>NT</sup> in ND7/23 cells increased current density, while here we observed that FGF14Δ<sup>NT</sup> expression in cerebellar Purkinje neurons exerted dominant-negative effects upon Na<sub>V</sub> channel kinetics, but no consequences for Na<sub>V</sub> current density. While the etiology of the different results in neurons compared to heterologous expression systems is not known, we speculate that additional regulatory factors present in neurons are necessary for physiologic regulation of Na<sub>V</sub> channels by FHFs. Indeed, we have observed similarly disparate results for the related FGF13 and the cardiac Na<sub>V</sub>1.5 channel. In HEK293 cells, FGF13 co-expression reduces Na<sub>V</sub>1.5 current density (not shown), but we showed that the role FGF13 in cardiomyocytes is to increase Na<sub>V</sub> current density (<xref ref-type="bibr" rid="bib30">Wang et al., 2011</xref>; <xref ref-type="bibr" rid="bib10">Hennessey et al., 2013</xref>).</p><p>Finally, our data also provide information about possible consequences of <italic>FGF14</italic> overexpression, hypothesized as pathologic in rare cases. Some patients with spinocerebellar ataxia, but not controls, harbor synonymous variants in <italic>FGF14</italic>. These variants encode a more frequently used codon than the wild type sequence, leading to the hypothesis that patients with these variants would overexpress <italic>FGF14</italic> as a cause of disease (<xref ref-type="bibr" rid="bib5">Dalski et al., 2005</xref>). We found, however, that overexpression of FGF14b<sup>WT</sup> did not affect current density or any of the measured Na<sub>V</sub> kinetic properties (<xref ref-type="fig" rid="fig3">Figure 3</xref> and <xref ref-type="table" rid="tbl1">Table 1</xref>). Thus, if these variants identified in spinocerebellar ataxia patients are truly associated with disease, our data suggest mechanisms other than FGF14 overexpression.</p><p>In summary, these data add to a growing appreciation of physiologic and pathophysiologic roles for FHFs in neurons. In the case of spinocerebellar ataxia, our data suggest that FGF14 is a critical regulator of the ability of cerebellar Purkinje neuron Na<sub>V</sub> channels to support resurgent Na<sub>V</sub> current and thereby allow Purkinje neurons to fire repetitively. Thus, we provide a molecular understanding for the observation that FGF14 regulates Purkinje neuron intrinsic excitability (<xref ref-type="bibr" rid="bib25">Shakkottai et al., 2009</xref>). In combination with our data showing that FGF14 also regulates presynaptic voltage-gated Ca<sup>2+</sup> channels at the cerebellar granule cell to Purkinje cell synapse, these data pinpoint several specific mechanisms by which mutations in <italic>FGF14</italic> underlie spinocerebellar ataxia.</p></sec><sec id="s4" sec-type="materials|methods"><title>Materials and methods</title><sec id="s4-1"><title>Primary cerebellar neuron culture and transfection</title><p>This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved Institutional Animal Care and Use Committee (IACUC) of Duke University (protocol #A292-13-11). Primary dissociated cerebellar neurons were cultured as previously described (<xref ref-type="bibr" rid="bib33">Yan et al., 2013</xref>) with some modifications. Briefly, primary cultures were prepared from P6-P8 C57BL6 mice. Cerebella were excised, dissected on ice, digested with 0.25% trypsin for 10 min at 37°C with Dulbecco's Modified Eagle's Medium (DMEM, Sigma, St. Louis, MO), and dissociated into single cells by gentle trituration. The cells were seeded onto coverslips coated with 50 μg/ml poly-D-lysine (Sigma) and 25 μg/ml laminin (Sigma) at a density of 2.5–3.0 × 10<sup>5</sup> cells/coverslip in DMEM supplemented with 10% heat-inactivated fetal bovine serum (FBS). The neurons were maintained in a humidified incubator in 5% CO<sub>2</sub> at 37°C. After 15–16 hr, the medium was replaced with Basal Medium Eagle (BME, Sigma) supplemented with 2% B27 (Invitrogen), 5% FBS, 25 μM uridine, 70 μM 5-fluorodeoxyuridine, and 20 mM KCl. Neurons were transiently transfected at 4 days in vitro with 1 μg plasmid DNA and/or shRNA plasmids per coverslip with calcium phosphate. Experiments were performed 8–10 days after transfection (12–14 days in vitro). To achieve good voltage control, all recordings were performed in neurons cultured no longer than 14 days in vitro.</p></sec><sec id="s4-2"><title>shRNA and cDNA construction</title><p>shRNAs targeted to FGF14 were designed with Invitrogen's RNAi Designer as previously described (<xref ref-type="bibr" rid="bib33">Yan et al., 2013</xref>) and the sequences were cloned into pLVTHM (Addgene). After evaluating several candidates, we found that the most effective shRNA sequence was 5′ CGCGTGGAGGCAAACCAGTCAACAAGTGCATTCAAGAGATGCACTTGTTGACTGGTTTGC CTCCTTTTTTAT 3′, which was used for the experiments described here. The scrambled shRNA which bears no homology to genes in the rodent genome (<xref ref-type="bibr" rid="bib30">Wang et al., 2011</xref>) has the sequence: 5′-CGCGTGACCCTTAGTTTATACCTATTCAAGAGATAGGTATAAACTAAGGGTCTTTTTTAT-3′. FGF14 rescue and overexpression experiments were performed with FGF14 constructs (either full-length or with the N-terminus truncated) cloned into pcDNA3.1 also containing tdTomato. Mutagenesis to obtain FGF14b<sup>R/A</sup> was performed using QuikChange (Agilent). All plasmids were verified by sequencing.</p></sec><sec id="s4-3"><title>Electrophysiological recordings</title><p>Purkinje neurons were identified by their characteristic teardrop morphology and large size. Whole-cell Na<sub>V</sub> currents and membrane voltage were recorded at 23–25°C using an EPC 10 USB patch amplifier (HEKA Elektronik). The signal was filtered at 2.9 Hz and digitized at 20 Hz. Na<sub>V</sub> currents were recorded with an extracellular solution containing (in mM) 124 NaCl, 20 TEA-Cl (tetraethylammonium Chloride), 5 HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid), 10 glucose, 0.3 CdCl<sub>2</sub>, 2 BaCl<sub>2</sub>, and 4-AP (4-aminopyridine). NaOH was added to achieve pH 7.3 (300–310 mOsm). Borosilicate glass patch pipettes (resistances within 3–4 MΩ) were filled with the following internal solution (in mM): 125 CsF, 10 NaCl, 10 HEPES, 15 TEA-Cl, 1.1 ethylene glycol tetraacetic acid (EGTA), and 0.5 Na-guanosine-5′-triphosphate (Na-GTP), pH adjusted to 7.3 with CsOH (290–300 mOsm). Tetrodotoxin (TTX)-sensitive Na<sub>V</sub> currents were isolated by subtraction of recordings performed in 1 μM TTX from the control recordings. Series resistance was compensated &gt;70%. Current-clamp recordings were performed after obtaining seal resistances &gt;1.2 GΩ. The internal solution was (in mM) 130 K-gluconate, 5 NaCl, 2 MgCl<sub>2</sub>, 10 HEPES, 4 Mg-ATP, 0.5 Na-GTP, 0.2 EGTA, and 10 phosphocreatine. KOH was used to obtain pH 7.3 (290–300 mOsm). The external solution was (in mM) 140 NaCl, 5 KCl, 2 CaCl<sub>2</sub>, 1 MgCl<sub>2</sub>, 5 HEPES, and 10 glucose, pH adjusted to 7.3 with NaOH. Resting membrane potential was directly measured in current-clamp mode after membrane rupture and only cells with a resting membrane potential more negative than −50 mV were studied. The liquid junction potential was not corrected. Input resistance was determined from membrane voltage deflection, evoked by 600-ms hyperpolarizing current injections (0 to −300 pA in steps of 50 pA) and calculated from the measured slope. Single action potentials were elicited by 10 ms depolarizing current injections with 5-pA increments. All drugs were from Sigma Aldrich, except for TTX (Abcam Biochemicals).</p></sec><sec id="s4-4"><title>Protocols and data analysis</title><p>Data analysis was performed using FitMaster (HEKA), Excel (Microsoft), and Origin software. All averaged data are presented as mean ± SEM. Statistical significance was determined using Student's <italic>t</italic> or one-way ANOVA tests. Calculated p values of ≤0.05 were accepted as evidence of statistically significant differences. For current amplitude, neurons were held at −90 mV and transient Na<sub>V</sub> current was elicited by depolarizing pulses of 20 ms from −90 mV to +55 mV in 5-mV increments. Current density was obtained by normalizing peak Na<sub>V</sub> current to membrane capacitance. Resurgent Na<sub>V</sub> current was evoked with repolarizing steps from +20 mV to a range of voltages between −80 mV and +5 mV in 5-mV increments for a 200-ms test pulse after 15 ms conditioning steps. Na<sub>V</sub> activation curves were obtained by transforming current data to conductance (G), with the equation G = <italic>I</italic><sub>Na</sub>/(E<sub>m</sub> − E<sub>rev</sub>), where: <italic>I</italic><sub>Na</sub> is the peak current; E<sub>m</sub> is the membrane potential; and E<sub>rev</sub> is the reversal potential of <italic>I</italic><sub>Na</sub>; and fitted with a Boltzmann equation of the form: G = G<sub>max</sub>/[1 + exp(<italic>V</italic><sub><italic>1/2</italic></sub> <italic>− V</italic>)/<italic>k</italic>], where G<sub>max</sub> is the extrapolated maximum Na<sup>+</sup> conductance, V is the test voltage, V<sub>1/2</sub> is the half-activation voltage, and <italic>k</italic> is the slope factor. For Na<sub>V</sub> steady-state inactivation, a voltage step to −20 mV for 20 ms was applied from a holding potential of −90 mV to preferentially activate <italic>I</italic><sub>Na</sub> after pre-pulse conditioning voltage steps of 300 ms in duration (ranging from −90 to +20 mV) in 5-mV increments. Steady-state inactivation curves were constructed by plotting the normalized peak current amplitude elicited during the test pulse as a function of the conditioning pre-pulse. A Boltzmann relationship, <italic>I</italic>/<italic>I</italic><sub>max</sub> = (1 + exp((<italic>V</italic> − <italic>V</italic><sub>1/2</sub>)/<italic>k</italic>))<sup>−1</sup> was used to fit the data where <italic>I</italic><sub>max</sub> is current elicited by the test pulse after a −90-mV prepulse; <italic>V</italic><sub>1/2</sub> is half-inactivation voltage; <italic>k</italic> is the slope. Late Na<sub>V</sub> current was measured at 150 ms during a 200 ms depolarizing pulse to −20 mV. The rate of decay of the transient Na<sub>V</sub> current (τ) was obtained from a single exponential function, <italic>I</italic><sub><italic>(t)</italic></sub> = <italic>I</italic><sub><italic>Na</italic></sub> exp <sup>(−t/τ)</sup>+ <italic>I</italic><sub><italic>SS</italic></sub>, where <italic>I</italic><sub><italic>(t)</italic></sub> is the amplitude of the current at time <italic>t</italic>; <italic>I</italic><sub><italic>SS</italic></sub> is the steady-state current during a single voltage step.</p><p>In current clamp, action potential amplitude was measured as the peak voltage with respect to the baseline 10 ms before the peak of the action potential. The action potential duration was evaluated at half-amplitude. Evoked action potentials were elicited by injecting a depolarizing current from 0 pA to 300 pA for 600 ms duration with 10-pA increments.</p></sec><sec id="s4-5"><title>Immunoprecipitation and Western blotting</title><p>Cerebella were isolated from two 5-week-old C57BL/6J mice and homogenized with a mortar and pestle in 8 ml of lysis buffer composed of 150 mM NaCl, 50 mM Tris-Cl, 1% Triton, and 1% sodium deoxycholate. Lysate was incubated on ice for 2 hr, passed through a 20g needle 20 times, and rocked end over end for 30 min at 4°C. The lysate was cleared of insoluble material by centrifugation at 4000 rcf at 4°C for 30 min followed by a second centrifugation at 17,100 rcf at 4°C for 10 min. The lysate was preincubated with 30 μl of Protein A/G (Santa Cruz Biotechnology) beads for 2 hr at 4°C. The beads were gently spun down at 0.4 rcf for 1 min to separate them from the lysate, which was then incubated with 20 μg of either anti-FGF14 (NeuroMab) or non-immune mouse IgG (Santa Cruz Biotechnology) overnight at 4°C. In order to immunoprecipitate protein complexes, 30 μl of Protein A/G beads were added and incubated with the lysate for 2 hr. Beads were then washed three times with lysis buffer followed by elution in 2× LDS Sample Buffer (Novex NuPage) plus 10 mM dithiothreiotol. Protein samples were run on 8–16% Tris-glycine SDS page gels and transferred to PVDF membranes. Primary antibodies used were rabbit polyclonal anti Na<sub>v</sub>1.6 from Millipore (1:200), anti-β-tubulin from Sigma (1:1000) as a loading control, and rabbit polyclonal anti-FGF14 (1:200), which was a kind gift from the Ornitz lab (Washington University, St. Louis). HEK293T cells on 100-mm plates were transfected with Lipofectamine 2000 (Invitrogen) when cells were at ∼60% confluency with 9 μg of Na<sub>V</sub>1.6 and 3 μg of FGF14b<sup>WT</sup> or FGF14b<sup>R/A</sup>. Cells were washed with ice-cold PBS 60 hr after transfection, and cell lysates were prepared with the addition of lysis buffer containing 150 mm NaCl, 50 mm Tris–HCl, pH 7.5, 1% Triton with protease inhibitor (Roche). The pelleted cells were pipetted up and down 20 times with lysis buffer, incubated at 4°C for 1 hr and then centrifuged at 16,000×<italic>g</italic> for 10 min at 4°C. Immunoprecipitation was performed on 2 mg of lysate with 2 μg of anti-FGF14 antibody (Neuromab). The samples were rocked gently at 4°C for 1 hr followed by addition of 30 μl of protein A/G-agarose slurry. The samples were rotated overnight at 4°C and microcentrifuged at 7000 rpm for 2 min. After washing with lysis buffer three times, 40 μl of loading buffer was added to the pellet, and protein was eluted from the beads by heating at 70°C for 20 min. The samples were subjected to NuPAGE 8–16% Bis-Tris gels (Invitrogen). The proteins were transferred to nitrocellulose membranes and subsequently immunoblotted with the anti-FGF14, anti-pan Na<sub>V</sub> antibody, and anti-tubulin antibody.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Dr Amanda H Lewis for insightful discussions. This work was supported by NIH R01 HL071165 and R01 HL112918 (GSP).</p></ack><sec sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>HY, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con2"><p>JLP, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con3"><p>CW, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con4"><p>GSP, Conception and design, Analysis and interpretation of data, Drafting or revising the article</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>Animal experimentation: This study was performed in strict accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All of the animals were handled according to approved institutional animal care and use committee (IACUC) of Duke University for the protocol #A292-13-11.</p></fn></fn-group></sec><sec sec-type="supplementary-material"><title>Additional files</title><sec sec-type="datasets"><title>Major dataset</title><p>The following previously published dataset was used:</p><p><related-object content-type="existing-dataset" source-id="http://www.pdb.org/pdb/explore/explore.do?structureId=4DCK" source-id-type="uri" id="dataro1"><collab collab-type="author">Wang C</collab>, <collab collab-type="author">Chung BC</collab>, <collab collab-type="author">Yan H</collab>, <collab collab-type="author">Lee SY</collab>, <collab collab-type="author">Pitt GS</collab>, <year>2012</year><x>, </x><source>Crystal structure of the C-terminus of voltage-gated sodium channel in complex with FGF13 and CaM</source><x>, </x><ext-link ext-link-type="uri" xlink:href="http://www.pdb.org/pdb/explore/explore.do?structureId=4DCK">http://www.pdb.org/pdb/explore/explore.do?structureId=4DCK</ext-link><x>, </x><comment>Publicly available at RCSB Protein Data Bank.</comment></related-object></p></sec></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Aman</surname><given-names>TK</given-names></name><name><surname>Grieco-Calub</surname><given-names>TM</given-names></name><name><surname>Chen</surname><given-names>C</given-names></name><name><surname>Rusconi</surname><given-names>R</given-names></name><name><surname>Slat</surname><given-names>EA</given-names></name><name><surname>Isom</surname><given-names>LL</given-names></name><name><surname>Raman</surname><given-names>IM</given-names></name></person-group><year>2009</year><article-title>Regulation of persistent Na current by interactions between beta subunits of voltage-gated Na channels</article-title><source>The Journal of Neuroscience</source><volume>29</volume><fpage>2027</fpage><lpage>2042</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.4531-08.2009</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname><given-names>Y</given-names></name><name><surname>Yu</surname><given-names>FH</given-names></name><name><surname>Sharp</surname><given-names>EM</given-names></name><name><surname>Beacham</surname><given-names>D</given-names></name><name><surname>Scheuer</surname><given-names>T</given-names></name><name><surname>Catterall</surname><given-names>WA</given-names></name></person-group><year>2008</year><article-title>Functional properties and differential neuromodulation of Na(v)1.6 channels</article-title><source>Molecular and Cellular Neurosciences</source><volume>38</volume><fpage>607</fpage><lpage>615</lpage><pub-id pub-id-type="doi">10.1016/j.mcn.2008.05.009</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Coebergh</surname><given-names>JA</given-names></name><name><surname>Fransen van de Putte</surname><given-names>DE</given-names></name><name><surname>Snoeck</surname><given-names>IN</given-names></name><name><surname>Ruivenkamp</surname><given-names>C</given-names></name><name><surname>van Haeringen</surname><given-names>A</given-names></name><name><surname>Smit</surname><given-names>LM</given-names></name></person-group><year>2013</year><article-title>A new variable phenotype in spinocerebellar ataxia 27 (SCA 27) caused by a deletion in the FGF14 gene</article-title><source>European Journal of Paediatric Neurology</source><volume>18</volume><fpage>413</fpage><lpage>415</lpage><pub-id pub-id-type="doi">10.1016/j.ejpn.2013.10.006</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dalski</surname><given-names>A</given-names></name><name><surname>Atici</surname><given-names>J</given-names></name><name><surname>Kreuz</surname><given-names>FR</given-names></name><name><surname>Hellenbroich</surname><given-names>Y</given-names></name><name><surname>Schwinger</surname><given-names>E</given-names></name><name><surname>Zühlke</surname><given-names>C</given-names></name></person-group><year>2005</year><article-title>Mutation analysis in the fibroblast growth factor 14 gene: frameshift mutation and polymorphisms in patients with inherited ataxias</article-title><source>European Journal of Human Genetics</source><volume>13</volume><fpage>118</fpage><lpage>120</lpage><pub-id pub-id-type="doi">10.1038/sj.ejhg.5201286</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Dover</surname><given-names>K</given-names></name><name><surname>Solinas</surname><given-names>S</given-names></name><name><surname>D'Angelo</surname><given-names>E</given-names></name><name><surname>Goldfarb</surname><given-names>M</given-names></name></person-group><year>2010</year><article-title>Long-term inactivation particle for voltage-gated sodium channels</article-title><source>The Journal of Physiology</source><volume>588</volume><fpage>3695</fpage><lpage>3711</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.2010.192559</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Goldfarb</surname><given-names>M</given-names></name><name><surname>Schoorlemmer</surname><given-names>J</given-names></name><name><surname>Williams</surname><given-names>A</given-names></name><name><surname>Diwakar</surname><given-names>S</given-names></name><name><surname>Wang</surname><given-names>Q</given-names></name><name><surname>Huang</surname><given-names>X</given-names></name><name><surname>Giza</surname><given-names>J</given-names></name><name><surname>Tchetchik</surname><given-names>D</given-names></name><name><surname>Kelley</surname><given-names>K</given-names></name><name><surname>Vega</surname><given-names>A</given-names></name><name><surname>Matthews</surname><given-names>G</given-names></name><name><surname>Rossi</surname><given-names>P</given-names></name><name><surname>Ornitz</surname><given-names>DM</given-names></name><name><surname>D'Angelo</surname><given-names>E</given-names></name></person-group><year>2007</year><article-title>Fibroblast growth factor homologous factors control neuronal excitability through modulation of voltage-gated sodium channels</article-title><source>Neuron</source><volume>55</volume><fpage>449</fpage><lpage>463</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2007.07.006</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Grieco</surname><given-names>TM</given-names></name><name><surname>Malhotra</surname><given-names>JD</given-names></name><name><surname>Chen</surname><given-names>C</given-names></name><name><surname>Isom</surname><given-names>LL</given-names></name><name><surname>Raman</surname><given-names>IM</given-names></name></person-group><year>2005</year><article-title>Open-channel block by the cytoplasmic tail of sodium channel beta4 as a mechanism for resurgent sodium current</article-title><source>Neuron</source><volume>45</volume><fpage>233</fpage><lpage>244</lpage><pub-id pub-id-type="doi">10.1016/j.neuron.2004.12.035</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Gruol</surname><given-names>DL</given-names></name><name><surname>Franklin</surname><given-names>CL</given-names></name></person-group><year>1987</year><article-title>Morphological and physiological differentiation of Purkinje neurons in cultures of rat cerebellum</article-title><source>The Journal of Neuroscience</source><volume>7</volume><fpage>1271</fpage><lpage>1293</lpage></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hennessey</surname><given-names>JA</given-names></name><name><surname>Marcou</surname><given-names>CA</given-names></name><name><surname>Wang</surname><given-names>C</given-names></name><name><surname>Wei</surname><given-names>EQ</given-names></name><name><surname>Wang</surname><given-names>C</given-names></name><name><surname>Tester</surname><given-names>DJ</given-names></name><name><surname>Torchio</surname><given-names>M</given-names></name><name><surname>Dagradi</surname><given-names>F</given-names></name><name><surname>Crotti</surname><given-names>L</given-names></name><name><surname>Schwartz</surname><given-names>PJ</given-names></name><name><surname>Ackerman</surname><given-names>MJ</given-names></name><name><surname>Pitt</surname><given-names>GS</given-names></name></person-group><year>2013</year><article-title>FGF12 is a candidate Brugada syndrome locus</article-title><source>Heart Rhythm</source><volume>10</volume><fpage>1886</fpage><lpage>1894</lpage><pub-id pub-id-type="doi">10.1016/j.hrthm.2013.09.064</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hennessey</surname><given-names>JA</given-names></name><name><surname>Wei</surname><given-names>EQ</given-names></name><name><surname>Pitt</surname><given-names>GS</given-names></name></person-group><year>2013</year><article-title>Fibroblast growth factor homologous factors modulate cardiac calcium channels</article-title><source>Circulation Research</source><volume>113</volume><fpage>381</fpage><lpage>388</lpage><pub-id pub-id-type="doi">10.1161/CIRCRESAHA.113.301215</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kalume</surname><given-names>F</given-names></name><name><surname>Yu</surname><given-names>FH</given-names></name><name><surname>Westenbroek</surname><given-names>RE</given-names></name><name><surname>Scheuer</surname><given-names>T</given-names></name><name><surname>Catterall</surname><given-names>WA</given-names></name></person-group><year>2007</year><article-title>Reduced sodium current in Purkinje neurons from Nav1.1 mutant mice: implications for ataxia in severe myoclonic epilepsy in infancy</article-title><source>The Journal of Neuroscience</source><volume>27</volume><fpage>11065</fpage><lpage>11074</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.2162-07.2007</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Khaliq</surname><given-names>ZM</given-names></name><name><surname>Gouwens</surname><given-names>NW</given-names></name><name><surname>Raman</surname><given-names>IM</given-names></name></person-group><year>2003</year><article-title>The contribution of resurgent sodium current to high-frequency firing in Purkinje neurons: an experimental and modeling study</article-title><source>The Journal of Neuroscience</source><volume>23</volume><fpage>4899</fpage><lpage>4912</lpage></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Laezza</surname><given-names>F</given-names></name><name><surname>Gerber</surname><given-names>BR</given-names></name><name><surname>Lou</surname><given-names>JY</given-names></name><name><surname>Kozel</surname><given-names>MA</given-names></name><name><surname>Hartman</surname><given-names>H</given-names></name><name><surname>Craig</surname><given-names>AM</given-names></name><name><surname>Ornitz</surname><given-names>DM</given-names></name><name><surname>Nerbonne</surname><given-names>JM</given-names></name></person-group><year>2007</year><article-title>The FGF14(F145S) mutation disrupts the interaction of FGF14 with voltage-gated Na+ channels and impairs neuronal excitability</article-title><source>The Journal of Neuroscience</source><volume>27</volume><fpage>12033</fpage><lpage>12044</lpage><pub-id pub-id-type="doi">10.1523/JNEUROSCI.2282-07.2007</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Laezza</surname><given-names>F</given-names></name><name><surname>Lampert</surname><given-names>A</given-names></name><name><surname>Kozel</surname><given-names>MA</given-names></name><name><surname>Gerber</surname><given-names>BR</given-names></name><name><surname>Rush</surname><given-names>AM</given-names></name><name><surname>Nerbonne</surname><given-names>JM</given-names></name><name><surname>Waxman</surname><given-names>SG</given-names></name><name><surname>Dib-Hajj</surname><given-names>SD</given-names></name><name><surname>Ornitz</surname><given-names>DM</given-names></name></person-group><year>2009</year><article-title>FGF14 N-terminal splice variants differentially modulate Nav1.2 and Nav1.6-encoded sodium channels</article-title><source>Molecular and Cellular Neurosciences</source><volume>42</volume><fpage>90</fpage><lpage>101</lpage><pub-id pub-id-type="doi">10.1016/j.mcn.2009.05.007</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Liu</surname><given-names>C</given-names></name><name><surname>Dib-Hajj</surname><given-names>SD</given-names></name><name><surname>Waxman</surname><given-names>SG</given-names></name></person-group><year>2001</year><article-title>Fibroblast growth factor homologous factor 1B binds to the C terminus of the tetrodotoxin-resistant sodium channel rNav1.9a (NaN)</article-title><source>The Journal of Biological Chemistry</source><volume>276</volume><fpage>18925</fpage><lpage>18933</lpage><pub-id pub-id-type="doi">10.1074/jbc.M101606200</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lou</surname><given-names>JY</given-names></name><name><surname>Laezza</surname><given-names>F</given-names></name><name><surname>Gerber</surname><given-names>BR</given-names></name><name><surname>Xiao</surname><given-names>M</given-names></name><name><surname>Yamada</surname><given-names>KA</given-names></name><name><surname>Hartmann</surname><given-names>H</given-names></name><name><surname>Craig</surname><given-names>AM</given-names></name><name><surname>Nerbonne</surname><given-names>JM</given-names></name><name><surname>Ornitz</surname><given-names>DM</given-names></name></person-group><year>2005</year><article-title>Fibroblast growth factor 14 is an intracellular modulator of voltage-gated sodium channels</article-title><source>The Journal of Physiology</source><volume>569</volume><fpage>179</fpage><lpage>193</lpage><pub-id pub-id-type="doi">10.1113/jphysiol.2005.097220</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Munoz-Sanjuan</surname><given-names>I</given-names></name><name><surname>Smallwood</surname><given-names>PM</given-names></name><name><surname>Nathans</surname><given-names>J</given-names></name></person-group><year>2000</year><article-title>Isoform diversity among fibroblast growth factor homologous factors is generated by alternative promoter usage and differential splicing</article-title><source>The Journal of Biological Chemistry</source><volume>275</volume><fpage>2589</fpage><lpage>2597</lpage><pub-id pub-id-type="doi">10.1074/jbc.275.4.2589</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Raman</surname><given-names>IM</given-names></name><name><surname>Bean</surname><given-names>BP</given-names></name></person-group><year>1999</year><article-title>Ionic currents underlying spontaneous action potentials in isolated cerebellar Purkinje neurons</article-title><source>The Journal of Neuroscience</source><volume>19</volume><fpage>1663</fpage><lpage>1674</lpage></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Raman</surname><given-names>IM</given-names></name><name><surname>Bean</surname><given-names>BP</given-names></name></person-group><year>1997</year><article-title>Resurgent sodium current and action potential formation in dissociated cerebellar Purkinje neurons</article-title><source>The Journal of Neuroscience</source><volume>17</volume><fpage>4517</fpage><lpage>4526</lpage></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Raman</surname><given-names>IM</given-names></name><name><surname>Sprunger</surname><given-names>LK</given-names></name><name><surname>Meisler</surname><given-names>MH</given-names></name><name><surname>Bean</surname><given-names>BP</given-names></name></person-group><year>1997</year><article-title>Altered subthreshold sodium currents and disrupted firing patterns in Purkinje neurons of Scn8a mutant mice</article-title><source>Neuron</source><volume>19</volume><fpage>881</fpage><lpage>891</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(00)80969-1</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rush</surname><given-names>AM</given-names></name><name><surname>Wittmack</surname><given-names>EK</given-names></name><name><surname>Tyrrell</surname><given-names>L</given-names></name><name><surname>Black</surname><given-names>JA</given-names></name><name><surname>Dib-Hajj</surname><given-names>SD</given-names></name><name><surname>Waxman</surname><given-names>SG</given-names></name></person-group><year>2006</year><article-title>Differential modulation of sodium channel Na(v)1.6 by two members of the fibroblast growth factor homologous factor 2 subfamily</article-title><source>The European Journal of Neuroscience</source><volume>23</volume><fpage>2551</fpage><lpage>2562</lpage><pub-id pub-id-type="doi">10.1111/j.1460-9568.2006.04789.x</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shakkottai</surname><given-names>VG</given-names></name><name><surname>Xiao</surname><given-names>M</given-names></name><name><surname>Xu</surname><given-names>L</given-names></name><name><surname>Wong</surname><given-names>M</given-names></name><name><surname>Nerbonne</surname><given-names>JM</given-names></name><name><surname>Ornitz</surname><given-names>DM</given-names></name><name><surname>Yamada</surname><given-names>KA</given-names></name></person-group><year>2009</year><article-title>FGF14 regulates the intrinsic excitability of cerebellar Purkinje neurons</article-title><source>Neurobiology of Disease</source><volume>33</volume><fpage>81</fpage><lpage>88</lpage><pub-id pub-id-type="doi">10.1016/j.nbd.2008.09.019</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Smallwood</surname><given-names>PM</given-names></name><name><surname>Munoz-Sanjuan</surname><given-names>I</given-names></name><name><surname>Tong</surname><given-names>P</given-names></name><name><surname>Macke</surname><given-names>JP</given-names></name><name><surname>Hendry</surname><given-names>SH</given-names></name><name><surname>Gilbert</surname><given-names>DJ</given-names></name><name><surname>Copeland</surname><given-names>NG</given-names></name><name><surname>Jenkins</surname><given-names>NA</given-names></name><name><surname>Nathans</surname><given-names>J</given-names></name></person-group><year>1996</year><article-title>Fibroblast growth factor (FGF) homologous factors: new members of the FGF family implicated in nervous system development</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>93</volume><fpage>9850</fpage><lpage>9857</lpage><pub-id pub-id-type="doi">10.1073/pnas.93.18.9850</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>van Swieten</surname><given-names>JC</given-names></name><name><surname>Brusse</surname><given-names>E</given-names></name><name><surname>de Graaf</surname><given-names>BM</given-names></name><name><surname>Krieger</surname><given-names>E</given-names></name><name><surname>van de Graaf</surname><given-names>R</given-names></name><name><surname>de Koning</surname><given-names>I</given-names></name><name><surname>Maat-Kievit</surname><given-names>A</given-names></name><name><surname>Leegwater</surname><given-names>P</given-names></name><name><surname>Dooijes</surname><given-names>D</given-names></name><name><surname>Oostra</surname><given-names>BA</given-names></name><name><surname>Heutink</surname><given-names>P</given-names></name></person-group><year>2003</year><article-title>A mutation in the fibroblast growth factor 14 gene is associated with Autosomal dominant Cerebral ataxia</article-title><source>The American Journal of Human Genetics</source><volume>72</volume><fpage>191</fpage><lpage>199</lpage><pub-id pub-id-type="doi">10.1086/345488</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>C</given-names></name><name><surname>Chung</surname><given-names>BC</given-names></name><name><surname>Yan</surname><given-names>H</given-names></name><name><surname>Lee</surname><given-names>SY</given-names></name><name><surname>Pitt</surname><given-names>GS</given-names></name></person-group><year>2012</year><article-title>Crystal structure of the ternary complex of a NaV C-terminal domain, a fibroblast growth factor homologous factor, and calmodulin</article-title><source>Structure</source><volume>20</volume><fpage>1167</fpage><lpage>1176</lpage><pub-id pub-id-type="doi">10.1016/j.str.2012.05.001</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>C</given-names></name><name><surname>Hennessey</surname><given-names>JA</given-names></name><name><surname>Kirkton</surname><given-names>RD</given-names></name><name><surname>Wang</surname><given-names>C</given-names></name><name><surname>Graham</surname><given-names>V</given-names></name><name><surname>Puranam</surname><given-names>RS</given-names></name><name><surname>Rosenberg</surname><given-names>PB</given-names></name><name><surname>Bursac</surname><given-names>N</given-names></name><name><surname>Pitt</surname><given-names>GS</given-names></name></person-group><year>2011</year><article-title>Fibroblast growth factor homologous factor 13 regulates Na+ channels and conduction velocity in murine hearts</article-title><source>Circulation Research</source><volume>109</volume><fpage>775</fpage><lpage>782</lpage><pub-id pub-id-type="doi">10.1161/CIRCRESAHA.111.247957</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>Q</given-names></name><name><surname>Bardgett</surname><given-names>ME</given-names></name><name><surname>Wong</surname><given-names>M</given-names></name><name><surname>Wozniak</surname><given-names>DF</given-names></name><name><surname>Lou</surname><given-names>J</given-names></name><name><surname>McNeil</surname><given-names>BD</given-names></name><name><surname>Chen</surname><given-names>C</given-names></name><name><surname>Nardi</surname><given-names>A</given-names></name><name><surname>Reid</surname><given-names>DC</given-names></name><name><surname>Yamada</surname><given-names>K</given-names></name><name><surname>Ornitz</surname><given-names>DM</given-names></name></person-group><year>2002</year><article-title>Ataxia and paroxysmal dyskinesia in mice lacking axonally transported FGF14</article-title><source>Neuron</source><volume>35</volume><fpage>25</fpage><lpage>38</lpage><pub-id pub-id-type="doi">10.1016/S0896-6273(02)00744-4</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wang</surname><given-names>Q</given-names></name><name><surname>McEwen</surname><given-names>DG</given-names></name><name><surname>Ornitz</surname><given-names>DM</given-names></name></person-group><year>2000</year><article-title>Subcellular and developmental expression of alternatively spliced forms of fibroblast growth factor 14</article-title><source>Mechanisms of Development</source><volume>90</volume><fpage>283</fpage><lpage>287</lpage><pub-id pub-id-type="doi">10.1016/S0925-4773(99)00241-5</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yan</surname><given-names>H</given-names></name><name><surname>Pablo</surname><given-names>JL</given-names></name><name><surname>Pitt</surname><given-names>GS</given-names></name></person-group><year>2013</year><article-title>FGF14 regulates presynaptic Ca2+ channels and synaptic transmission</article-title><source>Cell Reports</source><volume>4</volume><fpage>66</fpage><lpage>75</lpage><pub-id pub-id-type="doi">10.1016/j.celrep.2013.06.012</pub-id></element-citation></ref></ref-list></back><sub-article article-type="article-commentary" id="SA1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.04193.010</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Westbrook</surname><given-names>Gary L</given-names></name><role>Reviewing editor</role><aff><institution>Vollum Institute</institution>, <country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see <ext-link ext-link-type="uri" xlink:href="http://elifesciences.org/review-process">review process</ext-link>). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.</p></boxed-text><p>Thank you for sending your work entitled “FGF14 Modulates Resurgent Sodium Current in Mouse Cerebellar Purkinje Neurons” for consideration at <italic>eLife</italic>. Your article has been favorably evaluated by a Senior editor and 3 reviewers as well as Gary Westbrook, a member of our Board of Reviewing Editors.</p><p>The Reviewing editor and the other reviewers discussed their comments before we reached this decision, and following comments were assembled to help you prepare a revised submission. As you will see the reviewers thought the data was convincing in showing that the intracellular protein FGF14, which has previously been shown to interact with sodium channels, regulates the ability of the channels to generate “resurgent” sodium current, an unusual kinetic behavior of sodium channels linked to rapid firing, whereby sodium current flows during recovery from inactivation. The experiments are based on combined shRNA and dominant negative protein experiments using a preparation of cultured Purkinje neurons. This is a powerful combination of molecular tools and physiological function. The implication of FGF14 in resurgent current is of considerable significance, especially because mutations affecting FGF14 are implicated in some human spinocerebellar ataxias.</p><p>The strength of this manuscript is the clear presentation of the functional effects of FGF-14 on sodium currents in Purkinje neurons in <xref ref-type="fig" rid="fig1 fig2 fig3 fig4 fig5">Figures 1-5</xref>. These studies are not a dramatic conceptual advance, but the analysis presented here is more comprehensive and carefully documented than previous work and significantly increases our understanding of FGF-14 effects. The weakness of this manuscript is the interpretation of the regulatory effects observed in molecular terms. As the authors acknowledge, the molecular components required for resurgent sodium current remain unknown, and the molecular mechanism of generation of resurgent current is not substantially advanced by the work presented here. Specifically, no evidence was presented to support the authors' proposal that FGF14 serves as a blocking particle and thus the discussion of the molecular mechanism throughout the manuscript (Abstract, Introduction, Figure 6 and Discussion) should be removed as commented below.</p><p>Major points:</p><p>1) These experiments were done in cultured Purkinje neurons but no information is given about (<xref ref-type="bibr" rid="bib23">Raman et al., 1997</xref>) the extent to which their activity resembles that of Purkinje neurons in other preparations (acutely isolated, slice, in vivo) (<xref ref-type="bibr" rid="bib21">Raman and Bean, 1997</xref>) the age of the cultures (DIV) or (<xref ref-type="bibr" rid="bib8">Grieco et al., 2005</xref>) what efforts were made to achieve good voltage control, which is expected to be difficult in a culture preparation with big currents and axons. The culture preparation is necessary to do these experiments, but addressing these points is important because the data suggest that the cultured neurons do not fire spontaneously (Methods, “only cells with a resting membrane potential more negative than -50 mV were studied”; no indication of holding current to keep cells silent; no spikes evident before steps in current clamp records. Note the extracellular solution for recording spikes is also not reported), and if the authors wish to make a case that FGF14 affects Purkinje cell firing the link to the more physiological condition should be made.</p><p>2) The resurgent current seems to rise very rapidly (and looks generally different from that in acutely isolated cells) although that might just be the time base. What was the time to peak of the resurgent current? It would be helpful to illustrate the kinetics of resurgent currents a wider range of potentials to use as comparison to acutely isolated cells on which many earlier experiments are done. Even if there are differences between the acute and cultured preparations, it would be worth cataloguing systematically.</p><p>3) Abstract:</p><p>“These data suggest that the FGF14b N-terminus may serve as a blocking particle and/or cooperate with NaVbeta 4...” and Discussion as noted. There are no data on open channel block in this manuscript and this conclusion is unsupported. The data show nicely that reduction of functional FGF14 favors inactivation. Because any modulation that favors inactivation will reduce resurgent current, the observed reduction in peak resurgent current is predicted, though still worth documenting. The Results are presented quite clearly, but in the second paragraph of the Discussion the authors surprisingly and unnecessarily extrapolate to the suggestion that FGF14 is itself a blocker or forms part of a blocking complex. The existing data have no direct relationship to this conclusion, and actually seem to argue against the need to invoke this idea for the following reasons:</p><p>a) Losing FGF14 function speeds current decay at depolarized potentials, rather than slowing current decay at depolarized potentials, which is what would be expected if open channel block is directly disrupted (Khaliq et al. 2003, J Neurosci note also that these were the effects of trypsin and chymotrypsin in Grieco et al. 2005, Neuron, when the blocker was removed by proteolysis, although the authors argue that FGF14 might be a blocker because of trypsin sites).</p><p>b) Loss of FGF14 reduces resurgent current but doesn't seem to change its kinetics, which might be expected if the interaction of the blocking particle with the channels is itself altered.</p><p>If the authors want to investigate whether FGF14 can block Na channels, they should simply test whether the N-terminus can make a resurgent current in channels that don't have a native blocker. In the absence of some kind of direct evidence of block, the arguments based on whether the protein has lysines or trypsin sites, etc. are unconvincing and irrelevant. Most importantly, the discussion of FGF14 as a blocker is incidental to the line of the paper and could be cut with no loss to the manuscript.</p><p>4) Abstract:</p><p>a) “Cerebellar Purkinje neurons fire repetitive action potentials because of a voltage-gated Na+ (NaV) ”resurgent“ current” That is maybe overstating the role of resurgent sodium current. There are neurons withour resurgent current that can still fire repetitively. Something like “Rapid firing of cerebellar Purkinje neurons is facilitated by voltage-gated Na+ (NaV) ”resurgent“ current...” would be more accurate.</p><p>b) “Resurgent current results from unbinding of a blocking particle that previously terminated Na+ influx through the channel and simultaneously prevented channel inactivation.” This might be clearer as “Resurgent current results from unbinding of a blocking particle that competes with normal channel inactivation.”</p><p>5) Introduction:</p><p>a) “Cerebellar Purkinje neurons, which provide the sole cerebellar output signal...”. Not true. A correct statement would be “Cerebellar Purkinje neurons, which provide the sole output from the cerebellar cortex....” (not the cerebellum as a whole).</p><p>b) “This is an unusual behavior because, after initially opening, NaV channels in most neurons rapidly enter an inactivated state. This diminishes their ability to reopen quickly that defines the repetitive firing seen in Purkinje neurons.” This was a little clumsy. Something like “Fast repetitive firing in Purkinje neurons is promoted by unusual characteristics associated with sodium channel inactivation, whereby channels recover unusually rapidly from inactivation and in doing so pass a 'resurgent' sodium current, which helps drive the cell to fire a subsequent action potential.”</p><p>c)“First, more than half of the NaV current in Purkinje neurons is carried by NaV1.6, an isoform that is particularly reluctant to enter the inactivated state (<xref ref-type="bibr" rid="bib23">Raman et al., 1997</xref>).” This is a little misleading (because inactivation is still 95-99% complete) . Something like “..an isoform for which inactivation is somewhat less complete compared to others” would be better.</p><p>6) “Although this result appears to contrast with a report that resurgent NaV current was unaffected by the absence of FGF14 in cerebellar granule neurons (<xref ref-type="bibr" rid="bib5">Dalski et al., 2005</xref>), the protocol employed in that study was markedly different. Instead of measuring resurgent current, it evaluated channel recovery from inactivation.”</p><p>This is incorrect. <xref ref-type="table" rid="tbl1">Table 1</xref> from Neuron 55(3):449-463 shows statistics for voltage clamp measurements of resurgent sodium current. However, as the measurements were in cerebellar granule cells, there is no real conflict. Also, the measurements reported were for resurgent current at -85 mV, which in the present results <xref ref-type="fig" rid="fig2">Figure 2H</xref> showed much less change than at -40 mV where resurgent current is maximal.</p><p>7) “FGF14 is expressed in the hippocampus (<xref ref-type="bibr" rid="bib1">Aman et al., 2009</xref>), but resurgent NaV current is not observed in hippocampal neurons unless an exogenous blocking particle is added through the patch pipette (<xref ref-type="bibr" rid="bib8">Grieco et al., 2005</xref>).”</p><p>This is true for CA3 pyramidal neurons but not CA1 pyramidal neurons, which do express resurgent sodium current (Royeck M, Horstmann MT, Remy S, Reitze M, Yaari Y, Beck H. Role of axonal NaV1.6 sodium channels in action potential initiation of CA1 pyramidal neurons. J Neurophysiol. 2008 100:2361-80.)</p><p>8) <xref ref-type="table" rid="tbl1">Table 1</xref> includes several non-standard or ambiguous measurement parameters that are not defined in Methods, namely “AP rise time”, “AP decay time”, and “AP integral”. Because these do not change and are not referred to, they should be deleted or Methods should define how they were measured. (“AP rise time” is especially ambiguous and hard to interpret, because it is longer than AP duration.)</p><p>9) The authors write as though Purkinje neurons express only Nav1.6 channels. In fact, previous work suggests the presence of other sodium channels as well. For example, specific immunostaining and gene knockout indicate that Nav1.1 channels are present and constitute a significant fraction of sodium current in the cell bodies of dissociated Purkinje neurons (Kalume et al., J Neurosci, 2007). The presence of multiple sodium channel types in Purkinje neurons complicates all of the quantitative interpretations of the results presented here because it is unknown whether FHF-14 affects all of the sodium channels types that may be present in the same way.</p><p>10) <xref ref-type="fig" rid="fig4">Figure 4A, B</xref>. Why are interactions of Nav1.5 and FHF-13 reported here? These results should be replaced with experiments on Nav1.6 and FHF-14, which form the primary focus of this manuscript.</p><p>11) Figure 6. The molecular model developed in Figure 6 and the Discussion is highly speculative. There is no experimental basis for the interaction between the Navbeta4 subunit and FGF14 depicted in Figure 6, and indeed the role of Navbeta4 as a blocking protein has yet to be demonstrated for Purkinje cells. Similarly, the authors indicate that FHF-14 also is unable to generate resurgent sodium current when co-expressed with sodium channels, so there is no experimental basis for its proposed role as a blocking particle that generates resurgent sodium current either. If the authors wish to propose this molecular mechanism, they need to show that co-expression of Navbeta4, FHF-14, or both can generate resurgent sodium current in a cell type in which none is observed before co-expression.</p><p>12) The authors base much of the impact of their manuscript on elucidating the molecular mechanism of resurgent sodium current. However, as developed in the points above, their work does not directly address this problem. The authors need to re-orient the Abstract and Discussion and provide a more persuasive presentation of the importance of their findings for the physiology of Purkinje neurons and the pathophysiological effects of spinocerebellar ataxia mutations in FHF-14. The discussion of the molecular role of FHF-14 and Navbeta4 should be greatly reduced in favor of consideration of the potential impact of regulation by FHF-14 in the physiological function and pathophysiology of Purkinje neurons.</p></body></sub-article><sub-article article-type="reply" id="SA2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.04193.011</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p><italic>1) These experiments were done in cultured Purkinje neurons but no information is given about (</italic><xref ref-type="bibr" rid="bib23"><italic>Raman et al., 1997</italic></xref><italic>) the extent to which their activity resembles that of Purkinje neurons in other preparations (acutely isolated, slice, in vivo) (</italic><xref ref-type="bibr" rid="bib21"><italic>Raman and Bean, 1997</italic></xref><italic>) the age of the cultures (DIV) or (</italic><xref ref-type="bibr" rid="bib8"><italic>Grieco et al., 2005</italic></xref><italic>) what efforts were made to achieve good voltage control, which is expected to be difficult in a culture preparation with big currents and axons. The culture preparation is necessary to do these experiments, but addressing these points is important because the data suggest that the cultured neurons do not fire spontaneously (Methods, “only cells with a resting membrane potential more negative than -50 mV were studied”; no indication of holding current to keep cells silent; no spikes evident before steps in current clamp records. Note the extracellular solution for recording spikes is also not reported), and if the authors wish to make a case that FGF14 affects Purkinje cell firing the link to the more physiological condition should be made</italic>.</p><p>Similar to the activity of Purkinje neurons in acutely isolated slice or <italic>in vivo</italic>, we observed spontaneous firing in our cultured Purkinje neurons when they remained in culture for ≥ 20 days <italic>in vitro</italic>. However, our experiments were performed with 12-14 days <italic>in vitro</italic> Purkinje neurons, allowing us to achieve reasonable voltage control that was less attainable in older cultures. In this context, we chose to study evoked rather than spontaneous action potentials. These culture details have been added to the Methods and this specific limitation is now addressed in the text.</p><p>The extracellular solution is now reported (Methods Section).</p><p><italic>2) The resurgent current seems to rise very rapidly (and looks generally different from that in acutely isolated cells) although that might just be the time base. What was the time to peak of the resurgent current? It would be helpful to illustrate the kinetics of resurgent currents a wider range of potentials to use as comparison to acutely isolated cells on which many earlier experiments are done. Even if there are differences between the acute and cultured preparations, it would be worth cataloguing systematically</italic>.</p><p>We have calculated the time to peak for resurgent current over a wide range of potentials and have added these data to <xref ref-type="fig" rid="fig2">Figure 2K</xref>.The kinetics in cultured Purkinje neurons are only slightly faster than those reported in acutely dissociated Purkinje neurons (see Aman TK &amp; Raman IM (2010) J Neurosci 30(16):5629).</p><p>3<italic>) Abstract:</italic></p><p><italic>“These data suggest that the FGF14b N-terminus may serve as a blocking particle and/or cooperate with NaVbeta 4...” and Discussion as noted. There are no data on open channel block in this manuscript and this conclusion is unsupported. The data show nicely that reduction of functional FGF14 favors inactivation. Because any modulation that favors inactivation will reduce resurgent current, the observed reduction in peak resurgent current is predicted, though still worth documenting. The Results are presented quite clearly, but in the second paragraph of the Discussion the authors surprisingly and unnecessarily extrapolate to the suggestion that FGF14 is itself a blocker or forms part of a blocking complex</italic>. <italic>The existing data have no direct relationship to this conclusion, and actually seem to argue against the need to invoke this idea for the following reasons</italic>:</p><p><italic>a) Losing FGF14 function speeds current decay at depolarized potentials, rather than slowing current decay at depolarized potentials, which is what would be expected if open channel block is directly disrupted (Khaliq et al. 2003, J Neurosci note also that these were the effects of trypsin and chymotrypsin in Grieco et al. 2005, Neuron, when the blocker was removed by proteolysis, although the authors argue that FGF14 might be a blocker because of trypsin sites)</italic>.</p><p><italic>b) Loss of FGF14 reduces resurgent current but doesn't seem to change its kinetics, which might be expected if the interaction of the blocking particle with the channels is itself altered</italic>.</p><p><italic>If the authors want to investigate whether FGF14 can block Na channels, they should simply test whether the N-terminus can make a resurgent current in channels that don't have a native blocker. In the absence of some kind of direct evidence of block, the arguments based on whether the protein has lysines or trypsin sites, etc. are unconvincing and irrelevant. Most importantly, the discussion of FGF14 as a blocker is incidental to the line of the paper and could be cut with no loss to the manuscript</italic>.</p><p>As noted above, references to FGF14 as a blocking particle have been removed, as suggested.</p><p><italic>4) Abstract:</italic></p><p><italic>a) “Cerebellar Purkinje neurons fire repetitive action potentials because of a voltage-gated Na+ (NaV) ”resurgent“ current” That is maybe overstating the role of resurgent sodium current. There are neurons withour resurgent current that can still fire repetitively. Something like “Rapid firing of cerebellar Purkinje neurons is facilitated by voltage-gated Na+ (NaV) “resurgent” current...” would be more accurate</italic>.</p><p>Changed as suggested.</p><p><italic>b) “Resurgent current results from unbinding of a blocking particle that previously terminated Na+ influx through the channel and simultaneously prevented channel inactivation.” This might be clearer as “Resurgent current results from unbinding of a blocking particle that competes with normal channel inactivation</italic>.<italic>”</italic></p><p>Changed as suggested.</p><p><italic>5) Introduction:</italic></p><p><italic>a) &quot;Cerebellar Purkinje neurons, which provide the sole cerebellar output signal...“. Not true. A correct statement would be ”Cerebellar Purkinje neurons, which provide the sole output from the cerebellar cortex....” (not the cerebellum as a whole)</italic>.</p><p>Changed as suggested.</p><p><italic>b) “This is an unusual behavior because, after initially opening, NaV channels in most neurons rapidly enter an inactivated state. This diminishes their ability to reopen quickly that defines the repetitive firing seen in Purkinje neurons.” This was a little clumsy. Something like “Fast repetitive firing in Purkinje neurons is promoted by unusual characteristics associated with sodium channel inactivation, whereby channels recover unusually rapidly from inactivation and in doing so pass a 'resurgent' sodium current, which helps drive the cell to fire a subsequent action potential</italic>.<italic>”</italic></p><p>Changed as suggested.</p><p><italic>c)“First, more than half of the NaV current in Purkinje neurons is carried by NaV1.6, an isoform that is particularly reluctant to enter the inactivated state (</italic><xref ref-type="bibr" rid="bib23"><italic>Raman et al., 1997</italic></xref><italic>).” This is a little misleading (because inactivation is still 95-99% complete) . Something like “..an isoform for which inactivation is somewhat less complete compared to others” would be better</italic>.</p><p>Changed as suggested.</p><p><italic>6) “Although this result appears to contrast with a report that resurgent NaV current was unaffected by the absence of FGF14 in cerebellar granule neurons (</italic><xref ref-type="bibr" rid="bib5"><italic>Dalski et al., 2005</italic></xref><italic>), the protocol employed in that study was markedly different. Instead of measuring resurgent current, it evaluated channel recovery from inactivation</italic>.”</p><p><italic>This is incorrect.</italic> <xref ref-type="table" rid="tbl1"><italic>Table 1</italic></xref> <italic>from Neuron 55(3):449-463 shows statistics for voltage clamp measurements of resurgent sodium current. However, as the measurements were in cerebellar granule cells, there is no real conflict. Also, the measurements reported were for resurgent current at -85 mV, which in the present results</italic> <xref ref-type="fig" rid="fig2"><italic>Figure 2H</italic></xref> <italic>showed much less change than at -40 mV where resurgent current is maximal</italic>.</p><p>The reviewers are correct that <xref ref-type="table" rid="tbl1">Table 1</xref> from Neuron 55(3):449-463 reports no change in “resurgent current”. From our reading of that publication, however, the data for <xref ref-type="table" rid="tbl1">Table 1</xref> appear to be derived from the protocol and example traces described and depicted in Figure 7D. We believe that this protocol, and subsequently the data presented in <xref ref-type="table" rid="tbl1">Table 1</xref> are therefore not representative of the protocols previously used to measure resurgent current.</p><p><italic>7) “FGF14 is expressed in the hippocampus (</italic><xref ref-type="bibr" rid="bib1"><italic>Aman et al., 2009</italic></xref><italic>), but resurgent NaV current is not observed in hippocampal neurons unless an exogenous blocking particle is added through the patch pipette (</italic><xref ref-type="bibr" rid="bib8"><italic>Grieco et al., 2005</italic></xref><italic>)</italic>.<italic>”</italic></p><p><italic>This is true for CA3 pyramidal neurons but not CA1 pyramidal neurons, which do express resurgent sodium current (Royeck M, Horstmann MT, Remy S, Reitze M, Yaari Y, Beck H. Role of axonal NaV1.6 sodium channels in action potential initiation of CA1 pyramidal neurons. J Neurophysiol. 2008 100:2361-80</italic>.<italic>)</italic></p><p>We removed the discussion of FGF14 as a blocking particle, as suggested.</p><p><italic>8)</italic> <xref ref-type="table" rid="tbl1"><italic>Table 1</italic></xref> <italic>includes several non-standard or ambiguous measurement parameters that are not defined in Methods, namely “AP rise time”, “AP decay time”, and “AP integral”. Because these do not change and are not referred to, they should be deleted or Methods should define how they were measured. (“AP rise time” is especially ambiguous and hard to interpret, because it is longer than AP duration</italic>.<italic>)</italic></p><p>Deleted as suggested.</p><p><italic>9) The authors write as though Purkinje neurons express only Nav1.6 channels. In fact, previous work suggests the presence of other sodium channels as well. For example, specific immunostaining and gene knockout indicate that Nav1.1 channels are present and constitute a significant fraction of sodium current in the cell bodies of dissociated Purkinje neurons (Kalume et al., J Neurosci, 2007). The presence of multiple sodium channel types in Purkinje neurons complicates all of the quantitative interpretations of the results presented here because it is unknown whether FHF-14 affects all of the sodium channels types that may be present in the same way</italic>.</p><p>We agree that the interpretation of our data must account for all Na<sub>V</sub> channels in Purkinje neurons and have revised both the Introduction and the Discussion accordingly. FGF14 also regulates Na<sub>V</sub>1.1, as previously shown [J Physiol 2005;569:179]. Thus, the effects on resurgent current that we attribute to FGF14 may result from FGF14’s overall influence of Na<sub>V</sub> channel kinetics within Purkinje neurons. In addition to the added text, we removed the speculation that FGF14 may serve as a blocking particle for Na<sub>V</sub>1.6 (as suggested by the Reviewer); and with the consequent removal of the Na<sub>V</sub>1.6-centric model that was previously Figure 6, we believe that the revised manuscript addresses this issue appropriately.</p><p><italic>10)</italic> <xref ref-type="fig" rid="fig4"><italic>Figure 4A, B</italic></xref><italic>. Why are interactions of Nav1.5 and FHF-13 reported here? These results should be replaced with experiments on Nav1.6 and FHF-14, which form the primary focus of this manuscript</italic>.</p><p>We designed our mutagenesis strategy to disrupt FHF-Na<sub>V</sub> interaction by employing available crystallographic structural information from a complex that included FGF13 and the Na<sub>V</sub>1.5 C terminus. Because of the high sequence conservation among the FHFs and separately among the Na<sub>V</sub>1.x C termini, we believe that the FGF13-Na<sub>V</sub>1.5 model is relevant for Na<sub>V</sub>1.6 and FGF14. We agree with the Reviewer, however, that a demonstration that the FGF14b<sup>R/A</sup> mutant cannot bind Na<sub>V</sub>1.6 will enhance our manuscript. Therefore, we expressed either FGF14b or mutant FGF14b<sup>R/A</sup> with Na<sub>V</sub>1.6 in HEK cells and performed co-immunoprecipitation studies. As we now show in the new <xref ref-type="fig" rid="fig2">Figure 2B</xref>, FGF14b<sup>R/A</sup> does not co-immunoprecipitate with Na<sub>V</sub>1.6, demonstrating that the intact FGF14b<sup>R/A</sup> does not interact with the intact Na<sub>V</sub>1.6.</p><p><italic>11) Figure 6. The molecular model developed in Figure 6 and the Discussion is highly speculative. There is no experimental basis for the interaction between the Navbeta4 subunit and FGF14 depicted in Figure 6, and indeed the role of Navbeta4 as a blocking protein has yet to be demonstrated for Purkinje cells. Similarly, the authors indicate that FHF-14 also is unable to generate resurgent sodium current when co-expressed with sodium channels, so there is no experimental basis for its proposed role as a blocking particle that generates resurgent sodium current either. If the authors wish to propose this molecular mechanism, they need to show that co-expression of Navbeta4, FHF-14, or both can generate resurgent sodium current in a cell type in which none is observed before co-expression</italic>.</p><p>As suggested above, the references to FGF14 as a blocking particle have been removed.</p><p><italic>12) The authors base much of the impact of their manuscript on elucidating the molecular mechanism of resurgent sodium current. However, as developed in the points above, their work does not directly address this problem. The authors need to re-orient the Abstract and Discussion and provide a more persuasive presentation of the importance of their findings for the physiology of Purkinje neurons and the pathophysiological effects of spinocerebellar ataxia mutations in FHF-14. The discussion of the molecular role of FHF-14 and Navbeta4 should be greatly reduced in favor of consideration of the potential impact of regulation by FHF-14 in the physiological function and pathophysiology of Purkinje neurons</italic>.</p><p>As suggested, the manuscript has been re-tooled (particularly in the Discussion) to discuss the role of FGF14 as regulator of resurgent current through its effects upon Na<sub>V</sub> channel kinetic properties. All references to FGF14 as a potential blocking particle have been removed. The resultant discussion focuses more on the roles for FGF14 in Purkinje physiology and the consequences for spinocerebellar ataxia.</p></body></sub-article></article>