Permalink
Cannot retrieve contributors at this time
Fetching contributors…
Cannot retrieve contributors at this time
| <?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d1 20130915//EN" "JATS-archivearticle1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.1d1"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="hwp">eLife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">04265</article-id><article-id pub-id-type="doi">10.7554/eLife.04265</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Research article</subject></subj-group><subj-group subj-group-type="heading"><subject>Developmental biology and stem cells</subject></subj-group></article-categories><title-group><article-title>CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in <italic>C. elegans</italic></article-title></title-group><contrib-group><contrib contrib-type="author" corresp="yes" id="author-17335" equal-contrib="yes"><name><surname>Weaver</surname><given-names>Benjamin P</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="corresp" rid="cor1">*</xref><xref ref-type="fn" rid="equal-contrib">†</xref><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-17336" equal-contrib="yes"><name><surname>Zabinsky</surname><given-names>Rebecca</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="equal-contrib">†</xref><xref ref-type="other" rid="par-2"/><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-17337"><name><surname>Weaver</surname><given-names>Yi M</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-17338"><name><surname>Lee</surname><given-names>Eui Seung</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="par-4"/><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-17339"><name><surname>Xue</surname><given-names>Ding</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="other" rid="par-4"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-1306"><name><surname>Han</surname><given-names>Min</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="other" rid="par-3"/><xref ref-type="other" rid="par-5"/><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution content-type="dept">Department of Molecular, Cellular and Developmental Biology</institution>, <institution>University of Colorado Boulder</institution>, <addr-line><named-content content-type="city">Boulder</named-content></addr-line>, <country>United States</country></aff><aff id="aff2"><label>2</label><institution content-type="dept">Department of Molecular, Cellular and Developmental Biology</institution>, <institution>Howard Hughes Medical Institute, University of Colorado Boulder</institution>, <addr-line><named-content content-type="city">Boulder</named-content></addr-line>, <country>United States</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Joshua-Tor</surname><given-names>Leemor</given-names></name><role>Reviewing editor</role><aff><institution>Cold Spring Harbor Laboratory</institution>, <country>United States</country></aff></contrib></contrib-group><author-notes><corresp id="cor1"><label>*</label>For correspondence: <email>benjaminpweaver@gmail.com</email></corresp><fn fn-type="con" id="equal-contrib"><label>†</label><p>These authors contributed equally to this work</p></fn></author-notes><pub-date publication-format="electronic" date-type="pub"><day>30</day><month>12</month><year>2014</year></pub-date><pub-date pub-type="collection"><year>2014</year></pub-date><volume>3</volume><elocation-id>e04265</elocation-id><history><date date-type="received"><day>06</day><month>08</month><year>2014</year></date><date date-type="accepted"><day>26</day><month>11</month><year>2014</year></date></history><permissions><copyright-statement>© 2014, Weaver et al</copyright-statement><copyright-year>2014</copyright-year><copyright-holder>Weaver et al</copyright-holder><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife04265.pdf"/><abstract><object-id pub-id-type="doi">10.7554/eLife.04265.001</object-id><p>Genetic redundancy and pleiotropism have limited the discovery of functions associated with miRNAs and other regulatory mechanisms. To overcome this, we performed an enhancer screen for developmental defects caused by compromising both global miRISC function and individual genes in <italic>Caenorhabditis elegans</italic>. Among 126 interactors with miRNAs, we surprisingly found the CED-3 caspase that has only been well studied for its role in promoting apoptosis, mostly through protein activation. We provide evidence for a non-apoptotic function of CED-3 caspase that regulates multiple developmental events through proteolytic inactivation. Specifically, LIN-14, LIN-28, and DISL-2 proteins are known miRNA targets, key regulators of developmental timing, and/or stem cell pluripotency factors involved in miRNA processing. We show CED-3 cleaves these proteins in vitro. We also show CED-3 down-regulates LIN-28 in vivo, possibly rendering it more susceptible to proteasomal degradation. This mechanism may critically contribute to the robustness of gene expression dynamics governing proper developmental control.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.001">http://dx.doi.org/10.7554/eLife.04265.001</ext-link></p></abstract><abstract abstract-type="executive-summary"><object-id pub-id-type="doi">10.7554/eLife.04265.002</object-id><title>eLife digest</title><p>For an organism to develop from a single cell into a collection of many different, specialized cells, different genes must be switched on or off at particular times. However, some of these genes involved in development are ‘redundant’ and carry out the same or similar tasks. This acts like a backup system, so if one of the genes is unable to complete a task, the others can compensate and the organism will still develop correctly.</p><p>To produce a protein from a gene, the DNA sequence that makes up the gene is used as a template to create another molecule called messenger RNA. Genes can also be ‘silenced’—prevented from making proteins—by small molecules called microRNAs, which bind to messenger RNA molecules and mark them for destruction. MicroRNA molecules therefore play an important role in controlling development. However, as many microRNA molecules often work together, and as many genes are redundant, it can be difficult to discover the effects of specific microRNAs. It is also difficult to discover whether any other mechanisms work alongside the microRNAs to control development.</p><p>Weaver, Zabinsky et al. used mutant forms of the nematode worm <italic>Caenorhabditis elegans</italic>, in which microRNA gene regulation did not work correctly, to investigate the mechanisms that work alongside microRNAs to control development. Genes in these worms were silenced; those silenced genes that caused additional developmental defects were considered likely to work ‘redundantly’ in the same role as a microRNA molecule. This revealed over one hundred genes that were previously unknown to work with microRNA molecules.</p><p>Weaver, Zabinsky et al. focused on one of these genes, called <italic>ced-3</italic>. The CED-3 protein produced from this gene is known to execute programmed cell death, a carefully controlled process also known as apoptosis, but was not known to have other developmental functions. However, the worms with mutant forms of the <italic>ced-3</italic> gene already have problems performing apoptosis but are otherwise relatively normal, so Weaver, Zabinsky et al. reasoned that the CED-3 protein must also have another role in development.</p><p>Further investigation revealed that <italic>ced-3</italic> mutations most severely disrupt development when they are combined with mutations in one particular family of microRNAs. These microRNAs are particularly important for controlling both when cells specialize into a particular type of cell, and the timing of when certain stages of development happen. Experiments using purified proteins showed that CED-3 breaks down three proteins that are produced from genes controlled by this family of microRNA molecules, and one of these proteins was also broken down by CED-3 in experiments with mutant worms. Weaver, Zabinsky et al. therefore propose that CED-3 is part of a semi-redundant system that ensures the proteins are produced at the right level and at the right time even if the microRNAs insufficiently regulate them. This finding demonstrated both a specific role and specific targets for the CED-3 protein during development, entirely distinct from its role in apoptosis.</p><p>Although Weaver, Zabinsky et al. have identified a large number of genes that work alongside microRNAs to control development, these are only the genes that cause obvious developmental defects in healthy worms. Further experiments using similar techniques performed on worms under stress may reveal yet more such genes.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.002">http://dx.doi.org/10.7554/eLife.04265.002</ext-link></p></abstract><kwd-group kwd-group-type="author-keywords"><title>Author keywords</title><kwd>GW182</kwd><kwd>miRNA</kwd><kwd>caspase</kwd><kwd>DIS3L2</kwd><kwd>LIN28</kwd><kwd>heterochronic</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd><italic>C. elegans</italic></kwd></kwd-group><funding-group><award-group id="par-1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000048</institution-id><institution>American Cancer Society</institution></institution-wrap></funding-source><award-id>121631-PF-12-088-01-RMC</award-id><principal-award-recipient><name><surname>Weaver</surname><given-names>Benjamin P</given-names></name></principal-award-recipient></award-group><award-group id="par-2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000057</institution-id><institution content-type="university">National Institute of General Medical Sciences</institution></institution-wrap></funding-source><award-id>2T32GM008759-11</award-id><principal-award-recipient><name><surname>Zabinsky</surname><given-names>Rebecca</given-names></name></principal-award-recipient></award-group><award-group id="par-3"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000057</institution-id><institution content-type="university">National Institute of General Medical Sciences</institution></institution-wrap></funding-source><award-id>5R01GM047869</award-id><principal-award-recipient><name><surname>Han</surname><given-names>Min</given-names></name></principal-award-recipient></award-group><award-group id="par-4"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000057</institution-id><institution content-type="university">National Institute of General Medical Sciences</institution></institution-wrap></funding-source><award-id>R01GM059083</award-id><principal-award-recipient><name><surname>Lee</surname><given-names>Eui Seung</given-names></name><name><surname>Xue</surname><given-names>Ding</given-names></name></principal-award-recipient></award-group><award-group id="par-5"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000011</institution-id><institution content-type="university">Howard Hughes Medical Institute</institution></institution-wrap></funding-source><principal-award-recipient><name><surname>Han</surname><given-names>Min</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name><meta-value>2.0</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>A broadly used gene expression regulatory mechanism inactivates targets by CED-3-caspase-mediated proteolysis and works in parallel to miRNAs for diverse non-apoptotic developmental functions.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec sec-type="intro" id="s1"><title>Introduction</title><p>The robustness of animal development is ensured by multiple regulatory mechanisms with overlapping roles acting on specific cellular processes, often manifested as genetic redundancy (<xref ref-type="bibr" rid="bib18">Fay et al., 2002</xref>; <xref ref-type="bibr" rid="bib30">Kitano, 2004</xref>; <xref ref-type="bibr" rid="bib19">Felix and Wagner, 2008</xref>; <xref ref-type="bibr" rid="bib22">Hammell et al., 2009</xref>). miRNAs mostly exert repression of gene expression by blocking target mRNA translation and/or through mRNA decay as part of the miRNA-induced-silencing complex (miRISC), which includes GW182 and argonaute proteins (<xref ref-type="bibr" rid="bib14">Ding and Han, 2007</xref>; <xref ref-type="bibr" rid="bib17">Fabian and Sonenberg, 2012</xref>). miRNA-mediated gene silencing is a critical regulatory mechanism that ensures dynamic changes in gene expression during animal development or other physiological processes (<xref ref-type="bibr" rid="bib5">Ambros, 2004</xref>; <xref ref-type="bibr" rid="bib8">Bartel and Chen, 2004</xref>). However, specific physiological roles of individual miRNAs are often executed through the combinatory effects of multi-miRNA, multi-target mRNA networks (<xref ref-type="bibr" rid="bib9">Brenner et al., 2010</xref>; <xref ref-type="bibr" rid="bib28">Karp et al., 2011</xref>; <xref ref-type="bibr" rid="bib31">Kudlow et al., 2012</xref>; <xref ref-type="bibr" rid="bib36">Miska et al., 2007</xref>; <xref ref-type="bibr" rid="bib42">Parry et al., 2007</xref>; <xref ref-type="bibr" rid="bib62">Than et al., 2013</xref>; <xref ref-type="bibr" rid="bib2">Alvarez-Saavedra and Horvitz, 2010</xref>). Moreover, these miRNA–mRNA interaction networks may act in concert, and often semi-redundantly, with other regulatory mechanisms to limit the expression of many genes involved in animal development or other physiological functions (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Therefore, tackling genetic redundancy would be critical to uncover many specific functions associated with miRNAs and other gene expression regulatory mechanisms.<fig-group><fig id="fig1" position="float"><object-id pub-id-type="doi">10.7554/eLife.04265.003</object-id><label>Figure 1.</label><caption><title>Genome-wide RNAi screen for genes that cooperate with miRISCs to regulate development.</title><p>(<bold>A</bold>) Rationale of enhancer screen strategy (detailed in <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>). (<bold>B</bold>) The number of genes identified as interactors of either/both <italic>ain-1(lf)</italic> and/or <italic>ain-2(lf)</italic>. (<bold>C</bold>) Distribution of the 126 interactors into functional categories (interactors listed in <xref ref-type="supplementary-material" rid="SD9-data">Supplementary file 2</xref>). (<bold>D</bold>) The proportion of genes exhibiting singular vs pleiotropic RNAi phenotypes with <italic>ain-1(lf)</italic> or <italic>ain-2(lf)</italic> (detailed phenotypic frequencies shown in <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.003">http://dx.doi.org/10.7554/eLife.04265.003</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265f001"/></fig><fig id="fig1s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.004</object-id><label>Figure 1—figure supplement 1.</label><caption><title>RNAi screen strategy and frequencies of phenotypes.</title><p>(<bold>A</bold>) Cartoon diagram illustrating steps of the screen performed for the entire ORF RNAi library using liquid culture 96-well format. We included the RNAi-sensitizing mutation, <italic>rrf-3(lf)</italic>, with <italic>ain-1(lf)</italic> and <italic>ain-2(lf)</italic> to increase screen sensitivity and therefore used <italic>rrf-3(lf)</italic> alone for the control. In the double blind, we identified genes where the RNAi effect for the control was mostly normal but where <italic>ain-1(lf)</italic> or <italic>ain-2(lf)</italic> showed an obvious enhancer phenotype (as defined in <xref ref-type="supplementary-material" rid="SD8-data">Supplementary file 1</xref>). Example phenotypes body morphology defect (Bmd), embryonic lethality (Emb), and reduced brood size (Red) are depicted for illustration purposes only. Confirmations were performed in quadruplicate in the double blind. These interactors were all then revealed and sequence-verified. (<bold>B</bold>) Frequency of phenotypes observed in the RNAi screen. The three letter phenotypes indicated here are all defined in <xref ref-type="supplementary-material" rid="SD8-data">Supplementary file 1</xref> and are depicted here as the frequency of occurrence amongst interactors for either <italic>ain-1</italic> or <italic>ain-2</italic>. Due to pleiotropism, the sum of the phenotypes will exceed 100%. All genes identified in the screen with individual phenotypes are listed in <xref ref-type="supplementary-material" rid="SD9-data">Supplementary file 2</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.004">http://dx.doi.org/10.7554/eLife.04265.004</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs001"/></fig></fig-group></p><p>We have carried out a genome-wide enhancer screen for genes that when knocked down would generate a strong developmental defect when general miRISC function is compromised. Among a large number of interactors identified from the screen is the <italic>ced-3</italic> gene that encodes a caspase, well-characterized as a key component of the apoptotic pathway (<xref ref-type="bibr" rid="bib12">Conradt and Xue, 2005</xref>). While <italic>ced-3</italic> is absolutely required for the apoptotic process, null mutations of the gene are not associated with obvious developmental defects (<xref ref-type="bibr" rid="bib23">Hengartner, 1997</xref>). However, two recent studies have reported different non-apoptotic roles of the <italic>ced-3</italic> pathway, namely in stress-related neuronal function (<xref ref-type="bibr" rid="bib45">Pinan-Lucarre et al., 2012</xref>) and aging (<xref ref-type="bibr" rid="bib68">Yee et al., 2014</xref>). Because no specific downstream targets of CED-3 were found in these studies, the mechanistic detail of such non-apoptotic functions of CED-3 remains unclear. Moreover, whether the CED-3 system is widely utilized to regulate animal development and other functions is a question of high significance.</p></sec><sec sec-type="results" id="s2"><title>Results</title><sec id="s2-1"><title>A genome-wide enhancer screen to identify factors that act with miRISCs to ensure robust development</title><p>To uncover specific physiological functions of miRNAs and other regulatory mechanisms acting with miRNAs during development, we performed a genetic enhancer screen for developmental defects that manifested only when miRISC function and another regulatory mechanism were both compromised (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). We chose to use loss-of-function <italic>(lf)</italic> mutations of the <italic>ain-1</italic> and <italic>ain-2</italic> genes (GW182 orthologs) that each alone significantly compromises but does not eliminate global miRISC function (<xref ref-type="bibr" rid="bib15">Ding et al., 2005</xref>; <xref ref-type="bibr" rid="bib71">Zhang et al., 2007</xref>, <xref ref-type="bibr" rid="bib72">2009</xref>). While the <italic>ain-1(lf)</italic> mutant has a mild heterochronic phenotype and the <italic>ain-2(lf)</italic> mutant is superficially wild-type, loss of both genes results in severe pleiotropic defects including alteration in temporal cell fate patterning. Therefore, an enhancer screen using the <italic>ain-1(lf)</italic> or <italic>ain-2(lf)</italic> mutant can potentially detect functions associated with most miRNAs.</p><p>Using the entire <italic>Caenorhabditis elegans</italic> ORFeome RNAi feeding library (<xref ref-type="bibr" rid="bib51">Rual et al., 2004</xref>), we performed a double-blind screen that identified 126 genetic interactors (<xref ref-type="fig" rid="fig1">Figure 1A–D</xref>, <xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1</xref> and <xref ref-type="supplementary-material" rid="SD8-data SD9-data">Supplementary files 1,2</xref>), of which only eight have been reported to interact with miRNA regulatory pathways (<xref ref-type="bibr" rid="bib42">Parry et al., 2007</xref>). Many interactions were confirmed by testing candidate mutants for phenotypes when treated with <italic>ain-1</italic> and <italic>ain-2</italic> RNAi (<xref ref-type="supplementary-material" rid="SD10-data">Supplementary file 3</xref>). Nearly two-thirds of the 126 genetic interactors were found to interact with both <italic>ain-1</italic> and <italic>ain-2</italic> genes (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). Gene ontology analysis revealed that these genes belong to a broad range of functional groups (<xref ref-type="fig" rid="fig1">Figure 1C</xref>). Over-representation of genes associated with protein stability is consistent with the hypothesis that miRNAs act in concert with other repressive mechanisms to limit gene expression (<xref ref-type="fig" rid="fig1">Figure 1A,C</xref>). We found that <italic>ain-1(lf)</italic> displayed more pronounced pleiotropism with its interactors than <italic>ain-2(lf)</italic> (<xref ref-type="fig" rid="fig1">Figure 1D</xref>) and that the two GW182 homologs have distinct frequencies of phenotypes with their interactors (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>), arguing against general sickness being the cause for the enhancement (further elaborated in <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>). The pleiotropic nature of <italic>ain-1</italic> interactions is consistent with the diverse physiological functions associated with AIN-1 or possibly its expression patterns or levels.</p></sec><sec id="s2-2"><title>Cooperation between the CED-3 pathway and miRISC on multiple aspects of development</title><p>We were most surprised to identify the <italic>C. elegans</italic> cell-killing caspase, <italic>ced-3,</italic> as an interactor of the miRISC GW182 homolog, <italic>ain-1</italic>. Using multiple alleles of each gene, we found that <italic>ced-3(lf);ain-1(lf)</italic> double mutants have pleiotropic developmental phenotypes including delays in larval growth rate, smaller brood size, abnormal adult body morphology, egg-laying defect (accumulation of eggs inside the animal), sluggish movement, embryonic lethality, and laid oocytes (failure to fertilize) (<xref ref-type="fig" rid="fig2">Figure 2A–D</xref> and <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2A,B</xref>). The penetrance of abnormal phenotypes increased as the adults continued to age (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2C</xref>) and was therefore best quantified in a synchronized population. Combining mutations of miRISC components such as <italic>ain-1(GW182)(lf)</italic> or <italic>alg-1(argonaute)(lf)</italic> with the cell death pathway factors <italic>ced-3(caspase)(lf)</italic> or its upstream activator, <italic>ced-4(apaf-like)(lf),</italic> results in abnormal adults (<xref ref-type="fig" rid="fig2">Figure 2E</xref>) but <italic>ced-3(lf);ain-2(lf)</italic> animals did not show a significant defect (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2D</xref>). To test the involvement of other core cell death pathway factors, we also examined the interaction of <italic>ain-1</italic> with <italic>egl-1</italic> that has been shown to act upstream of the CED-3 caspase to promote apoptosis (<xref ref-type="fig" rid="fig2s3">Figure 2—figure supplement 3A</xref>) and <italic>egl-1(lf)</italic> is known to cause a strong cell death defect (<xref ref-type="bibr" rid="bib12">Conradt and Xue, 2005</xref>). We found that, like <italic>ced-3(lf)</italic> and <italic>ced-4(lf)</italic>, <italic>egl-1(RNAi)</italic> also significantly enhanced the developmental defects of <italic>ain-1(lf)</italic> (<xref ref-type="fig" rid="fig2s3">Figure 2—figure supplement 3B</xref>).<fig-group><fig id="fig2" position="float"><object-id pub-id-type="doi">10.7554/eLife.04265.005</object-id><label>Figure 2.</label><caption><title><italic>C. elegans</italic> strains compromised in both miRISC and <italic>ced-3</italic> functions have significant pleiotropic developmental phenotypes.</title><p>(<bold>A</bold> and <bold>B</bold>) Microscopic images showing the pleiotropic phenotypes of the <italic>ced-3(lf);ain-1(lf)</italic> double mutant, including egg-laying defect (Egl), sluggish movement (Slu), body morphology defects (Bmd), larval arrest (Lva), and embryonic lethality (Emb). Asterisk in (<bold>A</bold>) indicates an Egl animal that was devoured by internally hatched progeny, and the arrow indicates an adult animal with multiple defects (Egl, Slu and Bmd). <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref> shows the phenotype of another interactor, <italic>ceh-18</italic>, which is very different from <italic>ced-3</italic>, supporting distinct physiological relevance of the identified interactors. (<bold>C</bold>) <italic>ced-3(RNAi)</italic> significantly enhanced the frequency of <italic>ain-1(lf)</italic> phenotypes. Mean values ± SD for percent normal (p < 0.001, *compared to wt with mock RNAi, **compared to all others, Chi-square test comparing the distributions of phenotypes). Number of worms tested indicated above each bar (same for all figures). (<bold>D</bold>) Mean values ± SD of embryonic lethality (p < 0.05 **compared to all, Mann–Whitney test). (<bold>E</bold>) Enhancement of miRISC phenotypes by <italic>ced-3(lf)</italic> and <italic>ced-4(lf)</italic>. Mean values ± SD for percent normal (p < 0.0001, *compared to each of the relevant single mutants, Chi-square test comparing the distributions of phenotypes). Other <italic>ain-1</italic> and <italic>ced-3</italic> alleles (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2</xref>) and the <italic>ain-1</italic> interaction with <italic>egl-1</italic> (<xref ref-type="fig" rid="fig2s3">Figure 2—figure supplement 3</xref>) were also tested. (<bold>F</bold>) Rescue effects of expressing <italic>ain-1</italic> or <italic>ain-2</italic> in specific tissues (driven by tissue-specific promoters for the four principal tissues of <italic>C. elegans</italic> including the hypodermis, gut, muscle, and nerve; see ‘Materials and methods’) in the <italic>ced-3(lf);ain-1(lf)</italic> double mutants. ‘All tissues’ indicates a genomic <italic>ain-1</italic> transgene. Mean values ± SD for percent normal [p < 0.0001, Fisher's Exact test comparing the distribution of normal and abnormal animals for each rescue to <italic>ced-3(lf);ain-1(lf)</italic> without rescue (see ‘Materials and methods’ for statistical rationale)].</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.005">http://dx.doi.org/10.7554/eLife.04265.005</ext-link></p><p><supplementary-material id="SD1-data"><object-id pub-id-type="doi">10.7554/eLife.04265.006</object-id><label>Figure 2—source data 1.</label><caption><title>Source data quantifying genetic interactions between the miRISC and cell death pathways.</title><p>(<bold>A</bold>) Source data for <xref ref-type="fig" rid="fig2">Figure 2C</xref>, (<bold>B</bold>) Source data for <xref ref-type="fig" rid="fig2">Figure 2D</xref>, (<bold>C</bold>) Source data for <xref ref-type="fig" rid="fig2">Figure 2E</xref>, (<bold>D</bold>) Source data for <xref ref-type="fig" rid="fig2">Figure 2F</xref>, (<bold>E</bold>) Source data for <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1B</xref>, (<bold>F</bold>) Source data for <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2A</xref>, (<bold>G</bold>) Source data for <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2B</xref>, (<bold>H</bold>) Source data for <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2C</xref>, (<bold>I</bold>) Source data for <xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2D</xref>, (<bold>J</bold>) Source data for <xref ref-type="fig" rid="fig2s3">Figure 2—figure supplement 3B</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.006">http://dx.doi.org/10.7554/eLife.04265.006</ext-link></p></caption><media xlink:href="elife04265s001.xlsx" mimetype="application" mime-subtype="xlsx"/></supplementary-material></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265f002"/></fig><fig id="fig2s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.007</object-id><label>Figure 2—figure supplement 1.</label><caption><title><italic>ain-1(lf);ceh-18(lf)</italic> double mutants have reduced oocytes.</title><p>DIC images of gonads from single and double mutant animals. (<bold>A</bold>) Arrows indicate the farthest point for the gonad turn. Asterisks are located near the first identifiable oocyte in the given gonad arm. The expanded segment is a digital zoom-in to show the morphological detail of the double mutant gonad for the indicated segment. (<bold>B</bold>) Dot plot of the oocyte counts per gonad arm (n = 40 for each strain). Each dot represents the number of oocytes in one gonad arm and the median values are given by black bars for each strain (p < 0.001, *compared to <italic>ain-1(lf)</italic> and **compared to both <italic>ain-1(lf)</italic> and <italic>ceh-18</italic>(<italic>lf</italic>) alone, Mann–Whitney test). The distinct phenotypes observed amongst some of the genetic interactors, such as <italic>ced-3</italic> (shown in <xref ref-type="fig" rid="fig2">Figure 2</xref>) vs <italic>ceh-18</italic> suggest distinct physiological functions and argue against general sickness of the single mutants. This conclusion is also supported more broadly by the frequency of phenotypes observed (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1B</xref>) such that equal frequency is not observed across the various phenotypes.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.007">http://dx.doi.org/10.7554/eLife.04265.007</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs002"/></fig><fig id="fig2s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.008</object-id><label>Figure 2—figure supplement 2.</label><caption><title>Additional phenotypes of <italic>ced-3(lf);ain-1(lf)</italic> and test of other alleles.</title><p>(<bold>A</bold>) <italic>ain-1(lf)</italic> animals treated with <italic>ced-3(RNAi)</italic> have a significant increase in oocytes laid (p < 0.0001, *compared to wt mock, **compared to all others, Mann–Whitney test). (<bold>B</bold>) Developmental defects associated with <italic>ced-3(lf);ain-1(lf)</italic> double mutants were observed for other <italic>ain-1(lf)</italic> and <italic>ced-3(lf)</italic> alleles. Bar graph showing the synergistic effect between <italic>ain-1(tm3681)</italic> and two <italic>ced-3(lf)</italic> alleles on the egg-laying defective (Egl) phenotype. Animals were scored 5 days after eggs were placed on plates. The mean values are shown (**p < 0.001 compared to wt and each of the relevant single mutants, Fisher's exact test). (<bold>C</bold>) Phenotypes of adults scored at two time points after synchronized first stage larvae were placed on OP50 food. In panel (<bold>C</bold>), and elsewhere in the study, unless noted, the <italic>ain-1(ku322)</italic> and <italic>ced-3(n1286)</italic> alleles were used (**p < 0.001, relative to wt and single mutants, Fisher's exact test comparing the distribution of normal and abnormal animals). (<bold>D</bold>) The <italic>ced-3(lf);ain-2(lf)</italic> double mutant adults are phenotypically comparable to the <italic>ced-3(lf)</italic> single mutant adults in (<bold>C</bold>) at 96 hr on OP50 food following synchronization (p < 0.001, Chi-square analysis). For all panels: Slu, sluggish or immobile; Egl, egg-laying defective; Rup, ruptured through vulva. Number of worms tested is indicated above each bar.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.008">http://dx.doi.org/10.7554/eLife.04265.008</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs003"/></fig><fig id="fig2s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.009</object-id><label>Figure 2—figure supplement 3.</label><caption><title>The core apoptotic regulatory pathway acts in parallel to miRISC for normal development.</title><p>(<bold>A</bold>) Core apoptotic regulatory pathway with <italic>C. elegans</italic> gene names indicated (mammalian counterparts in parentheses). (<bold>B</bold>) The phenotypes observed for <italic>ced-3(lf);ain-1(lf)</italic> were observed when combining <italic>ain-1</italic>(<italic>lf</italic>) with RNAi of upstream components of the <italic>ced-3</italic> pathway. The <italic>ain-1</italic>(<italic>lf</italic>) single mutant shows enhanced defects when treated with <italic>ced-3</italic>, <italic>ced-4</italic>, or <italic>egl-1</italic> RNAi for two RNAi generations. Significance of phenotypes when wt and <italic>ain-1</italic>(<italic>lf</italic>) animals were fed the indicated RNAi was determined [**p < 0.001, relative to both <italic>ain-1</italic>(<italic>lf</italic>) fed mock RNAi and to wt fed the given RNAi, Fisher's exact test comparing the distributions of normal and abnormal animals (see ‘Materials and methods’ for statistical rationale)].</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.009">http://dx.doi.org/10.7554/eLife.04265.009</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs004"/></fig></fig-group></p><p>To better characterize these defects, we tested the interaction in specific tissues. Expressing either <italic>ain-1</italic> or <italic>ain-2</italic> in the intestine or hypodermis alone partially rescued the defects of the <italic>ced-3(lf);ain-1(lf)</italic> double mutant (<xref ref-type="fig" rid="fig2">Figure 2F</xref>). These findings suggest that these two tissues are the major sites for miRNA functions in this interaction and likely also CED-3 function given that <italic>ced-3</italic> acts cell autonomously (<xref ref-type="bibr" rid="bib70">Yuan and Horvitz, 1990</xref>). Expressing <italic>ced-3</italic> with strong tissue-specific promoters has been shown to kill those tissues, even in cells that do not normally die, due to the resulting high level of CED-3 accumulation (<xref ref-type="bibr" rid="bib55">Shaham and Horvitz, 1996</xref>; <xref ref-type="bibr" rid="bib23">Hengartner, 1997</xref>) thus preventing the reciprocal rescue experiments.</p></sec><sec id="s2-3"><title>Non-apoptotic functions of <italic>ced-3</italic> caspase in development</title><p>The <italic>ced-3</italic> caspase has been well-characterized for its role in apoptosis but not demonstrated to have a broad, non-apoptotic function in development (<xref ref-type="bibr" rid="bib69">Yuan et al., 1993</xref>; <xref ref-type="bibr" rid="bib67">Xue et al., 1996</xref>; <xref ref-type="bibr" rid="bib12">Conradt and Xue, 2005</xref>; <xref ref-type="bibr" rid="bib44">Peden et al., 2008</xref>). The fact that strong <italic>ced-3(lf)</italic> alleles cause robust defects in programmed cell death but not the developmental defects described above suggests that the functions of <italic>ced-3</italic> with miRISCs uncovered in our screen are non-apoptotic. To further address this question, we first used an assay previously shown to effectively identify apoptotic functions of genes, such as <italic>mcd-1</italic> encoding a zinc-finger containing protein, for which mutations caused subtle apoptotic defects alone, but significantly enhanced the cell death defect of a <italic>ced-3</italic> reduction-of-function allele (<italic>ced-3(rf)</italic>) (<xref ref-type="bibr" rid="bib47">Reddien et al., 2007</xref>) (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). We found that, in contrast to the positive control, <italic>mcd-1(lf)</italic>, the <italic>ain-1(lf)</italic> mutation did not enhance the apoptotic defect of <italic>ced-3(rf)</italic> animals as assayed by observing the perdurance of <italic>lin-11::GFP</italic> positive undead P9-11.aap cells (<xref ref-type="fig" rid="fig3">Figure 3A–B</xref>). Because <italic>nuc-1</italic> encodes an effector nuclease important for the proper execution of apoptosis (<xref ref-type="bibr" rid="bib66">Wu et al., 2000</xref>), we then tested if the <italic>ain-1(lf)</italic> mutation was able to enhance any subtle <italic>nuc-1(lf)</italic> phenotype and found no significant defect beyond the phenotypes of the single mutants (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). Finally, <italic>ain-1(RNAi)</italic> did not affect the number of apoptotic cell corpses accumulating in the heads of <italic>ced-1(lf)</italic> first stage larvae (<xref ref-type="fig" rid="fig3">Figure 3D</xref>), which are defective in cell corpse engulfment allowing for visualization of dead cell corpses. Therefore, the <italic>ain-1</italic> and <italic>ced-3</italic> interaction described above is non-apoptotic.<fig id="fig3" position="float"><object-id pub-id-type="doi">10.7554/eLife.04265.010</object-id><label>Figure 3.</label><caption><title><italic>ain-1(lf)</italic> does not alter cell-death phenotypes.</title><p>(<bold>A</bold>) Cartoon illustrating a previously established enhancer assay using a reduction-of-function (<italic>rf</italic>) <italic>ced-3</italic> allele (<xref ref-type="bibr" rid="bib47">Reddien et al., 2007</xref>). (<bold>B</bold>) <italic>ain-1(lf)</italic> does not enhance the cell death defect of a <italic>ced-3(rf)</italic> mutation (p < 0.0001, *compared to <italic>ced-3(rf)</italic>, Mann–Whitney test). (<bold>C</bold>) No enhanced interaction between <italic>ain-1(lf)</italic> and <italic>nuc-1(lf)</italic>. Mean values ± SD (no significant difference, Fisher's Exact test comparing the distributions of normal and abnormal animals of the <italic>ain-1(lf);nuc-1(lf)</italic> double mutant to the single mutants). (<bold>D</bold>) <italic>ain-1(RNAi)</italic> does not alter apoptotic events as indicated by L1 head corpses that fail to occur in <italic>ced-3(lf)</italic> mutants. The <italic>ced-1(lf)</italic> mutation was used to enhance visualization of head corpses (<xref ref-type="bibr" rid="bib33">Ledwich et al., 2000</xref>). Mean values ± SD (no significant difference, Mann–Whitney test).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.010">http://dx.doi.org/10.7554/eLife.04265.010</ext-link></p><p><supplementary-material id="SD2-data"><object-id pub-id-type="doi">10.7554/eLife.04265.011</object-id><label>Figure 3—source data 1.</label><caption><title>Source data quantifying apoptotic assays.</title><p>(<bold>A</bold>) Source data for <xref ref-type="fig" rid="fig3">Figure 3B</xref>, (<bold>B</bold>) Source data for <xref ref-type="fig" rid="fig3">Figure 3C</xref>, (<bold>C</bold>) Source data for <xref ref-type="fig" rid="fig3">Figure 3D</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.011">http://dx.doi.org/10.7554/eLife.04265.011</ext-link></p></caption><media xlink:href="elife04265s002.xlsx" mimetype="application" mime-subtype="xlsx"/></supplementary-material></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265f003"/></fig></p></sec><sec id="s2-4"><title>Function of <italic>ced-3</italic> caspase in temporal cell fate patterning</title><p>Further analysis indicated that the <italic>ced-3(lf)</italic> and <italic>ced-4(lf)</italic> single mutants have mild reduction in their rates of post-embryonic growth similar to the <italic>ain-1(lf)</italic> and <italic>alg-1(lf)</italic> mutants (<xref ref-type="fig" rid="fig4">Figure 4A–C</xref> and also <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref> for more <italic>ced-3(lf)</italic> data). Additionally, the <italic>ced-3(lf);ain-1(lf)</italic> and <italic>ced-3(lf);alg-1(lf)</italic> double mutants, but not <italic>ced-3(lf);ain-2(lf),</italic> have significantly slower growth rates beyond either single mutant (<xref ref-type="fig" rid="fig4">Figure 4A–C</xref> and <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>), suggesting cooperativity in regulating the related developmental programs.<fig-group><fig id="fig4" position="float"><object-id pub-id-type="doi">10.7554/eLife.04265.012</object-id><label>Figure 4.</label><caption><title>Loss of <italic>ced-3</italic> function slows the rate of post-embryonic development.</title><p>(<bold>A</bold>) Percent of animals reaching adulthood at 96 hr after hatching is shown. Mean ± SD (p < 0.0001, *compared to wt, **compared to the relevant single mutants, Fisher's Exact test comparing the distributions of adult to larval-stage animals at this time). (<bold>B</bold> and <bold>C</bold>) Distribution of stages at 48 hr and 72 hr with food (p < 0.0001, *compared to wt, **compared to the relevant single mutants, Chi-square test comparing the distributions of all stages). Also see <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.012">http://dx.doi.org/10.7554/eLife.04265.012</ext-link></p><p><supplementary-material id="SD3-data"><object-id pub-id-type="doi">10.7554/eLife.04265.013</object-id><label>Figure 4—source data 1.</label><caption><title>Source data quantifying post-embryonic growth rates.</title><p>(<bold>A</bold>) Source data for <xref ref-type="fig" rid="fig4">Figure 4A</xref>, (<bold>B</bold>) Source data for <xref ref-type="fig" rid="fig4">Figure 4B</xref>, (<bold>C</bold>) Source data for <xref ref-type="fig" rid="fig4">Figure 4C</xref>, (<bold>D</bold>) Source data for <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1A</xref>, (<bold>E</bold>) Source data for <xref ref-type="fig" rid="fig4s1">Figure 4—figure supplement 1B</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.013">http://dx.doi.org/10.7554/eLife.04265.013</ext-link></p></caption><media xlink:href="elife04265s003.xlsx" mimetype="application" mime-subtype="xlsx"/></supplementary-material></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265f004"/></fig><fig id="fig4s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.014</object-id><label>Figure 4—figure supplement 1.</label><caption><title><italic>ced-3(lf)</italic> mutants displayed a mild but significant reduction in the rate of post-embryonic development.</title><p>(<bold>A</bold> and <bold>B</bold>) Animals were synchronized 36 hr in M9 buffer at 20°C then placed on standard bacteria food (OP50) and staged every 24 hr thereafter. Data for 24 and 96 hr are shown here and data for 48 and 72 hr are shown in <xref ref-type="fig" rid="fig4">Figure 4B–C</xref>. The distribution of animals from first larval stage (L1) through young adult/adult (indicated as YA+) is shown (p < 0.0001, *compared to wt, Chi-square analysis comparing the distributions of stages). Number of worms indicated above each set.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.014">http://dx.doi.org/10.7554/eLife.04265.014</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs005"/></fig></fig-group></p><p>To interrogate the genetic interaction further, we screened all of the available <italic>C. elegans</italic> miRNA deletion strains in the blind (<xref ref-type="fig" rid="fig5">Figure 5A</xref>, strains listed in <xref ref-type="supplementary-material" rid="SD11-data">Supplementary file 4</xref>) for synthetic interactions with <italic>ced-3</italic> by depleting <italic>ced-3</italic> in each miRNA mutant background by RNA interference. After finding pronounced RNAi effects associated with several miRNA deletions, we then generated double or triple mutants containing <italic>ced-3(lf)</italic> and the miRNA mutations, and observed phenotypes similar to those seen in <italic>ced-3(lf);ain-1(lf)</italic> (<xref ref-type="fig" rid="fig5">Figure 5B</xref>, and refer to <xref ref-type="fig" rid="fig2">Figure 2A–E</xref>) Specifically, mutations in the <italic>let-7-</italic>family members, <italic>mir-48</italic> and <italic>mir-84</italic>, had the strongest effect with a fully penetrant egg-laying defect observed in the <italic>ced-3(lf);mir-48(lf);mir-84(lf)</italic> triple mutant (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). Interestingly, the <italic>ced-3(lf);mir-1(lf);mir-84(lf)</italic> triple mutant displayed some developmental defects not seen in the <italic>mir-1(lf);mir-84(lf)</italic>, <italic>ced-3(lf);mir-1(lf),</italic> or the <italic>ced-3(lf);mir-84(lf)</italic> double mutants (<xref ref-type="fig" rid="fig5">Figure 5B</xref>). Since <italic>ced-3(lf)</italic> had the strongest developmental defects with the <italic>let-7-</italic>family members, and since both <italic>lin-14</italic> and <italic>lin-28</italic> mRNAs are well-known targets of the <italic>let-7-</italic>family of miRNAs, we thus tested the possibility that <italic>ced-3(lf)</italic> may enhance specific temporal cell fate patterning defects of these miRNA mutants by examining their adult alae. Normal adult-specific alae are generated by seam cells and defects in adult alae formation are commonly used as a sensitive assay for defects in temporal cell fate patterning (<xref ref-type="bibr" rid="bib6">Ambros and Horvitz, 1984</xref>). We found that <italic>ced-3(lf)</italic> significantly enhanced adult alae defects (<xref ref-type="fig" rid="fig5">Figure 5C,D</xref>). This effect was observed for both the <italic>miR-48(lf),miR-84(lf);ced-3(lf)</italic> triple mutant and the <italic>ced-3(lf);ain-1(lf)</italic> double mutant, but not the <italic>ced-3(lf);mir-1(lf);mir-84(lf)</italic> triple mutant (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). These findings suggested the hypothesis that the expression of some developmental timing regulators is co-regulated by miRISCs and <italic>ced-3</italic>.<fig id="fig5" position="float"><object-id pub-id-type="doi">10.7554/eLife.04265.015</object-id><label>Figure 5.</label><caption><title>Identification of specific miRNAs that cooperate with <italic>ced-3</italic> caspase to regulate development.</title><p>(<bold>A</bold>) Diagram for screening miRNA deletion mutants (listed in <xref ref-type="supplementary-material" rid="SD11-data">Supplementary file 4</xref>) when fed mock or <italic>ced-3</italic> RNAi to identify overt developmental phenotypes when <italic>ced-3</italic> was depleted. <italic>let-7(lf)</italic> and <italic>lin-4(lf)</italic> mutants were excluded due to significant defects alone. (<bold>B</bold>) miRNA deletion(s) [indicated by the miR number(s)] identified in (<bold>A</bold>) were combined with <italic>ced-3(lf)</italic>. ‘+’ and ‘−’ indicate wild-type and <italic>ced-3(null)</italic>, respectively. Phenotypes including egg-laying defect (Egl), ruptured vulva (Rup), and sluggish movement (Slu) were quantified. Mean values ± SD for percent normal (p < 0.05, *when compared to <italic>ced-3(lf)</italic> and the relevant miRNA deletion(s) alone, Fisher's Exact test comparing the distributions of normal and abnormal animals). (<bold>C</bold> and <bold>D</bold>) <italic>ced-3(lf)</italic> enhances adult-specific alae defects including low quality (thin and rough) and gapped alae [bracket in (<bold>C</bold>) near the mid-body shows a gap]. Percent of adults with alae defects (p < 0.001, *compared to the relevant single or double mutants, Chi-square test comparing the distributions of adult alae phenotypes).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.015">http://dx.doi.org/10.7554/eLife.04265.015</ext-link></p><p><supplementary-material id="SD4-data"><object-id pub-id-type="doi">10.7554/eLife.04265.016</object-id><label>Figure 5—source data 1.</label><caption><title>Source data quantifying genetic interactions between miRNA mutants and <italic>ced-3</italic>.</title><p>(<bold>A</bold>) Source data for <xref ref-type="fig" rid="fig5">Figure 5B</xref>, (<bold>B</bold>) Source data for <xref ref-type="fig" rid="fig5">Figure 5D</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.016">http://dx.doi.org/10.7554/eLife.04265.016</ext-link></p></caption><media xlink:href="elife04265s004.xlsx" mimetype="application" mime-subtype="xlsx"/></supplementary-material></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265f005"/></fig></p></sec><sec id="s2-5"><title>Negative regulation of the pluripotency factors <italic>lin-14, lin-28,</italic> and <italic>disl-2</italic> by <italic>ced-3</italic></title><p>To better analyze the mechanism underlying this non-apoptotic temporal cell fate patterning function of <italic>ced-3</italic>, we tested its effect on seam cell development. The division and differentiation pattern of the stem cell-like seam cells are regulated by a well-described genetic pathway that includes several miRNAs and the LIN-28 pluripotency factor that blocks the maturation of pre-<italic>let-7</italic> miRNA (<xref ref-type="bibr" rid="bib65">Viswanathan and Daley, 2010</xref>). During each larval stage, lateral seam cells (V1–V4 and V6) divide in an asymmetric, stem-cell like manner with additional stems cells only produced in the L2 stage by an additional symmetric division pattern that duplicates V1–V4 and V6 seam cell numbers (<xref ref-type="bibr" rid="bib58">Sulston and Horvitz, 1977</xref>; <xref ref-type="bibr" rid="bib6">Ambros and Horvitz, 1984</xref>). Wild-type animals consistently have 16 seam cells on both the left and right sides by adulthood (<xref ref-type="bibr" rid="bib27">Joshi et al., 2010</xref>). The dynamic changes in the expression levels of several conserved pluripotency factors are critical for proper temporal cell fate patterning. LIN-14 is highly expressed during L1 to promote L1-specific developmental programs, whereas LIN-28 is highly expressed from late embryonic to L2 stages and acts to promote the L2-specific programs including the only normal symmetric division of V1–V4 and V6 seam cells (<xref ref-type="bibr" rid="bib6">Ambros and Horvitz, 1984</xref>; <xref ref-type="bibr" rid="bib3">Ambros, 1989</xref>; <xref ref-type="bibr" rid="bib52">Ruvkun and Giusto, 1989</xref>; <xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>; <xref ref-type="bibr" rid="bib50">Rougvie and Moss, 2013</xref>) (Diagrammed in <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2A</xref>). Expression of LIN-14 and LIN-28 rapidly diminishes after L1 and L2, respectively, which is necessary for animals to progress to the next stage (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2A</xref>). Loss-of-function (<italic>lf</italic>) mutations in <italic>lin-14</italic> and <italic>lin-28</italic> result in animals skipping the L1- and L2-specific programs, respectively (precocious phenotype) (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2A</xref>). In contrast, hyperactive (gain-of-function, <italic>gf</italic>) mutations leading to prolonged expression of each gene cause the animals to reiterate the corresponding stage (retarded phenotype) (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2A</xref>). Because of the additional symmetric cell division of V1–V4 and V6 seam cells in L2, skipping or reiterating the L2 stage in <italic>lin-28(lf)</italic> or <italic>lin-28(gf)</italic> mutations lead to a decrease or increase of total seam cell number, respectively (<xref ref-type="bibr" rid="bib6">Ambros and Horvitz, 1984</xref>; <xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>) and diagrammed in <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2A</xref>. Mammalian DIS3L2 was recently annotated as the ribonuclease that degrades the uridylated pre-<italic>let-7</italic> miRNA following binding by LIN-28 and 3′-oligo-uridylation by a polyU polymerase (<xref ref-type="bibr" rid="bib10">Chang et al., 2013</xref>). We identified the likely <italic>C. elegans</italic> ortholog of Dis3l2 and named it <italic>disl-2</italic> (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). The effects for <italic>disl-2</italic> on seam cell development have not been determined.</p><p>As previously published (<xref ref-type="bibr" rid="bib15">Ding et al., 2005</xref>; <xref ref-type="bibr" rid="bib71">Zhang et al., 2007</xref>), we also found that the <italic>ain-1(lf)</italic> mutant alone has a mild increase in the number of seam cells by late larval development (<xref ref-type="fig" rid="fig6">Figure 6A,B</xref> and <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2</xref>) consistent with the well-established role of miRNAs in regulation of temporal cell fate patterning; whereas the <italic>ced-3(lf)</italic> mutant alone rarely shows altered seam cell numbers (<xref ref-type="fig" rid="fig6">Figure 6A,B</xref> and <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2</xref>). Strikingly, the <italic>ced-3(lf);ain-1(lf)</italic> double mutants have both a markedly increased number of seam cells and an increased range of seam cell number by late larval development (<xref ref-type="fig" rid="fig6">Figure 6A,B</xref>) with a mean value (±SD) of 25.9 (±5.5) per side. Notably, the <italic>ced-3(lf);ain-1(lf)</italic> double mutants hatch with the correct number of seam cells but they continue to increase inappropriately throughout later larval development (<xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2A,B</xref>). The production of supernumerary seam cells indicates a previously unknown role for <italic>ced-3</italic> in cooperating with miRISC-regulated seam cell differentiation and temporal cell fate patterning (<xref ref-type="fig" rid="fig6">Figure 6A,B</xref> and <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2C</xref>).<fig-group><fig id="fig6" position="float"><object-id pub-id-type="doi">10.7554/eLife.04265.017</object-id><label>Figure 6.</label><caption><title><italic>ced-3</italic> may act upstream of multiple conserved pluripotent factors to affect differentiation of stem cell-like seam cells.</title><p>(<bold>A</bold> and <bold>B</bold>) Pseudocolored GFP from DIC images of a seam cell reporter and dot plot quantitation. The tick line depicts 16 seam cells that are normally found in wild-type animals. Black bars indicate the median values for each strain (p < 0.0001, *compared to wt, **compared to single mutants, Mann–Whitney test). (<bold>C</bold>) Effect of RNAi treatment beginning at L2 on the seam-cell-number phenotype of the <italic>ced-3(lf);ain-1(lf)</italic> double mutant (p < 0.0001, *compared to mock RNAi, Mann–Whitney test). <italic>C. elegans disl-2</italic> is homologous to mammalian Dis3l2 (<xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). (<bold>D</bold>) Effect of the same RNAi on the <italic>ced-3(lf);ain-1(lf)</italic> double mutant defects. Mean values ± SD for percent normal [p < 0.0001, *compared to mock RNAi, Fisher's Exact test comparing the distributions of normal and abnormal animals (see ‘Materials and methods’ for statistical rationale)].</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.017">http://dx.doi.org/10.7554/eLife.04265.017</ext-link></p><p><supplementary-material id="SD5-data"><object-id pub-id-type="doi">10.7554/eLife.04265.018</object-id><label>Figure 6—source data 1.</label><caption><title>Source data quantifying temporal cell fate patterning and other phenotypes.</title><p>(<bold>A</bold>) Source data for <xref ref-type="fig" rid="fig6">Figure 6B</xref>, (<bold>B</bold>) Source data for <xref ref-type="fig" rid="fig6">Figure 6C</xref>, (<bold>C</bold>) Source data for <xref ref-type="fig" rid="fig6">Figure 6D</xref>, (<bold>D</bold>) Source data for <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2B</xref>, (<bold>E</bold>) Source data for <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2C</xref>, (<bold>F</bold>) Source data for <xref ref-type="fig" rid="fig6s3">Figure 6—figure supplement 3B</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.018">http://dx.doi.org/10.7554/eLife.04265.018</ext-link></p></caption><media xlink:href="elife04265s005.xlsx" mimetype="application" mime-subtype="xlsx"/></supplementary-material></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265f006"/></fig><fig id="fig6s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.019</object-id><label>Figure 6—figure supplement 1.</label><caption><title>Protein sequence alignment of human DIS3L2 and <italic>C. elegans</italic> DISL-2.</title><p>Domain prediction and sequence alignment of the mammalian DIS3L2 protein with the <italic>C. elegans</italic> DISL-2 protein. Domain prediction was done by Interpro (<xref ref-type="bibr" rid="bib25">Hunter et al., 2012</xref>) and Pfam (<xref ref-type="bibr" rid="bib46">Punta et al., 2012</xref>), and the alignment was done using Clustal W (<xref ref-type="bibr" rid="bib32">Larkin et al., 2007</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.019">http://dx.doi.org/10.7554/eLife.04265.019</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs006"/></fig><fig id="fig6s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.020</object-id><label>Figure 6—figure supplement 2.</label><caption><title>Additional analyses of seam cells for the <italic>ced-3(lf);ain-1(lf)</italic> double mutant.</title><p>(<bold>A</bold>) Diagram depicting the symmetric and asymmetric cell divisions of V1–V4 and V6 lineages (based on content detailed in a recent review [<xref ref-type="bibr" rid="bib50">Rougvie and Moss, 2013</xref>]). One cell is shown beginning at L1 (red). In wt, the L2 stage has a symmetric division followed by asymmetric divisions thereafter. The <italic>lin-28(lf)</italic> mutation generates a precocious phenotype without the L2-specific symmetric division; whereas, the <italic>lin-28(gf)</italic> mutation generates a retarded phenotype with further L2-like reiterations. Thus, a normal animal hatches with 10 seam cells that result in 16 terminally differentiated seam cells by adulthood. (<bold>B</bold>) The <italic>ced-3(lf);ain-1(lf)</italic> double mutant animals hatch with the correct number of seam cells which continue to develop during late larval stages. 10 seam cells are observed for all strains with no significant differences observed. Black bars indicate the median values for each strain (p > 0.05, Mann–Whitney test, all single and double mutants compared to wild-type). (<bold>C</bold>) Quantitation of third and fourth larval stages of the <italic>ced-3(lf);ain-1(lf)</italic> double mutant animals suggests supernumerary seam cells continue to arise during late larval stages. Black bars indicate the median values for each strain (p = 0.008, *compared to L3 stage <italic>ced-3(lf);ain-1(lf)</italic>, Mann–Whitney test). The data shown for the L4 animals in panel (<bold>B</bold>) here are unique from the main <xref ref-type="fig" rid="fig6">Figure 6B</xref> and are not repeated.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.020">http://dx.doi.org/10.7554/eLife.04265.020</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs007"/></fig><fig id="fig6s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.021</object-id><label>Figure 6—figure supplement 3.</label><caption><title><italic>ced-3(lf)</italic> mutants enhance <italic>lin-66(RNAi)</italic> ruptured vulva phenotype.</title><p><italic>lin-66</italic> was previously shown to limit the expression of LIN-28 by an incompletely understood mechanism (<xref ref-type="bibr" rid="bib37">Morita and Han, 2006</xref>). We therefore tested if loss of <italic>ced-3</italic> could enhance the vulva defect in <italic>lin-66(RNAi)</italic>. (<bold>A</bold>) Images and (<bold>B</bold>) bar graph showing that <italic>lin-66(RNAi)</italic> increases the frequency of ruptured vulva of both <italic>ced-3(lf)</italic> and <italic>ain-1(lf)</italic> mutants. L2 stage animals were fed either mock or <italic>lin-66(RNAi)</italic> and the subsequent generation was scored for ruptured vulva (Rup) at adulthood (multiple ruptured animals are indicated by arrows). RNAi was used due to the fourth larval stage lethality of the <italic>lin-66(lf)</italic> alleles. <italic>ain-1</italic> in miRISC is already known to negatively regulate LIN-28 expression and its enhancer phenotype here with <italic>lin-66(RNAi)</italic> serves as a positive control. The percent mean values are shown (number of worms indicated above each bar, **p < 0.001, Chi-square analysis).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.021">http://dx.doi.org/10.7554/eLife.04265.021</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs008"/></fig></fig-group></p><p>We found that the increased number of seam cells in the <italic>ced-3(lf);ain-1(lf)</italic> double mutants was partially suppressed by down-regulating <italic>lin-14, lin-28,</italic> or <italic>disl-2(Dis3l2)</italic> through RNAi treatment beginning at L2 (<xref ref-type="fig" rid="fig6">Figure 6C</xref>), suggesting that an abnormally high level of any of the three proteins could be a significant contributor to the phenotype. A <italic>lin-14(lf)</italic> or <italic>lin-28(lf)</italic> mutation would not be effective for such a suppression test because of the strong defects associated with them at the early larval stage (<xref ref-type="bibr" rid="bib50">Rougvie and Moss, 2013</xref>). LIN-66 was previously shown to act in parallel to miRNAs to repress LIN-28 expression (<xref ref-type="bibr" rid="bib37">Morita and Han, 2006</xref>). Consistent with a <italic>ced-3</italic> function in <italic>lin-28</italic>-mediated temporal cell fate patterning regulation, we also observed that <italic>ced-3(lf)</italic> enhanced the heterochronic defect of <italic>lin-66</italic> reduction (<xref ref-type="fig" rid="fig6s3">Figure 6—figure supplement 3</xref>). We further found that down-regulation of <italic>lin-14, lin-28</italic>, or <italic>disl-2(Dis3l2)</italic> by RNAi beginning at L2 could significantly suppress the defects in the <italic>ced-3(lf);ain-1(lf)</italic> double mutants (<xref ref-type="fig" rid="fig6">Figure 6D</xref>). These findings suggest that <italic>ced-3</italic> cooperates with miRNAs to regulate the <italic>lin-14-lin-28</italic>-<italic>disl-2(Dis3l2)</italic> axis during development.</p></sec><sec id="s2-6"><title>Cleavage of LIN-14, LIN-28, and DISL-2 in vitro by CED-3</title><p>The above genetic data suggest that <italic>ced-3</italic> normally represses <italic>lin-28</italic>, <italic>disl-2</italic>, and/or <italic>lin-14</italic> in development. As a caspase, we thought that CED-3 may directly repress the expression of these genes through proteolytic cleavage, which is consistent with our observation that LIN-14, LIN-28, and DISL-2 contain multiple consensus CED-3 cleavage sites that consist of a tetra-peptide sequence usually ending in an aspartic acid residue (<xref ref-type="bibr" rid="bib67">Xue et al., 1996</xref>). To test this hypothesis, we performed an in vitro CED-3 cleavage assay as previously described (<xref ref-type="bibr" rid="bib67">Xue et al., 1996</xref>). We found that the DIS3L2 ribonuclease homolog, DISL-2, was robustly cleaved by the CED-3 caspase while LIN-14 and LIN-28 were partially cleaved (<xref ref-type="fig" rid="fig7">Figure 7A</xref>). The multiple cleavage products generated by CED-3 cleavage of DISL-2 (<xref ref-type="fig" rid="fig7">Figure 7A,B</xref>) suggest a clear role for CED-3-mediated inactivation of this target protein. We further tested the specificity of the partial LIN-28 cleavage by CED-3 and found that it was completely blocked by addition of the caspase-specific-inhibitor zDEVD-fmk (<xref ref-type="fig" rid="fig7">Figure 7C</xref>). We then determined the proteolytic cleavage site for LIN-28 by mutagenesis and identified the CED-3-specific recognition sequence (<xref ref-type="fig" rid="fig7">Figure 7D</xref> and <xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). Numerous possible cleavage sites were found for LIN-14 and DISL-2 but were not pursued further (<xref ref-type="fig" rid="fig7s2">Figure 7—figure supplement 2</xref>). The identified sequence DVVD fits the canonical CED-3 recognition motif (DxxD) (<xref ref-type="bibr" rid="bib67">Xue et al., 1996</xref>) and mutating the second aspartic acid residue to an alanine (D31A in <xref ref-type="fig" rid="fig7">Figure 7D</xref>) entirely eliminated CED-3 cleavage. CED-3 proteolysis of LIN-28A generates an N-terminal asparagine in the remaining protein (<xref ref-type="fig" rid="fig7">Figure 7E</xref>). Asparagine is known to function generally as a destabilizing residue at the N-terminus of eukaryotic proteins resulting in proteasomal degradation in a phenomenon termed the N-end rule (<xref ref-type="bibr" rid="bib57">Sriram et al., 2011</xref>).<fig-group><fig id="fig7" position="float"><object-id pub-id-type="doi">10.7554/eLife.04265.022</object-id><label>Figure 7.</label><caption><title>CED-3 cleavage of LIN-14, LIN-28, and DISL-2 (DIS3L2) in vitro.</title><p>(<bold>A</bold>) Established in vitro CED-3 cleavage assay (<xref ref-type="bibr" rid="bib67">Xue et al., 1996</xref>) of <sup>35</sup>S-labeled proteins. CED-9 served as a positive control throughout. Red asterisks indicate cleavage products (same in <bold>B</bold>–<bold>D</bold>). (<bold>B</bold>) Result from a longer-run gel showing near quantitative cleavage of full-length DISL-2 (arrow indicates the full-length protein). (<bold>C</bold>) In vitro cleavage assay with the zDEVD-fmk caspase-specific irreversible inhibitor (<xref ref-type="bibr" rid="bib49">Rickers et al., 1998</xref>). The arrow and arrowhead (and red asterisks) indicate the full-length protein and a predominant CED-3 cleavage product, respectively. (<bold>D</bold>) Effect of the D31A mutation on CED-3 cleavage (for other mutants see <xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). (<bold>E</bold>) Diagram showing the position and consequence of LIN-28A cleavage by CED-3 in vitro (22 kDa with an N-terminal asparagine). Each panel was performed as an independent experiment.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.022">http://dx.doi.org/10.7554/eLife.04265.022</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265f007"/></fig><fig id="fig7s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.023</object-id><label>Figure 7—figure supplement 1.</label><caption><title>Mutagenesis of LIN-28A to identify the CED-3 cleavage site.</title><p>Several possible cleavage sites exist in the <italic>C. elegans</italic> LIN-28A protein corresponding to the tetra-peptide D(E,N,G)xx<underline>D</underline>(E) cleavage sequence with the alternate residues indicated in parentheses and the proximal residue for cleavage underlined (aspartic acid in this position strongly favored) (<xref ref-type="bibr" rid="bib67">Xue et al., 1996</xref>). (<bold>A</bold>–<bold>B</bold>) Mutants were made for the second acidic residue in the tetra-peptide sequence for all such sites in the LIN-28A N-terminal region but only the DVVD to DVVA mutation (noted as D31A in panel <bold>B</bold> and <xref ref-type="fig" rid="fig7">Figure 7D</xref>) abolished CED-3 cleavage. Cleavage products are indicated by red asterisk. These experiments were run independently of those shown in <xref ref-type="fig" rid="fig7">Figure 7</xref> and thus constitute replicates for the mutant D31A cleavage assay.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.023">http://dx.doi.org/10.7554/eLife.04265.023</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs009"/></fig><fig id="fig7s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.024</object-id><label>Figure 7—figure supplement 2.</label><caption><title>Identification of possible CED-3 cleavage sites in LIN-14 and DISL-2.</title><p>Numerous possible CED-3 cleavage sites are found in LIN-14B and DISL-2 based on the consensus motif detailed in <xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref> (<xref ref-type="bibr" rid="bib67">Xue et al., 1996</xref>). (<bold>A</bold>–<bold>B</bold>) Potential CED-3 substrate tetrapeptides are shown in red font, some of which overlap. Closed triangles and open triangles indicate potential cleavage sites of high and moderate probability, respectively. The numbers in parentheses above the sequences indicate the proximal acidic residue. The LIN-14B isoform is shown in (<bold>A</bold>) since this is the isoform we cloned. However, all of the predicted cleavage sites shown here are also present in the LIN-14A isoform, which differs in the amino terminus prior to the first predicted site.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.024">http://dx.doi.org/10.7554/eLife.04265.024</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs010"/></fig></fig-group></p></sec><sec id="s2-7"><title>CED-3 impact on LIN-28 turnover in vivo</title><p>To examine CED-3-mediated turnover of the LIN-28 protein in vivo, we generated a polyclonal antibody against a C-terminal peptide in LIN-28 that recognizes both LIN-28 isoforms reported previously (<xref ref-type="bibr" rid="bib54">Seggerson et al., 2002</xref>) (<xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1A,B</xref>). We found that the dynamic decrease in LIN-28 abundance during L2–L4 stages was similarly delayed by two different <italic>ced-3(lf)</italic> mutations (<xref ref-type="fig" rid="fig8">Figure 8A</xref> and quantitation shown in <xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1C</xref>). At late L4 (48 hr in <xref ref-type="fig" rid="fig8">Figure 8A</xref>), LIN-28 was almost completely absent in both wild type and <italic>ced-3(lf)</italic> mutants, indicating the role of general, non-CED-3-mediated, proteolysis during late larval stages. Interestingly, the 22-kDa cleavage product observed in the in vitro assay (<xref ref-type="fig" rid="fig7">Figure 7D,E</xref>) was not observable in vivo (<xref ref-type="fig" rid="fig8">Figure 8A</xref>), consistent with the idea that the cleavage product with an asparagine at its N-terminus was possibly degraded by an additional proteolytic process. It is possible that the delayed down-regulation of LIN-28 seen in <xref ref-type="fig" rid="fig8">Figure 8A</xref> is the consequence of the slower post-embryonic growth rate observed for <italic>ced-3(lf)</italic> mutants (<xref ref-type="fig" rid="fig4">Figure 4</xref>). To address this question, we first used a LIN-28::GFP transgenic strain previously shown to have functional LIN-28 activity (<xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>) to monitor stage-matched L3 larvae with or without a <italic>ced-3(lf)</italic> mutation by DIC microscopy. We observed that the <italic>ced-3(lf)</italic> mutation delayed the proper down-regulation of the LIN-28::GFP reporter at L3 in the hypodermis (<xref ref-type="fig" rid="fig8">Figure 8B–D</xref> and <xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2A–C</xref>). We also found that down-regulation of LIN-28::GFP expression was delayed in neuronal cells in the head (<xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2D,E</xref>). These findings support the hypothesis for the delayed down-regulation of LIN-28 by <italic>ced-3(lf).</italic> The difference in magnitude between the Western blot results and the number of fluorescent cells seen by DIC microscopy may suggest that the observed fluorescence levels do not linearly reflect the protein levels and that the two methods may have different dynamic ranges.<fig-group><fig id="fig8" position="float"><object-id pub-id-type="doi">10.7554/eLife.04265.025</object-id><label>Figure 8.</label><caption><title>In vivo confirmation that CED-3 caspase negatively regulates LIN-28 expression in late larval stages.</title><p>(<bold>A</bold>) Western blot with the LIN-28 antibody we developed (validation shown in <xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1</xref>) to see the effects of <italic>ced-3(lf)</italic> mutations on LIN-28 protein expression during developmental transitions. Notice that the cleavage product of the larger isoform of LIN-28 observed in the in vitro assay (<xref ref-type="fig" rid="fig7">Figure 7</xref>) is not detectable in the in vivo analysis, suggesting that the cleavage product, which has an Asn instead of Met as the N-terminal end residue, may potentially be sensitive to the N-end rule proteasomal degradation pathway. The pattern and timing of LIN-28 expression and downregulation we show here for wt are similar to previous findings (<xref ref-type="bibr" rid="bib54">Seggerson et al., 2002</xref>; <xref ref-type="bibr" rid="bib37">Morita and Han, 2006</xref>) and two independent <italic>ced-3(lf)</italic> mutant strains are shown here (quantitation is shown in <xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1C</xref>). (<bold>B</bold>–<bold>C</bold>) Pseudocolored GFP from DIC images of L3 larvae near the mid-body. Also see DIC images of these same animals without GFP illumination (similar length gonads shown in <xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2A,B</xref>) and test of similar staging (<xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2C</xref>). Size bars are indicated. ‘<italic>wt’</italic> indicates the <italic>lin-28(+)::gfp</italic> integrated transgene alone previously shown to be functional (<xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>) and ‘<italic>ced-3(lf)</italic>’ indicates this same transgene combined with a <italic>ced-3(lf)</italic> mutation. (<bold>D</bold>) Quantitation of the LIN-28::GFP expression between the strains within the L3 stage. (p = 0.0038, significant compared to <italic>wt</italic>, Mann–Whitney test comparing the integrated intensity of LIN-28::GFP hypodermal expression in L3 larvae). Persistent expression of LIN-28::GFP in head cells (<xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2D,E</xref>).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.025">http://dx.doi.org/10.7554/eLife.04265.025</ext-link></p><p><supplementary-material id="SD6-data"><object-id pub-id-type="doi">10.7554/eLife.04265.026</object-id><label>Figure 8—source data 1.</label><caption><title>Source data quantifying effects of <italic>ced-3(lf)</italic> on LIN-28::GFP expression.</title><p>(<bold>A</bold>) Source data for <xref ref-type="fig" rid="fig8">Figure 8D</xref>, (<bold>B</bold>) Source data for <xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2C</xref>, (<bold>C</bold>) Source data for <xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2E</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.026">http://dx.doi.org/10.7554/eLife.04265.026</ext-link></p></caption><media xlink:href="elife04265s006.xlsx" mimetype="application" mime-subtype="xlsx"/></supplementary-material></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265f008"/></fig><fig id="fig8s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.027</object-id><label>Figure 8—figure supplement 1.</label><caption><title>Validation of our newly generated LIN-28 antibody and quantitation of Western blot data.</title><p>(<bold>A</bold>) Western blot to demonstrate the specificity of our peptide-purified rabbit-anti-<italic>C. elegans</italic> LIN-28 antibody. The peptide we chose to immunize the rabbits with is found near the C-terminus (reported in ‘Materials and methods’) and therefore should recognize both the a and b isoforms equally well. Equivalent amounts of extracts from mixed staged wt, <italic>lin-28(n719,lf)</italic>, and a strain with an integrated transgene of <italic>lin-28::GFP</italic> were resolved by SDS-PAGE then probed with our purified LIN-28 antibody. The <italic>Is[lin-28::gfp]</italic> strain shows both the endogenous forms of LIN-28 and the shifted fusion protein. (<bold>B</bold>) The large isoform of LIN-28 (corresponding to the a isoform) was synthesized in vitro then added at increasing amounts into the <italic>lin-28(n719,lf)</italic> strain to simulate a complex mixture for all other background proteins. Three exposures of the same gel are shown. Two predominant background bands from the in vitro lysate are indicated by dashed blue lines. LIN-28-specific bands (identified in panel <bold>A</bold>) are indicated. The <italic>lin-28(n719)</italic> + mock lane has as much in vitro lysate as the most +LIN-28a lane but with a mock vector to show lysate background. This background is not present in the worm extracts (compare the <italic>lin-28(n719)</italic> lane vs <italic>lin-28(n719)</italic> + mock). (<bold>C</bold>) Quantitation of Western blot data from <xref ref-type="fig" rid="fig8">Figure 8A</xref>. Arbitrarily, 100% was defined as the intensity of total LIN-28 at 0 hr normalized to actin for the wt strain. Both <italic>ced-3(lf)</italic> strains were set relative to the wt 0 hr. The subsequent time points for all strains were compared to this 0 hr value.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.027">http://dx.doi.org/10.7554/eLife.04265.027</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs011"/></fig><fig id="fig8s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.028</object-id><label>Figure 8—figure supplement 2.</label><caption><title>Larval staging and persistent LIN-28::GFP expression.</title><p>(<bold>A</bold>–<bold>C</bold>) Analysis of gonad length in LIN-28(+) transgenic lines with <italic>ced-3(wt)</italic> or <italic>ced-3(lf)</italic>. We first picked L3 stage animals in the blind on a non-fluorescent microscope. Prior to GFP illumination, we assessed the sub-stages of animals by measuring the gonad length of the animals. This was done since the animals had roller phenotype making P cell division difficult to observe and strong defects in LIN-28, directly, are known to have only minor effects on gonad development (<xref ref-type="bibr" rid="bib3a">Ambros, 1997</xref>). Thus, these strains should not be expected to have significant defects in gonad extension and gonad length should serve as a quantifiable metric of larval stage similar to previous reports (<xref ref-type="bibr" rid="bib6">Ambros and Horvitz, 1984</xref>; <xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>; <xref ref-type="bibr" rid="bib1">Abbott et al., 2005</xref>). The images shown here (<bold>A</bold>–<bold>B</bold>) are from the same animals shown in the main <xref ref-type="fig" rid="fig8">Figure 8B–C</xref>. The white bars indicate 20 μM. The white brackets indicate the gonads of equal length. (<bold>C</bold>) No significant difference in gonad length for the L3 samples was observed between the two strains suggesting similar sub-stage. Mean ± SD is shown (p > 0.05, Mann–Whitney test). (<bold>D</bold>–<bold>E</bold>) Pseudocolored GFP from DIC head images of L3 larvae and quantitation of the number of cells expressing LIN-28::GFP (p < 0.0001, *compared to wt;(+), Chi-square test comparing the distributions of L3 larvae based on the number of LIN-28::GFP positive cells). ‘+’ indicates the <italic>lin-28(+)::gfp</italic> integrated transgene previously shown to be functional (<xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>). This set of experiments was done completely independently of the ones shown in main <xref ref-type="fig" rid="fig8">Figure 8B–D</xref>. A similar method for selection of L3 animals in the blind on a non-fluorescent microscope was used. All animals were visualized for GFP positive cells through multiple focal planes of the head. All images were taken with identical exposure times, and all cells were counted by an individual who did not take the images.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.028">http://dx.doi.org/10.7554/eLife.04265.028</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs012"/></fig></fig-group></p><p>We then further addressed the question by testing the physiological impact of the <italic>lin-28(D31A)</italic> mutation. Specifically, we made the point mutation in the previously published <italic>lin-28(+)::gfp</italic> fusion protein (<xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>). To ensure that the LIN-28(D31A) mutation did not disrupt the global function of the protein, we tested its ability to overcome the highly penetrant protruding vulva (Pvl) phenotype in <italic>lin-28(n719,lf)</italic> animals and found that it was able to rescue the Pvl phenotype (<xref ref-type="fig" rid="fig9s1">Figure 9—figure supplement 1</xref>). Following integration and outcrossing, we found the copy number of the <italic>lin-28(D31A)::gfp</italic> transgene to be slightly lower than that of the non-mutated <italic>lin-28(+)::gfp</italic> transgene (<xref ref-type="fig" rid="fig9s2">Figure 9—figure supplement 2</xref>). We then examined the developmental profile and found that the <italic>lin-28(D31A)::gfp</italic> transgene alone caused a delay in larval development similar to that caused by the combination of the <italic>lin-28(+)::gfp</italic> transgene with <italic>ced-3(lf)</italic> (<xref ref-type="fig" rid="fig9">Figure 9A</xref>). Western blot analysis showed that the <italic>lin-28(D31A)::gfp</italic> integration had less basal expression than the non-mutated <italic>lin-28(+)::gfp</italic> integration, consistent with the lower copy number estimate. We observed a quantifiable difference in the down-regulation of the <italic>lin-28(D31A)::gfp</italic> transgene compared to the <italic>lin-28(+)::gfp</italic> transgene (<xref ref-type="fig" rid="fig9">Figure 9B,C</xref>). This finding provides evidence that a failure in CED-3 cleavage of LIN-28 leads to slower degradation of LIN-28 and is one of the causes of slower development, since the D31A point mutation alone resulted in both a slower growth rate (<xref ref-type="fig" rid="fig9">Figure 9A</xref>) and delayed LIN-28 down-regulation (<xref ref-type="fig" rid="fig9">Figure 9B,C</xref>). Additionally, in this Western blot (<xref ref-type="fig" rid="fig9">Figure 9B–C</xref>), down-regulation of the wild-type LIN-28 transgene in <italic>ced-3(lf)</italic> worms seems to be delayed more than LIN-28(D31A) in wild-type worms. Such a difference could be due to roles of CED-3 on other targets such as LIN-14 and DISL-2, which is also expected to contribute to the larval developmental defect in <italic>ced-3(lf)</italic> (<xref ref-type="fig" rid="fig9">Figure 9A</xref>).<fig-group><fig id="fig9" position="float"><object-id pub-id-type="doi">10.7554/eLife.04265.029</object-id><label>Figure 9.</label><caption><title>CED-3 caspase represses LIN-28 in vivo to ensure proper temporal cell fate patterning regulation.</title><p>(<bold>A</bold>) Effects of disrupting CED-3 activity on LIN-28 in vivo on the rate of post-embryonic growth. Percent of animals reaching adulthood at 96 hr after hatching is shown. ‘+’ indicates the <italic>lin-28(+)::gfp</italic> integrated transgene described in <xref ref-type="fig" rid="fig8">Figure 8B–C</xref>. D31A indicates a transgene integration with the CED-3-cleavage-resistant D31A point mutation in the first exon of LIN-28 but is otherwise identical to the original (+) transgene. Test of <italic>lin-28(lf)</italic> rescue (<xref ref-type="fig" rid="fig9s1">Figure 9—figure supplement 1</xref>) and copy number of the transgenes (<xref ref-type="fig" rid="fig9s2">Figure 9—figure supplement 2</xref>). Mean values ± SD (p < 0.0001, *compared to wt;(+), Fisher's Exact test comparing the distributions of adult to larval-stage animals at this time). (<bold>B</bold>–<bold>C</bold>) Western blot for the LIN-28::GFP transgenes described in (<bold>A</bold>) and quantitation from three independent Western blot experiments of the LIN-28::GFP transgenes [one Western blot shown in (<bold>B</bold>)]. Here, 1.0 was defined as the intensity of total LIN-28(D31A)::GFP at 0 hr normalized to actin. Both the <italic>lin-28(+)</italic> and the <italic>ced-3(lf);lin-28(+)</italic> strains and the 30 hr time point for all strains were compared to this value. Mean ± SEM for the two time points (dashed lines are used only to indicate the net change in relative expression for the three strains). (<bold>D</bold>) Disrupting CED-3 activity on LIN-28 enhances adult alae defects of the strains described in (<bold>A</bold>) (p < 0.01, *compared to wt;(+), Chi-square test comparing the distributions of adult alae phenotypes). <xref ref-type="fig" rid="fig9s3">Figure 9—figure supplement 3</xref> shows examples of the adult alae phenotypes for these three strains. Data for increased expression of LIN-14 in <italic>ced-3(lf)</italic> mutants at the first larval stage is shown in <xref ref-type="fig" rid="fig9s4">Figure 9—figure supplement 4</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.029">http://dx.doi.org/10.7554/eLife.04265.029</ext-link></p><p><supplementary-material id="SD7-data"><object-id pub-id-type="doi">10.7554/eLife.04265.030</object-id><label>Figure 9—source data 1.</label><caption><title>Source data quantifying effects of <italic>ced-3(lf)</italic> and LIN-28(D31A) mutation on protein levels and developmental phenotypes.</title><p>(<bold>A</bold>) Source data for <xref ref-type="fig" rid="fig9">Figure 9A</xref>, (<bold>B</bold>) Source data for <xref ref-type="fig" rid="fig9">Figure 9C</xref>, (<bold>C</bold>) Source data for <xref ref-type="fig" rid="fig9">Figure 9D</xref>, (<bold>D</bold>) Source data for <xref ref-type="fig" rid="fig9s1">Figure 9—figure supplement 1B</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.030">http://dx.doi.org/10.7554/eLife.04265.030</ext-link></p></caption><media xlink:href="elife04265s007.xlsx" mimetype="application" mime-subtype="xlsx"/></supplementary-material></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265f009"/></fig><fig id="fig9s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.031</object-id><label>Figure 9—figure supplement 1.</label><caption><title>Test for <italic>lin-28(D31A)</italic> function in overcoming the <italic>lin-28(n719,lf)</italic> protruding vulva defect.</title><p>The full name of the extrachromosomal array that we tested: <italic>Ex[lin-28(D31A)::gfp::lin-28 3′UTR; myo-3::mCherry; pBSIIKS(−)]</italic> where <italic>myo-3::mCherry</italic> served as the transgenic marker. (<bold>A</bold>) Myo-3::mCherry positive animals are rescued from the Pvl phenotype similar to the original <italic>lin-28(+)::gfp</italic> described previously (<xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>). The top panel shows two adults not carrying the array which displayed the protruding vulva (Pvl) and ruptured vulva (Rup) (arrows) phenotype, respectively. Three adults carrying the array are indicated in this same panel by an asterisk near their well-developed vulva (also <italic>myo-3::mCherry</italic> positive). The bottom two panels show magnified images of two different animals, one without array, and therefore Pvl, and one with the array, and therefore not Pvl. (<bold>B</bold>) The array-positive animals have a significant rescue compared to animals without the array (89% rescued on average, p < 0.0001, *when compared to animals without the array, Fisher's Exact test) showing that the D31A mutation does not alter the gross function of the protein. Rather, we conclude that the D31A mutation only abolishes the direct cleavage of LIN-28 as supported by our in vitro experiments (<xref ref-type="fig" rid="fig7">Figure 7</xref> and <xref ref-type="fig" rid="fig7s1">Figure 7—figure supplement 1</xref>). The offspring from parents bearing the rescue array may have some maternal effect with ∼10% of adults not carrying the array without Pvl but with severe egg-laying defect (also suggests a non-functional vulva) and the remaining 5% with apparently normal vulva.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.031">http://dx.doi.org/10.7554/eLife.04265.031</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs013"/></fig><fig id="fig9s2" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.032</object-id><label>Figure 9—figure supplement 2.</label><caption><title>Transgene copy number determination.</title><p>+ indicates the <italic>[lin-28(+)::gfp::lin-28 3′UTR; rol-6]</italic> integrated transgene which was previously published as functional (<xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>). D31A indicates the transgene integration we generated which contains the D31A point mutation in the first exon of LIN-28. Following integration, total DNA was used as input for qPCR to quantify the copy number. Mean ± SD is from two sets of <italic>lin-28</italic> primers normalized to two sets of unrelated endogenous genes (<italic>ain-1</italic> and <italic>hrp-1</italic>). These findings suggest low copy number integration for the two transgenes.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.032">http://dx.doi.org/10.7554/eLife.04265.032</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs014"/></fig><fig id="fig9s3" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.033</object-id><label>Figure 9—figure supplement 3.</label><caption><title>Loss of <italic>ced-3</italic> function or mutating the CED-3 cleavage site of LIN-28 enhances adult alae defects by a multi-copy <italic>lin-28</italic> transgene.</title><p>(<bold>A</bold>–<bold>D</bold>) Adult alae were scored using DIC optics (quantitation of findings is shown in <xref ref-type="fig" rid="fig9">Figure 9D</xref>). These images serve only as visual reference for the phenotypes scored. The strains are described in <xref ref-type="fig" rid="fig9s1 fig9s2">Figure 9—figure supplements 1–2</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.033">http://dx.doi.org/10.7554/eLife.04265.033</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs015"/></fig><fig id="fig9s4" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.034</object-id><label>Figure 9—figure supplement 4.</label><caption><title>LIN-14 protein levels are increased in <italic>ced-3(lf)</italic> mutants at the first larval stage.</title><p>An integrated transgenic strain <italic>Is[lin-14::gfp]</italic> previously published (<xref ref-type="bibr" rid="bib41">Olsson-Carter and Slack, 2010</xref>) was crossed with a <italic>ced-3(lf)</italic> mutation. Sibling offspring were isolated to obtain the <italic>Is[lin-14::gfp]</italic> (with wild-type <italic>ced-3</italic> gene) and the <italic>ced-3(lf);Is[lin-14::gfp]</italic>. Results from three independent Western blots of three independent synchronous first stage larvae are shown here. Samples were synchronized, collected, processed, probed by Western blot with an anti-GFP antibody (Clontech, Antibody JL8) independently at different times. Though the difference between wild-type and <italic>ced-3(lf)</italic> is subtle, it is repeatable. The subtle effects seen for LIN-14 are also of note since it is, in part, an upstream positive regulator of <italic>lin-28</italic>. Thus, subtle effects may be physiologically significant.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.034">http://dx.doi.org/10.7554/eLife.04265.034</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs016"/></fig></fig-group></p><p>Examination of adult-specific alae is a sensitive physiological readout that should overcome any limitations of monitoring delays in the down-regulation of LIN-28 expression levels since scoring adult alae ensures stage-matching and accounts for any perdurance. To further test the functional outcome of both the LIN-28(D31A) transgene and the LIN-28(+) transgene combined with <italic>ced-3(lf)</italic>, we examined the adult-specific alae and found significant defects including low quality and gapped alae (<xref ref-type="fig" rid="fig9">Figure 9D</xref> and <xref ref-type="fig" rid="fig9s3">Figure 9—figure supplement 3</xref>). This is consistent with the data described above that <italic>ced-3(lf)</italic> enhances adult-specific alae defect of let-7-family miRNA mutants and <italic>ain-1(lf)</italic> (<xref ref-type="fig" rid="fig5">Figure 5C–D</xref>). We should note that the original report of the LIN-28(+) transgene indicated that some of the adults were observed to have gapped alae (<xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>). Though we did observe rough and very thin sections of alae for this strain (scored as low quality alae), we did not observe any gapped adult alae. This subtle difference is likely explained by a different threshold since we scored alae using a sensitive camera (See ‘Materials and methods’). Nonetheless, the relative enhancement of <italic>ced-3(lf)</italic> with this transgene is quite obvious and similar to that of the caspase-cleavage resistant LIN-28(D31A) point mutant transgene (<xref ref-type="fig" rid="fig9">Figure 9D</xref>). Altogether, our data support a causal role for CED-3 cleavage of LIN-28 in the regulation of temporal cell fate patterning. CED-3 appears to facilitate the stereotypical transition of LIN-28 to enhance the robustness of the L2 to L3 developmental transition.</p><p>Consistent with LIN-14 being modestly cleaved by CED-3 in vitro (<xref ref-type="fig" rid="fig7">Figure 7A</xref>), we found that the LIN-14::GFP level was modestly increased in <italic>ced-3(lf)</italic> mutants in vivo at the L1 stage (<xref ref-type="fig" rid="fig9s4">Figure 9—figure supplement 4</xref>). This result may not be explained by slower growth rate since these animals were obtained as synchronous L1s without food. Our attempts to monitor DISL-2 protein levels including developing an antibody to endogenous DISL-2 were impeded by technical difficulties. Moreover, N- and C-terminal GFP fusions to DISL-2 had exceedingly low levels of expression beyond detection by common methods suggesting that DISL-2 protein levels are kept exquisitely low for physiological significance.</p><p>Therefore, our in vitro and in vivo data show that developmental timing regulators are proteolytic targets of the CED-3 caspase, likely resulting in their inactivation. This role of CED-3 cleavage is in contrast to known apoptotic functions of CED-3 caspase activity in two major aspects: CED-3 inactivates its targets rather than activates them as in its apoptotic function (<xref ref-type="bibr" rid="bib12">Conradt and Xue, 2005</xref>); and it acts with other regulatory systems, including miRNAs and possibly the N-end rule proteasomal system, to maintain robust developmental functions.</p></sec></sec><sec sec-type="discussion" id="s3"><title>Discussion</title><sec id="s3-1"><title>Role of non-apoptotic CED-3 activity in enhancing the robustness of dynamic changes in gene expression for development</title><p>We report the discovery of a new gene expression regulatory mechanism whereby a non-apoptotic activity of the CED-3 caspase functions to inactivate and repress the expression of key developmental regulators, significantly contributing to the robustness of gene expression dynamics and animal development (<xref ref-type="fig" rid="fig10">Figure 10A</xref>). Consistent with this, a previous report showed that CED-3 is capable of cleaving more than 22 <italic>C. elegans</italic> proteins in an in vitro proteomics survey (<xref ref-type="bibr" rid="bib60">Taylor et al., 2007</xref>) and two recent genetics-based findings showed that <italic>ced-3</italic> may play important roles in neural regeneration (<xref ref-type="bibr" rid="bib45">Pinan-Lucarre et al., 2012</xref>) and aging (<xref ref-type="bibr" rid="bib68">Yee et al., 2014</xref>). Second, the described CED-3 function in repressing gene expression is likely in contrast to the role of CED-3 in promoting apoptosis through activation of protein targets by cleavage at specific sites (<xref ref-type="bibr" rid="bib40">Nakagawa et al., 2010</xref>; <xref ref-type="bibr" rid="bib11">Chen et al., 2013</xref>). Here, the CED-3 cleavage alone may already destroy the target protein activity. Additionally, the cleavage products may be further degraded by other degradation systems notably via N-terminal destabilizing residues which may make the target more susceptible to additional degradation mechanisms, such as proteasomal degradation (<xref ref-type="bibr" rid="bib57">Sriram et al., 2011</xref>) (<xref ref-type="fig" rid="fig10">Figure 10B</xref>). We hypothesize that this function operates continually during development to facilitate rapid turnover of these regulatory proteins at the post-translational level and in cooperation with other regulatory mechanisms (<xref ref-type="fig" rid="fig10s1">Figure 10—figure supplement 1</xref>). We should note that it is curious that only the LIN-28A isoform was found to be cleaved by CED-3 in vitro yet expression of both LIN-28A and LIN-28B isoforms was altered by <italic>ced-3(lf)</italic> in vivo. This may imply that <italic>ced-3</italic> has potential indirect effects on other factors within the heterochronic pathway that could alter LIN-28 isoform expression but further experiments are required to satisfactorily explain this.<fig-group><fig id="fig10" position="float"><object-id pub-id-type="doi">10.7554/eLife.04265.035</object-id><label>Figure 10.</label><caption><title>Model for CED-3 function in temporal cell fate patterning regulation.</title><p>(<bold>A</bold>) Model of CED-3 collaborating with miRNAs to repress the expression of LIN-14, LIN-28, and DISL-2. Red blocks indicate the new findings. For simplicity, many other factors in the pathway were not included here including additional regulators associated with this pathway that were also identified in our genomic enhancer screen (see <xref ref-type="fig" rid="fig10s1">Figure 10—figure supplement 1</xref>). (<bold>B</bold>) Hypothetical model for the biochemical role of CED-3 cleavage in protein turnover during development whereby a new N-terminus is generated which could potentially destabilize the protein according to the N-end rule (see text).</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.035">http://dx.doi.org/10.7554/eLife.04265.035</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265f010"/></fig><fig id="fig10s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04265.036</object-id><label>Figure 10—figure supplement 1.</label><caption><title>A more detailed genetic model for roles of CED-3 caspase in regulating the heterochronic pathway and for showing other genes from our genomic screen in this pathway.</title><p>Modified from the discussion provided by a recent review (<xref ref-type="bibr" rid="bib50">Rougvie and Moss, 2013</xref>), this model is still simplified given the complex and dynamic processes (<xref ref-type="bibr" rid="bib3">Ambros, 1989</xref>; <xref ref-type="bibr" rid="bib56">Slack and Ruvkun, 1997</xref>; <xref ref-type="bibr" rid="bib4">Ambros, 2000</xref>; <xref ref-type="bibr" rid="bib43">Pasquinelli and Ruvkun, 2002</xref>; <xref ref-type="bibr" rid="bib48">Resnick et al., 2010</xref>; <xref ref-type="bibr" rid="bib50">Rougvie and Moss, 2013</xref>). Black arrows and blocks indicate aspects of the pathway that were previously known. Red blocks and font indicate the major findings of this study. Blue font indicates factors known to function in this pathway that were also identified in our enhancer screen (<xref ref-type="supplementary-material" rid="SD9-data">Supplementary file 2</xref>) as genetic interactors of GW182 (<italic>ain-1</italic> and/or <italic>ain-2</italic>). The blue asterisk associated with <italic>let-7</italic> is to indicate that we also identified the <italic>let-7</italic> family miRNAs in our miRNA-<italic>ced-3</italic> enhancer screen (<xref ref-type="fig" rid="fig5">Figure 5A,B</xref>) and that <italic>ced-3(lf)</italic> was able to enhance their specific temporal cell fate patterning phenotypes as seen with adult-specific alae defects (<xref ref-type="fig" rid="fig5">Figure 5D</xref>). The blue asterisks and dashed red lines for <italic>miR-1</italic> and <italic>miR-246</italic> indicate additional miRNAs we identified in our miRNA-<italic>ced-3</italic> enhancer screen (<xref ref-type="fig" rid="fig5">Figure 5A,B</xref>). Both <italic>miR-1</italic> and <italic>miR-246</italic> are predicted to target <italic>lin-14</italic> mRNA (See ‘Materials and methods’) but have not been experimentally demonstrated to do so here. They failed to show enhanced specific developmental timing defects and were not pursued further. Dashed arrows and blocks are intended to indicate a combination of complex direct and indirect effects ultimately affecting developmental fate and timing. ** Previous works have indicated DAF-12 functions on several components of the pathway (<xref ref-type="bibr" rid="bib50">Rougvie and Moss, 2013</xref>; <xref ref-type="bibr" rid="bib24">Hochbaum et al., 2011</xref>), providing the basis for us to have observed the enhanced developmental defects associated with <italic>ain-1(lf)</italic> and <italic>daf-12(RNAi)</italic> (<xref ref-type="supplementary-material" rid="SD9-data">Supplementary file 2</xref>). The exact mechanism of LIN-66 function is still unclear (dashed block) though it is able to negatively regulate LIN-28 function (<xref ref-type="bibr" rid="bib37">Morita and Han, 2006</xref>). MSI-1 (Musashi-1) was identified as an RNA-binding protein that may be important for LIN-28-mediated regulation of pre-miRNA processing as well as translational regulation (<xref ref-type="bibr" rid="bib53">Sakakibara et al., 1996</xref>; <xref ref-type="bibr" rid="bib29">Kawahara et al., 2011</xref>). Interestingly, we also identified the <italic>C. elegans</italic> musashi-1 ortholog, <italic>msi-1</italic>, as an enhancer in our screen (<xref ref-type="supplementary-material" rid="SD9-data">Supplementary file 2</xref>). Following binding by LIN-28, pre-<italic>let-7</italic> is poly-uridylated by a TUTase (poly-U-polymerase) to mark it for destruction. PUP-2 is indicated here as a <italic>C. elegans</italic> ortholog for TUTase and it was also identified in our screen (<xref ref-type="supplementary-material" rid="SD9-data">Supplementary file 2</xref>). Recently, the RNAse, Dis3l2 (Dis-3-like RNAse gene 2), was identified as the 3′-5′ exonuclease that degrades poly-uridylated-pre-<italic>let-7</italic> miRNA and is the RNAse mutated in Perlman syndrome (<xref ref-type="bibr" rid="bib29">Kawahara et al., 2011</xref>; <xref ref-type="bibr" rid="bib10">Chang et al., 2013</xref>; <xref ref-type="bibr" rid="bib64">Ustianenko et al., 2013</xref>). We suggest that the <italic>C. elegans</italic> gene F48E8.6 is the <italic>C. elegans</italic> ortholog of Dis3l2 and have therefore named it DISL-2 (Dis-3-like RNAse gene 2) (See <xref ref-type="fig" rid="fig6s1">Figure 6—figure supplement 1</xref>). The intricate network of regulatory factors shown here emphasizes the importance of this pathway and how CED-3 caspase cooperates with the miRISC and numerous other factors to control temporal cell fate patterning.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.036">http://dx.doi.org/10.7554/eLife.04265.036</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04265fs017"/></fig></fig-group></p><p>We find that the altered LIN-28 expression levels in a <italic>ced-3(lf)</italic> background or with the caspase-cleavage resistant mutant [LIN-28(D31A)] in a <italic>ced-3(wt)</italic> background, are subtle compared to previous findings regarding a <italic>lin-28(gf)</italic> transgene with deleted <italic>lin-4</italic> and <italic>let-7</italic> miRNA-binding sites in the 3′ UTR (<xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>). Consistent with this subtlety, <italic>ced-3(lf)</italic> alone displays essentially no defect in seam cell numbers (<xref ref-type="fig" rid="fig6">Figure 6</xref>). The physiological effect of this subtle regulation is clearly seen in seam cell temporal patterning when miRNA function is compromised in the <italic>ain-1(lf)</italic> mutant background. This prominent enhancement indicates that <italic>ced-3</italic> has an important role in supporting the robustness of the larval transitions. Based on the pleiotropic phenotypes associated with <italic>ced-3(lf);ain-1(lf)</italic>, such roles may potentially extend to a broad range of cellular processes.</p></sec><sec id="s3-2"><title>Cooperative gene regulation revealed by our genome-scale screen</title><p>Previous studies using model organisms, including our own, have indicated that genetic redundancy by structurally unrelated genes is commonly associated with genes with regulatory functions (<xref ref-type="bibr" rid="bib20">Ferguson et al., 1987</xref>; <xref ref-type="bibr" rid="bib18">Fay et al., 2002</xref>; <xref ref-type="bibr" rid="bib59">Suzuki and Han, 2006</xref>; <xref ref-type="bibr" rid="bib13">Costanzo et al., 2011</xref>). Asking the same question for the global miRISC function, our screen, by identifying 118 previously unknown miRISC interactors, thus identified new roles for miRISC in normal developmental processes that are otherwise masked by redundancy and/or pleiotropism, as well as identifying other regulatory mechanisms that collaborate with miRNAs. Examples we found for the latter in this study include genes encoding the POU-homeodomain protein (<italic>ceh-18</italic>, <xref ref-type="fig" rid="fig2s1">Figure 2—figure supplement 1</xref>), the histone acetyltransferase <italic>(pcaf-1</italic>), the ras-related GTPase homolog (<italic>ral-1)</italic>, the homeodomain transcription factor (<italic>unc-39</italic>), and the cell-killing <italic>ced-3</italic> caspase (the majority of this study) (and others listed in <xref ref-type="supplementary-material" rid="SD9-data">Supplementary file 2</xref>). However, the interactions identified in this study most likely reflect only a small portion of miRNA functions because screening for obvious developmental defects under well-fed conditions only permitted us to identify limited physiological functions. Applying various assays, including behavioural assays or animals under various growth or stress conditions, is expected to identify many more miRNA functions. Furthermore, although feeding RNAi has important advantages for such a screen, it is not effective for many genes especially for genes functioning in certain tissues such as neurons. Therefore, genetic screens or analyses under sensitized backgrounds will continue to play a major role in identifying miRNA functions.</p></sec></sec><sec sec-type="materials|methods" id="s4"><title>Materials and methods</title><sec id="s4-1"><title><italic>C. elegans</italic> strains</title><p>See <xref ref-type="supplementary-material" rid="SD11-data">Supplementary file 4</xref> for the list of all strains used in this study<bold>.</bold></p></sec><sec id="s4-2"><title>Rationale of phenotypes scored in this screen</title><p>In this screen, we wanted to identify genetic pathways that may redundantly cooperate with the miRISC in development. Since the loss of most miRISC function resulted in highly pleiotropic phenotypes (<xref ref-type="bibr" rid="bib72">Zhang et al., 2009</xref>), we chose to score multiple obvious phenotypes (defined in <xref ref-type="supplementary-material" rid="SD8-data">Supplementary file 1</xref>).</p></sec><sec id="s4-3"><title>Genome-wide, double blind RNAi screen</title><p>The ORFeome RNAi feeding library (<xref ref-type="bibr" rid="bib51">Rual et al., 2004</xref>) was screened using a 96-well liquid culture format in the double blind. Here, double blind means that no identities for interactors were revealed to anyone setting up the plates, anyone phenotyping the plates, nor anyone processing the scored data until all candidate interactors were confirmed in a secondary screen performed in quadruplicate (see below). Similar to a previously reported method (<xref ref-type="bibr" rid="bib34">Lehner et al., 2006</xref>), a 2 day set up for each screening session was employed (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>).</p><p>For each scoring session, <italic>rrf-3(pk1426,lf), ain-1(ku322,lf);rrf-3(pk1426,lf)</italic>, and <italic>ain-2(tm2432,lf);rrf-3(pk1426,lf)</italic> were each fed with mock, <italic>ain-1</italic>, and <italic>ain-2</italic> RNAi cultures in parallel which served as the experimental controls. These controls were set up in 4 sets of triplicate (n = 12 total for each). We identified potential interactors whenever <italic>ain-1(ku322);rrf-3(pk1426)</italic> or <italic>ain-2(tm2432);rrf-3(pk1426)</italic> showed a significant defect (<xref ref-type="fig" rid="fig1s1">Figure 1—figure supplement 1A</xref>). All candidates were then retested in quadruplicate liquid format. Any gene showing effect in three or more replicates was considered a <italic>bona fide</italic> interactor by RNAi and their identities were then revealed and confirmed by sequence analysis. Multiple interactors were confirmed by testing the corresponding mutant strains when treated with <italic>ain-1</italic> or <italic>ain-2</italic> RNAi (<xref ref-type="supplementary-material" rid="SD10-data">Supplementary file 3</xref>).</p></sec><sec id="s4-4"><title>Statistical analyses</title><p>Before any statistical analyses were made, all relevant data sets were first tested for normality using the D'Agostino-Pearson omnibus test. This test also informed us for sufficient sample sizes. We analyzed our results in the following ways: (1) the Mann–Whitney test was used for pair-wise comparisons, (2) Chi-square analysis was used to compare distributions of categorical data, and (3) Fisher's Exact test was used to analyze cases where two categories were most important between two strains (e.g., the frequency of normal animals to the pooled frequency of all abnormal animals in each of the tissue-specific rescues or in the RNAi suppression test). Use of Fisher's Exact test in such cases prevented outcomes where Chi-square analysis of the same data may identify a rescue as significant only because the abnormal phenotypic categories had changed in distribution relative to the unrescued mutant, but where the fraction of normal animals was not improved. p values and statistical tests were reported throughout the study. Statistics source data have been provided.</p></sec><sec id="s4-5"><title>RNAi treatment by feeding on solid agar</title><p>Similar to the liquid culture format, positive and negative controls were run in parallel to ensure effectiveness of the culturing conditions. RNAi cultures and plates were prepared as previously described (<xref ref-type="bibr" rid="bib21">Fraser et al., 2000</xref>; <xref ref-type="bibr" rid="bib63">Timmons et al., 2001</xref>) with 100 μg/ml ampicillin. Depending on the experiment, strains were added to RNAi plates in one of the following ways: (1) bleached strains were synchronised in M9 for 36 hr at 20°C, counted, then added to plates or (2) either eggs, L2 stage animals, or L4 stage animals were carefully added to lawns.</p></sec><sec id="s4-6"><title>Counting percent of eggs hatched after RNAi treatment</title><p>Gravid young adult <italic>ain-1(lf)</italic> hermaphrodites fed either mock or <italic>ced-3</italic> RNAi since hatching were transferred to a new RNAi plate and allowed to lay eggs for 4–5 hr. The young adults were removed and the eggs laid were counted. After 40 hr at 20°C, unhatched eggs and larvae were scored. 64 hr after removing young adults, very few additional larvae were observed for <italic>ain-1(lf)</italic> animals treated with <italic>ced-3</italic> RNAi. Data are from eight independent trials.</p></sec><sec id="s4-7"><title>Assay for the rates of post-embryonic development</title><p>Synchronous L1 stage animals were added to normal food (OP50 bacteria) (150–200 worms per trial) and incubated at 20°C. Animals were scored for developmental stages every 24 hr thereafter. Data are from three to five independent trials.</p></sec><sec id="s4-8"><title>Tissue-specific rescue of <italic>ain-1(lf)</italic></title><p>The <italic>ain-1(lf)</italic> defects were rescued using a fragment of genomic DNA containing <italic>ain-1</italic> sequence and native promoter (<xref ref-type="bibr" rid="bib15">Ding et al., 2005</xref>), an <italic>ain-1</italic> sequence driven by a <italic>dpy-5</italic> (hypodermal-specific [<xref ref-type="bibr" rid="bib61">Thacker et al., 2006</xref>]) or a <italic>ges-1</italic> (gut-specific [<xref ref-type="bibr" rid="bib16">Egan et al., 1995</xref>]) promoter, and genome-integrated constructs with tissue-specific promoters driving <italic>ain-2</italic> expression which has previously been shown by our lab to rescue <italic>ain-1(lf)</italic> in those tissues (<xref ref-type="bibr" rid="bib73">Zhang et al., 2011</xref>; <xref ref-type="bibr" rid="bib31">Kudlow et al., 2012</xref>; <xref ref-type="bibr" rid="bib62">Than et al., 2013</xref>). Data are from four to ten independent trials.</p></sec><sec id="s4-9"><title>Enhancer screen for <italic>miRNA</italic> deletion mutants with <italic>ced-3</italic> RNAi</title><p>In the blind, all available miRNA deletion mutants were tested for enhancer phenotypes with <italic>ced-3</italic> using the RNAi feeding method on solid agar. The <italic>let-7(lf)</italic> and <italic>lin-4(lf)</italic> mutants were excluded since they are very sick. One person picked 10 eggs or 2 L4 stage animals onto mock or <italic>ced-3</italic> RNAi in replicates according to a key that was kept confidential. 4 to 5 days later, another person then examined the plates for phenotypes (defined in <xref ref-type="supplementary-material" rid="SD8-data">Supplementary file 1</xref>). All mutants showing an RNAi phenotype were revealed for identity and then crossed with <italic>ced-3(lf)</italic> mutants in single or in combination and tested for enhancer phenotypes.</p></sec><sec id="s4-10"><title>Apoptotic assay and rationale</title><p>We employed a published assay to identify subtle apoptotic enhancers using a reporter line: <italic>ced-3(n2427</italic>, reduction of function)<italic>;nls106 [lin-11::GFP + lin-15(+)X]</italic> (<xref ref-type="bibr" rid="bib47">Reddien et al., 2007</xref>). The <italic>ced-3(n717);nIs106</italic> strain served as the positive control for complete loss of <italic>ced-3</italic> function, and the <italic>mcd-1(n3376);ced-3(n2427,rf);nIs106</italic> strain was the positive control for enhanced ablation of programmed cell death comparable to the strong <italic>ced-3(n717)</italic> loss of function allele for accumulation of P9-11.aap cells, consistent with the previous findings (<xref ref-type="bibr" rid="bib47">Reddien et al., 2007</xref>). Young adults of all strains were scored in the blind for the number of GFP-positive undead P9-11.aap ventral cord cells. Three independent lines of <italic>ced-3(n2427,rf);ain-1(lf);nIs106</italic> were scored in the blind (data for these three lines were combined in <xref ref-type="fig" rid="fig3">Figure 3B</xref>).</p></sec><sec id="s4-11"><title>L1 stage cell-corpse assay</title><p>This standard method was done as previously described (<xref ref-type="bibr" rid="bib33">Ledwich et al., 2000</xref>). The <italic>ced-1(e1735)</italic> mutation was used to enhance visualization of corpses. DIC optics were used to count the head corpses.</p></sec><sec id="s4-12"><title>3′ UTR miRNA seed site prediction</title><p>These predictions were all made by TargetScan 6.2 release June 2012 (<xref ref-type="bibr" rid="bib26">Jan et al., 2011</xref>; <xref ref-type="bibr" rid="bib35">Lewis et al., 2005</xref>).</p></sec><sec id="s4-13"><title>Scoring adult-specific alae</title><p>Adult alae were scored using DIC optics (Zeiss Axioplan 2, Thornwood, NY) at 630× magnification (<xref ref-type="bibr" rid="bib15">Ding et al., 2005</xref>; <xref ref-type="bibr" rid="bib71">Zhang et al., 2007</xref>, <xref ref-type="bibr" rid="bib72">2009</xref>). One side of each non-roller adult was scored (the side facing up). All roller phenotype animals (the three LIN-28::GFP transgenic lines) were scored in the same way such that all alae that could be viewed were assessed for gaps and quality. Each animal was scored as either normal, low quality alae (very thin and rough sections) or gapped alae (discontinuous alae). Animals with both low quality and gapped alae were counted as only gapped alae so that each animal was represented only once. Any thin region of alae that appeared as a gap through the oculars was imaged by the camera (Zeiss Axiocam MRm) and evaluated on a large screen. Only alae observed as truly discontinuous by aid of the camera were scored as gapped. This method was applied equally to all strains throughout the study.</p></sec><sec id="s4-14"><title>Seam cell counting method</title><p>All seam cell lines were counted on a fluorescent microscope with DIC optics (Zeiss Axioplan 2) at 110× and 630× magnification (<xref ref-type="bibr" rid="bib72">Zhang et al., 2009</xref>) at the L1, L3, or L4 stage. To prevent over-representation of our sample size, we reported only one side of each animal. We randomly chose to report the top or the left side of the animal, depending on the orientation in the microscopy field. We followed this convention for the single mutants as well. Therefore, one dot corresponds to one side of one animal and each animal is plotted only once (<xref ref-type="fig" rid="fig6">Figure 6A–C</xref> and <xref ref-type="fig" rid="fig6s2">Figure 6—figure supplement 2</xref>). Data are from five independent trials.</p></sec><sec id="s4-15"><title>RNAi suppression test</title><p>We hypothesized that loss of both <italic>ain-1</italic> and <italic>ced-3</italic> resulted in the upregulation of LIN-14, LIN-28, and DISL-2. These factors are normally expressed at high levels beginning in late embryonic development and down-regulated toward the end of the second larval stage. We therefore decided to begin RNAi treatment of <italic>ced-3(lf);ain-1(lf)</italic> animals at the second larval stage and score for phenotypes 48–54 hr later. Animals were considered normal if they were only mildly-to-moderately egg-laying defective and capable of normal motility. Data are from three to six independent trials.</p></sec><sec id="s4-16"><title>CED-3 in vitro cleavage assay</title><p>The LIN-14, LIN-28, and DISL-2 coding sequence templates for in vitro synthesis were each generated first by reverse transcription from mixed stage WT (N2) <italic>C. elegans</italic> total RNA and then PCR amplified before subcloning into pTNT vector (Promega, Madison WI). The primer sequences are as follows (Restrictions sites indicated in bold-type, start codons underlined in FWD primers): <italic>lin-14</italic> FWD, att<bold>acgcgt</bold>ACCATGGCT<underline>ATG</underline>GATCTGCCTGGAACGTCTTCGAAC; REV, att<bold>ggtacc</bold>CTATTGTGGACCTTGAAGAGGAGGAG; <italic>lin-28</italic> FWD, att<bold>acgcgt</bold>ACCATGGCT<underline>ATG</underline>TCGACGGTAGTATCGGAGGGA; REV, att<bold>ggtacc</bold>CTCAGTGTCTAGATGATTCTATTCATC; <italic>disl-2</italic> FWD, att<bold>acgcgt</bold>ACCATGGCT<underline>ATG</underline>TCAGCAGTTGAAAGTCCCGTT; REV, att<bold>ggtacc</bold>CTACTGAAGAATTGTTGAGCCCGTTTC. Point mutations were generated using Quick Change II kit (Agilent Technologies, Santa Clara, CA). All constructs were sequence-verified. As previously published (<xref ref-type="bibr" rid="bib67">Xue et al., 1996</xref>), cleavage substrates were freshly synthesised with L-<sup>35</sup>S-Methionine in vitro and used immediately. For caspase inhibitor reactions, zDEVD-fmk caspase-specific inhibitor (ApexBio, Houston, TX) or DMSO was added. All cleavage reactions were incubated at 30°C in a thermocycler with heated lid for up to 6 hr. Each panel shown in <xref ref-type="fig" rid="fig7">Figure 7</xref> was performed independently with freshly synthesized L-<sup>35</sup>S-labeled substrates and independent cleavage reactions for each experiment.</p></sec><sec id="s4-17"><title>LIN-28 antibody and Western blot</title><p>Antibody against a LIN-28 C-terminal peptide (RKHRPEQVAAEEAEA) was produced by Spring Valley Laboratories (Sykesville, MD) using rabbit as the host and purified using a peptide column. Validation of the specificity of the antibody is shown in <xref ref-type="fig" rid="fig8s1">Figure 8—figure supplement 1A,B</xref>. Synchronous L1 stage animals were added to normal food (OP50 bacteria) and incubated at 20°C then collected at the indicated hours with food. For each time-point, equivalent protein input from wt, <italic>ced-3(n717), and ced-3(n1286)</italic> staged animal lysates were resolved by SDS-PAGE and then detected by Western blot using the anti-LIN-28 antibody. Actin was used as loading control (Anti-Actin antibody, A2066, Sigma–Aldrich, St. Louis, MO).</p></sec><sec id="s4-18"><title>Scoring LIN-28::GFP positive cells by DIC optics</title><p>Similarly sized L3 stage animals were picked on a non-fluorescent dissecting scope to blind the selection of animals. Prior to fluorescent illumination, gonad length was observed and measured to ensure animals were of comparable developmental stage (<xref ref-type="bibr" rid="bib6">Ambros and Horvitz, 1984</xref>; <xref ref-type="bibr" rid="bib38">Moss et al., 1997</xref>; <xref ref-type="bibr" rid="bib1">Abbott et al., 2005</xref>). This method should provide a similar distribution of developmental sub-stages for both backgrounds within the L3 stage. No significant difference in gonad extension was found (<xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2A–C</xref>). Gonad length was measured and recorded prior to GFP illumination to ensure no bias. All animals were illuminated for 5 s for each picture by DIC optics. Multiple planes through the animal were examined by one person to ensure all GFP positive cells were identified. Another person, who did not take the images, then used ImageJ to obtain integrated GFP intensity values which were reported relative to the gonad length to account for stage (<xref ref-type="fig" rid="fig8">Figure 8B–D</xref>) or counted the number of GFP positive head cells (<xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2D,E</xref>). Data for all animals viewed by DIC were kept and reported. Data for the hypodermal and head cell expression assays come from two and three independent experiments, respectively.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank R Horvitz, S Mitani, V Ambros, and the CGC (funded by NIH Office of Research Infrastructure Programs (P40 OD010440)) for strains; E Moss for materials; A Fire for vectors; V Ambros, W Wood, R Yi, S Park, M Kniazeva, M Cui, and Han lab members for discussions; and A Sewell for comments. Supported by the postdoctoral fellowship 121631-PF-12-088-01-RMC from the American Cancer Society (BPW), NIH grants 5R01GM047869 (MH), R01GM059083 (DX), and 2T32GM008759-11 (RZ). The authors of this study would like to declare no competing financial interests. The funding agencies had no role in study design, data collection, interpretation of the results, the decision to publish, or preparation of the manuscript.</p></ack><sec sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>BPW, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con2"><p>RZ, Conception and design, Acquisition of data, Analysis and interpretation of data</p></fn><fn fn-type="con" id="con3"><p>YMW, Conception and design, Acquisition of data, Analysis and interpretation of data</p></fn><fn fn-type="con" id="con4"><p>ESL, Provided critical guidance, Contributed unpublished essential data or reagents</p></fn><fn fn-type="con" id="con5"><p>DX, Provided critical guidance, Contributed unpublished essential data or reagents</p></fn><fn fn-type="con" id="con6"><p>MH, Supervised the study</p></fn></fn-group></sec><sec sec-type="supplementary-material"><title>Additional files</title><supplementary-material id="SD8-data"><object-id pub-id-type="doi">10.7554/eLife.04265.037</object-id><label>Supplementary file 1.</label><caption><p>Definition of phenotypes scored in this study.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.037">http://dx.doi.org/10.7554/eLife.04265.037</ext-link></p></caption><media xlink:href="elife04265s008.docx" mimetype="application" mime-subtype="docx"/></supplementary-material><supplementary-material id="SD9-data"><object-id pub-id-type="doi">10.7554/eLife.04265.038</object-id><label>Supplementary file 2.</label><caption><p>List of <italic>ain-1</italic> and <italic>ain-2</italic> genetic interactors identified in this study and their relevant phenotypes in brief. RNAi clones are listed alphabetically by gene name. Relevant phenotypes indicated for the given strains are defined in <xref ref-type="supplementary-material" rid="SD8-data">Supplementary file 1</xref>.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.038">http://dx.doi.org/10.7554/eLife.04265.038</ext-link></p></caption><media xlink:href="elife04265s009.docx" mimetype="application" mime-subtype="docx"/></supplementary-material><supplementary-material id="SD10-data"><object-id pub-id-type="doi">10.7554/eLife.04265.039</object-id><label>Supplementary file 3.</label><caption><p>Phenotypes observed for reverse confirmation test with <italic>ain-1</italic> and <italic>ain-2</italic> RNAi. Effects indicated are relative to the given mutant strain phenotype on mock RNAi. These are results for one generation on the indicated RNAi and not with RNAi enhancing mutations.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.039">http://dx.doi.org/10.7554/eLife.04265.039</ext-link></p></caption><media xlink:href="elife04265s010.docx" mimetype="application" mime-subtype="docx"/></supplementary-material><supplementary-material id="SD11-data"><object-id pub-id-type="doi">10.7554/eLife.04265.040</object-id><label>Supplementary file 4.</label><caption><p>List of <italic>C. elegans</italic> strains and relevant genotypes used in this study.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04265.040">http://dx.doi.org/10.7554/eLife.04265.040</ext-link></p></caption><media xlink:href="elife04265s011.docx" mimetype="application" mime-subtype="docx"/></supplementary-material></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Abbott</surname><given-names>AL</given-names></name><name><surname>Alvarez-Saavedra</surname><given-names>E</given-names></name><name><surname>Miska</surname><given-names>EA</given-names></name><name><surname>Lau</surname><given-names>NC</given-names></name><name><surname>Bartel</surname><given-names>DP</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name><name><surname>Ambros</surname><given-names>V</given-names></name></person-group><year>2005</year><article-title>The let-7 MicroRNA family members mir-48, mir-84, and mir-241 function together to regulate developmental timing in <italic>Caenorhabditis elegans</italic></article-title><source>Developmental Cell</source><volume>9</volume><fpage>403</fpage><lpage>414</lpage><pub-id pub-id-type="doi">10.1016/j.devcel.2005.07.009</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Alvarez-Saavedra</surname><given-names>E</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>2010</year><article-title>Many families of <italic>C. elegans</italic> microRNAs are not essential for development or viability</article-title><source>Current Biology</source><volume>20</volume><fpage>367</fpage><lpage>373</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2009.12.051</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ambros</surname><given-names>V</given-names></name></person-group><year>1989</year><article-title>A hierarchy of regulatory genes controls a larva-to-adult developmental switch in <italic>C. elegans</italic></article-title><source>Cell</source><volume>57</volume><fpage>49</fpage><lpage>57</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(89)90171-2</pub-id></element-citation></ref><ref id="bib3a"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ambros</surname><given-names>V</given-names></name></person-group><year>1997</year><article-title>Heterochronic Genes</article-title><person-group person-group-type="editor"><name><surname>Riddle</surname><given-names>DL</given-names></name><name><surname>Blumenthal</surname><given-names>T</given-names></name><name><surname>Meyer</surname><given-names>BJ</given-names></name><name><surname>Priess</surname><given-names>JR</given-names></name></person-group><source>C. elegans II</source><volume>2<sup>nd</sup> edition</volume><publisher-loc>Cold Spring Harbor (NY)</publisher-loc><publisher-name>Cold Spring Harbor Laboratory Press</publisher-name><comment>Chapter 18</comment></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ambros</surname><given-names>V</given-names></name></person-group><year>2000</year><article-title>Control of developmental timing in <italic>Caenorhabditis elegans</italic></article-title><source>Current Opinion in Genetics & Development</source><volume>10</volume><fpage>428</fpage><lpage>433</lpage><pub-id pub-id-type="doi">10.1016/S0959-437X(00)00108-8</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ambros</surname><given-names>V</given-names></name></person-group><year>2004</year><article-title>The functions of animal microRNAs</article-title><source>Nature</source><volume>431</volume><fpage>350</fpage><lpage>355</lpage><pub-id pub-id-type="doi">10.1038/nature02871</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ambros</surname><given-names>V</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>1984</year><article-title>Heterochronic mutants of the nematode <italic>Caenorhabditis elegans</italic></article-title><source>Science</source><volume>226</volume><fpage>409</fpage><lpage>416</lpage><pub-id pub-id-type="doi">10.1126/science.6494891</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Bartel</surname><given-names>DP</given-names></name><name><surname>Chen</surname><given-names>CZ</given-names></name></person-group><year>2004</year><article-title>Micromanagers of gene expression: the potentially widespread influence of metazoan microRNAs</article-title><source>Nature Reviews Genetics</source><volume>5</volume><fpage>396</fpage><lpage>400</lpage><pub-id pub-id-type="doi">10.1038/nrg1328</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Brenner</surname><given-names>JL</given-names></name><name><surname>Jasiewicz</surname><given-names>KL</given-names></name><name><surname>Fahley</surname><given-names>AF</given-names></name><name><surname>Kemp</surname><given-names>BJ</given-names></name><name><surname>Abbott</surname><given-names>AL</given-names></name></person-group><year>2010</year><article-title>Loss of individual microRNAs causes mutant phenotypes in sensitized genetic backgrounds in <italic>C. elegans</italic></article-title><source>Current Biology</source><volume>20</volume><fpage>1321</fpage><lpage>1325</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2010.05.062</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chang</surname><given-names>HM</given-names></name><name><surname>Triboulet</surname><given-names>R</given-names></name><name><surname>Thornton</surname><given-names>JE</given-names></name><name><surname>Gregory</surname><given-names>RI</given-names></name></person-group><year>2013</year><article-title>A role for the Perlman syndrome exonuclease Dis3l2 in the Lin28-let-7 pathway</article-title><source>Nature</source><volume>497</volume><fpage>244</fpage><lpage>248</lpage><pub-id pub-id-type="doi">10.1038/nature12119</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Chen</surname><given-names>YZ</given-names></name><name><surname>Mapes</surname><given-names>J</given-names></name><name><surname>Lee</surname><given-names>ES</given-names></name><name><surname>Skeen-Gaar</surname><given-names>RR</given-names></name><name><surname>Xue</surname><given-names>D</given-names></name></person-group><year>2013</year><article-title>Caspase-mediated activation of <italic>Caenorhabditis elegans</italic> CED-8 promotes apoptosis and phosphatidylserine externalization</article-title><source>Nature Communications</source><volume>4</volume><fpage>2726</fpage><pub-id pub-id-type="doi">10.1038/ncomms3726</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Conradt</surname><given-names>B</given-names></name><name><surname>Xue</surname><given-names>D</given-names></name></person-group><year>2005</year><article-title>Programmed cell death</article-title><source>Wormbook</source><fpage>1</fpage><lpage>13</lpage></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Costanzo</surname><given-names>M</given-names></name><name><surname>Baryshnikova</surname><given-names>A</given-names></name><name><surname>Myers</surname><given-names>CL</given-names></name><name><surname>Andrews</surname><given-names>B</given-names></name><name><surname>Boone</surname><given-names>C</given-names></name></person-group><year>2011</year><article-title>Charting the genetic interaction map of a cell</article-title><source>Current Opinion in Biotechnology</source><volume>22</volume><fpage>66</fpage><lpage>74</lpage><pub-id pub-id-type="doi">10.1016/j.copbio.2010.11.001</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ding</surname><given-names>L</given-names></name><name><surname>Han</surname><given-names>M</given-names></name></person-group><year>2007</year><article-title>GW182 family proteins are crucial for microRNA-mediated gene silencing</article-title><source>Trends in Cell Biology</source><volume>17</volume><fpage>411</fpage><lpage>416</lpage><pub-id pub-id-type="doi">10.1016/j.tcb.2007.06.003</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ding</surname><given-names>L</given-names></name><name><surname>Spencer</surname><given-names>A</given-names></name><name><surname>Morita</surname><given-names>K</given-names></name><name><surname>Han</surname><given-names>M</given-names></name></person-group><year>2005</year><article-title>The developmental timing regulator AIN-1 interacts with miRISCs and may target the argonaute protein ALG-1 to cytoplasmic P bodies in <italic>C. elegans</italic></article-title><source>Molecular Cell</source><volume>19</volume><fpage>437</fpage><lpage>447</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2005.07.013</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Egan</surname><given-names>CR</given-names></name><name><surname>Chung</surname><given-names>MA</given-names></name><name><surname>Allen</surname><given-names>FL</given-names></name><name><surname>Heschl</surname><given-names>MF</given-names></name><name><surname>Van Buskirk</surname><given-names>CL</given-names></name><name><surname>McGhee</surname><given-names>JD</given-names></name></person-group><year>1995</year><article-title>A gut-to-pharynx/tail switch in embryonic expression of the <italic>Caenorhabditis elegans</italic> ges-1 gene centers on two GATA sequences</article-title><source>Developmental Biology</source><volume>170</volume><fpage>397</fpage><lpage>419</lpage><pub-id pub-id-type="doi">10.1006/dbio.1995.1225</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fabian</surname><given-names>MR</given-names></name><name><surname>Sonenberg</surname><given-names>N</given-names></name></person-group><year>2012</year><article-title>The mechanics of miRNA-mediated gene silencing: a look under the hood of miRISC</article-title><source>Nature Structural & Molecular Biology</source><volume>19</volume><fpage>586</fpage><lpage>593</lpage><pub-id pub-id-type="doi">10.1038/nsmb.2296</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fay</surname><given-names>DS</given-names></name><name><surname>Keenan</surname><given-names>S</given-names></name><name><surname>Han</surname><given-names>M</given-names></name></person-group><year>2002</year><article-title>fzr-1 and lin-35/Rb function redundantly to control cell proliferation in <italic>C. elegans</italic> as revealed by a nonbiased synthetic screen</article-title><source>Genes & Development</source><volume>16</volume><fpage>503</fpage><lpage>517</lpage><pub-id pub-id-type="doi">10.1101/gad.952302</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Felix</surname><given-names>MA</given-names></name><name><surname>Wagner</surname><given-names>A</given-names></name></person-group><year>2008</year><article-title>Robustness and evolution: concepts, insights and challenges from a developmental model system</article-title><source>Heredity</source><volume>100</volume><fpage>132</fpage><lpage>140</lpage><pub-id pub-id-type="doi">10.1038/sj.hdy.6800915</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ferguson</surname><given-names>EL</given-names></name><name><surname>Sternberg</surname><given-names>PW</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>1987</year><article-title>A genetic pathway for the specification of the vulval cell lineages of <italic>Caenorhabditis elegans</italic></article-title><source>Nature</source><volume>326</volume><fpage>259</fpage><lpage>267</lpage><pub-id pub-id-type="doi">10.1038/326259a0</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Fraser</surname><given-names>AG</given-names></name><name><surname>Kamath</surname><given-names>RS</given-names></name><name><surname>Zipperlen</surname><given-names>P</given-names></name><name><surname>Martinez-Campos</surname><given-names>M</given-names></name><name><surname>Sohrmann</surname><given-names>M</given-names></name><name><surname>Ahringer</surname><given-names>J</given-names></name></person-group><year>2000</year><article-title>Functional genomic analysis of <italic>C. elegans</italic> chromosome I by systematic RNA interference</article-title><source>Nature</source><volume>408</volume><fpage>325</fpage><lpage>330</lpage></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hammell</surname><given-names>CM</given-names></name><name><surname>Karp</surname><given-names>X</given-names></name><name><surname>Ambros</surname><given-names>V</given-names></name></person-group><year>2009</year><article-title>A feedback circuit involving let-7-family miRNAs and DAF-12 integrates environmental signals and developmental timing in <italic>Caenorhabditis elegans</italic></article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>106</volume><fpage>18668</fpage><lpage>18673</lpage><pub-id pub-id-type="doi">10.1073/pnas.0908131106</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="book"><person-group person-group-type="author"><name><surname>Hengartner</surname><given-names>MO</given-names></name></person-group><year>1997</year><article-title>Cell death</article-title><person-group person-group-type="editor"><name><surname>Riddle</surname><given-names>DL</given-names></name><name><surname>Blumenthal</surname><given-names>T</given-names></name><name><surname>Meyer</surname><given-names>BJ</given-names></name><name><surname>Priess</surname><given-names>JR</given-names></name></person-group><source>Source C. elegans II</source><edition>2nd edition</edition><publisher-loc>Cold Spring Harbor (NY)</publisher-loc><publisher-name>Cold Spring Harbor Laboratory Press</publisher-name><comment>Chapter 15</comment></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hochbaum</surname><given-names>D</given-names></name><name><surname>Zhang</surname><given-names>Y</given-names></name><name><surname>Stuckenholz</surname><given-names>C</given-names></name><name><surname>Labhart</surname><given-names>P</given-names></name><name><surname>Alexiadis</surname><given-names>V</given-names></name><name><surname>Martin</surname><given-names>R</given-names></name><name><surname>Knolker</surname><given-names>HJ</given-names></name><name><surname>Fisher</surname><given-names>AL</given-names></name></person-group><year>2011</year><article-title>DAF-12 regulates a connected network of genes to ensure robust developmental decisions</article-title><source>PLOS Genetics</source><volume>7</volume><fpage>e1002179</fpage><pub-id pub-id-type="doi">10.1371/journal.pgen.1002179</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hunter</surname><given-names>S</given-names></name><name><surname>Jones</surname><given-names>P</given-names></name><name><surname>Mitchell</surname><given-names>A</given-names></name><name><surname>Apweiler</surname><given-names>R</given-names></name><name><surname>Attwood</surname><given-names>TK</given-names></name><name><surname>Bateman</surname><given-names>A</given-names></name><name><surname>Bernard</surname><given-names>T</given-names></name><name><surname>Binns</surname><given-names>D</given-names></name><name><surname>Bork</surname><given-names>P</given-names></name><name><surname>Burge</surname><given-names>S</given-names></name><name><surname>de</surname><given-names>CE</given-names></name><name><surname>Coggill</surname><given-names>P</given-names></name><name><surname>Corbett</surname><given-names>M</given-names></name><name><surname>Das</surname><given-names>U</given-names></name><name><surname>Daugherty</surname><given-names>L</given-names></name><name><surname>Duquenne</surname><given-names>L</given-names></name><name><surname>Finn</surname><given-names>RD</given-names></name><name><surname>Fraser</surname><given-names>M</given-names></name><name><surname>Gough</surname><given-names>J</given-names></name><name><surname>Haft</surname><given-names>D</given-names></name><name><surname>Hulo</surname><given-names>N</given-names></name><name><surname>Kahn</surname><given-names>D</given-names></name><name><surname>Kelly</surname><given-names>E</given-names></name><name><surname>Letunic</surname><given-names>I</given-names></name><name><surname>Lonsdale</surname><given-names>D</given-names></name><name><surname>Lopez</surname><given-names>R</given-names></name><name><surname>Madera</surname><given-names>M</given-names></name><name><surname>Maslen</surname><given-names>J</given-names></name><name><surname>McAnulla</surname><given-names>C</given-names></name><name><surname>McDowall</surname><given-names>J</given-names></name><name><surname>McMenamin</surname><given-names>C</given-names></name><name><surname>Mi</surname><given-names>H</given-names></name><name><surname>Mutowo-Muellenet</surname><given-names>P</given-names></name><name><surname>Mulder</surname><given-names>N</given-names></name><name><surname>Natale</surname><given-names>D</given-names></name><name><surname>Orengo</surname><given-names>C</given-names></name><name><surname>Pesseat</surname><given-names>S</given-names></name><name><surname>Punta</surname><given-names>M</given-names></name><name><surname>Quinn</surname><given-names>AF</given-names></name><name><surname>Rivoire</surname><given-names>C</given-names></name><name><surname>Sangrador-Vegas</surname><given-names>A</given-names></name><name><surname>Selengut</surname><given-names>JD</given-names></name><name><surname>Sigrist</surname><given-names>CJ</given-names></name><name><surname>Scheremetjew</surname><given-names>M</given-names></name><name><surname>Tate</surname><given-names>J</given-names></name><name><surname>Thimmajanarthanan</surname><given-names>M</given-names></name><name><surname>Thomas</surname><given-names>PD</given-names></name><name><surname>Wu</surname><given-names>CH</given-names></name><name><surname>Yeats</surname><given-names>C</given-names></name><name><surname>Yong</surname><given-names>SY</given-names></name></person-group><year>2012</year><article-title>InterPro in 2011: new developments in the family and domain prediction database</article-title><source>Nucleic Acids Research</source><volume>40</volume><fpage>D306</fpage><lpage>D312</lpage><pub-id pub-id-type="doi">10.1093/nar/gkr948</pub-id></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Jan</surname><given-names>CH</given-names></name><name><surname>Friedman</surname><given-names>RC</given-names></name><name><surname>Ruby</surname><given-names>JG</given-names></name><name><surname>Bartel</surname><given-names>DP</given-names></name></person-group><year>2011</year><article-title>Formation, regulation and evolution of <italic>Caenorhabditis elegans</italic> 3'UTRs</article-title><source>Nature</source><volume>469</volume><fpage>97</fpage><lpage>101</lpage><pub-id pub-id-type="doi">10.1038/nature09616</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Joshi</surname><given-names>PM</given-names></name><name><surname>Riddle</surname><given-names>MR</given-names></name><name><surname>Djabrayan</surname><given-names>NJ</given-names></name><name><surname>Rothman</surname><given-names>JH</given-names></name></person-group><year>2010</year><article-title><italic>Caenorhabditis elegans</italic> as a model for stem cell biology</article-title><source>Developmental Dynamics</source><volume>239</volume><fpage>1539</fpage><lpage>1554</lpage><pub-id pub-id-type="doi">10.1002/dvdy.22296</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Karp</surname><given-names>X</given-names></name><name><surname>Hammell</surname><given-names>M</given-names></name><name><surname>Ow</surname><given-names>MC</given-names></name><name><surname>Ambros</surname><given-names>V</given-names></name></person-group><year>2011</year><article-title>Effect of life history on microRNA expression during <italic>C. elegans</italic> development</article-title><source>RNA</source><volume>17</volume><fpage>639</fpage><lpage>651</lpage><pub-id pub-id-type="doi">10.1261/rna.2310111</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kawahara</surname><given-names>H</given-names></name><name><surname>Okada</surname><given-names>Y</given-names></name><name><surname>Imai</surname><given-names>T</given-names></name><name><surname>Iwanami</surname><given-names>A</given-names></name><name><surname>Mischel</surname><given-names>PS</given-names></name><name><surname>Okano</surname><given-names>H</given-names></name></person-group><year>2011</year><article-title>Musashi1 cooperates in abnormal cell lineage protein 28 (Lin28)-mediated let-7 family microRNA biogenesis in early neural differentiation</article-title><source>The Journal of Biological Chemistry</source><volume>286</volume><fpage>16121</fpage><lpage>16130</lpage><pub-id pub-id-type="doi">10.1074/jbc.M110.199166</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kitano</surname><given-names>H</given-names></name></person-group><year>2004</year><article-title>Biological robustness</article-title><source>Nature Reviews Genetics</source><volume>5</volume><fpage>826</fpage><lpage>837</lpage><pub-id pub-id-type="doi">10.1038/nrg1471</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kudlow</surname><given-names>BA</given-names></name><name><surname>Zhang</surname><given-names>L</given-names></name><name><surname>Han</surname><given-names>M</given-names></name></person-group><year>2012</year><article-title>Systematic analysis of tissue-restricted miRISCs reveals a broad role for microRNAs in suppressing basal activity of the <italic>C. elegans</italic> pathogen response</article-title><source>Molecular Cell</source><volume>46</volume><fpage>530</fpage><lpage>541</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2012.03.011</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Larkin</surname><given-names>MA</given-names></name><name><surname>Blackshields</surname><given-names>G</given-names></name><name><surname>Brown</surname><given-names>NP</given-names></name><name><surname>Chenna</surname><given-names>R</given-names></name><name><surname>McGettigan</surname><given-names>PA</given-names></name><name><surname>McWilliam</surname><given-names>H</given-names></name><name><surname>Valentin</surname><given-names>F</given-names></name><name><surname>Wallace</surname><given-names>IM</given-names></name><name><surname>Wilm</surname><given-names>A</given-names></name><name><surname>Lopez</surname><given-names>R</given-names></name><name><surname>Thompson</surname><given-names>JD</given-names></name><name><surname>Gibson</surname><given-names>TJ</given-names></name><name><surname>Higgins</surname><given-names>DG</given-names></name></person-group><year>2007</year><article-title>Clustal W and Clustal X version 2.0</article-title><source>Bioinformatics</source><volume>23</volume><fpage>2947</fpage><lpage>2948</lpage><pub-id pub-id-type="doi">10.1093/bioinformatics/btm404</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ledwich</surname><given-names>D</given-names></name><name><surname>Wu</surname><given-names>YC</given-names></name><name><surname>Driscoll</surname><given-names>M</given-names></name><name><surname>Xue</surname><given-names>D</given-names></name></person-group><year>2000</year><article-title>Analysis of programmed cell death in the nematode <italic>Caenorhabditis elegans</italic></article-title><source>Methods in Enzymology</source><volume>322</volume><fpage>76</fpage><lpage>88</lpage><pub-id pub-id-type="doi">10.1016/S0076-6879(00)22009-0</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lehner</surname><given-names>B</given-names></name><name><surname>Tischler</surname><given-names>J</given-names></name><name><surname>Fraser</surname><given-names>AG</given-names></name></person-group><year>2006</year><article-title>RNAi screens in <italic>Caenorhabditis elegans</italic> in a 96-well liquid format and their application to the systematic identification of genetic interactions</article-title><source>Nature Protocols</source><volume>1</volume><fpage>1617</fpage><lpage>1620</lpage><pub-id pub-id-type="doi">10.1038/nprot.2006.245</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lewis</surname><given-names>BP</given-names></name><name><surname>Burge</surname><given-names>CB</given-names></name><name><surname>Bartel</surname><given-names>DP</given-names></name></person-group><year>2005</year><article-title>Conserved seed pairing, often flanked by adenosines, indicates that thousands of human genes are microRNA targets</article-title><source>Cell</source><volume>120</volume><fpage>15</fpage><lpage>20</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2004.12.035</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Miska</surname><given-names>EA</given-names></name><name><surname>Alvarez-Saavedra</surname><given-names>E</given-names></name><name><surname>Abbott</surname><given-names>AL</given-names></name><name><surname>Lau</surname><given-names>NC</given-names></name><name><surname>Hellman</surname><given-names>AB</given-names></name><name><surname>McGonagle</surname><given-names>SM</given-names></name><name><surname>Bartel</surname><given-names>DP</given-names></name><name><surname>Ambros</surname><given-names>VR</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>2007</year><article-title>Most <italic>Caenorhabditis elegans</italic> microRNAs are individually not essential for development or viability</article-title><source>PLOS Genetics</source><volume>3</volume><fpage>e215</fpage><pub-id pub-id-type="doi">10.1371/journal.pgen.0030215</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Morita</surname><given-names>K</given-names></name><name><surname>Han</surname><given-names>M</given-names></name></person-group><year>2006</year><article-title>Multiple mechanisms are involved in regulating the expression of the developmental timing regulator lin-28 in <italic>Caenorhabditis elegans</italic></article-title><source>The EMBO Journal</source><volume>25</volume><fpage>5794</fpage><lpage>5804</lpage><pub-id pub-id-type="doi">10.1038/sj.emboj.7601451</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Moss</surname><given-names>EG</given-names></name><name><surname>Lee</surname><given-names>RC</given-names></name><name><surname>Ambros</surname><given-names>V</given-names></name></person-group><year>1997</year><article-title>The cold shock domain protein LIN-28 controls developmental timing in <italic>C. elegans</italic> and is regulated by the lin-4 RNA</article-title><source>Cell</source><volume>88</volume><fpage>637</fpage><lpage>646</lpage><pub-id pub-id-type="doi">10.1016/S0092-8674(00)81906-6</pub-id></element-citation></ref><ref id="bib40"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Nakagawa</surname><given-names>A</given-names></name><name><surname>Shi</surname><given-names>Y</given-names></name><name><surname>Kage-Nakadai</surname><given-names>E</given-names></name><name><surname>Mitani</surname><given-names>S</given-names></name><name><surname>Xue</surname><given-names>D</given-names></name></person-group><year>2010</year><article-title>Caspase-dependent conversion of Dicer ribonuclease into a death-promoting deoxyribonuclease</article-title><source>Science</source><volume>328</volume><fpage>327</fpage><lpage>334</lpage><pub-id pub-id-type="doi">10.1126/science.1182374</pub-id></element-citation></ref><ref id="bib41"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Olsson-Carter</surname><given-names>K</given-names></name><name><surname>Slack</surname><given-names>FJ</given-names></name></person-group><year>2010</year><article-title>A developmental timing switch promotes axon outgrowth independent of known guidance receptors</article-title><source>PLOS Genetics</source><volume>6</volume><pub-id pub-id-type="doi">10.1371/journal.pgen.1001054</pub-id></element-citation></ref><ref id="bib42"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Parry</surname><given-names>DH</given-names></name><name><surname>Xu</surname><given-names>J</given-names></name><name><surname>Ruvkun</surname><given-names>G</given-names></name></person-group><year>2007</year><article-title>A whole-genome RNAi Screen for <italic>C. elegans</italic> miRNA pathway genes</article-title><source>Current Biology</source><volume>17</volume><fpage>2013</fpage><lpage>2022</lpage><pub-id pub-id-type="doi">10.1016/j.cub.2007.10.058</pub-id></element-citation></ref><ref id="bib43"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pasquinelli</surname><given-names>AE</given-names></name><name><surname>Ruvkun</surname><given-names>G</given-names></name></person-group><year>2002</year><article-title>Control of developmental timing by micrornas and their targets</article-title><source>Annual Review of Cell and Developmental Biology</source><volume>18</volume><fpage>495</fpage><lpage>513</lpage><pub-id pub-id-type="doi">10.1146/annurev.cellbio.18.012502.105832</pub-id></element-citation></ref><ref id="bib44"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Peden</surname><given-names>E</given-names></name><name><surname>Killian</surname><given-names>DJ</given-names></name><name><surname>Xue</surname><given-names>D</given-names></name></person-group><year>2008</year><article-title>Cell death specification in C. elegans</article-title><source>Cell Cycle</source><volume>7</volume><fpage>2479</fpage><lpage>2484</lpage><pub-id pub-id-type="doi">10.4161/cc.7.16.6479</pub-id></element-citation></ref><ref id="bib45"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pinan-Lucarre</surname><given-names>B</given-names></name><name><surname>Gabel</surname><given-names>CV</given-names></name><name><surname>Reina</surname><given-names>CP</given-names></name><name><surname>Hulme</surname><given-names>SE</given-names></name><name><surname>Shevkoplyas</surname><given-names>SS</given-names></name><name><surname>Slone</surname><given-names>RD</given-names></name><name><surname>Xue</surname><given-names>J</given-names></name><name><surname>Qiao</surname><given-names>Y</given-names></name><name><surname>Weisberg</surname><given-names>S</given-names></name><name><surname>Roodhouse</surname><given-names>K</given-names></name><name><surname>Sun</surname><given-names>L</given-names></name><name><surname>Whitesides</surname><given-names>GM</given-names></name><name><surname>Samuel</surname><given-names>A</given-names></name><name><surname>Driscoll</surname><given-names>M</given-names></name></person-group><year>2012</year><article-title>The core apoptotic executioner proteins CED-3 and CED-4 promote initiation of neuronal regeneration in <italic>Caenorhabditis elegans</italic></article-title><source>PLOS Biology</source><volume>10</volume><fpage>e1001331</fpage><pub-id pub-id-type="doi">10.1371/journal.pbio.1001331</pub-id></element-citation></ref><ref id="bib46"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Punta</surname><given-names>M</given-names></name><name><surname>Coggill</surname><given-names>PC</given-names></name><name><surname>Eberhardt</surname><given-names>RY</given-names></name><name><surname>Mistry</surname><given-names>J</given-names></name><name><surname>Tate</surname><given-names>J</given-names></name><name><surname>Boursnell</surname><given-names>C</given-names></name><name><surname>Pang</surname><given-names>N</given-names></name><name><surname>Forslund</surname><given-names>K</given-names></name><name><surname>Ceric</surname><given-names>G</given-names></name><name><surname>Clements</surname><given-names>J</given-names></name><name><surname>Heger</surname><given-names>A</given-names></name><name><surname>Holm</surname><given-names>L</given-names></name><name><surname>Sonnhammer</surname><given-names>EL</given-names></name><name><surname>Eddy</surname><given-names>SR</given-names></name><name><surname>Bateman</surname><given-names>A</given-names></name><name><surname>Finn</surname><given-names>RD</given-names></name></person-group><year>2012</year><article-title>The Pfam protein families database</article-title><source>Nucleic Acids Research</source><volume>40</volume><fpage>D290</fpage><lpage>D301</lpage><pub-id pub-id-type="doi">10.1093/nar/gkr1065</pub-id></element-citation></ref><ref id="bib47"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Reddien</surname><given-names>PW</given-names></name><name><surname>Andersen</surname><given-names>EC</given-names></name><name><surname>Huang</surname><given-names>MC</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>2007</year><article-title>DPL-1 DP, LIN-35 Rb and EFL-1 E2F act with the MCD-1 zinc-finger protein to promote programmed cell death in <italic>Caenorhabditis elegans</italic></article-title><source>Genetics</source><volume>175</volume><fpage>1719</fpage><lpage>1733</lpage><pub-id pub-id-type="doi">10.1534/genetics.106.068148</pub-id></element-citation></ref><ref id="bib48"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Resnick</surname><given-names>TD</given-names></name><name><surname>McCulloch</surname><given-names>KA</given-names></name><name><surname>Rougvie</surname><given-names>AE</given-names></name></person-group><year>2010</year><article-title>miRNAs give worms the time of their lives: small RNAs and temporal control in <italic>Caenorhabditis elegans</italic></article-title><source>Developmental Dynamics</source><volume>239</volume><fpage>1477</fpage><lpage>1489</lpage><pub-id pub-id-type="doi">10.1002/dvdy.22260</pub-id></element-citation></ref><ref id="bib49"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rickers</surname><given-names>A</given-names></name><name><surname>Brockstedt</surname><given-names>E</given-names></name><name><surname>Mapara</surname><given-names>MY</given-names></name><name><surname>Otto</surname><given-names>A</given-names></name><name><surname>Dörken</surname><given-names>B</given-names></name><name><surname>Bommert</surname><given-names>K</given-names></name></person-group><year>1998</year><article-title>Inhibition of CPP32 blocks surface IgM-mediated apoptosis and D4-GDI cleavage in human BL60 Burkitt lymphoma cells</article-title><source>European Journal of Immunology</source><volume>28</volume><fpage>296</fpage><lpage>304</lpage><pub-id pub-id-type="doi">10.1002/(SICI)1521-4141(199801)28:013.0.CO;2-4</pub-id></element-citation></ref><ref id="bib50"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rougvie</surname><given-names>AE</given-names></name><name><surname>Moss</surname><given-names>EG</given-names></name></person-group><year>2013</year><article-title>Developmental transitions in C. elegans larval stages</article-title><source>Current Topics in Developmental Biology</source><volume>105</volume><fpage>153</fpage><lpage>180</lpage><pub-id pub-id-type="doi">10.1016/B978-0-12-396968-2.00006-3</pub-id></element-citation></ref><ref id="bib51"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rual</surname><given-names>JF</given-names></name><name><surname>Ceron</surname><given-names>J</given-names></name><name><surname>Koreth</surname><given-names>J</given-names></name><name><surname>Hao</surname><given-names>T</given-names></name><name><surname>Nicot</surname><given-names>AS</given-names></name><name><surname>Hirozane-Kishikawa</surname><given-names>T</given-names></name><name><surname>Vandenhaute</surname><given-names>J</given-names></name><name><surname>Orkin</surname><given-names>SH</given-names></name><name><surname>Hill</surname><given-names>DE</given-names></name><name><surname>van den</surname><given-names>HS</given-names></name><name><surname>Vidal</surname><given-names>M</given-names></name></person-group><year>2004</year><article-title>Toward improving <italic>Caenorhabditis elegans</italic> phenome mapping with an ORFeome-based RNAi library</article-title><source>Genome Research</source><volume>14</volume><fpage>2162</fpage><lpage>2168</lpage><pub-id pub-id-type="doi">10.1101/gr.2505604</pub-id></element-citation></ref><ref id="bib52"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ruvkun</surname><given-names>G</given-names></name><name><surname>Giusto</surname><given-names>J</given-names></name></person-group><year>1989</year><article-title>The <italic>Caenorhabditis elegans</italic> heterochronic gene lin-14 encodes a nuclear protein that forms a temporal developmental switch</article-title><source>Nature</source><volume>338</volume><fpage>313</fpage><lpage>319</lpage><pub-id pub-id-type="doi">10.1038/338313a0</pub-id></element-citation></ref><ref id="bib53"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sakakibara</surname><given-names>S</given-names></name><name><surname>Imai</surname><given-names>T</given-names></name><name><surname>Hamaguchi</surname><given-names>K</given-names></name><name><surname>Okabe</surname><given-names>M</given-names></name><name><surname>Aruga</surname><given-names>J</given-names></name><name><surname>Nakajima</surname><given-names>K</given-names></name><name><surname>Yasutomi</surname><given-names>D</given-names></name><name><surname>Nagata</surname><given-names>T</given-names></name><name><surname>Kurihara</surname><given-names>Y</given-names></name><name><surname>Uesugi</surname><given-names>S</given-names></name><name><surname>Miyata</surname><given-names>T</given-names></name><name><surname>Ogawa</surname><given-names>M</given-names></name><name><surname>Mikoshiba</surname><given-names>K</given-names></name><name><surname>Okano</surname><given-names>H</given-names></name></person-group><year>1996</year><article-title>Mouse-Musashi-1, a neural RNA-binding protein highly enriched in the mammalian CNS stem cell</article-title><source>Developmental Biology</source><volume>176</volume><fpage>230</fpage><lpage>242</lpage><pub-id pub-id-type="doi">10.1006/dbio.1996.0130</pub-id></element-citation></ref><ref id="bib54"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Seggerson</surname><given-names>K</given-names></name><name><surname>Tang</surname><given-names>L</given-names></name><name><surname>Moss</surname><given-names>EG</given-names></name></person-group><year>2002</year><article-title>Two genetic circuits repress the <italic>Caenorhabditis elegans</italic> heterochronic gene lin-28 after translation initiation</article-title><source>Developmental Biology</source><volume>243</volume><fpage>215</fpage><lpage>225</lpage><pub-id pub-id-type="doi">10.1006/dbio.2001.0563</pub-id></element-citation></ref><ref id="bib55"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Shaham</surname><given-names>S</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>1996</year><article-title>Developing <italic>Caenorhabditis elegans</italic> neurons may contain both cell-death protective and killer activities</article-title><source>Genes & Development</source><volume>10</volume><fpage>578</fpage><lpage>591</lpage><pub-id pub-id-type="doi">10.1101/gad.10.5.578</pub-id></element-citation></ref><ref id="bib56"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Slack</surname><given-names>F</given-names></name><name><surname>Ruvkun</surname><given-names>G</given-names></name></person-group><year>1997</year><article-title>Temporal pattern formation by heterochronic genes</article-title><source>Annual Review of Genetics</source><volume>31</volume><fpage>611</fpage><lpage>634</lpage><pub-id pub-id-type="doi">10.1146/annurev.genet.31.1.611</pub-id></element-citation></ref><ref id="bib57"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sriram</surname><given-names>SM</given-names></name><name><surname>Kim</surname><given-names>BY</given-names></name><name><surname>Kwon</surname><given-names>YT</given-names></name></person-group><year>2011</year><article-title>The N-end rule pathway: emerging functions and molecular principles of substrate recognition</article-title><source>Nature Reviews Molecular Cell Biology</source><volume>12</volume><fpage>735</fpage><lpage>747</lpage><pub-id pub-id-type="doi">10.1038/nrm3217</pub-id></element-citation></ref><ref id="bib58"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sulston</surname><given-names>JE</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>1977</year><article-title>Post-embryonic cell lineages of the nematode, <italic>Caenorhabditis elegans</italic></article-title><source>Developmental Biology</source><volume>56</volume><fpage>110</fpage><lpage>156</lpage><pub-id pub-id-type="doi">10.1016/0012-1606(77)90158-0</pub-id></element-citation></ref><ref id="bib59"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Suzuki</surname><given-names>Y</given-names></name><name><surname>Han</surname><given-names>M</given-names></name></person-group><year>2006</year><article-title>Genetic redundancy masks diverse functions of the tumor suppressor gene PTEN during C. elegans development</article-title><source>Genes & Development</source><volume>20</volume><fpage>423</fpage><lpage>428</lpage><pub-id pub-id-type="doi">10.1101/gad.1378906</pub-id></element-citation></ref><ref id="bib60"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Taylor</surname><given-names>RC</given-names></name><name><surname>Brumatti</surname><given-names>G</given-names></name><name><surname>Ito</surname><given-names>S</given-names></name><name><surname>Hengartner</surname><given-names>MO</given-names></name><name><surname>Derry</surname><given-names>WB</given-names></name><name><surname>Martin</surname><given-names>SJ</given-names></name></person-group><year>2007</year><article-title>Establishing a blueprint for CED-3-dependent killing through identification of multiple substrates for this protease</article-title><source>The Journal of Biological Chemistry</source><volume>282</volume><fpage>15011</fpage><lpage>15021</lpage><pub-id pub-id-type="doi">10.1074/jbc.M611051200</pub-id></element-citation></ref><ref id="bib61"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Thacker</surname><given-names>C</given-names></name><name><surname>Sheps</surname><given-names>JA</given-names></name><name><surname>Rose</surname><given-names>AM</given-names></name></person-group><year>2006</year><article-title>Caenorhabditis elegans dpy-5 is a cuticle procollagen processed by a proprotein convertase</article-title><source>Cellular and Molecular Life Sciences</source><volume>63</volume><fpage>1193</fpage><lpage>1204</lpage><pub-id pub-id-type="doi">10.1007/s00018-006-6012-z</pub-id></element-citation></ref><ref id="bib62"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Than</surname><given-names>MT</given-names></name><name><surname>Kudlow</surname><given-names>BA</given-names></name><name><surname>Han</surname><given-names>M</given-names></name></person-group><year>2013</year><article-title>Functional analysis of neuronal microRNAs in Caenorhabditis elegans dauer formation by combinational genetics and Neuronal miRISC immunoprecipitation</article-title><source>PLOS Genetics</source><volume>9</volume><fpage>e1003592</fpage><pub-id pub-id-type="doi">10.1371/journal.pgen.1003592</pub-id></element-citation></ref><ref id="bib63"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Timmons</surname><given-names>L</given-names></name><name><surname>Court</surname><given-names>DL</given-names></name><name><surname>Fire</surname><given-names>A</given-names></name></person-group><year>2001</year><article-title>Ingestion of bacterially expressed dsRNAs can produce specific and potent genetic interference in Caenorhabditis elegans</article-title><source>Gene</source><volume>263</volume><fpage>103</fpage><lpage>112</lpage><pub-id pub-id-type="doi">10.1016/S0378-1119(00)00579-5</pub-id></element-citation></ref><ref id="bib64"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ustianenko</surname><given-names>D</given-names></name><name><surname>Hrossova</surname><given-names>D</given-names></name><name><surname>Potesil</surname><given-names>D</given-names></name><name><surname>Chalupnikova</surname><given-names>K</given-names></name><name><surname>Hrazdilova</surname><given-names>K</given-names></name><name><surname>Pachernik</surname><given-names>J</given-names></name><name><surname>Cetkovska</surname><given-names>K</given-names></name><name><surname>Uldrijan</surname><given-names>S</given-names></name><name><surname>Zdrahal</surname><given-names>Z</given-names></name><name><surname>Vanacova</surname><given-names>S</given-names></name></person-group><year>2013</year><article-title>Mammalian DIS3L2 exoribonuclease targets the uridylated precursors of let-7 miRNAs</article-title><source>RNA</source><volume>19</volume><fpage>1632</fpage><lpage>1638</lpage><pub-id pub-id-type="doi">10.1261/rna.040055</pub-id></element-citation></ref><ref id="bib65"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Viswanathan</surname><given-names>SR</given-names></name><name><surname>Daley</surname><given-names>GQ</given-names></name></person-group><year>2010</year><article-title>Lin28: a microRNA regulator with a macro role</article-title><source>Cell</source><volume>140</volume><fpage>445</fpage><lpage>449</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2010.02.007</pub-id></element-citation></ref><ref id="bib66"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wu</surname><given-names>YC</given-names></name><name><surname>Stanfield</surname><given-names>GM</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>2000</year><article-title>NUC-1, a caenorhabditis elegans DNase II homolog, functions in an intermediate step of DNA degradation during apoptosis</article-title><source>Genes & Development</source><volume>14</volume><fpage>536</fpage><lpage>548</lpage></element-citation></ref><ref id="bib67"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Xue</surname><given-names>D</given-names></name><name><surname>Shaham</surname><given-names>S</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>1996</year><article-title>The Caenorhabditis elegans cell-death protein CED-3 is a cysteine protease with substrate specificities similar to those of the human CPP32 protease</article-title><source>Genes & Development</source><volume>10</volume><fpage>1073</fpage><lpage>1083</lpage><pub-id pub-id-type="doi">10.1101/gad.10.9.1073</pub-id></element-citation></ref><ref id="bib68"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yee</surname><given-names>C</given-names></name><name><surname>Yang</surname><given-names>W</given-names></name><name><surname>Hekimi</surname><given-names>S</given-names></name></person-group><year>2014</year><article-title>The intrinsic apoptosis pathway mediates the pro-longevity response to mitochondrial ROS in C. elegans</article-title><source>Cell</source><volume>157</volume><fpage>897</fpage><lpage>909</lpage><pub-id pub-id-type="doi">10.1016/j.cell.2014.02.055</pub-id></element-citation></ref><ref id="bib69"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yuan</surname><given-names>J</given-names></name><name><surname>Shaham</surname><given-names>S</given-names></name><name><surname>Ledoux</surname><given-names>S</given-names></name><name><surname>Ellis</surname><given-names>HM</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>1993</year><article-title>The C. elegans cell death gene ced-3 encodes a protein similar to mammalian interleukin-1 beta-converting enzyme</article-title><source>Cell</source><volume>75</volume><fpage>641</fpage><lpage>652</lpage><pub-id pub-id-type="doi">10.1016/0092-8674(93)90485-9</pub-id></element-citation></ref><ref id="bib70"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Yuan</surname><given-names>JY</given-names></name><name><surname>Horvitz</surname><given-names>HR</given-names></name></person-group><year>1990</year><article-title>The Caenorhabditis elegans genes ced-3 and ced-4 act cell autonomously to cause programmed cell death</article-title><source>Developmental Biology</source><volume>138</volume><fpage>33</fpage><lpage>41</lpage><pub-id pub-id-type="doi">10.1016/0012-1606(90)90174-H</pub-id></element-citation></ref><ref id="bib71"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>L</given-names></name><name><surname>Ding</surname><given-names>L</given-names></name><name><surname>Cheung</surname><given-names>TH</given-names></name><name><surname>Dong</surname><given-names>MQ</given-names></name><name><surname>Chen</surname><given-names>J</given-names></name><name><surname>Sewell</surname><given-names>AK</given-names></name><name><surname>Liu</surname><given-names>X</given-names></name><name><surname>Yates</surname><given-names>JR</given-names><suffix>III</suffix></name><name><surname>Han</surname><given-names>M</given-names></name></person-group><year>2007</year><article-title>Systematic identification of C. elegans miRISC proteins, miRNAs, and mRNA targets by their interactions with GW182 proteins AIN-1 and AIN-2</article-title><source>Molecular Cell</source><volume>28</volume><fpage>598</fpage><lpage>613</lpage><pub-id pub-id-type="doi">10.1016/j.molcel.2007.09.014</pub-id></element-citation></ref><ref id="bib72"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>L</given-names></name><name><surname>Hammell</surname><given-names>M</given-names></name><name><surname>Kudlow</surname><given-names>BA</given-names></name><name><surname>Ambros</surname><given-names>V</given-names></name><name><surname>Han</surname><given-names>M</given-names></name></person-group><year>2009</year><article-title>Systematic analysis of dynamic miRNA-target interactions during C. elegans development</article-title><source>Development</source><volume>136</volume><fpage>3043</fpage><lpage>3055</lpage><pub-id pub-id-type="doi">10.1242/dev.039008</pub-id></element-citation></ref><ref id="bib73"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhang</surname><given-names>X</given-names></name><name><surname>Zabinsky</surname><given-names>R</given-names></name><name><surname>Teng</surname><given-names>Y</given-names></name><name><surname>Cui</surname><given-names>M</given-names></name><name><surname>Han</surname><given-names>M</given-names></name></person-group><year>2011</year><article-title>microRNAs play critical roles in the survival and recovery of Caenorhabditis elegans from starvation-induced L1 diapause</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>108</volume><fpage>17997</fpage><lpage>18002</lpage><pub-id pub-id-type="doi">10.1073/pnas.1105982108</pub-id></element-citation></ref></ref-list></back><sub-article article-type="article-commentary" id="SA1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.04265.041</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Joshua-Tor</surname><given-names>Leemor</given-names></name><role>Reviewing editor</role><aff><institution>Cold Spring Harbor Laboratory</institution>, <country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see <ext-link ext-link-type="uri" xlink:href="http://elifesciences.org/review-process">review process</ext-link>). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.</p></boxed-text><p>Thank you for choosing to send your work entitled “Non-apoptotic CED-3 regulates LIN-28-LET-7 pluripotency pathway and other factors for robust development in <italic>C. elegans</italic>” for consideration at <italic>eLife</italic>. Your full submission has been evaluated by Detlef Weigel (Senior editor), a member of our Board of Reviewing Editors, and 2 peer reviewers, and the decision was reached after discussions between the reviewers.</p><p>We are in principle interested in the work, because it potentially reveals a new and exciting mechanism for CED-3 action. Unfortunately, the claims made in the article and abstract, which imply a direct effect of the CED-3 protease on the stability of Lin-28 present only one possible explanation of many for the observed data. Demonstrating such a direct effect would, however, be essential for eventual acceptance of the work. We would minimally expect direct <italic>in vivo</italic> observations of Lin28 protein stability in the appropriate ced3 genetic background in properly staged animals.</p><p>The main set of experiments that are not clear revolve around the interpretation of the LIN-28 time course in wild-type and ced-3 mutants. There is an important facet to the interpretation of these experiments that may be explained by the trivial notion that <italic>ced-3</italic> mutants develop more slowly than wild-type animals. The reviewers feel that this caveat could be addressed as you will see in the more detailed comments below. It would also be important to provide a clear definition of what is being phenotypically assayed.</p><p><italic>Reviewer #1:</italic></p><p>Summary: While the authors outline a nice genetic strategy to identify components that function with or in parallel to genes involved in general miRNA regulation and also clearly demonstrate that <italic>ced-3</italic> functions in this capacity and outside its role in cell death, the experiments that demonstrate LIN-28 regulatory defects in <italic>ced-3</italic> mutants are need expansion. The <italic>in vitro</italic> and genetic data are solid. Unfortunately, the phenotypes the statement that <italic>ced-3</italic> contributes to the post-translational regulation of various miRNA targets is not complete. The authors have all of the reagents to prove this assertion follow-up experiments are outlined below.</p><p>Genetic screen and strategy: The authors present the findings of a genome-wide RNAi screen designed to identify factors that work together or in parallel to essential components of the miRNA machinery that regulates developmental gene expression. The basis for this screen relies on the fact that <italic>ain-1</italic>, encoding the <italic>C. elegans</italic> miRISC component/GW Protein homolog, is non-essential (due to a redundancy with the <italic>C. elegans ain-2</italic> gene), displays a variety of pleiotropic phenotypes that can serve as the starting point for an enhancer screen. To identify genetic interactors, the authors systematically depleted each protein-coding gene individually by RNAi and scored for a wide range of general phenotypes. This resulted in the identification of 126 genes, that when depleted, result in a reproducibly synergistic enhancement of <italic>ain-1</italic> and <italic>ain-2</italic> mutant phenotypes. This list is composed of genes that function in a wide array of cellular and development functions and is interesting in itself with regard to the many functions for miRNAs in normal development.</p><p><italic>Reviewer #2:</italic></p><p>The manuscript by Weaver et al. presents the data from a carefully controlled genome-wide RNAi screen to search for genes whose depletion enhances phenotypes of animals compromised for miRISC function. This data set is likely to be of broad interest to the scientific community. A significant and somewhat surprising finding from this screen is the discovery that the CED-3 caspase has non-apoptotic roles in multiple developmental processes. Other recent studies have implicated <italic>ced-3</italic> in similar such functions, but did not pursue <italic>ced-3</italic> involvement to the level of protein targets. One key aspect of this paper is the identification of candidate <italic>ced-3</italic> target proteins with bearing on the synthetic phenotype. However, the experiments to demonstrate the <italic>in vivo</italic> relevance of these targets need to be strengthened.</p><p>Ced-3 mediated cleavage of LIN-28, LIN-14, and DISL-2 is an attractive hypothesis that is nicely supported by <italic>in vitro</italic> studies. What is most important is to substantiate this with <italic>in vivo</italic> studies, which the authors attempt using developmental westerns and transgene expression studies. As is, these experiments are weak. <xref ref-type="fig" rid="fig8">Figure 8</xref> should ultimately have quantitation of LIN-28 signals vs actin, but the more problematic issue is that in <xref ref-type="fig" rid="fig4s1">Figure 4–figure supplement 1</xref>, the authors demonstrate that ced-3 animals have a developmental delay. Is it fair to compare animals at the same timepoint for <xref ref-type="fig" rid="fig8">Figure 8</xref>? E.g. at 24 hours wt are L3s but <italic>ced-3</italic> mutants are mostly L2s. Could the apparent persistence of LIN-28 in <italic>ced-3</italic> mutants be an indirect result? I.e. LIN-28 levels appear higher because the population is developmentally younger rather than lack of LIN-28 cleavage by CED-3?</p><p>To clarify the issue of the cleavage product not being detectable on westerns, is it possible to inactivate the N-end rule pathway to show the cleavage product is present in wt but not <italic>ced-3</italic> mutants?</p><p>Demonstration of physiological relevance is also important. The authors attempt this by engineering a mutation in the CED-3 cleavage site in a <italic>lin-28::gfp</italic> transgene and compare it to a similar strain with wild-type <italic>lin-28::gfp</italic> made years ago. They compare these strains using qPCR to indicate that copy number is similar. This is not terribly satisfying, as integrated arrays can be silenced to different degrees. At minimum, how does expression compare between these strains? A perhaps better experiment would be to integrate the constructs in single copy at the same locus or engineer the mutation into the endogenous <italic>lin-28</italic> locus.</p><p>The manuscript could also benefit from revision of the text. The presentation of data is sometimes hard to follow and suffers from some paragraphs that read as strings of facts without input of the authors' interpretations. There is also a tendency to throw in gene names without introduction or explanation of relevance. Both of these weaknesses make the paper less accessible to non-specialists. One example of an issue that warrants clarification is the description of phenotypes.</p><p>There are various places where phenotypes are referred to as “adult onset” or “more severe as animals progressed into adulthood”, but there isn't data that demonstrate these aspects of the phenotypes. A related issue is the use of “superficially wt adults”. For example, the rescue experiments (<xref ref-type="fig" rid="fig2">Figure 2D</xref>) are difficult to interpret when the measurement is “superficially wt adults”. Does hypodermal or gut expression of <italic>ain-1</italic> rescue multiple phenes, restoring pleiotropic defects to superficially wild-type? Or does hyp expression only rescue hypodermal phenotypes? More explanation of the phenotype, perhaps in the methods, would help. Do the various aspects of the pleiotropic phenotype track together? Or do some animals have subsets? The multi-colored bar graphs in <xref ref-type="fig" rid="fig2">Figure 2</xref> help some, but it is not completely clear how separable are the phenes.</p><p>[Editors’ note: further revisions were requested, as shown below.]</p><p>Thank you for resubmitting your work entitled “Non-apoptotic CED-3 activity regulates LIN-28 pluripotency pathway and others for robust development in <italic>C. elegans</italic>” for further consideration at <italic>eLife</italic>. Your revised article has been favorably evaluated by Detlef Weigel (Senior editor), a Reviewing editor, and the original two reviewers. The manuscript has been improved but there are some remaining issues that need to be addressed before acceptance, as outlined below:</p><p>In your revised manuscript entitled “Non-apoptotic CED-3 activity regulates LIN-28 pluripotency pathway and others for robust development in <italic>C. elegans</italic>,” you addressed most of the main concerns that the reviewers were concerned about. The assertions made in the current version of the manuscript are much more strongly supported than the previous version. The manuscript is more appropriately specific about phenotypes, having dispensed with “adult onset” and “superficially wild-type” in favor of more specific phenotypes. Additional data have been added to support your claim of LIN-28 as a proteolysis target of CED-3 and the conclusions have been toned down.</p><p>While the new experiments provide stronger evidence <italic>ced-3</italic> function in the regulation of miRNA targets, the text of the manuscript was difficult to read with regard to clarity and succinctness. In addition, the authors should also address the issues raised below in a corrected version:</p><p>1) Please provide an alternative title that would be understandable to a wider audience. ‘CED-3’ and ‘LIN-28’ may not be familiar to many people and some description might help.</p><p>2) The abstract should be clarified further as it implies that LIN-14, LIN-28, DISL-1 are all demonstrated in vivo targets.</p><p>3) It is appreciated that demonstration of CED-3-mediated proteolysis in vivo is challenging. The new data to support a role in proteolysis are helpful, but perhaps not definitive, a result that might be consistent with a mechanism that contributes to robustness of a developmental process. Analysis of <italic>lin-28::gfp</italic> in “age-matched” wt and <italic>ced-3(lf)</italic> mutants is provided through a picture of a head together with quantitation that indicates a modest increase in number of GFP+ cells when ced-3 is missing. The data seem to support the claim, but additional experimental details could help. What is the definition of “age-matched” here? Are the animals scored simply somewhere within the L3 stage? Or were they selected at a specific point within the stage by cell division pattern? This is an issue because the wild-type transgene is not always off; are the animals all at the same point in the L3? Also, are the cell types in question consistent with LIN-28 function?</p><p>4) The authors should avoid using developmental delay when they are referring to heterochronic phenotypes. This is especially important because the authors do measure both the growth rates and temporal patterning of development. It may be easier to just use temporal patterning when they reference heterochronic phenotypes.</p><p>5) <xref ref-type="fig" rid="fig6">Figure 6</xref>, it is relevant to know when the additional seam cells arise. The Methods section on scoring has been elaborated, but this information still appears to be lacking. Are the animals born with the correct number of seam cells and it gradually increases through extra L2-type proliferative divisions or is it late onset? This issue should be easy to clarify. <xref ref-type="fig" rid="fig6">Figure 6B</xref> should include the quantification of Wild Type seam cell numbers.</p><p>6) The paragraph outlining LIN-28, LIN-14 and DIS-1 regulation in <italic>C. elegans</italic> development should be more clearly written. This would include an outline of seam cell development, stage-specific expression of the genes and then the phenotypic consequences (with regard to seam cell number) associated with mutations in each of these genes. The impact of the synthetic interactions will be more impactful.</p><p>7) Regarding the text about the tetra-peptide sequence for CED-3 cleavage: these sites (numbers etc.) should be shown in each of the proteins. In addition, while true, the LIN-28 isoform lacks this putative site but is barely mentioned throughout the text. Its absence would have implications for future experiments and discussions.</p><p>8) Experiments outlined in <xref ref-type="fig" rid="fig9">Figure 9</xref> should be more clearly described in the text or in the Figure legend. Is it the case that the percentage of animals reaching adulthood actually means the percentage of animals reaching adulthood after a defined time interval? What is that time interval?</p><p>The authors argue that aspects of these experiments support their model and some do, but some of the comparisons involve two variables (two different transgenes and +/- <italic>ced-3</italic>) coupled to potential developmental delays, which continue to complicate interpretations. Perhaps the new <xref ref-type="fig" rid="fig9">Figure 9D</xref> makes the best argument. Here, the animals are being assayed for adult cuticle, so must have reach a particular stage. And one can compare the effect of each transgene on the phenotype: if D31A starts out with lower expression than the wild-type transgene, one might expect it to have a weaker phenotype than the wild-type, yet it appears stronger, consistent with LIN-28 staying high longer. (It is a bit puzzling that the wt transgene does not cause gaps in alae, as this was indicated in Moss et al. '97.)</p><p>Since the LIN-28(D31A)::GFP transgene outlined in <xref ref-type="fig" rid="fig9">Figure 9</xref> produces a ced-3(lf)-like phenotype (a slowing of animal growth), one would expect that the expression of LIN-28(D31A)::GFP would maintain inappropriate expression pattern to a similar amount/time (if not more than) the wild-type LIN-28::GFP reporter exhibits in ced-3(lf) animals. Why was this not done? It seems so obvious and so easy to do.</p><p>9) It seems incredibly surprising that the additional expression of LIN-28::GFP in ced-3 mutant backgrounds (increased expression in a very small number of cells; <xref ref-type="fig" rid="fig8">Figure 8B</xref>) reflects the dramatic differences in the expression of the endogenous LIN-28 at a similar time point/developmental stage described in the experiments outlined in <xref ref-type="fig" rid="fig8">Figure 8A</xref>. While the perdurance of LIN-28::GFP expression in <italic>ced-3(lf)</italic> mutants is supported by the in vivo evidence, these dramatic differences in scale of the phenotype should be addressed in the text.</p></body></sub-article><sub-article article-type="reply" id="SA2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.04265.042</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p><italic>We are in principle interested in the work, because it potentially reveals a new and exciting mechanism for CED-3 action. Unfortunately, the claims made in the article and abstract, which imply a direct effect of the CED-3 protease on the stability of Lin-28 present only one possible explanation of many for the observed data. Demonstrating such a direct effect would, however, be essential for eventual acceptance of the work. We would minimally expect direct in vivo observations of Lin28 protein stability in the appropriate ced3 genetic background in properly staged animals</italic>.</p><p><italic>The main set of experiments that are not clear revolve around the interpretation of the LIN-28 time course in wild-type and ced-3 mutants. There is an important facet to the interpretation of these experiments that may be explained by the trivial notion that ced-3 mutants develop more slowly than wild-type animals. The reviewers feel that this caveat could be addressed as you will see in the more detailed comments below</italic>.</p><p>The editor/reviewers raised an important and complex issue.</p><p>We agree with the editor/reviewers that when you observe a change in development (slow progression, in this case) and a change in gene expression at the same time, it is difficult to determine which is the cause. This problem is actually quite common in analyzing gene expression during development, including in published literature.</p><p>However, given that previous work has established the dominant roles of <italic>lin-28</italic> and <italic>lin-14</italic> in regulating timing, and we have shown LIN-28, LIN-14 and DISL-2 are cleaved by CED-3 <italic>in vitro</italic>, it would be reasonable to make a suggestion out of the correlation data (<xref ref-type="fig" rid="fig8">Figure 8A</xref>) that lack of the CED-3 activity on these developmental regulators contributed to the timing defect. Doing further <italic>in vivo</italic> analysis suggested by the reviewers has certainly help to strengthen this claim.</p><p>We added four sets of new experimental data to address this question:</p><p>As requested by the reviewers and editor, we quantified LIN-28::GFP expression in individual stage-matched worms for <italic>ced-3(lf)</italic> relative to <italic>ced-3</italic> wild-type animals by DIC microscopy (<xref ref-type="fig" rid="fig8">Figure 8B-C</xref>). These data for <italic>ced-3(lf)</italic> suggest that the Western blot data shown in <xref ref-type="fig" rid="fig8">Figure 8A</xref> cannot mainly be explained by a younger cohort.</p><p>We have added new data showing that the CED-3-cleavage-resistant mutant form of LIN-28 [<italic>i.e.</italic> LIN-28(D31A)::GFP] in a <italic>ced-3(wild-type)</italic> background has a delayed down-regulation of LIN-28 relative to the wild-type LIN-28::GFP using Western blot (<xref ref-type="fig" rid="fig9">Figure 9B-C</xref>). Because this CED-3-cleavage-resistant LIN-28 mutation also causes a slight delay in development of <italic>ced-3(wild type)</italic> worms (<xref ref-type="fig" rid="fig9">Figure 9A</xref>), it provides a strong piece of evidence that lack of LIN-28 cleavage by CED-3 is one of the causes of the delayed developmental progression.</p><p>In this new Western blot (<xref ref-type="fig" rid="fig9">Figure 9B-C</xref>), down-regulation of the wild-type LIN-28 transgene in <italic>ced-3(lf)</italic> worms seems to be delayed more than LIN-28(D31A) in wild type worms. Such a difference could be due to roles of CED-3 on other targets such as LIN-14 and DISL-2, which may cause a stronger developmental delay (<xref ref-type="fig" rid="fig9">Figure 9A</xref>).</p><p>We added new data (<xref ref-type="fig" rid="fig9">Figure 9D</xref>), as requested by reviewer 1, showing that the CED-3-cleavage-resistant mutant of LIN-28 [<italic>i.e.</italic> LIN-28(D31A)::GFP] in a <italic>ced-3(wild-type)</italic> background and the wild-type LIN-28::GFP reporter in a <italic>ced-3(lf)</italic> mutant background both have defective adult alae. These data support a clear function for CED-3-directed proteolysis of the LIN-28 protein in the heterochronic pathway.</p><p>Furthermore, we added new data (<xref ref-type="fig" rid="fig5">Figure 5C-D</xref>), as requested by reviewer 1, showing that <italic>ced-3(lf)</italic> mutation enhances specific heterochronic phenotypes of <italic>let-7-</italic>family miRNA mutants and <italic>ain-1(lf)</italic> mutants, resulting in a significant number of animals with gapped adult alae.</p><p>Demonstrating <italic>in vivo</italic> protease activity of CED-3 on specific targets has always been difficult in the <italic>ced-3</italic> field. In our case, the challenge also lies on the fact that the CED-3-mediated repression of individual targets is subtle, as it works in concert with miRNAs and other proteolytic mechanisms, which is an important concept we try to deliver in this paper. We hope our new data and explanation here would be sufficient to address this issue.</p><p>In addition, we have modified the wording in the abstract and text to soften the conclusion regarding LIN-28 stability.</p><p><italic>It would also be important to provide a clear definition of what is being phenotypically assayed</italic>.</p><p>We agree that clarity is important, as the editor/reviewers have suggested, and we have now revised all of the Figure panels in question to show all phenotypic details.</p><p>Reviewer #1:</p><p><italic>Summary: While the authors outline a nice genetic strategy to identify components that function with or in parallel to genes involved in general miRNA regulation and also clearly demonstrate that</italic> ced-3 <italic>functions in this capacity and outside its role in cell death, the experiments that demonstrate LIN-28 regulatory defects in</italic> ced-3 <italic>mutants are need expansion. The in vitro and genetic data are solid. Unfortunately, the phenotypes the statement that</italic> ced-3 <italic>contributes to the post-translational regulation of various miRNA targets is not complete. The authors have all of the reagents to prove this assertion follow-up experiments are outlined below.</italic></p><p><italic>Genetic screen and strategy: The authors present the findings of a genome-wide RNAi screen designed to identify factors that work together or in parallel to essential components of the miRNA machinery that regulates developmental gene expression. The basis for this screen relies on the fact that ain-1, encoding the C. elegans miRISC component/GW Protein homolog, is non-essential (due to a redundancy with the C. elegans ain-2 gene), displays a variety of pleiotropic phenotypes that can serve as the starting point for an enhancer screen. To identify genetic interactors, the authors systematically depleted each protein-coding gene individually by RNAi and scored for a wide range of general phenotypes. This resulted in the identification of 126 genes, that when depleted, result in a reproducibly synergistic enhancement of ain-1 and ain-2 mutant phenotypes. This list is composed of genes that function in a wide array of cellular and development functions and is interesting in itself with regard to the many functions for miRNAs in normal development</italic>.</p><p>The suggestion to move the two panels from <xref ref-type="fig" rid="fig1">Figure 1</xref> to <xref ref-type="fig" rid="fig2">Figure 2</xref> is a good idea. These suggestions have been followed.</p><p>Reviewer #2:</p><p><italic>The manuscript by Weaver et al. presents the data from a carefully controlled genome-wide RNAi screen to search for genes whose depletion enhances phenotypes of animals compromised for miRISC function. This data set is likely to be of broad interest to the scientific community. A significant and somewhat surprising finding from this screen is the discovery that the CED-3 caspase has non-apoptotic roles in multiple developmental processes. Other recent studies have implicated</italic> ced-3 <italic>in similar such functions, but did not pursue</italic> ced-3 <italic>involvement to the level of protein targets. One key aspect of this paper is the identification of candidate</italic> ced-3 <italic>target proteins with bearing on the synthetic phenotype. However, the experiments to demonstrate the in vivo relevance of these targets need to be strengthened.</italic></p><p>Ced-3 <italic>mediated cleavage of LIN-28, LIN-14, and DISL-2 is an attractive hypothesis that is nicely supported by in vitro studies. What is most important is to substantiate this with in vivo studies, which the authors attempt using developmental westerns and transgene expression studies. As is, these experiments are weak.</italic> <xref ref-type="fig" rid="fig8"><italic>Figure 8</italic></xref> <italic>should ultimately have quantitation of LIN-28 signals vs actin, but the more problematic issue is that in</italic> <xref ref-type="fig" rid="fig4s1"><italic>Figure 4–figure supplement 1</italic></xref><italic>, the authors demonstrate that ced-3 animals have a developmental delay. Is it fair to compare animals at the same timepoint for</italic> <xref ref-type="fig" rid="fig8"><italic>Figure 8</italic></xref><italic>? E.g. at 24 hours wt are L3s but</italic> ced-3 <italic>mutants are mostly L2s. Could the apparent persistence of LIN-28 in</italic> ced-3 <italic>mutants be an indirect result? I.e. LIN-28 levels appear higher because the population is developmentally younger rather than lack of LIN-28 cleavage by CED-3?</italic></p><p><italic>To clarify the issue of the cleavage product not being detectable on westerns, is it possible to inactivate the N-end rule pathway to show the cleavage product is present in wt but not</italic> ced-3 <italic>mutants?</italic></p><p>The reviewer raises some important concepts. First, we agree and have now added quantitation of <xref ref-type="fig" rid="fig8">Figure 8A</xref> in the supplement. Second, regarding the “developmentally younger” concern, please see the accompanying response for new experimental data and explanations that address this point. Third, the reviewer brought up a very interesting question regarding whether we can test the interaction between <italic>ced-3</italic>, miRNA, and the N-end rule pathway. We have actually done several experiments addressing this issue and realized that it is not as simple in an animal system. To make a solid conclusion, we will need to treat this as a separate project showing both <italic>in vivo</italic> and <italic>in vitro</italic> data, as well as analyzing the functional interaction between the N-end rule pathway with <italic>ced-3</italic> and miRNAs. If successful, perhaps we could come back to add a short Research advance attached to this first paper. As for this paper, we have kept it as a hypothesis. We have modified the wording to soften the related statements.</p><p><italic>Demonstration of physiological relevance is also important. The authors attempt this by engineering a mutation in the CED-3 cleavage site in a</italic> lin-28::gfp <italic>transgene and compare it to a similar strain with wild-type</italic> lin-28::gfp <italic>made years ago. They compare these strains using qPCR to indicate that copy number is similar. This is not terribly satisfying, as integrated arrays can be silenced to different degrees. At minimum, how does expression compare between these strains? A perhaps better experiment would be to integrate the constructs in single copy at the same locus or engineer the mutation into the endogenous</italic> lin-28 <italic>locus.</italic></p><p>We appreciate this concern and have added quantified Western blot data from three independent replicates to show: 1) basal expression from the LIN-28(D31A)::GFP is somewhat less than the LIN-28::GFP alone which is consistent with the qPCR data measuring the transgene copy number (<xref ref-type="fig" rid="fig9s1">Figure 9–figure supplement 1</xref>), 2) the transgene with the point mutation alone had higher expression at 30 hours of feeding, suggesting that this mutation is sufficient to contribute to the developmental growth rate defect we observed.</p><p>Moreover, we agree that generating a single copy integration is ideal, which is now commonly practiced in our lab. Unfortunately, after many attempts, we were unable to generate such a line since the homologous rescue knock-in approach into either the endogenous locus or a Mos site requires high levels of the rescue construct that is unfortunately lethal. We are also aware of the two-step strategy of delivering constructs in sequential knock-in/replacement recombinations that could overcome lethality of the intact gene at high dosage. However, this would not only be time consuming but also low in feasibility because it requires that the first step creates a knock-out allele that would unfortunately generate the <italic>lin-28(lf)</italic> phenotype. This phenotype will render it unlikely for the second set of injections to generate transgenic F1s since <italic>lin-28(lf)</italic> animals would have a fully penetrant Pvl phenotype resulting in Egl with few progeny per adult. We have yet to reconcile this difficulty but feel that the transgenic lines we have used adequately test the concepts under consideration, including the new data assaying stage-matched animals, as well as observation of defects in adult-specific alae.</p><p><italic>The manuscript could also benefit from revision of the text. The presentation of data is sometimes hard to follow and suffers from some paragraphs that read as strings of facts without input of the authors' interpretations. There is also a tendency to throw in gene names without introduction or explanation of relevance. Both of these weaknesses make the paper less accessible to non-specialists. One example of an issue that warrants clarification is the description of phenotypes</italic>.</p><p>We appreciate these points and have made modifications to improve the writing.</p><p><italic>There are various places where phenotypes are referred to as “adult onset” or “more severe as animals progressed into adulthood”, but there isn't data that demonstrate these aspects of the phenotypes. A related issue is the use of “superficially wt adults”. For example, the rescue experiments (</italic><xref ref-type="fig" rid="fig2"><italic>Figure 2D</italic></xref><italic>) are difficult to interpret when the measurement is “superficially wt adults”. Does hypodermal or gut expression of</italic> ain-1 <italic>rescue multiple phenes, restoring pleiotropic defects to superficially wild-type? Or does hyp expression only rescue hypodermal phenotypes? More explanation of the phenotype, perhaps in the methods, would help. Do the various aspects of the pleiotropic phenotype track together? Or do some animals have subsets? The multi-colored bar graphs in</italic> <xref ref-type="fig" rid="fig2"><italic>Figure 2</italic></xref> <italic>help some, but it is not completely clear how separable are the phenes.</italic></p><p>We apologize for the cumbersome display of our results. To clarify our meaning, we have revised these statements from “adult-onset defects” to simply “defects” and clarified to “the frequency of abnormal phenotypes increased as the adults continued to age (<xref ref-type="fig" rid="fig2s2">Figure 2—figure supplement 2C</xref>)…” As stated above, we were originally hesitant to show too much phenotypic detail as we felt this was distracting. Both reviewers and the editor seemed to have disliked this presentation of the data and we now include all phenotypic details. Due to the pleiotropic nature of the genetic defects, the specific phenotypes do not have a strict correlation with tissue-specific rescue.</p><p>[Editors’ note: further revisions were requested, as shown below.]</p><p><italic>1) Please provide an alternative title that would be understandable to a wider audience. ‘CED-3’ and ‘LIN-28’ may not be familiar to many people and some description might help</italic>.</p><p>We have revised the title to: “CED-3 caspase acts with miRNAs to regulate non-apoptotic gene expression dynamics for robust development in <italic>C. elegans</italic>”.</p><p><italic>2) The abstract should be clarified further as it implies that LIN-14, LIN-28, DISL-1 are all demonstrated in vivo targets</italic>.</p><p>We agree with this valid point and have made the changes in the abstract to more accurately summarize the data.</p><p><italic>3) It is appreciated that demonstration of CED-3-mediated proteolysis in vivo is challenging. The new data to support a role in proteolysis are helpful, but perhaps not definitive, a result that might be consistent with a mechanism that contributes to robustness of a developmental process. Analysis of</italic> lin-28::gfp <italic>in “age-matched” wt and</italic> ced-3(lf) <italic>mutants is provided through a picture of a head together with quantitation that indicates a modest increase in number of GFP+ cells when</italic> ced-3 <italic>is missing. The data seem to support the claim, but additional experimental details could help. What is the definition of “age-matched” here? Are the animals scored simply somewhere within the L3 stage? Or were they selected at a specific point within the stage by cell division pattern? This is an issue because the wild-type transgene is not always off; are the animals all at the same point in the L3? Also, are the cell types in question consistent with LIN-28 function?</italic></p><p>We understand the reviewers’ two main concerns presented here and we apologize for our lack of sufficient methodological detail. We addressed these questions by doing new experiments and improving the description.</p><p>First, we performed a new set of experiments to examine hypodermal expression at the L3 stage (new <xref ref-type="fig" rid="fig8">Figure 8B-D</xref>). We first picked similarly sized L3 stage animals in a “blinded” fashion on a non-fluorescent dissecting scope. Prior to fluorescent illumination (to avoid bias), we measured gonad length to ensure they were very comparable (no significant difference found between the two strains: new <xref ref-type="fig" rid="fig8s2">Figure 8—figure supplement 2A-C</xref>). It is already known that LIN-14, LIN-28 and miRNA pathway defects (with the exception of DAF-12) have only minor effects on gonad development making it a reliable marker to stage match animals (Ambros, 1997, <italic>C. elegans</italic> II; <xref ref-type="bibr" rid="bib38">Moss <italic>et al.,</italic> 1997</xref>, Cell; and <xref ref-type="bibr" rid="bib1">Abbott, et al. 2005</xref>, Dev. Cell). Our method should thus provide a similar distribution of developmental sub-stages for both backgrounds within the L3 stage. We did not follow P cell division because we found that observation of P cell divisions was extremely difficult due to the roller phenotype of the animals. All animals were illuminated for 5 seconds for each picture by DIC optics. Multiple planes through the body were examined to ensure the brightest field of GFP positive cells was identified. Another person, who did not take the images, then quantified the GFP positive cells using Image J to obtain integrated values of GFP intensity. Data for all animals viewed by DIC were kept and reported.</p><p>Second, regarding the counting of GFP cells in the head for the data presented in the last revision (<xref ref-type="fig" rid="fig8">Figure 8B-C</xref>), we did not sufficiently explain the method in the last version, which could have alleviated the concern. We selected animals in the blind and staged them as mentioned above. All animals were illuminated for 5 seconds for each picture by DIC optics. Multiple planes through the head were examined to ensure all GFP positive cells were identified. Another person, who did not take the images, then counted the number of GFP-positive cells. Data for all animals viewed by DIC were kept and reported. Those data were then presented in a way that we felt was most fair with respect to the null hypothesis (that “there was no difference between the two backgrounds”). However, analysis of the data showed that there was a significant difference in the number of cells still expressing GFP in the <italic>ced-3(lf)</italic> background. To address this concern, we have added the above details to the Methods section (Scoring LIN-28::GFP positive cells by DIC optics).</p><p>Third, we agree with the reviewer that lin-28 expression in the hypodermis (new data in <xref ref-type="fig" rid="fig8">Figure 8B-D</xref>) is more relevant to the phenotypes of interest. However, we still decided to keep the neuron data but moved it to supplement (<xref ref-type="fig" rid="fig8s2">Figure 8– figure supplement 2</xref>). The function of <italic>lin-28</italic> in head neurons is currently unclear but the data still reflects the role of <italic>ced-3</italic> on <italic>lin-28</italic> expression.</p><p><italic>4) The authors should avoid using developmental delay when they are referring to heterochronic phenotypes. This is especially important because the authors do measure both the growth rates and temporal patterning of development. It may be easier to just use temporal patterning when they reference heterochronic phenotypes</italic>.</p><p>We highly appreciate the suggestion including the helpful examples from the reviewer. We have modified the wording following the suggestions.</p><p><italic>5)</italic> <xref ref-type="fig" rid="fig6"><italic>Figure 6</italic></xref><italic>, it is relevant to know when the additional seam cells arise. The Methods section on scoring has been elaborated, but this information still appears to be lacking. Are the animals born with the correct number of seam cells and it gradually increases through extra L2-type proliferative divisions or is it late onset? This issue should be easy to clarify.</italic> <xref ref-type="fig" rid="fig6"><italic>Figure 6B</italic></xref> <italic>should include the quantification of Wild Type seam cell numbers</italic>.</p><p>This is a valid question and we have addressed it by doing additional experiments examining seam cells at three different stages. We find that the <italic>ced-3(lf);ain-1(lf)</italic> double mutant animals are born with the proper number of seam cells (new <xref ref-type="fig" rid="fig6s1">Figure 6–figure supplement 1A</xref>). Analysis of third and fourth larval stages of the <italic>ced-3(lf);ain-1(lf)</italic> double mutant animals suggests that the supernumerary seam cells continue to develop during late larval stages (new <xref ref-type="fig" rid="fig6s1">Figure 6–figure supplement 1B</xref>) though we cannot rule out earlier reiterations with an incompletely penetrant phenotype. We have also included the data for wild type animals (new <xref ref-type="fig" rid="fig6">Figure 6B</xref>).</p><p><italic>6) The paragraph outlining LIN-28, LIN-14 and DIS-1 regulation in</italic> C. elegans <italic>development should be more clearly written. This would include an outline of seam cell development, stage-specific expression of the genes and then the phenotypic consequences (with regard to seam cell number) associated with mutations in each of these genes. The impact of the synthetic interactions will be more impactful.</italic></p><p>We have modified the writing following this helpful suggestion.</p><p><italic>7) Regarding the text about the tetra-peptide sequence for CED-3 cleavage: these sites (numbers etc.) should be shown in each of the proteins. In addition, while true, the LIN-28 isoform lacks this putative site but is barely mentioned throughout the text. Its absence would have implications for future experiments and discussions</italic>.</p><p>We agree with these comments and have made the recommended changes. The putative cleavage sites for LIN-14 and DISL-2 are now added to the supplement. We have also added a discussion regarding the LIN-28B isoform.</p><p><italic>8) Experiments outlined in</italic> <xref ref-type="fig" rid="fig9"><italic>Figure 9</italic></xref> <italic>should be more clearly described in the text or in the Figure legend. Is it the case that the percentage of animals reaching adulthood actually means the percentage of animals reaching adulthood after a defined time interval? What is that time interval</italic>?</p><p>We apologize for our vague presentation of these data. We scored for the percentage of animals reaching adulthood by 96 hours after being added to OP50 food following synchronization in M9. We have now added these necessary details to the legend.</p><p><italic>The authors argue that aspects of these experiments support their model and some do, but some of the comparisons involve two variables (two different transgenes and +/- ced-3) coupled to potential developmental delays, which continue to complicate interpretations. Perhaps the new</italic> <xref ref-type="fig" rid="fig9"><italic>Figure 9D</italic></xref> <italic>makes the best argument. Here, the animals are being assayed for adult cuticle, so must have reach a particular stage. And one can compare the effect of each transgene on the phenotype: if D31A starts out with lower expression than the wild-type transgene, one might expect it to have a weaker phenotype than the wild-type, yet it appears stronger, consistent with LIN-28 staying high longer. (It is a bit puzzling that the wt transgene does not cause gaps in alae, as this was indicated in Moss et al. '97</italic>.<italic>)</italic></p><p>We understand the reviewers’ concern regarding the apparent inconsistency in not finding gapped adult alae in the wild-type LIN-28::GFP transgene. We feel the most likely explanation is simply an advance in camera technology. We only scored gaps that could be photographed by our camera (Zeiss Axiocam MRm). We have added the following statements to the Methods section: “Any thin region of alae that appeared as a gap through the oculars was imaged by the camera and evaluated on a large screen. Only alae observed as truly discontinuous by aid of the camera were scored as gapped. This method was applied equally to all strains throughout the study.” We have also added a note about the original phenotype (from <xref ref-type="bibr" rid="bib38">Moss, <italic>et al.</italic> 1997</xref>) to the Results section to help the reader. We would like to make note that the relative enhancement by <italic>ced-3(lf)</italic> or the D31A mutation alone is most significant.</p><p><italic>Since the LIN-28(D31A)::GFP transgene outlined in</italic> <xref ref-type="fig" rid="fig9"><italic>Figure 9</italic></xref> <italic>produces a</italic> ced-3(lf)<italic>-like phenotype (a slowing of animal growth), one would expect that the expression of LIN-28(D31A)::GFP would maintain inappropriate expression pattern to a similar amount/time (if not more than) the wild-type LIN-28::GFP reporter exhibits in</italic> ced-3(lf) <italic>animals. Why was this not done? It seems so obvious and so easy to do.</italic></p><p>We appreciate the reviewers’ suggestion of examining the number of GFP positive cells in the D31A mutant by DIC optics, which we also initially set out to do. However, careful examination of the Western blot data shown in <xref ref-type="fig" rid="fig9">Figure 9B</xref> reveals that the basal expression level of the LIN-28(D31A)::GFP reporter is obviously lower than the wild-type transgene (quantified in <xref ref-type="fig" rid="fig9">Figure 9C</xref> 0hr). Thus, a direct comparison of these lines by DIC microscopy would effectively be an uncontrolled experiment since there is no satisfactory way to control for exposure time between the two transgenic lines with differing basal expression. This is unlike the wild-type transgene compared in two genetic backgrounds: <italic>ced-3(lf)</italic> versus <italic>ced-3(wt)</italic> discussed above. Though not asked for here, we would like to state, as mentioned in the previous review rebuttal, that the toxicity of a lin-28-Cas9 rescue construct has prevented us from making single copy transgenes (which is not itself guaranteed to have the same level of expression). Moreover, we feel that examination of the adult-specific alae gaps is a more meaningful experiment (as suggested by the reviewers in the first review) since it is such a well-established phenotype linking persistent LIN-28 levels to defects in temporal cell fate patterning. This phenotype also considers the entire life history of the animal and thus any perdurance.</p><p>We added a paragraph to the Discussion to consider these concepts.</p><p><italic>9) It seems incredibly surprising that the additional expression of LIN-28::GFP in</italic> ced-3 <italic>mutant backgrounds (increased expression in a very small number of cells;</italic> <xref ref-type="fig" rid="fig8"><italic>Figure 8B</italic></xref><italic>) reflects the dramatic differences in the expression of the endogenous LIN-28 at a similar time point/developmental stage described in the experiments outlined in</italic> <xref ref-type="fig" rid="fig8"><italic>Figure 8A</italic></xref><italic>. While the perdurance of LIN-28::GFP expression in</italic> ced-3(lf) <italic>mutants is supported by the in vivo evidence, these dramatic differences in scale of the phenotype should be addressed in the text.</italic></p><p>We understand the reviewers’ concern about the difference in magnitude seen by the two methods. This difference may suggest that the observed fluorescence levels do not linearly reflect the protein levels. We have made note of it in the text. We would suggest that one should not expect that the dynamic range seen by Western blot is equal to that seen for direct fluorescence microscopy. Again, as noted by the reviewer, the <italic>in vivo</italic> defects in seam cell patterning and adult alae show that whatever the true alteration in expression level, it is sufficient to result in the observed defects. This has been emphasized in the Discussion section of the revised manuscript.</p></body></sub-article></article> |