Permalink
Cannot retrieve contributors at this time
Fetching contributors…
Cannot retrieve contributors at this time
| <?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Archiving and Interchange DTD v1.1d1 20130915//EN" "JATS-archivearticle1.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.1d1"><front><journal-meta><journal-id journal-id-type="nlm-ta">elife</journal-id><journal-id journal-id-type="hwp">eLife</journal-id><journal-id journal-id-type="publisher-id">eLife</journal-id><journal-title-group><journal-title>eLife</journal-title></journal-title-group><issn publication-format="electronic">2050-084X</issn><publisher><publisher-name>eLife Sciences Publications, Ltd</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="publisher-id">04316</article-id><article-id pub-id-type="doi">10.7554/eLife.04316</article-id><article-categories><subj-group subj-group-type="display-channel"><subject>Short report</subject></subj-group><subj-group subj-group-type="heading"><subject>Neuroscience</subject></subj-group></article-categories><title-group><article-title>Knockdown of hypothalamic RFRP3 prevents chronic stress-induced infertility and embryo resorption</article-title></title-group><contrib-group><contrib contrib-type="author" id="author-10249"><name><surname>Geraghty</surname><given-names>Anna C</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con1"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-3038"><name><surname>Muroy</surname><given-names>Sandra E</given-names></name><contrib-id contrib-id-type="orcid">http://orcid.org/0000-0002-4014-5189</contrib-id><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="fn" rid="con2"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-17756"><name><surname>Zhao</surname><given-names>Sheng</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="fn" rid="pa1">‡</xref><xref ref-type="fn" rid="con3"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-17757" equal-contrib="yes"><name><surname>Bentley</surname><given-names>George E</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="equal-contrib">†</xref><xref ref-type="fn" rid="con4"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" id="author-17758" equal-contrib="yes"><name><surname>Kriegsfeld</surname><given-names>Lance J</given-names></name><xref ref-type="aff" rid="aff2">2</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="fn" rid="equal-contrib">†</xref><xref ref-type="other" rid="par-2"/><xref ref-type="fn" rid="con5"/><xref ref-type="fn" rid="conf1"/></contrib><contrib contrib-type="author" corresp="yes" id="author-2977" equal-contrib="yes"><name><surname>Kaufer</surname><given-names>Daniela</given-names></name><xref ref-type="aff" rid="aff1">1</xref><xref ref-type="aff" rid="aff3">3</xref><xref ref-type="aff" rid="aff4">4</xref><xref ref-type="corresp" rid="cor1">*</xref><xref ref-type="fn" rid="equal-contrib">†</xref><xref ref-type="other" rid="par-1"/><xref ref-type="fn" rid="con6"/><xref ref-type="fn" rid="conf1"/></contrib><aff id="aff1"><label>1</label><institution content-type="dept">Department of Integrative Biology</institution>, <institution>University of California, Berkeley</institution>, <addr-line><named-content content-type="city">Berkeley</named-content></addr-line>, <country>United States</country></aff><aff id="aff2"><label>2</label><institution content-type="dept">Department of Psychology</institution>, <institution>University of California, Berkeley</institution>, <addr-line><named-content content-type="city">Berkeley</named-content></addr-line>, <country>United States</country></aff><aff id="aff3"><label>3</label><institution content-type="dept">Helen Wills Neuroscience Institute</institution>, <institution>University of California, Berkeley</institution>, <addr-line><named-content content-type="city">Berkeley</named-content></addr-line>, <country>United States</country></aff><aff id="aff4"><label>4</label><institution>Canadian Institute for Advanced Research</institution>, <addr-line><named-content content-type="city">Toronto</named-content></addr-line>, <country>Canada</country></aff></contrib-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Fernald</surname><given-names>Russ</given-names></name><role>Reviewing editor</role><aff><institution>Stanford University</institution>, <country>United States</country></aff></contrib></contrib-group><author-notes><corresp id="cor1"><label>*</label>For correspondence: <email>danielak@berkeley.edu</email></corresp><fn fn-type="con" id="equal-contrib"><label>†</label><p>These authors contributed equally to this work</p></fn><fn fn-type="present-address" id="pa1"><label>‡</label><p>Department of Biochemistry and Molecular Biology, Southeast University, Jiangsu, China.</p></fn></author-notes><pub-date publication-format="electronic" date-type="pub"><day>12</day><month>01</month><year>2015</year></pub-date><pub-date pub-type="collection"><year>2015</year></pub-date><volume>4</volume><elocation-id>e04316</elocation-id><history><date date-type="received"><day>11</day><month>08</month><year>2014</year></date><date date-type="accepted"><day>16</day><month>12</month><year>2014</year></date></history><permissions><copyright-statement>© 2014, Geraghty et al</copyright-statement><copyright-year>2014</copyright-year><copyright-holder>Geraghty et al</copyright-holder><license xlink:href="http://creativecommons.org/licenses/by/4.0/"><license-p>This article is distributed under the terms of the <ext-link ext-link-type="uri" xlink:href="http://creativecommons.org/licenses/by/4.0/">Creative Commons Attribution License</ext-link>, which permits unrestricted use and redistribution provided that the original author and source are credited.</license-p></license></permissions><self-uri content-type="pdf" xlink:href="elife04316.pdf"/><abstract><object-id pub-id-type="doi">10.7554/eLife.04316.001</object-id><p>Whereas it is well established that chronic stress induces female reproductive dysfunction, whether stress negatively impacts fertility and fecundity when applied <italic>prior</italic> to mating and pregnancy has not been explored. In this study, we show that stress that concludes 4 days prior to mating results in persistent and marked reproductive dysfunction, with fewer successful copulation events, fewer pregnancies in those that successfully mated, and increased embryo resorption. Chronic stress exposure led to elevated expression of the hypothalamic inhibitory peptide, RFamide-related peptide-3 (RFRP3), in regularly cycling females. Remarkably, genetic silencing of RFRP3 during stress using an inducible-targeted shRNA completely alleviates stress-induced infertility in female rats, resulting in mating and pregnancy success rates indistinguishable from non-stress controls. We show that chronic stress has long-term effects on pregnancy success, even post-stressor, that are mediated by RFRP3. This points to RFRP3 as a potential clinically relevant single target for stress-induced infertility.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04316.001">http://dx.doi.org/10.7554/eLife.04316.001</ext-link></p></abstract><abstract abstract-type="executive-summary"><object-id pub-id-type="doi">10.7554/eLife.04316.002</object-id><title>eLife digest</title><p>Infertility has become alarmingly common in otherwise healthy women and around 15% of healthy couples younger than 30 years old are unable to conceive within the first year of trying. High-stress levels are known to decrease short-term fertility in humans and other animals, which may serve to prevent pregnancy during times when food or other resources are in short supply.</p><p>However, it is not clear if exposure to stress has lasting effects on fertility. Previous studies have found that when male rats experience stress, they release a protein called RFRP3. This protein inhibits brain activity, leading to a reduction in the release of reproductive hormones.</p><p>Geraghty et al. took a closer look at how stress may cause lasting fertility problems in female rats. The researchers exposed female rats to stress by restricting their movements for 3 hr each day over the course of 18 days, which increased the levels of stress hormones in the animals. They allowed the rats to recover for one full reproductive cycle—equivalent to a month in humans—and found that while their stress hormone levels returned to normal, RFRP3 levels in the brain remained high. Even after the recovery period, the females were less likely to mate. Also, the females that did mate were less likely to become pregnant, and the ones that did were more likely to lose some of the embryos. Overall, the level of reproductive success in these rats was only 21%, down from 76% in the control group (who were not exposed to the stress).</p><p>Next, Geraghty et al. injected a genetically engineered virus into the brain of the stressed rats to switch off the gene that makes RFRP3 during the stress period. This reduced the levels of the RFRP3 protein and restored the mating, pregnancy, and embryo survival rates to the normal levels seen in unstressed rats.</p><p>These results suggest that increased levels of RFRP3 during stress can have lasting negative effects on fertility. In the future, developing therapies that lower RFRP3 levels may help individuals who experience fertility problems.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04316.002">http://dx.doi.org/10.7554/eLife.04316.002</ext-link></p></abstract><kwd-group kwd-group-type="author-keywords"><title>Author keywords</title><kwd>stress</kwd><kwd>infertility</kwd><kwd>RFRP3</kwd></kwd-group><kwd-group kwd-group-type="research-organism"><title>Research organism</title><kwd>rat</kwd></kwd-group><funding-group><award-group id="par-1"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000025</institution-id><institution content-type="university">National Institute of Mental Health</institution></institution-wrap></funding-source><award-id>BRAINS R01 MH087495</award-id><principal-award-recipient><name><surname>Kaufer</surname><given-names>Daniela</given-names></name></principal-award-recipient></award-group><award-group id="par-2"><funding-source><institution-wrap><institution-id institution-id-type="FundRef">http://dx.doi.org/10.13039/100000009</institution-id><institution content-type="university">Foundation for the National Institutes of Health</institution></institution-wrap></funding-source><award-id>R01 HD050470</award-id><principal-award-recipient><name><surname>Kriegsfeld</surname><given-names>Lance J</given-names></name></principal-award-recipient></award-group><funding-statement>The funders had no role in study design, data collection and interpretation, or the decision to submit the work for publication.</funding-statement></funding-group><custom-meta-group><custom-meta><meta-name>elife-xml-version</meta-name><meta-value>2.0</meta-value></custom-meta><custom-meta specific-use="meta-only"><meta-name>Author impact statement</meta-name><meta-value>A chronic stressor prior to mating has lasting negative consequences on the fertility and fecundity of female rats, which can be prevented by blocking a single hypothalamic reproductive inhibitory hormone.</meta-value></custom-meta></custom-meta-group></article-meta></front><body><sec id="s1"><title>Main Text</title><p>High psychological stress inhibits reproductive function when both occur concomitantly (<xref ref-type="bibr" rid="bib21">Rivier and Rivest, 1991</xref>; <xref ref-type="bibr" rid="bib7">Ferin, 1999</xref>; <xref ref-type="bibr" rid="bib28">Tilbrook et al., 2000</xref>; <xref ref-type="bibr" rid="bib15">Louis et al., 2011</xref>). From an evolutionary perspective, inhibition of reproductive function by acute stress may be adaptive, delaying reproduction in times of duress or resource scarcity (<xref ref-type="bibr" rid="bib35">Wasser and Barash, 1983</xref>; <xref ref-type="bibr" rid="bib15">Louis et al., 2011</xref>). Chronic stress, however can result in persistent, maladaptive sexual dysfunction and suppressed fertility (<xref ref-type="bibr" rid="bib37">Young et al., 2006</xref>). Little is understood about the lasting effects of stress exposure. For example, after its cessation, can a prior, persistent stressor have long-term negative after-effects on reproductive health? In humans, a high-stress environment may be a significant barrier to sexual well-being and childbearing. In healthy couples under 30 years of age, 63–80% are unable to conceive within 3 months of attempting, and within 1 year of attempting pregnancy, 15% of couples remain unable to conceive (<xref ref-type="bibr" rid="bib20">Practice Committee of the American Society for Reproductive Medicine in collaboration with the Society for Reproductive Endocrinology and Infertility, 2008</xref>). A molecular framework to understand the long-term effects of stress on female reproduction, and its implications for human health, is currently lacking.</p><p>The present series of studies sought to answer two main questions: 1) Do stressful events negatively impact female reproductive function even following recovery of the stressor, and, if so, 2) are the deficits observed mediated by stress-induced elevation of the inhibitory neuropeptide, RFamide-related peptide-3 (RFRP3)? To our knowledge, no study to date has elucidated the molecular mechanisms of stress-induced infertility nor has there been any investigation of long-lasting after-effects of pre-conception stress on reproductive success and pregnancy outcome. RFRP3, the mammalian ortholog of gonadotropin-inhibitory hormone (GnIH) first identified in Japanese quail (<xref ref-type="bibr" rid="bib28a">Tsutsui et al., 2000</xref>), is common across mammals, including rats and mice (<xref ref-type="bibr" rid="bib33">Ukena and Tsutsui, 2001</xref>; <xref ref-type="bibr" rid="bib34">Ukena et al., 2002</xref>; <xref ref-type="bibr" rid="bib12">Kriegsfeld et al., 2006</xref>), hamsters (<xref ref-type="bibr" rid="bib32">Ubuka et al., 2012</xref>), non-human primates (<xref ref-type="bibr" rid="bib29">Ubuka et al., 2009a</xref>), and humans (<xref ref-type="bibr" rid="bib30">Ubuka et al., 2009b</xref>), and is a hypothalamic hormone that directly inhibits the firing of kisspeptin-sensitive gonadotropin-releasing hormone (GnRH) neurons in the hypothalamus in mice (<xref ref-type="bibr" rid="bib6">Ducret et al., 2009</xref>; <xref ref-type="bibr" rid="bib36">Wu et al., 2009</xref>). It also reduces downstream luteinizing hormone (LH) secretion in rats (<xref ref-type="bibr" rid="bib10">Johnson et al., 2007</xref>; <xref ref-type="bibr" rid="bib16">Murakami et al., 2008</xref>), mice (<xref ref-type="bibr" rid="bib27">Son et al., 2012</xref>), and hamsters (<xref ref-type="bibr" rid="bib12">Kriegsfeld et al., 2006</xref>). There is some debate as to whether RFRP3 is a hypophysiotropic hormone (<xref ref-type="bibr" rid="bib16">Murakami et al., 2008</xref>; <xref ref-type="bibr" rid="bib11">Kirby et al., 2009</xref>; <xref ref-type="bibr" rid="bib18">Pineda et al., 2010a</xref>, <xref ref-type="bibr" rid="bib19">2010b</xref>) or only centrally inhibits GnRH to elicit a response (<xref ref-type="bibr" rid="bib22">Rizwan et al., 2009</xref>, <xref ref-type="bibr" rid="bib23">2012</xref>). Regardless of its mechanism of action, RFRP3 decreases the synthesis and release of pituitary gonadotropins, LH, and follicle stimulating hormone (FSH), in many species, including rats and mice (<xref ref-type="bibr" rid="bib3">Ciccone et al., 2004</xref>; <xref ref-type="bibr" rid="bib10">Johnson et al., 2007</xref>; <xref ref-type="bibr" rid="bib16">Murakami et al., 2008</xref>; <xref ref-type="bibr" rid="bib24">Sari et al., 2009</xref>; <xref ref-type="bibr" rid="bib13">Kriegsfeld et al., 2010</xref>; <xref ref-type="bibr" rid="bib31">Ubuka et al., 2011</xref>; <xref ref-type="bibr" rid="bib27">Son et al., 2012</xref>). In females, RFRP was shown to be regulated throughout the ovulatory cycle in rats and hamsters, and it elicits a marked inhibitory effect on the pre-ovulatory LH surge through inhibition of GnRH activation in rats (<xref ref-type="bibr" rid="bib1">Anderson et al., 2009</xref>). In male rats, RFRP3 expression is elevated 24 hr after a chronic stressor, suggesting that RFRP3 may mediate enduring changes in reproductive function (<xref ref-type="bibr" rid="bib11">Kirby et al., 2009</xref>). Levels of the glucocorticoid stress hormone (in rodents, corticosterone) may mediate this effect; RFRP3 neurons in the rat hypothalamus were shown to express glucocorticoid receptor (GR) (<xref ref-type="bibr" rid="bib11">Kirby et al., 2009</xref>), as well as RFRP-expressing neuronal cell line in vitro (<xref ref-type="bibr" rid="bib14">Lee Son et al., 2014</xref>). Finally, the RFRP promoter region includes two glucocorticoid response elements (GREs), all together supporting the hypothesis that RFRP may be directly regulated by circulating glucocorticoid levels (<xref ref-type="bibr" rid="bib14">Lee Son et al., 2014</xref>). Together, these findings provide support for the notion that stress-induced increases in RFRP3 might have long-lasting negative impact on female reproductive functioning. Despite knowledge of RFRP's responsiveness to stress and its role in regulating reproductive axis activity, no study to date has established a causal link between RFRP and fertility in any species. We set out to test the potential role of RFRP expression in stress-induced infertility in females.</p></sec><sec sec-type="results" id="s2"><title>Results</title><p>In sum, we found that chronic stress led to elevated RFRP3 at all stages of the ovulatory cycle. This elevated level of expression persisted after a full cycle of recovery from stress, indicating that the impact of stress on RFRP3 lasts well beyond removal of the stressor. Stressed females exhibited fewer successful copulation events, fewer pregnancies in those that did successfully mate, and increased frequency of embryo resorption in the achieved pregnancies. These marked effects of stress on fertility were completely blocked by knockdown of RFRP3, even though RFRP3 function was restored following stress cessation. These findings indicate that stress has lingering negative consequences for female reproductive function that are mediated by a transient rise in RFRP3.</p><p>Female rats were subjected to an 18 day stress paradigm followed by quantification of hypothalamic markers of reproductive function either immediately after stress exposure or after one full estrous cycle (4 days) of recovery (<xref ref-type="fig" rid="fig1">Figure 1A</xref>). Serum levels of corticosterone (CORT) were measured on days 1, 4, 7, 11, and 18 of the 18 days immobilization stress paradigm, and on day 22, 4 days after the cessation of stressor. Baseline levels at the onset of stress exposure sessions were unchanged throughout the 18 days. However, CORT levels were significantly elevated in samples drawn on days 1, 4, 7, and 11 at the end of the 3-hr stress exposure.<fig id="fig1" position="float"><object-id pub-id-type="doi">10.7554/eLife.04316.003</object-id><label>Figure 1.</label><caption><title>18 days chronic stress leads to an upregulation of RFRP mRNA that persists for at least one estrous cycle in the rat.</title><p>(<bold>A</bold>) Experimental timeline. (<bold>B</bold>). Corticosterone was measured in serum samples from tail vein blood immediately before and after stress sessions on days 1, 4, 7, 11, and 18, and on day 22, 4 days post-stress cessation (N = 36/group in 1,4,7,11,18 timepoints, N = 18/group on 22). (<bold>C</bold>, <bold>E</bold>, <bold>G</bold>, <bold>I</bold>) Gene expression changes in the hypothalamus immediately after stress and (<bold>D</bold>, <bold>F</bold>, <bold>H</bold>, <bold>J</bold>) 4 days after stress. mRNA levels of all (mean ± SEM, N = 6/group) were determined using qRT–PCR relative to the ribosomal reference gene RPLP at day 0 and 4 post-stress cessation. Estrous cycle staging was determined by inspection of daily vaginal smears. *p < 0.05, **p < 0.01, ***p < 0.001. PCR statistics were done by a Kruskal–Wallis one-way ANOVA followed by Dunn's multiple comparison test for post-hoc analysis, CORT statistics analyzed by a repeated two-way ANOVA.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04316.003">http://dx.doi.org/10.7554/eLife.04316.003</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04316f001"/></fig></p><p>On day 22, after 4 days of recovery from the stressor, the stressed rats exhibited serum CORT concentrations indistinguishable from baseline values (<xref ref-type="fig" rid="fig1">Figure 1B</xref>). Rats exhibit a 4–5 days long estrous cycle, with rising estrogen concentrations triggering a surge of luteinizing hormone (LH) to initiate ovulation, and estrogen and progesterone driving sexual receptivity on the night of proestrus (<xref ref-type="bibr" rid="bib2">Blaustein, 2008</xref>). Stress acutely inhibits the LH surge (<xref ref-type="bibr" rid="bib5">Du Ruisseau et al., 1979</xref>) and subsequent sexual receptivity and fertility (<xref ref-type="bibr" rid="bib26">Sirinathsinghji et al., 1983</xref>; <xref ref-type="bibr" rid="bib25">Sato et al., 1996</xref>). However, it is unknown whether reproductive function continues to be negatively impacted even following recovery from stress (defined as exhibiting baseline levels of CORT after 4 days of no stress exposure). Rats were monitored daily by vaginal smear to determine whether estrous cyclicity was affected during application of the stressor and to allow separation of animals into different cycle stages (diestrus, proestrus, and estrus) at the termination of the stressor. Stress did not affect estrous cyclicity, with all animals exhibiting normal vaginal cytology throughout the stressor, and all animals exhibited a normal 4- to 5-day estrous cycle after the cessation of stress. At all estrous cycle stages, RFRP3 mRNA expression in the hypothalamus was significantly elevated both 0 and 4 days after the stressor was terminated (<xref ref-type="fig" rid="fig1">Figure 1C,D</xref>). Hypothalamic expression of the RFRP3 receptor, G-protein-coupled receptor-147 (GPR147), was also upregulated after stress during all stages of the cycle, and returned to baseline values after the cessation of stress (<xref ref-type="fig" rid="fig1">Figure 1E,F</xref>). We did not find significant differences in either GnRH or kisspeptin (KISS1) mRNA expression post-stress in any stage of the cycle (<xref ref-type="fig" rid="fig1">Figure 1G–J</xref>). However, hypothalamic samples were taken from whole hypothalamus, precluding the ability to differentiate between rostral and caudal kisspeptin cell populations, potentially masking subtle differences. Notably, the persistent increases in the expression of both RFRP3 and its receptor specifically in proestrus coincide with the cyclical onset of sexual receptivity, suggesting that RFRP3 provides a mechanistic basis for long-lasting suppression of reproductive behavior after stress.</p><p>To investigate whether the stress-induced increase in RFRP3 plays a causal role in prolonged sexual inhibition, we developed a conditional viral vector to knock down RFRP3 expression (tet-OFF lentivirus RFRP3 shRNA) in vivo during the strictly-defined time window of the chronic stressor. This lentiviral construct expresses RFRP3 shRNA from a constitutively active CMV promoter, driving both shRNA and blue fluorescent protein (BFP) marker expression. When exposed to doxycycline (DOX, via drinking water) (<xref ref-type="fig" rid="fig2">Figure 2A</xref>), the tet-Off element is prevented from driving TRE-initiated transcription and both shRNA and BFP production cease (location and extent of viral infection can be seen in <xref ref-type="fig" rid="fig2">Figure 2B,C</xref>). Stereotaxic infusion of RFRP3 shRNA lentivirus into the hypothalamus led to an 87% down-regulation of RFRP3 mRNA expression within 7 days relative to a control-scrambled shRNA (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). Immunohistological labeling verified that the peptide level in the hypothalamus was similarly knocked down by 85% compared to scrambled control virus, measured 2 weeks following viral injection (<xref ref-type="fig" rid="fig2">Figure 2E</xref>, representative images of RFRP labeling with either scramble or RFRP-shRNA virus and pre- and post-DOX administration <xref ref-type="fig" rid="fig2">Figure 2F–I</xref>). Critically, administration of doxycycline in the drinking water restored RFRP3 mRNA to normal levels within 4 days (<xref ref-type="fig" rid="fig2">Figure 2D</xref>). This viral vector system permitted knocking down of RFRP3 expression during chronic stress and restoration of RFRP3 during the later stages of copulation, mating, and birthing, which may rely on RFRP3 function in unknown ways.<fig id="fig2" position="float"><object-id pub-id-type="doi">10.7554/eLife.04316.004</object-id><label>Figure 2.</label><caption><title>RFRP-shRNA successfully knocks down RFRP expression in the dorsal medial hypothalamus, and expression is recovered upon DOX induction.</title><p>(<bold>A</bold>) Map of RFRP-shRNA viral plasmid. (<bold>B</bold>) Brain sectioned and stained with an anti-BFP antibody to label virus infection (green) and anti-RFRP 2 weeks post-injection (WPI) to show injection location and (<bold>C</bold>) spread. Scale bar indicates 100 µm. (<bold>D</bold>) mRNA levels of RFRP following injection of RFRP-shRNA viral vector were determined using qRT-PCR (WPI = weeks post-injection, mean ± SEM, N = 4). (<bold>E</bold>) RFRP3-ir cells/section counts in the DMH after 2 weeks post-injection with either scramble or RFRP-shRNA virus. (<bold>F</bold>–<bold>I</bold>) Brain sectioned stained with anti-RFRP3 antibody 2 weeks post-injection with scramble or RFRP-shRNA virus and before and after DOX administration. Scale bar indicates 100 µm. *p < 0.05, **p < 0.01, ***p < 0.001. Statistics were done by one-way analysis of variance (ANOVA) and Bonferroni post-hoc tests. For mRNA data, PCR statistics were done by a Kruskal–Wallis one-way ANOVA followed by Dunn's multiple comparison test for post-hoc analysis and statistics for protein counts were a student's t-test.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04316.004">http://dx.doi.org/10.7554/eLife.04316.004</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04316f002"/></fig></p><p>A second group of female rats received dorsomedial hypothalamic injections of either RFRP3 shRNA or a scrambled control shRNA lentivirus 3 weeks before the 18 days of immobilization. Estrous cycles were monitored for each rat with immobilization timed to coincide with the onset of estrus, leaving most rats in proestrus 4 days after the end of stress. All rats were administered DOX on the final day of stress so that restoration of RFRP3 expression coincided with the onset of proestrus after the 4-day recovery period. (<xref ref-type="fig" rid="fig3">Figure 3A</xref>). After one full estrous cycle of recovery from stress, rats underwent a timed mating test on the night of proestrus and were monitored through gestation and birth, to assess the long-term effects of stress on reproductive success including successful copulation and pregnancy outcome.<fig-group><fig id="fig3" position="float"><object-id pub-id-type="doi">10.7554/eLife.04316.005</object-id><label>Figure 3.</label><caption><title>Knocking down RFRP during stress completely prevents stress-induced reproductive dysfunction.</title><p>(<bold>A</bold>) Experimental time line. (<bold>B</bold>) Corticosterone concentrations were measured in serum samples from tail vein blood immediately before and after stress sessions on days 1, 11, and 18. (<bold>C</bold>) Total reproductive success was measured as percentage of females that successfully brought a litter to full term (Scramble/control N = 17, Scramble/Stress N = 14, shRNA/control N = 20, shRNA/stress N = 14, g-statistics: G = 5.836, df = 1 p = 0.016, fisher's exact test p = 0.0031). Breaking down total reproductive success, (<bold>D</bold>) copulation success was measured as percentage of females that exhibited lordosis and allowed a male to achieve intromission within 15 min (g-statistics: G = 2.405, df = 1 p = 0.028, fisher's exact test p = 0.0062), and (<bold>E</bold>) pregnancy success refers to the percentage of females that got pregnant out of the subgroup that successfully copulated (Scramble/control N = 15, Scramble/Stress N = 6, RFRP-shRNA/control N = 18, RFRP-shRNA/stress N = 11). (<bold>F</bold>) Litter sizes measured as number of pups born alive immediately after birth (dams-Scramble/control N = 13, Scramble/Stress N = 3, RFRP-shRNA/control N = 16, RFRP-shRNA/stress N = 9). (<bold>G</bold>) Embryos implanted measured as number of placental scars identified in the dam's uterine horns after birth. (<bold>H</bold>) Embryo survival was calculated as the number of birthed pups divided by number of maternal placental scars and shown as a percentage (indicative of initial implantation, mean ± SEM) *p < 0.05, **p < 0.01, ***p < 0.001. Reproductive success statistics were done by G-statistics tests followed by Fisher's Exact test, statistics for litter size, placental scars, and embryo resorption were done by a two-way analysis of variance (ANOVA) followed by Bonferroni post-hoc tests and CORT statistics analyzed by a repeated two-way ANOVA.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04316.005">http://dx.doi.org/10.7554/eLife.04316.005</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04316f003"/></fig><fig id="fig3s1" position="float" specific-use="child-fig"><object-id pub-id-type="doi">10.7554/eLife.04316.006</object-id><label>Figure 3—figure supplement 1.</label><caption><title>RFRP-shRNA animals had increased plasma estradiol on proestrus during stress and RFRP-shRNA animals that mated had higher circulating estradiol than scrambled animals.</title><p>(<bold>A</bold>) Estradiol levels as measured from tail bleed samples over the cycles of all stressed rats with either scrambled or RFRP-shRNA virus (n = 14). (<bold>B</bold>) Within proestrus, estradiol measurements were separated by mating success and virus (n = 10, 21, 11, 25 samples for each successive group). (<bold>C</bold>) Lordosis intensity, or quality of the lordosis pose, scored between 0 and 3 as published in <xref ref-type="bibr" rid="bib9">Hardy and Debold (1971)</xref>. We found a significant main effect of stress (F(1, 61) = 5.15, p = 0.0268), however, no significant differences within groups. (<bold>D</bold>) Lordosis quotient was calculated as the ratio of male mounts to female lordosis poses of a score of 2 or 3. We found a significant main effect of stress (F(1, 61) = 11.66, p = 0.0011), as well a significant decrease in the scramble stress group. p < 0.05, **p < 0.01, ***p < 0.001. Estradiol, lordosis intensity and quotient statistics were a two-way analysis of variance (ANOVA) followed by Bonferroni post-hoc tests.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04316.006">http://dx.doi.org/10.7554/eLife.04316.006</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04316fs001"/></fig></fig-group></p><p>Tail vein serum samples taken at the onset and end of stress sessions on days 1, 11, and 18 revealed that post-stress circulating levels of CORT were elevated on days 1 and 11 of the immobilization period (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). Moreover, RFRP3 knockdown during stress did not significantly alter CORT response during stress, indicating an intact hormonal stress response (<xref ref-type="fig" rid="fig3">Figure 3B</xref>). Stress exposure led to a profound decrease in total reproductive success in females that received the control virus: only 21% of stressed females became pregnant and carried to live birth, as compared to 76% of non-stressed females with control virus (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). 80% of the females that received the RFRP-shRNA virus became pregnant and carried to live birth (<xref ref-type="fig" rid="fig3">Figure 3C</xref>). The stress-induced decline in reproductive success resulted from a cumulative decrease in mating success (from 88 and 90% in non-stressed groups to 43% in the stress-scrambled group, <xref ref-type="fig" rid="fig3">Figure 3D</xref>) and pregnancy rates in the females that mated (from 87 and 89% in non-stressed groups to 50% in the stress-scrambled group, <xref ref-type="fig" rid="fig3">Figure 3E</xref>). Interestingly, knockdown of RFRP3 expression in the hypothalamus during stress exposure prevented the stress-induced suppression of reproduction, leading to 79% copulation success, 82% pregnancy success, and overall reproductive success to 64%, a rate statistically equivalent to control (non-stress) levels (76%, <xref ref-type="fig" rid="fig3">Figure 3C</xref>).</p><p>Exposure to acute stress on the evening of the third day of pregnancy was reported to lead to reduced litter size, via inhibition of implantation which occurs normally 5 days after mating (<xref ref-type="bibr" rid="bib39">Zhao et al., 2013</xref>). Therefore, we next assessed whether pre-copulation stress exposure affects pregnancy outcome. Stressed females that received control-scrambled shRNA had significantly smaller litter sizes (<xref ref-type="fig" rid="fig3">Figure 3F</xref>, 12.77 ± 0.91 vs 7.667 ± 2.60 pups/litter, p < 0.05) with no difference in placental scars (<xref ref-type="fig" rid="fig3">Figure 3G</xref>, 13.0 ± 0.91 vs10.667 ± 3.93, p > 0.05). Embryo survival was analyzed in the females that were successfully impregnated by determining the ratio of placental scars (indicative of successful implantation) to the number of live pups in the litter. These were first pregnancies for all females, so the number of placental scars is indicative of implantation events during this pregnancy. Embryo survival in stressed females that received scrambled shRNA was 78.8 ± 11.7% of fetuses, compared to 98.1 ± 0.95%, and 97.8 ± 1.5% survival in the control scrambled and control RFRP-shRNA groups, respectively (<xref ref-type="fig" rid="fig3">Figure 3F</xref>, p < 0.05). Most remarkably, RFRP3 shRNA administration suppressed stress-induced fetal resorption, showing a 93.4 ± 3.2% fetal survival rate (<xref ref-type="fig" rid="fig3">Figure 3H</xref>). These results demonstrate that stress-induced increases in RFRP3 expression has long-term detrimental effects on female reproductive fitness that persist long after the stressor has been removed and CORT levels have returned to baseline. In addition, knocking-down RFRP3 expression during stress eliminated the stress-induced decrease in sexual motivation, decrease in pregnancy success, and subsequent increase in embryo resorption.</p><p>We next examined plasma estradiol concentration in animals throughout the stress period in both scrambled and RFRP-shRNA groups. We found that animals with RFRP knocked down had significantly higher circulating estradiol in proestrus during the stress exposure than animals that received the scrambled virus (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1A</xref>, p < 0.01), indicating that RFRP knockdown reverses the stress-induced blockade of the E2 rise that occurs during proestrus. Examining animals more closely during proestrus, we found that the RFRP-shRNA animals that successfully mated after the stressor had significantly higher circulating estradiol in their proestrus periods over the course of the stressor than both scrambled groups (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1B</xref>, p < 0.05).</p><p>Finally, we investigated behavioral measures of female receptivity to test its potential contribution to the stress-induced reproductive deficits observed. Lordosis intensity is a rating (from 0-3) of the quality of all lordosis poses the female exhibits during the mating session, when 0 marks no lordosis and 3 is a fully mounted spinal flexion pose. In rats, a common index of relative sexual receptivity of a female in the presence of males, is the lordosis quotient (LQ), calculated by the number of times the female adopts a lordosis posture scored 2 or higher, divided by the number of times a male mounts her. All females included in the study exhibited lordosis when introduced to a male (indicating that they were in the correct stage of their cycle). Lordosis intensity did not differ within groups (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1C</xref>) but a significant main effect of stress revealed that lordosis intensity was significantly suppressed by stress (F(1, 61) = 5.15, p = 0.0268). Furthermore, lordosis quotient measures revealed significantly lower ratio in the scrambled stress group compared to the non-stressed groups that received scrambled or RFRP-shRNA (0.30 ± 0.10 vs 0.73 ± 0.07 and 0.68 ± 0.07), indicating that stress exposure decreased the relative sexual receptivity of the females (<xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1D</xref>), congruent with the stress-induced drop in mating success we found. Interestingly, LQ ratios in stressed females that received RFRP-shRNA were not significantly different from controls ratios (0.53 ± 0.10, <xref ref-type="fig" rid="fig3s1">Figure 3—figure supplement 1D</xref>), demonstrating that knock-down of RFRP reversed the stress-induced decrease in sexual receptivity, and congruent with the reversal of mating success found in this group.</p></sec><sec sec-type="discussion" id="s3"><title>Discussion</title><p>In humans, high anxiety and psychological stress can lead to long-term impaired fertility, ranging from reduced libido, delayed pregnancy success to the extreme of complete reproductive axis suppression as in the case of hypothalamic amenorrhea (<xref ref-type="bibr" rid="bib7">Ferin, 1999</xref>). In our studies, selective knock-down of hypothalamic RFRP3 during stress exposure preserved all aspects of reproductive function that were otherwise reduced in stress-exposed animals (summary schematic, <xref ref-type="fig" rid="fig4">Figure 4</xref>). The stress-induced spike in RFRP3 initiates a long-lasting suppression of reproduction, well after the removal of the stressor, perhaps via positive feedback that maintains elevated RFRP3 levels or engages downstream suppressive targets. These findings reveal a single molecular target that persistently underlies a range of different reproductive dysfunctions that may provide a novel translational framework for clinical study of human reproductive health.<fig id="fig4" position="float"><object-id pub-id-type="doi">10.7554/eLife.04316.007</object-id><label>Figure 4.</label><caption><title>Schematic illustration of experiments.</title><p>Female rats (in pink at top) were injected with either an inducible RFRP-shRNA or a scrambled control virus. Each group was furthered separated into a no stress control or subjected to 18 days of immobilization stress. Stressed females exhibited fewer successful copulation events, fewer pregnancies in those that did successfully mate, and increased frequency of embryo resorption. These marked effects of stress on fertility were completely blocked by knockdown of RFRP3.</p><p><bold>DOI:</bold> <ext-link ext-link-type="doi" xlink:href="10.7554/eLife.04316.007">http://dx.doi.org/10.7554/eLife.04316.007</ext-link></p></caption><graphic xmlns:xlink="http://www.w3.org/1999/xlink" xlink:href="elife04316f004"/></fig></p><p>The stress-induced rise in RFRP may be acting on neural circuits influencing mating and pregnancy, potentially independently of sex steroids. RFRP projects to multiple brain regions responsible for successful reproduction and mating behavior, including the medial pre-optic area (mPOA) (where it is known to affect GnRH release) as well as the BNST, medial amygdala, anterior hypothalamus, and arcuate nucleus (<xref ref-type="bibr" rid="bib12">Kriegsfeld et al., 2006</xref>). Piekarski et al. found that administering RFRP3 to hamsters reduced sexual motivation (as measured by percent of time spent with castrated vs intact males) and vaginal scent marking without effect on lordosis behavior, similar to our present findings. Additionally, RFRP3 administration altered cellular activation in regions of the brain implicated in female sexual motivation, including the mPOA, medial amygdala, and BNST—all regions that receive RFRP projections. These effects were independent of gonadal steroids and kisspeptin cellular activation (<xref ref-type="bibr" rid="bib17">Piekarski et al., 2013</xref>). While we were unable to measure progesterone or prolactin in this study, it is possible that RFRP projections to the arcuate nucleus affect dopaminergic signaling required for prolactin release and maintenance of progesterone levels and pregnancy success. Future studies aimed at systematically examining each step in these processes is required to gain a full understanding of the neural circuits underlying the deleterious effects of stress on reproduction.</p><p>In humans, RFRP 1 and 3, and their cognate receptor are expressed in the hypothalamus (<xref ref-type="bibr" rid="bib30">Ubuka et al., 2009b</xref>). It is possible that manipulation of RFRP3 signaling in humans may relieve stress-related reproductive dysfunction, including decreased sex drive, impaired fertility, and increased miscarriages. Likewise, if similar mechanisms of stress-induced reproductive suppression are common across species, such strategies may be similarly relevant to species bred in captivity that are susceptible to stress-induced infertility, in particular, endangered species whose preservation depends on captive breeding programs.</p></sec><sec sec-type="materials|methods" id="s4"><title>Materials and methods</title><sec id="s4-1"><title>Experimental subjects</title><p>Adult female Sprague–Dawley rats were triple-housed on a 12/12-hr light–dark cycle with lights on at 0700 hr and ad libitum food and water. For all studies, rats were acclimated for a week and then vaginal smears were obtained daily to verify normal cyclicity for 12 days before the studies commenced. Rats that did not cycle normally were removed from the study. For the chronic stress experiment, rats were immobilized daily from 9 am to 12 pm (N = 6 for each cycle time point) or left undisturbed in their home cages (N = 6 for each cycle time point) until terminal samples were collected (stress paradigm described below). In the RFRP knockdown study, animals received stereotaxic injections of either RFRP-shRNA (N = 30) or scrambled control (N = 28), then allowed to recover for 3 weeks. After recovery, rats were exposed to the same stress paradigm as the previous experiment. After cessation of stress all animals were left undisturbed in their home cage for 4 days, and on the night of the fourth day observed during timed mating (see below). Rats that successfully mated were left in their home cages for the duration of gestation and then perfused within 24 hr after parturition. (stress/shRNA, N = 14, control/shRNA, N = 20, stress/scrambled, N = 14, control/scrambled, N = 17). One cage of control/scrambled animals were removed from analysis due to fighting. All animal care and procedures were approved by the University of California–Berkeley Animal Care and Use Committee (Protocol R303-0313BC).</p></sec><sec id="s4-2"><title>Immobilization stress</title><p>Rats were immobilized in Decapicone bags (Braintree scientific) and placed in individual cages in a fume hood for 3 hr/day for 18 days from 9am-12pm. Blood samples were collected for corticosterone measurement on days 1, 4, 7, 11, and 18 at the onset of the stressor and again at the end of the 3 hr.</p></sec><sec id="s4-3"><title>Plasma corticosterone and E2 hormone sampling</title><p>All blood samples were collected from tail vein and centrifuged at 2000×<italic>g</italic> for 15 min. Plasma was extracted and stored at −20°C until assayed. Corticosterone was measured using a Corticosterone EIA kit (Enzo Life Sciences, Farmingdale, NY) with individual samples used for analysis. Sample values below the detection level of the assay were included as the lowest detectible value. Samples were assayed in duplicate and groups were balanced across different plates. Inter-assay coefficients were <3% and intra-assay coefficients were <5%.</p><p>Estradiol assays were run at the University of Virginia Center for Research in Reproduction and were measured by CalBiotech EIA (Spring Valley, CA) in singlet with individual samples used for analysis. Again, sample values below the detection level of the assay were included as the lowest detectible value. Inter-assay coefficients were <2% and intra-assay coefficients were <8%.</p></sec><sec id="s4-4"><title>Copulation tests</title><p>Females verified to be in proestrus were paired with a novel male in a large rectangular cage under red light illumination during the lights off phase. The male was permitted to mate with the female for up to two ejaculations after which the male was removed from the cage. The interactions were videotaped and both male and female behaviors were blindly scored post-hoc. Females that never exhibited lordosis posture during the test were removed from analysis. Females that exhibit at least one lordosis posture but that did not allow the male to achieve intromission were termed an ‘unsuccessful maters’ and after 15 min removed from the cage.</p></sec><sec id="s4-5"><title>Scoring of sexual behaviors</title><p>All mating tests were videotaped in real-time for subsequent behavioral scoring. Videos were scored by two individuals blind to the experimental conditions. Behaviors of male and female animals were scored. The lordosis intensity was scored on a 4-point scale (0–3) as described by Hardy and DeBold (<xref ref-type="bibr" rid="bib9">Hardy and Debold, 1971</xref>) where 0 indicates no lordosis response and 3 indicates a pronounced spinal flexion, and averaged over the number of lordotic poses presented. The lordosis quotient (LQ) was determined as the number of lordosis responses (scores of 2 or 3) divided by the total number of mounts during the scored session. The number of proceptive behaviors was calculated as number of ear wiggles/minute during duration of test, as well as the number of darts and hops through duration of test. Males were scored for total number of mounts and intromissions.</p></sec><sec id="s4-6"><title>Measurement of placental scars</title><p>Post-partum mothers were sacrificed 1-day post-partum. The abdominal cavity was opened and both uterine horns gently removed. Placental scars were identified as distinctive dark brown spots, counted, and logged (<xref ref-type="bibr" rid="bib4">Conaway and Conaway, 1955</xref>).</p></sec><sec id="s4-7"><title>Virus preparation</title><p>The viral vector pLenZs-tetOFF-BFP-shRNAmir-HygR was redesigned based on the backbone of pGIPZ vector originally from Open Biosystems to implement the new features and better single restriction enzyme cutting sites for molecular cloning. Briefly, PCR products for tetOFF and its response elements (TetOff Gene Expression System from Clontech, Mountain View, CA), tagBFP (pTagBFP-H2B vector from Evrogen, Farmingdale, NY), and a hygromycin-resistant gene (pSilencer-hygro vector from Ambion, Grand Island, NY) were inserted in to the original pGIPZ vector to replace the unwanted components (e.g., original fluorescent protein and the puromycin resistant gene). The constructed vector map is shown in <xref ref-type="fig" rid="fig2">Figure 2D</xref>. To construct the shRNA against RFRP, a 22 nucleotide-mer oligo against RFRP gene was designed using the online program maintained by Dr Ravi Sachidanandam's Lab (<ext-link xmlns:xlink="http://www.w3.org/1999/xlink" ext-link-type="uri" xlink:href="http://katahdin.mssm.edu/siRNA/RNAi.cgi?type=shRNA">http://katahdin.mssm.edu/siRNA/RNAi.cgi?type=shRNA</ext-link>). The oligo was inserted into the linearized pLenZs-tetOFF-BFP-shRNAmir-HygR vector using KpnI and EcoRI enzymes after adding enzyme arms on both sides of the oligo using PCR. Lentiviral particles were prepared by PEG-2000 purification of transfected Hek-293 cells and concentrated to titers of 10<sup>9</sup>–10<sup>10</sup> infectious particles per ml. The control virus was a non-silence vector commercially available from Open Biosystems (Lafayette, CO), with similar GC content and BLASTed to verify non-specificity.</p><p>RFRP sequence: CACAGCAAAGAAGGTGACGGAA.</p><p>Control sequence: CTCTCGCTTGGGCGAGAGTAAG.</p></sec><sec id="s4-8"><title>Stereotaxic surgery</title><p>Stereotaxic microinjections of the RFRP-shRNA and scrambled control viral particles were injected in the hypothalamus as described previously (<xref ref-type="bibr" rid="bib8">Goosens and Maren, 2001</xref>). Coordinates for viral injection into the dorsal medial hypothalamus were: −3.3 mm anterior/posterior, ±0.5 mm medial/lateral relative to bregma, −8.4 mm relative to dura with skull level between bregma and lambda. Virus was infused at a rate of 0.2 μl/min for 5 min (1 μl total). At 6–8 hr after surgery, all rats received an injection of meloxicam (2 mg/kg, s.c.).</p></sec><sec id="s4-9"><title>Immunohistochemical staining for virus verification</title><p>One series of free-floating sections were rinsed in 0.1M PBS then incubated in 0.3% H<sub>2</sub>0<sub>2</sub> in PBS for 10 min. After rinsing, tissue was blocked with 2% normal donkey serum, 0.3% Triton-X 100 in PBS, then transferred into primary antibody against GnIH (PAC123/124, Bentley) 1:5000 in PBS plus 0.3% Triton-100 [PBS-T] and sections were incubated in antibody overnight, on rotation, at 4°C. The next day, sections were rinsed in PBS and incubated in secondary for 1 hr at room temperature (Biotin donkey anti-rabbit 1:500, Jackson ImmunoResearch, West Grove, PA). Following rinsing, sections were incubated in ABC reagent (Vector) and then amplified by incubating in biotinylated tyramide for 30 min. Tertiary incubation for 1 hr at room temperature followed with streptavidin-Alexa594 (1:1000 in PBS, Jackson Immunoresearch). Following tertiary incubation, sections were incubated in an antibody against blue-fluorescent protein (anti-BFP; 1:5000, Abcam, Cambridge, MA) on a rotating stage, overnight, at 4°C. The next day, sections were rinsed in PBS then incubated in secondary antibody for 2 hr at room temperature (donkey anti-rabbit cy5, Jackson Immunoresearch). After rinsing in PBS-T, slides were coverslipped using DABCO antifading medium and stored in the dark at 4°C.</p></sec><sec id="s4-10"><title>Real-time reverse transcriptase PCR</title><p>Real-time reverse transcriptase PCR was run on TRIzol-extracted RNA further purified with DNase (DNA-free, Ambion). Rat primers were designed using NCBI Primer BLAST software, which verifies specificity. The Ct values were determined using PCR miner (<xref ref-type="bibr" rid="bib38">Zhao and Fernald, 2005</xref>) and normalized to the ribosomal reference gene, ribosomal protein L16P (RPLP). There were no significant differences in RPLP values across any groups. For all studies, two-step PCR was used, following the manufacturer's instructions for iScript cDNA synthesis kit (BioRad, Hercules, CA) and then the manufacturer's instructions for SsoAdvanced SYBR supermix (BioRad). Samples were run in a BioRad CFX96 real-time PCR system. After the PCR was complete, specificity of each primer pair was confirmed using melt curve analysis, and all samples run on a 2% ethidium bromide agarose gel with a 50-bp DNA ladder (Invitrogen, Carlsbad, CA) to verify correct product size.</p><p>Primer sequences:<table-wrap id="tblu1" position="anchor"><table frame="hsides" rules="groups"><tbody><tr><td>Primer</td><td>Forward</td><td>Reverse</td><td>Temp</td><td>Product Size</td></tr><tr><td>RPLP</td><td>ATCTACTCCGCCCTCATCCT</td><td>GCAGATGAGGCTTCCAATGT</td><td>55</td><td>159</td></tr><tr><td>RFRP</td><td>CCAAAGGTTTGGGAGAACAA</td><td>GGGTCATGGCATAGAGCAAT</td><td>55</td><td>110</td></tr><tr><td>GPR147</td><td>GGTCAGAACGGGAGTGATGT</td><td>AGGAAGATGAGCACGTAGGC</td><td>55</td><td>119</td></tr><tr><td>LH<bold>β</bold></td><td>GCAAAAGCCAGGTCAGGGATAG</td><td>AGGCCCACACCACACTTGG</td><td>55</td><td>92</td></tr><tr><td>FSH<bold>β</bold></td><td>TTCAGCTTTCCCCAGGAGAGATAG</td><td>ATCTTATGGTCTCGTACACCAGCT</td><td>55</td><td>305</td></tr><tr><td>TSH<bold>β</bold></td><td>TCGTTCTCTTTTCCGTGCTT</td><td>CGGTATTTCCACCGTTCTGT</td><td>55</td><td>245</td></tr><tr><td>glycoprotein alpha subunit</td><td>CTATCAGTGTATGGGCTGTTG</td><td>CTTGTGGTAGTAACAAGTGC</td><td>55</td><td>199</td></tr><tr><td>KISS1</td><td>TGGCACCTGTGGTGAACCCTG</td><td>ATCAGGCGACTGCGGGTGGCA</td><td>61.4</td><td>202</td></tr><tr><td>GnRH</td><td>GCAGATCCCTAAGAGGTGAA</td><td>CCGCTGTTGTTCTGTTGACT</td><td>55</td><td>201</td></tr></tbody></table></table-wrap></p></sec><sec id="s4-11"><title>Statistical analysis</title><p>In the chronic stress and reproductive success experiments, group differences in reproductive success, mating success, and pregnancy success were examined using G-statistics and Fisher's exact tests on raw numbers, not percentages. Litter size, placental scar, embryo survival, estradiol measurements, lordosis quotient, and intensity differences were assessed using two-way analysis of variance (ANOVA) followed by Bonferroni post-hoc tests. Differences in genes examined via RT-PCR were analyzed by a Kruskal–Wallis one-way ANOVA followed by Dunn's multiple comparison test for post-hoc analysis. Differences in corticosterone concentrations were subjected to repeated two-way ANOVAs followed by Bonferroni post-hoc test to determine statistical differences. *p < 0.05, **p < 0.01, ***p < 0.001. Statistics were performed using R (for G-statistics and Fisher's exact test) and Prism software.</p></sec></sec></body><back><ack id="ack"><title>Acknowledgements</title><p>We thank Dr I Zucker, D Covarrubias, AR Friedman, and ED Kirby for critical discussion and editorial comments, M Krolikoski and S Sanger for help in data collection, the Berkeley Molecular Imaging Center and H Aaron for imaging help. The University of Virginia Center for Research in Reproduction Ligand Assay and Analysis Core is supported by the Eunice Kennedy Shriver NICHD/NIH (SCCPIR) Grant U54-HD28934.This work was supported by NIMH BRAINS R01 MH087495 (DK) and by NIH R01 HD050470 (LJK).</p></ack><sec sec-type="additional-information"><title>Additional information</title><fn-group content-type="competing-interest"><title>Competing interests</title><fn fn-type="conflict" id="conf1"><p>The authors declare that no competing interests exist.</p></fn></fn-group><fn-group content-type="author-contribution"><title>Author contributions</title><fn fn-type="con" id="con1"><p>ACG, Conception and design, Acquisition of data, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents</p></fn><fn fn-type="con" id="con2"><p>SEM, Conception and design, Acquisition of data, Drafting or revising the article</p></fn><fn fn-type="con" id="con3"><p>SZ, Drafting or revising the article, Contributed unpublished essential data or reagents</p></fn><fn fn-type="con" id="con4"><p>GEB, Conception and design, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents</p></fn><fn fn-type="con" id="con5"><p>LJK, Conception and design, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents</p></fn><fn fn-type="con" id="con6"><p>DK, Conception and design, Analysis and interpretation of data, Drafting or revising the article, Contributed unpublished essential data or reagents</p></fn></fn-group><fn-group content-type="ethics-information"><title>Ethics</title><fn fn-type="other"><p>Animal experimentation: All animal procedures were approved by the UC Berkeley Animal Care and Use Committees (Protocol R303-0313BC) and performed in accordance with the recommendations in the Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. All surgery was performed under isoflurane anesthesia with appropriate pre and post-operative analgesia, and every effort was made to minimize suffering.</p></fn></fn-group></sec><ref-list><title>References</title><ref id="bib1"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Anderson</surname><given-names>G</given-names></name><name><surname>Relf</surname><given-names>H</given-names></name><name><surname>Rizwan</surname><given-names>M</given-names></name><name><surname>Evans</surname><given-names>J</given-names></name></person-group><year>2009</year><article-title>Central and peripheral effects of RFamide-related peptide-3 on luteinizing hormone and prolactin secretion in rats</article-title><source>Endocrinology</source><volume>150</volume><fpage>1834</fpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1212</comment><pub-id pub-id-type="doi">10.1210/en.2008-1359</pub-id></element-citation></ref><ref id="bib2"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Blaustein</surname><given-names>JD</given-names></name></person-group><year>2008</year><article-title>Neuroendocrine regulation of feminine sexual behavior: lessons from rodent models and thoughts about humans</article-title><source>Annual Review of Psychology</source><volume>59</volume><fpage>93</fpage><lpage>118</lpage><pub-id pub-id-type="doi">10.1146/annurev.psych.59.103006.093556</pub-id></element-citation></ref><ref id="bib3"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ciccone</surname><given-names>NA</given-names></name><name><surname>Dunn</surname><given-names>IC</given-names></name><name><surname>Boswell</surname><given-names>T</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name><name><surname>Ubuka</surname><given-names>T</given-names></name><name><surname>Ukena</surname><given-names>K</given-names></name><name><surname>Sharp</surname><given-names>PJ</given-names></name></person-group><year>2004</year><article-title>Gonadotrophin inhibitory hormone depresses gonadotrophin alpha and follicle-stimulating hormone beta subunit expression in the pituitary of the domestic chicken</article-title><source>Journal of Neuroendocrinology</source><volume>16</volume><fpage>999</fpage><lpage>1006</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1278</comment><pub-id pub-id-type="doi">10.1111/j.1365-2826.2005.01260.x</pub-id></element-citation></ref><ref id="bib4"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Conaway</surname><given-names>CH</given-names></name><name><surname>Conaway</surname><given-names>BYCH</given-names></name></person-group><year>1955</year><article-title>Embryo resorption and placental scar Formation in the rat</article-title><source>Journal of Mammalogy</source><volume>36</volume><fpage>516</fpage><lpage>532</lpage><pub-id pub-id-type="doi">10.2307/1375806</pub-id></element-citation></ref><ref id="bib5"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Du Ruisseau</surname><given-names>P</given-names></name><name><surname>Taché</surname><given-names>Y</given-names></name><name><surname>Brazeau</surname><given-names>P</given-names></name><name><surname>Collu</surname><given-names>R</given-names></name></person-group><year>1979</year><article-title>Effects of chronic immobilization stress on pituitary hormone secretion, on hypothalamic factor levels, and on pituitary responsiveness to LHRH and TRH in female rats</article-title><source>Neuroendocrinology</source><volume>29</volume><fpage>90</fpage><lpage>99</lpage><pub-id pub-id-type="doi">10.1159/000122910</pub-id></element-citation></ref><ref id="bib6"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ducret</surname><given-names>E</given-names></name><name><surname>Anderson</surname><given-names>GM</given-names></name><name><surname>Herbison</surname><given-names>AE</given-names></name></person-group><year>2009</year><article-title>RFamide-related peptide-3, a mammalian gonadotropin-inhibitory hormone ortholog, regulates gonadotropin-releasing hormone neuron firing in the mouse</article-title><source>Endocrinology</source><volume>150</volume><fpage>2799</fpage><lpage>2804</lpage><pub-id pub-id-type="doi">10.1210/en.2008-1623</pub-id></element-citation></ref><ref id="bib7"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ferin</surname><given-names>M</given-names></name></person-group><year>1999</year><article-title>Clinical review 105: stress and the reproductive cycle</article-title><source>The Journal of Clinical Endocrinology and Metabolism</source><volume>84</volume><fpage>1768</fpage><lpage>1774</lpage><pub-id pub-id-type="doi">10.1210/jcem.84.6.5367</pub-id></element-citation></ref><ref id="bib8"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Goosens</surname><given-names>KA</given-names></name><name><surname>Maren</surname><given-names>S</given-names></name></person-group><year>2001</year><article-title>Contextual and auditory fear conditioning are mediated by the lateral, basal, and central amygdaloid nuclei in rats</article-title><source>Learning & Memory</source><volume>8</volume><fpage>148</fpage><lpage>155</lpage><pub-id pub-id-type="doi">10.1101/lm.37601</pub-id></element-citation></ref><ref id="bib9"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Hardy</surname><given-names>DF</given-names></name><name><surname>Debold</surname><given-names>JF</given-names></name></person-group><year>1971</year><article-title>Effects of mounts without intromission upon the behavior of female rats during the onset of estrogen-induced heat</article-title><source>Physiology & Behavior</source><volume>7</volume><fpage>643</fpage><lpage>645</lpage><pub-id pub-id-type="doi">10.1016/0031-9384(71)90120-X</pub-id></element-citation></ref><ref id="bib10"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Johnson</surname><given-names>M</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name><name><surname>Fraley</surname><given-names>G</given-names></name></person-group><year>2007</year><article-title>Rat RFamide-related peptide-3 stimulates GH secretion, inhibits LH secretion, and has variable effects on sex behavior in the adult male rat</article-title><source>Hormones and Behavior</source><volume>51</volume><fpage>171</fpage><lpage>180</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1258</comment><pub-id pub-id-type="doi">10.1016/j.yhbeh.2006.09.009</pub-id></element-citation></ref><ref id="bib11"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kirby</surname><given-names>ED</given-names></name><name><surname>Geraghty</surname><given-names>AC</given-names></name><name><surname>Ubuka</surname><given-names>T</given-names></name><name><surname>Bentley</surname><given-names>GE</given-names></name><name><surname>Kaufer</surname><given-names>D</given-names></name></person-group><year>2009</year><article-title>Stress increases putative gonadotropin inhibitory hormone and decreases luteinizing hormone in male rats</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>106</volume><fpage>11324</fpage><lpage>11329</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1273</comment><pub-id pub-id-type="doi">10.1073/pnas.0901176106</pub-id></element-citation></ref><ref id="bib12"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kriegsfeld</surname><given-names>L</given-names></name><name><surname>Mei</surname><given-names>DF</given-names></name><name><surname>Bentley</surname><given-names>GE</given-names></name><name><surname>Ubuka</surname><given-names>T</given-names></name><name><surname>Mason</surname><given-names>AO</given-names></name><name><surname>Inoue</surname><given-names>K</given-names></name><name><surname>Ukena</surname><given-names>K</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name><name><surname>Silver</surname><given-names>R</given-names></name></person-group><year>2006</year><article-title>Identification and characterization of a gonadotropin-inhibitory system in the brains of mammals</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>103</volume><fpage>2410</fpage><lpage>2415</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1216</comment><pub-id pub-id-type="doi">10.1073/pnas.0511003103</pub-id></element-citation></ref><ref id="bib13"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Kriegsfeld</surname><given-names>LJ</given-names></name><name><surname>Gibson</surname><given-names>EM</given-names></name><name><surname>Williams</surname><given-names>WP</given-names><suffix>III</suffix></name><name><surname>Zhao</surname><given-names>S</given-names></name><name><surname>Mason</surname><given-names>AO</given-names></name><name><surname>Bentley</surname><given-names>GE</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name></person-group><year>2010</year><article-title>The roles of RFamide-related peptide-3 in mammalian reproductive function and behaviour</article-title><source>Journal of Neuroendocrinology</source><volume>22</volume><fpage>692</fpage><lpage>700</lpage><pub-id pub-id-type="doi">10.1111/j.1365-2826.2010.02031.x</pub-id></element-citation></ref><ref id="bib14"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Lee Son</surname><given-names>Y</given-names></name><name><surname>Ubuka</surname><given-names>T</given-names></name><name><surname>Narihiro</surname><given-names>M</given-names></name><name><surname>Fukuda</surname><given-names>Y</given-names></name><name><surname>Hasunuma</surname><given-names>I</given-names></name><name><surname>Yamamoto</surname><given-names>K</given-names></name><name><surname>Belsham</surname><given-names>DD</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name></person-group><year>2014</year><article-title>Molecular basis for the activation of gonadotropin-inhibitory hormone gene transcription by corticosterone</article-title><source>Endocrinology</source><volume>155</volume><fpage>1817</fpage><lpage>1826</lpage><pub-id pub-id-type="doi">10.1210/en.2013-2076</pub-id></element-citation></ref><ref id="bib15"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Louis</surname><given-names>GM</given-names></name><name><surname>Lum</surname><given-names>KJ</given-names></name><name><surname>Sundaram</surname><given-names>R</given-names></name><name><surname>Chen</surname><given-names>Z</given-names></name><name><surname>Kim</surname><given-names>S</given-names></name><name><surname>Lynch</surname><given-names>CD</given-names></name><name><surname>Schisterman</surname><given-names>EF</given-names></name><name><surname>Pyper</surname><given-names>C</given-names></name></person-group><year>2011</year><article-title>Stress reduces conception probabilities across the fertile window: evidence in support of relaxation</article-title><source>Fertility and Sterility</source><volume>95</volume><fpage>2184</fpage><lpage>2189</lpage><pub-id pub-id-type="doi">10.1016/j.fertnstert.2010.06.078</pub-id></element-citation></ref><ref id="bib16"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Murakami</surname><given-names>M</given-names></name><name><surname>Matsuzaki</surname><given-names>T</given-names></name><name><surname>Iwasa</surname><given-names>T</given-names></name><name><surname>Yasui</surname><given-names>T</given-names></name><name><surname>Irahara</surname><given-names>M</given-names></name><name><surname>Osugi</surname><given-names>T</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name></person-group><year>2008</year><article-title>Hypophysiotropic role of RFamide-related peptide-3 in the inhibition of LH secretion in female rats</article-title><source>The Journal of Endocrinology</source><volume>199</volume><fpage>105</fpage><lpage>112</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1255</comment><pub-id pub-id-type="doi">10.1677/JOE-08-0197</pub-id></element-citation></ref><ref id="bib17"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Piekarski</surname><given-names>DJ</given-names></name><name><surname>Zhao</surname><given-names>S</given-names></name><name><surname>Jennings</surname><given-names>KJ</given-names></name><name><surname>Iwasa</surname><given-names>T</given-names></name><name><surname>Legan</surname><given-names>SJ</given-names></name><name><surname>Mikkelsen</surname><given-names>JD</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name><name><surname>Kriegsfeld</surname><given-names>LJ</given-names></name></person-group><year>2013</year><article-title>Gonadotropin-inhibitory hormone reduces sexual motivation but not lordosis behavior in female Syrian hamsters (Mesocricetus auratus)</article-title><source>Hormones and Behavior</source><volume>64</volume><fpage>501</fpage><lpage>510</lpage><pub-id pub-id-type="doi">10.1016/j.yhbeh.2013.06.006</pub-id></element-citation></ref><ref id="bib18"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pineda</surname><given-names>R</given-names></name><name><surname>Garcia-Galiano</surname><given-names>D</given-names></name><name><surname>Sanchez-Garrido</surname><given-names>MA</given-names></name><name><surname>Romero</surname><given-names>M</given-names></name><name><surname>Ruiz-Pino</surname><given-names>F</given-names></name><name><surname>Aguilar</surname><given-names>E</given-names></name><name><surname>Dijcks</surname><given-names>FA</given-names></name><name><surname>Blomenröhr</surname><given-names>M</given-names></name><name><surname>Pinilla</surname><given-names>L</given-names></name><name><surname>van Noort</surname><given-names>PI</given-names></name><name><surname>Tena-Sempere</surname><given-names>M</given-names></name></person-group><year>2010</year><article-title>Characterization of the inhibitory roles of RFRP3, the mammalian ortholog of GnIH, in the control of gonadotropin secretion in the rat: in vivo and in vitro studies</article-title><source>American Journal of Physiology Endocrinology and Metabolism</source><volume>299</volume><fpage>E39</fpage><lpage>E46</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1269</comment><pub-id pub-id-type="doi">10.1152/ajpendo.00108.2010</pub-id></element-citation></ref><ref id="bib19"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Pineda</surname><given-names>R</given-names></name><name><surname>Garcia-Galiano</surname><given-names>D</given-names></name><name><surname>Sanchez-Garrido</surname><given-names>MA</given-names></name><name><surname>Romero</surname><given-names>M</given-names></name><name><surname>Ruiz-Pino</surname><given-names>F</given-names></name><name><surname>Aguilar</surname><given-names>E</given-names></name><name><surname>Dijcks</surname><given-names>FA</given-names></name><name><surname>Blomenröhr</surname><given-names>M</given-names></name><name><surname>Pinilla</surname><given-names>L</given-names></name><name><surname>van Noort</surname><given-names>PI</given-names></name><name><surname>Tena-Sempere</surname><given-names>M</given-names></name></person-group><year>2010</year><article-title>Characterization of the potent gonadotropin-releasing activity of RF9, a selective antagonist of RF-amide-related peptides and neuropeptide FF receptors: physiological and pharmacological implications</article-title><source>Endocrinology</source><volume>151</volume><fpage>1902</fpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1214</comment><pub-id pub-id-type="doi">10.1210/en.2009-1259</pub-id></element-citation></ref><ref id="bib20"><element-citation publication-type="journal"><person-group person-group-type="author"><collab>Practice Committee of the American Society for Reproductive Medicine in collaboration with the Society for Reproductive Endocrinology and Infertility</collab></person-group><year>2008</year><article-title>Optimizing natural fertility</article-title><source>Fertility and Sterility</source><volume>90</volume><fpage>S1</fpage><lpage>S6</lpage><pub-id pub-id-type="doi">10.1016/j.fertnstert.2008.08.122</pub-id></element-citation></ref><ref id="bib21"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rivier</surname><given-names>C</given-names></name><name><surname>Rivest</surname><given-names>S</given-names></name></person-group><year>1991</year><article-title>Effect of stress on the activity of the hypothalamic-pituitary-gonadal axis: peripheral and central mechanisms</article-title><source>Biology of Reproduction</source><volume>45</volume><fpage>523</fpage><lpage>532</lpage><pub-id pub-id-type="doi">10.1095/biolreprod45.4.523</pub-id></element-citation></ref><ref id="bib22"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rizwan</surname><given-names>MZ</given-names></name><name><surname>Porteous</surname><given-names>R</given-names></name><name><surname>Herbison</surname><given-names>AE</given-names></name><name><surname>Anderson</surname><given-names>GM</given-names></name></person-group><year>2009</year><article-title>Cells expressing RFamide-related peptide-1/3, the mammalian gonadotropin-inhibitory hormone orthologs, are not hypophysiotropic neuroendocrine neurons in the rat</article-title><source>Endocrinology</source><volume>150</volume><fpage>1413</fpage><lpage>1420</lpage><pub-id pub-id-type="doi">10.1210/en.2008-1287</pub-id></element-citation></ref><ref id="bib23"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Rizwan</surname><given-names>MZ</given-names></name><name><surname>Poling</surname><given-names>MC</given-names></name><name><surname>Corr</surname><given-names>M</given-names></name><name><surname>Cornes</surname><given-names>PA</given-names></name><name><surname>Augustine</surname><given-names>RA</given-names></name><name><surname>Quennell</surname><given-names>JH</given-names></name><name><surname>Kauffman</surname><given-names>AS</given-names></name><name><surname>Anderson</surname><given-names>GM</given-names></name></person-group><year>2012</year><article-title>RFamide-related peptide-3 receptor gene expression in GnRH and kisspeptin neurons and GnRH-dependent mechanism of action</article-title><source>Endocrinology</source><volume>153</volume><fpage>3770</fpage><lpage>3779</lpage><pub-id pub-id-type="doi">10.1210/en.2012-1133</pub-id></element-citation></ref><ref id="bib24"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sari</surname><given-names>IP</given-names></name><name><surname>Rao</surname><given-names>A</given-names></name><name><surname>Smith</surname><given-names>JT</given-names></name><name><surname>Tilbrook</surname><given-names>AJ</given-names></name><name><surname>Clarke</surname><given-names>IJ</given-names></name></person-group><year>2009</year><article-title>Effect of RF-amide-related peptide-3 on luteinizing hormone and follicle-stimulating hormone synthesis and secretion in ovine pituitary gonadotropes</article-title><source>Endocrinology</source><volume>150</volume><fpage>5549</fpage><lpage>5556</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1243</comment><pub-id pub-id-type="doi">10.1210/en.2009-0775</pub-id></element-citation></ref><ref id="bib25"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sato</surname><given-names>Y</given-names></name><name><surname>Suzuki</surname><given-names>N</given-names></name><name><surname>Horita</surname><given-names>H</given-names></name><name><surname>Wada</surname><given-names>H</given-names></name><name><surname>Shibuya</surname><given-names>A</given-names></name><name><surname>Adachi</surname><given-names>H</given-names></name><name><surname>Tsukamoto</surname><given-names>T</given-names></name><name><surname>Kumamoto</surname><given-names>Y</given-names></name><name><surname>Yamamoto</surname><given-names>M</given-names></name></person-group><year>1996</year><article-title>Effects of long-term psychological stress on sexual behavior and brain catecholamine levels</article-title><source>Journal of Andrology</source><volume>17</volume><fpage>83</fpage><lpage>90</lpage></element-citation></ref><ref id="bib26"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Sirinathsinghji</surname><given-names>DJ</given-names></name><name><surname>Rees</surname><given-names>LH</given-names></name><name><surname>Rivier</surname><given-names>J</given-names></name><name><surname>Vale</surname><given-names>W</given-names></name></person-group><year>1983</year><article-title>Corticotropin-releasing factor is a potent inhibitor of sexual receptivity in the female rat</article-title><source>Nature</source><volume>305</volume><fpage>232</fpage><lpage>235</lpage><pub-id pub-id-type="doi">10.1038/305232a0</pub-id></element-citation></ref><ref id="bib27"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Son</surname><given-names>YL</given-names></name><name><surname>Ubuka</surname><given-names>T</given-names></name><name><surname>Millar</surname><given-names>RP</given-names></name><name><surname>Kanasaki</surname><given-names>H</given-names></name></person-group><year>2012</year><article-title>Gonadotropin-inhibitory hormone inhibits GnRH- induced gonadotropin subunit gene transcriptions by inhibiting AC/cAMP/PKA-dependent ERK Pathway in L[beta]T2 cells</article-title><source>Endocrinology</source><volume>153</volume><fpage>2332</fpage><lpage>2343</lpage><pub-id pub-id-type="doi">10.1210/en.2011-1904</pub-id></element-citation></ref><ref id="bib28"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tilbrook</surname><given-names>AJ</given-names></name><name><surname>Turner</surname><given-names>AI</given-names></name><name><surname>Clarke</surname><given-names>IJ</given-names></name></person-group><year>2000</year><article-title>Effects of stress on reproduction in non-rodent mammals: the role of glucocorticoids and sex differences</article-title><source>Reviews of Reproduction</source><volume>5</volume><fpage>105</fpage><lpage>113</lpage><pub-id pub-id-type="doi">10.1530/ror.0.0050105</pub-id></element-citation></ref><ref id="bib28a"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Tsutsui</surname><given-names>K</given-names></name><name><surname>Saigoh</surname><given-names>E</given-names></name><name><surname>Ukena</surname><given-names>K</given-names></name><name><surname>Teranishi</surname><given-names>H</given-names></name><name><surname>Fujisawa</surname><given-names>Y</given-names></name><name><surname>Kikuchi</surname><given-names>M</given-names></name><name><surname>Ishii</surname><given-names>S</given-names></name><name><surname>Sharp</surname><given-names>PJ</given-names></name></person-group><year>2000</year><article-title>A novel avian hypothalamic peptide inhibiting gonadotropin release</article-title><source>Biochemical and Biophysical Research Communications</source><volume>275</volume><fpage>661</fpage><lpage>667</lpage><pub-id pub-id-type="doi">10.1006/bbrc.2000.3350</pub-id></element-citation></ref><ref id="bib29"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ubuka</surname><given-names>T</given-names></name><name><surname>Lai</surname><given-names>H</given-names></name><name><surname>Kitani</surname><given-names>M</given-names></name><name><surname>Suzuuchi</surname><given-names>A</given-names></name><name><surname>Pham</surname><given-names>V</given-names></name><name><surname>Cadigan</surname><given-names>PA</given-names></name><name><surname>Wang</surname><given-names>A</given-names></name><name><surname>Chowdhury</surname><given-names>VS</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name><name><surname>Bentley</surname><given-names>GE</given-names></name></person-group><year>2009</year><article-title>Gonadotropin-inhibitory hormone identification, cDNA cloning, and distribution in rhesus macaque brain</article-title><source>The Journal of Comparative Neurology</source><volume>517</volume><fpage>841</fpage><lpage>855</lpage><pub-id pub-id-type="doi">10.1002/cne.22191</pub-id></element-citation></ref><ref id="bib30"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ubuka</surname><given-names>T</given-names></name><name><surname>Morgan</surname><given-names>K</given-names></name><name><surname>Pawson</surname><given-names>AJ</given-names></name><name><surname>Osugi</surname><given-names>T</given-names></name><name><surname>Chowdhury</surname><given-names>VS</given-names></name><name><surname>Minakata</surname><given-names>H</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name><name><surname>Millar</surname><given-names>RP</given-names></name><name><surname>Bentley</surname><given-names>GE</given-names></name></person-group><year>2009</year><article-title>Identification of human GnIH homologs, RFRP-1 and RFRP-3, and the cognate receptor, GPR147 in the human hypothalamic pituitary axis</article-title><source>PLOS ONE</source><volume>4</volume><fpage>1334</fpage><lpage>1339</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1233</comment><pub-id pub-id-type="doi">10.1371/journal.pone.0008400</pub-id></element-citation></ref><ref id="bib31"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ubuka</surname><given-names>T</given-names></name><name><surname>Inoue</surname><given-names>K</given-names></name><name><surname>Fukuda</surname><given-names>Y</given-names></name><name><surname>Mizuno</surname><given-names>T</given-names></name><name><surname>Ukena</surname><given-names>K</given-names></name><name><surname>Kriegsfeld</surname><given-names>LJ</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name></person-group><year>2011</year><article-title>Identification, expression, and physiological functions of Siberian hamster gonadotropin-inhibitory hormone</article-title><source>Endocrinology</source><volume>153</volume><fpage>373</fpage><lpage>385</lpage><comment>Available at: papers://cf7c60b8–94a1-4c79-88e4-6c57345fd583/Paper/p1335</comment><pub-id pub-id-type="doi">10.1210/en.2011-1110</pub-id></element-citation></ref><ref id="bib32"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ubuka</surname><given-names>T</given-names></name><name><surname>Inoue</surname><given-names>K</given-names></name><name><surname>Fukuda</surname><given-names>Y</given-names></name><name><surname>Mizuno</surname><given-names>T</given-names></name><name><surname>Ukena</surname><given-names>K</given-names></name><name><surname>Kriegsfeld</surname><given-names>LJ</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name></person-group><year>2012</year><article-title>Identification, expression, and physiological functions of Siberian hamster gonadotropin-inhibitory hormone</article-title><source>Endocrinology</source><volume>153</volume><fpage>373</fpage><lpage>385</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1434</comment><pub-id pub-id-type="doi">10.1210/en.2011-1110</pub-id></element-citation></ref><ref id="bib33"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ukena</surname><given-names>K</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name></person-group><year>2001</year><article-title>Distribution of novel RFamide-related peptide-like immunoreactivity in the mouse central nervous system</article-title><source>Neuroscience Letters</source><volume>300</volume><fpage>153</fpage><lpage>156</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1304</comment><pub-id pub-id-type="doi">10.1016/S0304-3940(01)01583-X</pub-id></element-citation></ref><ref id="bib34"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Ukena</surname><given-names>K</given-names></name><name><surname>Iwakoshi</surname><given-names>E</given-names></name><name><surname>Minakata</surname><given-names>H</given-names></name><name><surname>Tsutsui</surname><given-names>K</given-names></name></person-group><year>2002</year><article-title>A novel rat hypothalamic RFamide-related peptide identified by immunoaffinity chromatography and mass spectrometry</article-title><source>FEBS Letters</source><volume>512</volume><fpage>255</fpage><lpage>258</lpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1299</comment><pub-id pub-id-type="doi">10.1016/S0014-5793(02)02275-5</pub-id></element-citation></ref><ref id="bib35"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wasser</surname><given-names>SK</given-names></name><name><surname>Barash</surname><given-names>DP</given-names></name></person-group><year>1983</year><article-title>Reproductive suppression among female mammals: implications for biomedicine and sexual selection theory</article-title><source>The Quarterly Review of Biology</source><volume>58</volume><fpage>513</fpage><lpage>538</lpage><pub-id pub-id-type="doi">10.1086/413545</pub-id></element-citation></ref><ref id="bib36"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Wu</surname><given-names>M</given-names></name><name><surname>Dumalska</surname><given-names>I</given-names></name><name><surname>Morozova</surname><given-names>E</given-names></name><name><surname>Van Den Pol</surname><given-names>A</given-names></name><name><surname>Alreja</surname><given-names>M</given-names></name></person-group><year>2009</year><article-title>Gonadotropin inhibitory hormone inhibits basal forebrain vGluT2-gonadotropin-releasing hormone neurons via a direct postsynaptic mechanism</article-title><source>The Journal of Physiology</source><volume>587</volume><fpage>1401</fpage><comment>Available at: papers://cf7c60b8-94a1-4c79-88e4-6c57345fd583/Paper/p1234</comment><pub-id pub-id-type="doi">10.1113/jphysiol.2008.166447</pub-id></element-citation></ref><ref id="bib37"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Young</surname><given-names>AJ</given-names></name><name><surname>Carlson</surname><given-names>AA</given-names></name><name><surname>Monfort</surname><given-names>SL</given-names></name><name><surname>Russell</surname><given-names>AF</given-names></name><name><surname>Bennett</surname><given-names>NC</given-names></name><name><surname>Clutton-Brock</surname><given-names>T</given-names></name></person-group><year>2006</year><article-title>Stress and the suppression of subordinate reproduction in cooperatively breeding meerkats</article-title><source>Proceedings of the National Academy of Sciences of USA</source><volume>103</volume><fpage>12005</fpage><lpage>12010</lpage><pub-id pub-id-type="doi">10.1073/pnas.0510038103</pub-id></element-citation></ref><ref id="bib38"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhao</surname><given-names>S</given-names></name><name><surname>Fernald</surname><given-names>RD</given-names></name></person-group> <year>2005</year><article-title>Comprehensive algorithm for quantitative real-time polymerase chain reaction</article-title><source>Journal of Computational Biology</source><volume>12</volume><fpage>1047</fpage><lpage>1064</lpage><pub-id pub-id-type="doi">10.1089/cmb.2005.12.1047</pub-id></element-citation></ref><ref id="bib39"><element-citation publication-type="journal"><person-group person-group-type="author"><name><surname>Zhao</surname><given-names>LH</given-names></name><name><surname>Cui</surname><given-names>XZ</given-names></name><name><surname>Yuan</surname><given-names>HJ</given-names></name><name><surname>Liang</surname><given-names>B</given-names></name><name><surname>Zheng</surname><given-names>LL</given-names></name><name><surname>Liu</surname><given-names>YX</given-names></name><name><surname>Luo</surname><given-names>MJ</given-names></name><name><surname>Tan</surname><given-names>JH</given-names></name></person-group><year>2013</year><article-title>Restraint stress inhibits mouse implantation: temporal window and the involvement of HB-EGF, estrogen and progesterone</article-title><source>PLOS ONE</source><volume>8</volume><fpage>e80472</fpage><pub-id pub-id-type="doi">10.1371/journal.pone.0080472</pub-id></element-citation></ref></ref-list></back><sub-article article-type="article-commentary" id="SA1"><front-stub><article-id pub-id-type="doi">10.7554/eLife.04316.008</article-id><title-group><article-title>Decision letter</article-title></title-group><contrib-group content-type="section"><contrib contrib-type="editor"><name><surname>Fernald</surname><given-names>Russ</given-names></name><role>Reviewing editor</role><aff><institution>Stanford University</institution>, <country>United States</country></aff></contrib></contrib-group></front-stub><body><boxed-text><p>eLife posts the editorial decision letter and author response on a selection of the published articles (subject to the approval of the authors). An edited version of the letter sent to the authors after peer review is shown, indicating the substantive concerns or comments; minor concerns are not usually shown. Reviewers have the opportunity to discuss the decision before the letter is sent (see <ext-link ext-link-type="uri" xlink:href="http://elifesciences.org/review-process">review process</ext-link>). Similarly, the author response typically shows only responses to the major concerns raised by the reviewers.</p></boxed-text><p>Thank you for sending your work entitled “Knockdown of a single gene prevents stress-induced infertility and embryo resorption” for consideration at <italic>eLife</italic>. Your article has been favorably evaluated by a Senior editor, a Reviewing editor, and 2 reviewers.</p><p>The Reviewing editor and the two reviewers discussed their comments before we reached this decision, and the Reviewing editor has assembled the following comments to help you prepare a revised submission.</p><p>This study is novel and interesting, and could potentially have significant impact. There are some concerns, however, and the questions listed below need to be addressed:</p><p>1) Knowing the levels of reproductive hormones, especially E2 and progesterone, is critical for interpreting pregnancy measures and sexual behavior, not to mention mRNA expression of multiple genes measured, and could potentially alter how the current data are interpreted. Stress can alter E2 levels and E2 can down-regulate RFRP expression in rodent hypothalamus (Molnar et al, 2011, Endocrinology; Poling et al, 2012, Endocrinology), strongly alters KISS expression (Smith et al., 2005, Endocrinology), and is essential for normal female sexual behavior and hence, successful fertility (Pfaff, 1973, Science; Rissman et al, 1997, Endocrinology). Decreases in circulating serum LH values are frequently reported to demonstrate that HPG axis is impaired by stress treatments (including in the context of RFRP; Kirby et al. 2009, PNAS). Without knowing circulating E2 or LH values, it is difficult to interpret the current experimental paradigm and outcomes. Could reproductive behavioral deficits or reversals reflective of changes in E2 levels? Is the increase in RFRP seen after stress a secondary effect due to stress's down-regulation of E2, which will result in a removal of E2 inhibition on RFRP expression? Is the neuroendocrine reproductive axis functionally active during this chronic stress paradigm (e.g. are estrous cycles normal during or after the 18 days of stress)? Are serum E2 and LH levels reversed in stressed RFRP knockdown rats? Is progesterone altered during pregnancy by the stress paradigm or prior RFRP knockdown?</p><p>2) It is not clear what value or significance the pituitary data in <xref ref-type="fig" rid="fig2">Figure 2</xref> add, especially since many of the study's reproductive measures (mating, pregnancy, embryo survival, etc.) are not directly regulated by gonadotropins but only indirectly influenced due to ovarian sex steroid secretion. Additionally, most of the pituitary genes did not change (except during estrous in a few cases), making the functional significance unclear. Even in the few cases where pituitary genes changed, it is not certain these are functionally relevant changes, since serum LH, FSH, or E2 levels are not reported. LH release is itself regulated separately from transcription and does not always reflect mRNA levels (further necessitating the measure of serum LH levels).</p><p>3) The authors may need to determine if the recovery from “RFRP knockdown” to “normal elevated RFRP” itself alters reproductive success, independent of stress history. A possible interpretation of the authors' data is that RFRP add-back, via DOX suppression of the shRNA, has an unexpected positive effect on fertility, which is counteracting any negative effects of prior stress, rather than the interpretation that RFRP knockdown during stress is the important factor. This is supported by the findings that reproductive success is 64% in “unstressed, scrambled controls,” but 87% in “unstressed shRNA knockdown-then add back“ rats. This is a 23% difference, which is not unsubstantial. Likewise, pregnancy success was 15% higher in control rats with previous RFRP knockdown relative to control animals without prior RFRP knockdown.</p><p>4) The authors need to provide some data about how their stress paradigm affects pre-mating reproductive measures, as well as greater discussion as to how changes in RFRP's actions are possibly transduced to influence mating and fertility many days later. Did females cycle or ovulate normally during or after the stress period? It is inferred that cycles were normal since females were reported to be in all phases of the estrous cycle, but cyclicity data was not shown. It would also seem that ovulation was normal, assuming no differences in # of placental scars between groups (this data was not reported but should be). If cycles, ovulation, and circulating gonadotropins and E2 are normal, then females are either not stressed or estrous cycles and ovulation are resistant (or habituate) to repeated immobilization stress whereas mating and pregnancy physiology are more stress-sensitive. If so, what's the possible mechanism or model for how stress or early changes in RFRP well before mating persist to influence pregnancy later on when CORT and RFRP are back to normal levels? Particularly in regards to pregnancy and copulation success, is RFRP acting on mating neural circuits? Or pregnancy physiology? Is embryo resorption a stress-induced uterine or ovarian pregnancy hormone issue influenced somehow by brain RFRP signaling?</p><p>5) The authors conclude that the stress-induced dysfunction in reproduction is solely the effect of RFRP3, however, there is much evidence that kisspeptin (KISS) is also greatly down regulated) by stress (e.g., Kinsey-Jones et al, 2008, J Neuroendocrinology). Yet, the authors report no changes in KISS. This contradictory outcome is not properly discussed. Additionally, there is a limitation with the KISS measures in that the hypothalamic chunk contains several distinct KISS populations, which often show differential responses to treatments, and play different functional roles in fertility. Combining the separate KISS populations together in one measure diminishes interpretability.</p><p>6) Considering that there was no effect of chronic stress on lordosis quotient or lordosis intensity (4I and 4J), the dysfunction presented in 4C and 4D may be the fault of the partner breeder male, not the female. Lack of intromissions with a lordotic female would be suggestive of male, not female, sexual dysfunction.</p><p>7) In <xref ref-type="fig" rid="fig1 fig2">Figures 1 and 2</xref>, in each graph the data should all be plotted be relative to diestrus control, not relative to control animals within each separate cycle stage, since the latter way abolishes cycle changes in gene expression, which are themselves important to assess with and without stress.</p><p>8) There are some concerns over the use of the proper statistics/analyses in several cases.</p><p>a) A 1-way ANOVA is inappropriate for determining whether stress (vs. control) responded differently in the shRNA vs. scrambled animals. This comparison warrants use of 2-way ANOVA to determine if there is a significant interaction between treatments (shRNA vs. Scrambled) and group (control vs. Stress).</p><p>b) In <xref ref-type="fig" rid="fig1 fig2">Figures 1 and 2</xref>, the control animal error bars appear to be identical and plotted twice, for both stress and post-stress. Was there only one control group (if so, killed on what day?) or were there two control groups (stressed and 4d recovery) that were then combined? In either case, what is the rationale for not using separate control groups for each scenario, stressed and post-stress recovery?</p><p>c) “Unsuccessful maters” where thrown out of the study, but no information is given on this. Which group(s) were these animals from? Why were these rats not included in the lordosis quotient and lordosis intensity (with scores of 0, as would be appropriate for animals that did not show lordosis)? These animals are potentially an important aspect of the analysis.</p></body></sub-article><sub-article article-type="reply" id="SA2"><front-stub><article-id pub-id-type="doi">10.7554/eLife.04316.009</article-id><title-group><article-title>Author response</article-title></title-group></front-stub><body><p><italic>1) Knowing the levels of reproductive hormones, especially E2 and progesterone, is critical for interpreting pregnancy measures and sexual behavior, not to mention mRNA expression of multiple genes measured, and could potentially alter how the current data are interpreted. Stress can alter E2 levels and E2 can down-regulate RFRP expression in rodent hypothalamus (Molnar et al, 2011, Endocrinology; Poling et al, 2012, Endocrinology), strongly alters KISS expression (Smith et al., 2005, Endocrinology), and is essential for normal female sexual behavior and hence, successful fertility (Pfaff, 1973, Science; Rissman et al, 1997, Endocrinology). Decreases in circulating serum LH values are frequently reported to demonstrate that HPG axis is impaired by stress treatments (including in the context of RFRP; Kirby et al. 2009, PNAS). Without knowing circulating E2 or LH values, it is difficult to interpret the current experimental paradigm and outcomes. Could reproductive behavioral deficits or reversals reflective of changes in E2 levels? Is the increase in RFRP seen after stress a secondary effect due to stress's down-regulation of E2, which will result in a removal of E2 inhibition on RFRP expression? Is the neuroendocrine reproductive axis functionally active during this chronic stress paradigm (e.g. are estrous cycles normal during or after the 18 days of stress)? Are serum E2 and LH levels reversed in stressed RFRP knockdown rats? Is progesterone altered during pregnancy by the stress paradigm or prior RFRP knockdown?</italic></p><p>In response to the reviewers’ request we measured E2 and LH. In an effort to minimize additional stressors to the females in addition to the immobilization stress that occurred prior to mating and pregnancy, blood samples were only taken during the stress exposure at 9am (before the stressor began) and at 12pm (when the stressor was terminated) and not taken from controls or pregnant dams. This limits our ability to measure reproductive hormones in the present study at other time points, precluding measurements of progesterone in pregnant dams. We were able to analyze levels of LH and E2 from tail bleed samples taken throughout the stressor. The LH blood levels peak in Sprague-dawley females about 3 hours before lights out (5pm) and are low throughout the rest of the cycle. Accordingly, LH measurements in most samples fell below the detection range and did not differ among conditions.</p><p>However, we were able to measure E2 in stressed animals across all cycle stages and compare treatment with scrambled or RFRP shRNA virus, as well as compare animals that successfully mated with those that did not. These new and exciting data are now added to <xref ref-type="fig" rid="fig4">figure 4A</xref>. In short, we found that stressed animals that received RFRP shRNA virus had significantly higher serum estradiol levels in the morning of proestrus than stressed animals that received the control scrambled virus, implying the RFRP knockdown reverses the stress-induced blockade of the E2 rise that occurs during proestrus. Analysis of proestrus E2 levels by mating success revealed that animals that received RFRP shRNA and successfully mated had significantly higher estradiol levels than both successful and unsuccessful maters in the control scrambled groups. The data are now added to <xref ref-type="fig" rid="fig3s1">Figure 3–figure supplement 1A and B</xref>, described in the Results section, and interpretation of the results in light of these additional data is added to the Discussion.</p><p><italic>Is the neuroendocrine reproductive axis functionally active during this chronic stress paradigm (e.g</italic>. <italic>are estrous cycles normal during or after the 18 days of stress)?</italic></p><p>The estrous cycle continues normally during and after the 18 days of stress. This observation has now been added to the manuscript to read: “Rats were monitored daily by vaginal smear to determine whether estrous cyclicity was affected during application of the stressor and to allow separation of animals into different cycle stages (diestrus, proestrus and estrus) at the termination of the stressor. Stress did not affect estrous cyclicity, with all animals exhibiting normal vaginal cytology throughout the stressor.”</p><p><italic>2) It is not clear what value or significance the pituitary data in</italic> <xref ref-type="fig" rid="fig2"><italic>Figure 2</italic></xref> <italic>add, especially since many of the study's reproductive measures (mating, pregnancy, embryo survival, etc.) are not directly regulated by gonadotropins but only indirectly influenced due to ovarian sex steroid secretion. Additionally, most of the pituitary genes did not change (except during estrous in a few cases), making the functional significance unclear. Even in the few cases where pituitary genes changed, it is not certain these are functionally relevant changes, since serum LH, FSH, or E2 levels are not reported. LH release is itself regulated separately from transcription and does not always reflect mRNA levels (further necessitating the measure of serum LH levels)</italic>.</p><p>We have removed all the pituitary data.</p><p><italic>3) The authors may need to determine if the recovery from “RFRP knockdown” to “normal elevated RFRP” itself alters reproductive success, independent of stress history. A possible interpretation of the authors' data is that RFRP add-back, via DOX suppression of the shRNA, has an unexpected positive effect on fertility, which is counteracting any negative effects of prior stress, rather than the interpretation that RFRP knockdown during stress is the important factor. This is supported by the findings that reproductive success is 64% in “unstressed, scrambled controls,” but 87% in “unstressed shRNA knockdown-then add back” rats. This is a 23% difference, which is not unsubstantial. Likewise, pregnancy success was 15% higher in control rats with previous RFRP knockdown relative to control animals without prior RFRP knockdown</italic>.</p><p>The difference (e.g. 64% vs. 87%) was non-significant though we understand the reviewer’s concern. We suspected that this difference may be due to the smaller number of animals in the control group (that resulted from a cage removed from the study because of fighting wounds) and not reflecting a biological difference. To test this possibility, we ran an additional experiment: control animals received either RFRP shRNA or control scrambled virus via stereotaxic injections in the hypothalamus (n=12 total). Copulation, pregnancy success and embryo survival were measured in this cohort. The new data were added to the dataset in <xref ref-type="fig" rid="fig3">Figure 3C-H</xref>, and they demonstrate that reproductive success is not different in the control group treated with RFRP shRNA compared to control scrambled. (Reproductive success: 76 vs. 80%; pregnancy success: 87 vs. 89%; Copulation success: 88 vs. 90%; Embryo survival: 98 vs. 98%).</p><p><italic>4) The authors need to provide some data about how their stress paradigm affects pre-mating reproductive measures, as well as greater discussion as to how changes in RFRP's actions are possibly transduced to influence mating and fertility many days later. Did females cycle or ovulate normally during or after the stress period? It is inferred that cycles were normal since females were reported to be in all phases of the estrous cycle, but cyclicity data was not shown. It would also seem that ovulation was normal, assuming no differences in # of placental scars between groups (this data was not reported but should be). If cycles, ovulation, and circulating gonadotropins and E2 are normal, then females are either not stressed or estrous cycles and ovulation are resistant (or habituate) to repeated immobilization stress whereas mating and pregnancy physiology are more stress-sensitive. If so, what's the possible mechanism or model for how stress or early changes in RFRP well before mating persist to influence pregnancy later on when CORT and RFRP are back to normal levels? Particularly in regards to pregnancy and copulation success, is RFRP acting on mating neural circuits? Or pregnancy physiology? Is embryo resorption a stress-induced uterine or ovarian pregnancy hormone issue influenced somehow by brain RFRP signaling?</italic></p><p>According to our cytology measurements (explained above), females continue to cycle normally throughout the stress procedure, although RFRP levels are elevated throughout and E2 levels are low. To be included in the study, animals had to exhibit normal vaginal cytology during the 4-5 day estrous cycle after the stress ended.</p><p>Additionally, we have now added the data reporting no difference in the number of placental scars (<xref ref-type="fig" rid="fig2">Figure 2G</xref>).</p><p>The following section has been added to our discussion to consider a possible mechanism: “The stress-induced rise in RFRP may be acting on neural circuits influencing mating and pregnancy, potentially independently of sex steroids. RFRP projects to multiple brain regions responsible for successful reproduction and mating behavior, including the medial preoptic area (mPOA) (where it is known to affect GnRH release) as well as the BNST, medial amygdala, anterior hypothalamus and arcuate nucleus (<xref ref-type="bibr" rid="bib12">Kriegsfeld et al., 2006</xref>). Piekarski et. al. found that administering RFRP3 to hamsters reduced sexual motivation (as measured by percent of time spent with castrated vs. intact males) and vaginal scent marking without effect on lordosis behavior, similar to our present findings. Additionally, RFRP3 administration altered cellular activation in regions of the brain implicated in female sexual motivation, including the mPOA, medial amygdala, and BNST - all regions that receive RFRP projections. These effects were independent of gonadal steroids and kisspeptin cellular activation (<xref ref-type="bibr" rid="bib4">Conaway and Conaway, 1955</xref>). While we were unable to measure progesterone or prolactin in this study, it is possible that RFRP projections to the arcuate nucleus affect dopaminergic signaling required for prolactin release and maintenance of progesterone levels and pregnancy success. Future studies aimed at systematically examining each step in these processes is required to gain a full understanding of the neural circuits underlying the deleterious effects of stress on reproduction.”</p><p><italic>5) The authors conclude that the stress-induced dysfunction in reproduction is solely the effect of RFRP3, however, there is much evidence that kisspeptin (KISS) is also greatly down regulated) by stress (e.g., Kinsey-Jones et al, 2008, J Neuroendocrinology). Yet, the authors report no changes in KISS. This contradictory outcome is not properly discussed. Additionally, there is a limitation with the KISS measures in that the hypothalamic chunk contains several distinct KISS populations, which often show differential responses to treatments, and play different functional roles in fertility. Combining the separate KISS populations together in one measure diminishes interpretability</italic>.</p><p>As this reviewers indicate, the KISS measurements are difficult to interpret as anterior and posterior cell populations cannot be disambiguated. It is possible that a change in one population, without an accompanying change in the other, masks a significant effect. As a result, we cannot rule out a role for kisspeptin downstream of RFRP. This consideration is now discussed in the manuscript text. However, suppression of RFRP during stress was sufficient to rescue the impact of stress on reproductive outcomes, underscoring the role of RFRP (vs. kisspeptin involvement). These points are now clarified in the Discussion of the revised manuscript.</p><p><italic>6) Considering that there was no effect of chronic stress on lordosis quotient or lordosis intensity (4I and 4J), the dysfunction presented in 4C and 4D may be the fault of the partner breeder male, not the female. Lack of intromissions with a lordotic female would be suggestive of male</italic>, <italic>not female, sexual dysfunction.</italic></p><p>In the original figure we presented the behavioral data (lordosis quotient or lordosis intensity) from the successful maters only, showing no differences between groups. Based on the reviewer suggestion to score non-maters as 0, we have now changed the figure to include unsuccessful maters with the successful maters for both lordosis quotient and intensity (new <xref ref-type="fig" rid="fig3s1">Figure 3–figure supplement 1C and D</xref>), and results described in the text. We found a significant main effect of stress on lordosis intensity, though post hoc tests showed no significant differences within groups. Lordosis quotient measures revealed significantly lower ratio in the scrambled stress group compared to the nonstressed groups that received scrambled or RFRP-shRNA (0.30±0.10 vs. 0.73±0.07 and 0.68±0.07), indicating that stress exposure decreased the relative sexual receptivity of the females (<xref ref-type="fig" rid="fig3s1">Figure 3–figure supplement 1D</xref>), congruent with the stress-induced drop in mating success. Interestingly, LQ ratios in stressed females that received RFRP-shRNA were not significantly different from controls ratios (0.53±0.10, <xref ref-type="fig" rid="fig3s1">Figure 3–figure supplement 1D</xref>), demonstrating that knockdown of RFRP reversed the stress-induced decrease in sexual receptivity, and congruent with the reversal of mating success found in this group.</p><p><italic>7) In</italic> <xref ref-type="fig" rid="fig1 fig2"><italic>Figures 1 and 2</italic></xref><italic>, in each graph the data should all be plotted be relative to diestrus control, not relative to control animals within each separate cycle stage, since the latter way abolishes cycle changes in gene expression, which are themselves important to assess with and without stress</italic>.</p><p><xref ref-type="fig" rid="fig1">Figure 1</xref> data has all been reevaluated so that each group (18D and 18D+4) is analyzed relative to diestrus control. The only case is which this markedly changed the original data is found in <xref ref-type="fig" rid="fig1">Figure 1F</xref>, where we no longer see an increase in the RFRP receptor during proestrus. GnRH appears lower in proestrus animals after stress, however this difference is not significant.</p><p><italic>8) There are some concerns over the use of the proper statistics/analyses in several cases</italic>.</p><p><italic>a) A 1-way ANOVA is inappropriate for determining whether stress (vs. control) responded differently in the shRNA vs. scrambled animals. This comparison warrants use of 2-way ANOVA to determine if there is a significant interaction between treatments (shRNA vs. Scrambled) and group (control vs. Stress)</italic>.</p><p>We thank the reviewers for noting this oversight that has now been remedied. Data is now analyzed using a 2-way ANOVA, and the Methods, Results and figure legend has been edited to reflect this change.</p><p><italic>b) In</italic> <xref ref-type="fig" rid="fig1 fig2"><italic>Figures 1 and 2</italic></xref><italic>, the control animal error bars appear to be identical and plotted twice, for both stress and post-stress. Was there only one control group (if so, killed on what day?) or were there two control groups (stressed and 4d recovery) that were then combined? In either case, what is the rationale for not using separate control groups for each scenario, stressed and post-stress recovery?</italic></p><p>Originally, all groups (18D and 18D+4) were shown on the same graph and controls were collapsed as they were not statistically different. When they were separated into different graphs, the control groups were not appropriately separated. We thank the reviewer for identifying this error. We re-plotted these graphs each with their own controls.</p><p><italic>c) “Unsuccessful maters” where thrown out of the study, but no information is given on this. Which group(s) were these animals from? Why were these rats not included in the lordosis quotient and lordosis intensity (with scores of 0, as would be appropriate for animals that did not show lordosis)? These animals are potentially an important aspect of the analysis</italic>.</p><p>Unsuccessful maters were found in all groups: sample sizes have been incorporated into the figure legend to indicate where animals were removed from each step. Lordosis quotient and intensity has been moved to <xref ref-type="fig" rid="fig3s1">Figure 3–figure supplement 1C and D</xref>, and now includes totals of all animals, rather than separated by mating. (See answer to comment 6.)</p></body></sub-article></article> |