Permalink
Browse files

Add input data

  • Loading branch information...
laduplessis committed Feb 2, 2017
1 parent 6f2ae2f commit da5a3fb8f2c3b4e4cd5a23fceb961d6003d6ec31
Showing with 449 additions and 0 deletions.
  1. +63 −0 data/26.nex
  2. +64 −0 data/29.nex
  3. +67 −0 data/47.nex
  4. +63 −0 data/53.nex
  5. +64 −0 data/59.nex
  6. +64 −0 data/64.nex
  7. +64 −0 data/72.nex
@@ -0,0 +1,63 @@
#NEXUS
[TBO26oLong]
BEGIN DATA;
DIMENSIONS NTAX =26 NCHAR=614;
FORMAT DATATYPE = DNA GAP = - MISSING = ?;
MATRIX
Orthogeomys_heterodus ATTCTAGGCAAAAAG-AGCAATGCTGGAGGTATTACAATACCAGACTTCAAACTTTACTATAGAGCCATAATAACAAAAACCGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAATGGAAYAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGTCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCACCATGCACAGGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCAGAAACCGTGAAACTGCTACATGATAAAGTAGGAGAGACACTGGAACTCATAGGCACAGGGGAAAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATAGGAGAAAGACTCAATAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGATAAAAACATAGT-CGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAATAATACATCTGACAAATGCTTGAT--ATCCAGT-ATCTACAGGGAACTCAAGAAATTAATC
Thomomys_bottae_awahnee_a ????????????????????ATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACMCAGTCTATTCAATTATTGGKGCTGGCAAAACTGGGCAGCCMCATGCARAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
Thomomys_bottae_awahnee_b ????????????????????ATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAACTGCTACATGATAAAGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAAAGATTCCTGAACAGAATCCCAGGGTCM-CAACAGATTGGAGAGAGACTCGATAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGATAAAAACATAGTT-GCAAAAGT????????????????????????????????????????????????????????????????????????????????????????????????????
Thomomys_bottae_xerophilus ????????????????????ATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAAYTGCTACATGATAAAGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAAAGATTCCTGAA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
Thomomys_bottae_cactophilus ????????????????AGCAATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAAYGTCAGACCGGAAACCGTGAAAYTGTTACATGATAAAGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAA????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
Thomomys_bottae_albatus ????????????????AGCAATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGATCCAGAAATAGAACCAC-ATACCTATAGTCAACTTGTATTTGATAAAGGAGCTAAAGATATACAGTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCATTTCACCATGCACAAGAATTAACTCAAAGTGGATCAAAGACCTCAATGTCAGACCT-------------------------------------CATAGGCACTCATAGGCACAGGCAAAAGATTCCTATACAGGAACCCAGGGTCAACAACAGATTGGAGAGAGACTCAATAAATGGGACTACCTAAAAATAAAA-GTTTCTGCAC?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
Thomomys_bottae_ruidosae ????????????????AGCAATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCARAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAATGTCAGACCGGAAACCGTGAAAYTGCTACATGATAAAGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAAAG??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
Thomomys_bottae_bottae ????????????????AGCAATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAATGTCAGACCGGAAACCGTGAAACTGCTACATGATAAAGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAAAAATTCCTGAACAGAATCCCAGGGTCA-CAACAGATKGGAGAGAGACTCGATAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGATAAAAACATAGTT-GCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATA?????????????????????????????????????????????????????????????????????
Thomomys_bottae_alpinus ????????????????AGCAATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCTATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCA??????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
Thomomys_bottae_riparius ????????????????AGCAATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAACTGCTACATGATAAAGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAAAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGATAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGATAAAAACATAGT-TGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACA???????????????????????????????????????????????????????????
Thomomys_bottae_mewa ????????????????????ATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCATTTCACCATGCACAAGAATTAACTCAAAGTGGATCAAAGACCTCAATGTCAGACCGGAAACCGTGAAA???????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
Thomomys_bottae_saxatilis ????????????????????ATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACARTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAA?????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????????
Thomomys_bottae_laticeps ????????????????????ATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACARTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAATTGCTACATGATAAWGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAAAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCAATAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGATAAAAACATAGTT-GCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATAT????????????????????????????????????????????????????????????????????
Thomomys_talpoides_ocius ???CTAGGCAAAA-G-AGC-ATGCTGGTGGTATCACAATACCAGACTTCAAACTTTACTATAAAGCCATAATAACAAAAACTGC-TTGGTACTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGATATAGAACCAC-ACAACTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATMCAATGGAACGAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGAAAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCRACGTCAGACCGGAAACCGTGAAACTGCTACATGATAATGTAGGAGAGACACTGGAACTCATAGGCACAGGAAACAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGACAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGACAAAAACATAGT-CKCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACAATGTATCTGACAAATGCTTAAT--ATCCAGC-ATCTACAGAGAACTCAAGAAACTAATC
Thomomys_idahoensis_pygmaeus_a ????????CAAAA-G-AGCAATGCTGGTGGTATYACAATACCAGACTTCAAACTTTACTATAAAGCCATAATAACAAAAACTGC-TTGGTACTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGATATAGAACCAC-ACAACTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATMCAATGGAACGAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGAAAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCRACGTCAGACCGGAAACCGTGAAACTGCTACATGATAATGTAGGAGAGACACTGGAACTCATAGGCACAGGAAACAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGACAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGACAAAAACATAGT-CGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACAATRTATCTGACAAATGCTTAAT--ATCCAGC-ATCTACAGAGAACTCAAGAAACTAATC
Thomomys_idahoensis_pygmaeus_b ????GGCGCAAAA-G-AGCAATGCTGGTGGTATCACAATACCAGACTTCAAACTTTACTATAAAGCCATAATAACAAAAACTGC-TTGGTACTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGATATAGAACCAC-ACAACTATAGGCAACTTRTATTTGACAAAGGAGCCAAAGATATMCAATGGAACGAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGAAAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAACTGCTACATGATAATGTAGGAGAGACACTGGAACTCATAGGCACAGGAAACAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGACAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGACAAAAACATAGT-CGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACAATRTATCTGACAAATGCTTAAT--ATCCAGCTATCTACAGAGAACTCAAGAAACTAATC
Thomomys_mazama_mazama ATTCTAGGCAAAAAGAAGCAATGCTGGTGGTATCACAATACCAGACTTCAAACTTTACTATAAAGCCATAATAACAAAAACTGC-TTGGTACTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGATATAGAACCAC-ACAACTATAGGCAACTTRTATTTGACAAAGGAGCCAAAGATATACAATGGAACGAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGAAAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAACTGCTACATGATAATGTAGGAGAGACACTGGAAYTCATAGGCACAGGAAACAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGACAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGACAAAAACATAGT-CGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACAATGTATCTGACAAATGCTTAAT--ATCCAGC-ATCTACAGAGAACTCAAGAAACTAATC
Thomomys_mazama_nasicus ATTCTAGGCAAAAAG-AGCAATGCTGGTGGTATCACAATACCAGACTTCAAACTTTACTATAAAGCCATAATAACAAAAACTGC-TTGGTACTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGATATAGAACCAC-ACAACTATAGGCAACTTRTATTTGACAAAGGAGCCAAAGATATACAATGGAACGAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGAAAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCSCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAACTGCTACATGATAATGTAGGAGAGACACTGGAAYTCATAGGCACAGGAAACAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGACAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGACAAAAACATAGT-CGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACAATGTATCTGACAAATGCTTAAT--ATCCAGC-ATCTACAGAGAACTCAAGAAACTA-TC
Thomomys_monticola_a ??????????????G-AGCAATGCTGGTGGTATCACAATACCAGACTTCAAACTTTACTATAAAGCCATAATAACAAAAACTGC-TTGGTACTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGATATAGAACCAC-ACAACTATAGGCAACTTRTATTTGACAAAGGAGCCAAAGATATACAATGGAACGAACACAGYCTATTCAATTATTGGTGCTGGCAAAACTGGAAAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAACTGCTACATGATAATGTAGGAGAGACACTGGAACTCATAGGCACAGGAAACAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGACAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGACAAAAACATAGT-CGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACAATRTATCTGACAAATGCTTAAT--ATCCAGC-ATCTACAGAGAACTCAAGAAACTAATC
Thomomys_monticola_b ATTCTAGGCAAAAAG-AGCAATGCTGGTGGTATYACAATACCAGACTTCAAACTTTACTATAAAGCCATAATAACAAAAACTGC-TTGGTACTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAWATAGAACCAC-ACAACTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAATGGAACRAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGAAAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAACTGCTACATGATAATGTAGGAGAGACACTGGAACTCATAGGCACAGGAAACAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGACAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGACAAAAACATAGT-CGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACAATATATCTGACAAATGCTTAAT--ATCCAGC-ATCTACAGAGAACTCAAGAAACTAATC
Thomomys_talpoides_yakimensis ATTCTAGGCAAAA-G-AGCAATGCTGGTGGTATCACAATACCAGACTTCAAACTKTACTATAAAGCCATAATAACAAAAACTGC-TTGGTACTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGATATAGAACCAC-ACAACTATAGGCAACTTRTATTTGACAAAGGAGCCAAAGATATACAATGGAACGAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGAAAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAAYGTCAGACCGGAAACCGTGAAACTGCTACATGATAATGTAGGAGAGACACTGGAAYTCATAGGCACAGGAAACAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGACAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGACAAAAACATAGT-CGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACAATGTATCTGACAAATGCTTAAT--ATCCAGC-ATCTACAGAGAACTCAAGAAACTAATC
Thomomys_talpoides_bridgeri ATTCTAGGCAAAAAG-AGCAATGCTGGTGGTATCACAATACCAGACTTCAAACTTTACTATAAAGCCATAATAACAAAAACTGC-TTGGTACTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGATATAGAACCAC-ACAACTATAGGCAACTTRTATTTGACAAAGGAGCCAAAGATATCCAATGGAACGAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGAAAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCRACGTCAGACCGGAAACCGTGAAACTGCTACATGATAATGTAGGAGAGACACTGGAACTCATAGGCACAGGAAACAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGACAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGACAAAAACATAGT-CGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACAATGTATCTGACAAATGCTTAAT--ATCCAGC-ATCTACAGAGAACTCAAGAAACTAATC
Thomomys_townsendii_townsendii ATTCTAGGCAAAAAG-AGCAATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACARTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTYGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAACTGCTACATGATAAAGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAAAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGATAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGATAAAAACATAGTCTGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCCACAATACATCTGACAAATGCTTAAT--ATCCAGT-ATCTACAGG-AACTCAAG?????????
Thomomys_townsendii_relictus ??????????????G-AGCAATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTAYTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCACTATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACAATGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAACGTCAGACCGGAAACCGTGAAATTGCTACATGATAAWGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAAAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGATAAATGGGACTACCTAAAAATAAAATGTTTCTGTACAGATAAAAACATAG???????????????????????????????????????????????????????????????????????????????????????????????????????????????
Thomomys_umbrinus_chihuahuae ?????????????AG-AGC-ATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGC-TTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGGCAACTTGTATTTGACAAAGGAGCCAAAGATATACARTGGAACAAACACAGTCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCTTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAATGTCAGACCGGAAACCGTGAAACTGCTACATGATAAAGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAAAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGATAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGATAAAAACATAGT-TGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCAACAATACATCTGACAAATGCTTAAT--ATCCAGT-ATCTACA????????????????????
Thomomys_umbrinus_atroavarius ATTCTAGGCAAAAAG-AGCAATGCTGGTGGTATTACAATACCAGACTTCAAACTCTACTATAGAGCCATAATAACAAAAACTGCATTGGTATTGGCACAAAAACAGACCAGAAGATCAGTGGAACAGAATAGAAGACCCAGAAATAGAACCAC-ATACCTATAGKCAACTTGTATTTGACAAAGGAGCCAAAGATATACAGTGGAACAAACACAGYCTATTCAATTATTGGTGCTGGCAAAACTGGGCAGCCACATGCAGAAAACTAAAAATTGACCCTAGCCTTTCGCCATGCACAAGCATTAACTCAAAGTGGATCAAAGACCTCAAYGTCAGACCGGAAACCGTGAAATTGCTACATGATAAAGTAGGAGAGACACTGGAACTCATAGGCACAGGCAAAAGATTCCTGAACAGAATCCCAGGGTCA-CAACAGATTGGAGAGAGACTCGATAAATGGGACTACCTAAAAATAAAAAGTTTCTGTACAGATAAAAACATAGT-TGCAAAAGTAGAGAGACAGCCAACCAACTGGGAAAAGATATTCACCCACAATACATCTGACAAATGCTT-ATATATCCAGT-ATCTACAGAGAACTCAAG?????????
;
END;
Oops, something went wrong.

0 comments on commit da5a3fb

Please sign in to comment.