test/bench/go1: first draft of Go 1 benchmark suite

I have included a few important microbenchmarks,
but the overall intent is to have mostly end-to-end
benchmarks timing real world operations.

The jsondata.go file is a summary of agl's
activity in various open source repositories.
It gets used as test data for many of the benchmarks.

Everything links into one binary (even the test data)
so that it is easy to run the benchmarks on many
computers: there is just one file to copy around.

R=golang-dev, r, bradfitz, adg, r
CC=golang-dev
https://golang.org/cl/5484071

Author: rsc

src/clean.bash

@@ -24,7 +24,7 @@ for i in lib9 libbio libmach cmd pkg \
 	../misc/cgo/life ../misc/cgo/test \
 	../misc/dashboard/builder ../misc/goplay\
 	../doc/codelab/wiki\
-	../test/bench/shootout ../test/bench/garbage
+	../test/bench/shootout ../test/bench/garbage ../test/bench/go1
 do
 	# Do not use gomake here. It may not be available.
 	$MAKE -C "$GOROOT/src/$i" clean

src/run.bash

@@ -105,6 +105,10 @@ done
 ./timing.sh -test
 ) || exit $?
 
+(xcd ../test/bench/go1
+gomake test
+) || exit $?
+
 (xcd ../test
 ./run
 ) || exit $?

test/bench/go1/Makefile

@@ -0,0 +1,7 @@
+include $(GOROOT)/src/Make.inc
+
+TARG=go1
+GOFILES=\
+	dummy.go\
+
+include $(GOROOT)/src/Make.pkg

test/bench/go1/binarytree_test.go

@@ -0,0 +1,63 @@
+// Copyright 2011 The Go Authors.  All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark, taken from the shootout, tests garbage collector
+// performance by generating and discarding large binary trees.
+
+package go1
+
+import "testing"
+
+type binaryNode struct {
+	item        int
+	left, right *binaryNode
+}
+
+func bottomUpTree(item, depth int) *binaryNode {
+	if depth <= 0 {
+		return &binaryNode{item: item}
+	}
+	return &binaryNode{item, bottomUpTree(2*item-1, depth-1), bottomUpTree(2*item, depth-1)}
+}
+
+func (n *binaryNode) itemCheck() int {
+	if n.left == nil {
+		return n.item
+	}
+	return n.item + n.left.itemCheck() - n.right.itemCheck()
+}
+
+const minDepth = 4
+
+func binarytree(n int) {
+	maxDepth := n
+	if minDepth+2 > n {
+		maxDepth = minDepth + 2
+	}
+	stretchDepth := maxDepth + 1
+
+	check := bottomUpTree(0, stretchDepth).itemCheck()
+	//fmt.Printf("stretch tree of depth %d\t check: %d\n", stretchDepth, check)
+
+	longLivedTree := bottomUpTree(0, maxDepth)
+
+	for depth := minDepth; depth <= maxDepth; depth += 2 {
+		iterations := 1 << uint(maxDepth-depth+minDepth)
+		check = 0
+
+		for i := 1; i <= iterations; i++ {
+			check += bottomUpTree(i, depth).itemCheck()
+			check += bottomUpTree(-i, depth).itemCheck()
+		}
+		//fmt.Printf("%d\t trees of depth %d\t check: %d\n", iterations*2, depth, check)
+	}
+	longLivedTree.itemCheck()
+	//fmt.Printf("long lived tree of depth %d\t check: %d\n", maxDepth, longLivedTree.itemCheck())
+}
+
+func BenchmarkBinaryTree17(b *testing.B) {
+	for i := 0; i < b.N; i++ {
+		binarytree(17)
+	}
+}

test/bench/go1/dummy.go

@@ -0,0 +1,3 @@
+package go1
+
+// Nothing to see here: everything is in the _test files.

test/bench/go1/fannkuch_test.go

@@ -0,0 +1,84 @@
+// Copyright 2011 The Go Authors.  All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+// This benchmark, taken from the shootout, tests array indexing
+// and array bounds elimination performance.
+
+package go1
+
+import "testing"
+
+func fannkuch(n int) int {
+	if n < 1 {
+		return 0
+	}
+
+	n1 := n - 1
+	perm := make([]int, n)
+	perm1 := make([]int, n)
+	count := make([]int, n)
+
+	for i := 0; i < n; i++ {
+		perm1[i] = i // initial (trivial) permutation
+	}
+
+	r := n
+	didpr := 0
+	flipsMax := 0
+	for {
+		if didpr < 30 {
+			didpr++
+		}
+		for ; r != 1; r-- {
+			count[r-1] = r
+		}
+
+		if perm1[0] != 0 && perm1[n1] != n1 {
+			flips := 0
+			for i := 1; i < n; i++ { // perm = perm1
+				perm[i] = perm1[i]
+			}
+			k := perm1[0] // cache perm[0] in k
+			for {         // k!=0 ==> k>0
+				for i, j := 1, k-1; i < j; i, j = i+1, j-1 {
+					perm[i], perm[j] = perm[j], perm[i]
+				}
+				flips++
+				// Now exchange k (caching perm[0]) and perm[k]... with care!
+				j := perm[k]
+				perm[k] = k
+				k = j
+				if k == 0 {
+					break
+				}
+			}
+			if flipsMax < flips {
+				flipsMax = flips
+			}
+		}
+
+		for ; r < n; r++ {
+			// rotate down perm[0..r] by one
+			perm0 := perm1[0]
+			for i := 0; i < r; i++ {
+				perm1[i] = perm1[i+1]
+			}
+			perm1[r] = perm0
+			count[r]--
+			if count[r] > 0 {
+				break
+			}
+		}
+		if r == n {
+			return flipsMax
+		}
+	}
+	return 0
+}
+
+func BenchmarkFannkuch11(b *testing.B) {
+	for i := 0; i < b.N; i++ {
+		fannkuch(11)
+	}
+}

test/bench/go1/fasta_test.go

@@ -0,0 +1,164 @@
+// Copyright 2011 The Go Authors.  All rights reserved.
+// Use of this source code is governed by a BSD-style
+// license that can be found in the LICENSE file.
+
+package go1
+
+// Not a benchmark; input for revcomp.
+
+var fasta25m = fasta(25e6)
+
+func fasta(n int) []byte {
+	out := make(fastaBuffer, 0, 11*n)
+
+	iub := []fastaAcid{
+		{prob: 0.27, sym: 'a'},
+		{prob: 0.12, sym: 'c'},
+		{prob: 0.12, sym: 'g'},
+		{prob: 0.27, sym: 't'},
+		{prob: 0.02, sym: 'B'},
+		{prob: 0.02, sym: 'D'},
+		{prob: 0.02, sym: 'H'},
+		{prob: 0.02, sym: 'K'},
+		{prob: 0.02, sym: 'M'},
+		{prob: 0.02, sym: 'N'},
+		{prob: 0.02, sym: 'R'},
+		{prob: 0.02, sym: 'S'},
+		{prob: 0.02, sym: 'V'},
+		{prob: 0.02, sym: 'W'},
+		{prob: 0.02, sym: 'Y'},
+	}
+
+	homosapiens := []fastaAcid{
+		{prob: 0.3029549426680, sym: 'a'},
+		{prob: 0.1979883004921, sym: 'c'},
+		{prob: 0.1975473066391, sym: 'g'},
+		{prob: 0.3015094502008, sym: 't'},
+	}
+
+	alu := []byte(
+		"GGCCGGGCGCGGTGGCTCACGCCTGTAATCCCAGCACTTTGG" +
+			"GAGGCCGAGGCGGGCGGATCACCTGAGGTCAGGAGTTCGAGA" +
+			"CCAGCCTGGCCAACATGGTGAAACCCCGTCTCTACTAAAAAT" +
+			"ACAAAAATTAGCCGGGCGTGGTGGCGCGCGCCTGTAATCCCA" +
+			"GCTACTCGGGAGGCTGAGGCAGGAGAATCGCTTGAACCCGGG" +
+			"AGGCGGAGGTTGCAGTGAGCCGAGATCGCGCCACTGCACTCC" +
+			"AGCCTGGGCGACAGAGCGAGACTCCGTCTCAAAAA")
+
+	out.WriteString(">ONE Homo sapiens alu\n")
+	fastaRepeat(&out, alu, 2*n)
+	out.WriteString(">TWO IUB ambiguity codes\n")
+	fastaRandom(&out, iub, 3*n)
+	out.WriteString(">THREE Homo sapiens frequency\n")
+	fastaRandom(&out, homosapiens, 5*n)
+	return out
+}
+
+type fastaBuffer []byte
+
+func (b *fastaBuffer) Flush() {
+	panic("flush")
+}
+
+func (b *fastaBuffer) WriteString(s string) {
+	p := b.NextWrite(len(s))
+	copy(p, s)
+}
+
+func (b *fastaBuffer) NextWrite(n int) []byte {
+	p := *b
+	if len(p)+n > cap(p) {
+		b.Flush()
+		p = *b
+	}
+	out := p[len(p) : len(p)+n]
+	*b = p[:len(p)+n]
+	return out
+}
+
+const fastaLine = 60
+
+func fastaRepeat(out *fastaBuffer, alu []byte, n int) {
+	buf := append(alu, alu...)
+	off := 0
+	for n > 0 {
+		m := n
+		if m > fastaLine {
+			m = fastaLine
+		}
+		buf1 := out.NextWrite(m + 1)
+		copy(buf1, buf[off:])
+		buf1[m] = '\n'
+		if off += m; off >= len(alu) {
+			off -= len(alu)
+		}
+		n -= m
+	}
+}
+
+const (
+	fastaLookupSize          = 4096
+	fastaLookupScale float64 = fastaLookupSize - 1
+)
+
+var fastaRand uint32 = 42
+
+type fastaAcid struct {
+	sym   byte
+	prob  float64
+	cprob float64
+	next  *fastaAcid
+}
+
+func fastaComputeLookup(acid []fastaAcid) *[fastaLookupSize]*fastaAcid {
+	var lookup [fastaLookupSize]*fastaAcid
+	var p float64
+	for i := range acid {
+		p += acid[i].prob
+		acid[i].cprob = p * fastaLookupScale
+		if i > 0 {
+			acid[i-1].next = &acid[i]
+		}
+	}
+	acid[len(acid)-1].cprob = 1.0 * fastaLookupScale
+
+	j := 0
+	for i := range lookup {
+		for acid[j].cprob < float64(i) {
+			j++
+		}
+		lookup[i] = &acid[j]
+	}
+
+	return &lookup
+}
+
+func fastaRandom(out *fastaBuffer, acid []fastaAcid, n int) {
+	const (
+		IM = 139968
+		IA = 3877
+		IC = 29573
+	)
+	lookup := fastaComputeLookup(acid)
+	for n > 0 {
+		m := n
+		if m > fastaLine {
+			m = fastaLine
+		}
+		buf := out.NextWrite(m + 1)
+		f := fastaLookupScale / IM
+		myrand := fastaRand
+		for i := 0; i < m; i++ {
+			myrand = (myrand*IA + IC) % IM
+			r := float64(int(myrand)) * f
+			a := lookup[int(r)]
+			for a.cprob < r {
+				a = a.next
+			}
+			buf[i] = a.sym
+		}
+		fastaRand = myrand
+		buf[m] = '\n'
+		n -= m
+	}
+}