========================================================== Maximum likelihood reconstruction of ancient DNA fragments

QUESTIONS : gabriel [dot] reno [ at sign ] gmail.com

About

leeHom is a program for the maximum likelihood reconstruction of ancient DNA (the binary is mergeTrimReadsBAM)

Downloading:

Go to https://github.com/grenaud/leeHom and either:

1. Download ZIP

or

2. Do a "git clone --recursive https://github.com/grenaud/leeHom.git"

Installation:

Make sure you have cmake installed, if not install it by typing "apt-get install cmake" for Ubuntu for example.

1. Build Bamtools first:

   cd bamtools/
   mkdir build/
   cd build/ cmake .. make cd ../..

2. Build the submodules and main code by typing :

   make

running the program:

To launch the program simply type:

src/leeHom

Test data:

A small test set of 50,000 ancient DNA sequences from the Altai Neandertal can be found here:

testData/rawAncientDNA.bam

To launch the reconstruction program for this test data set, use the following command :

src/leeHom -f AGATCGGAAGAGCACACGTCTGAACTCCAG -s GGAAGAGCGTCGTGTAGGGAAAGAGTGTAG --ancientdna  -o testData/reconsAncientDNA.bam testData/rawAncientDNA.bam

The reconstructed ancient DNA fragments will be in

testData/reconsAncientDNA.bam

for fastq data:

src/leeHom -f AGATCGGAAGAGCACACGTCTGAACTCCAG -s GGAAGAGCGTCGTGTAGGGAAAGAGTGTAG --ancientdna  -fq1 testData/rawAncientDNA.f1.gz -fq2 testData/rawAncientDNA.f2.gz -fqo testData/outfq

The output files will have the testData/outfq* prefix.