Skip to content
The stand-alone version of VITCOMIC2 (http://vitcomic.org/).
Branch: master
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Type Name Latest commit message Commit time
Failed to load latest commit information.
.gitignore
FASTQFASTA.pl
LICENSE
MimicCluster.pl
Parse_Single.pl
PileupGenera.pl
PileupGenera2.pl
README.md
Refs_14_04_11.SPlist.Pro.txt
Refs_14_04_11.SPlist.Pro.txt.mapseq
Refs_14_04_11.fasta.one.fa.dup.gz
Refs_14_04_11.fasta.one.fa.dup.mscluster
RemovePhiHu.pl
phiX174.fasta

README.md

vitcomic2 local

The stand-alone version of VITCOMIC2 (http://vitcomic.org/).

Before VITCOMIC2, we recommend you to conduct quality filtering of reads.

download and install fastp https://github.com/OpenGene/fastp

download and install bwa https://sourceforge.net/projects/bio-bwa/files/

Quality filtering example:

bwa index -a bwtsw phiX174.fasta
vi QFtest.sh
for i in *.fastq;do
bwa mem phiX174.fasta $i> $i.sam
perl RemovePhiHu.pl $i $i.sam
fastp -i $i.rem.fastq -o $i.rem2.fastq -G -3 -n 1 -l 90 -w 1 -x
fastp -i $i.rem2.fastq -o $i.rem3.fastq -G -3 -n 1 -l 90 -w 1 -a ATGCCGTCTTCTGCTTG
fastp -i $i.rem3.fastq -o $i.rem4.fastq -G -3 -n 1 -l 90 -w 1 -a GAGACTAAGGCGAATCTCGT
fastp -i $i.rem4.fastq -o $i.rem5.fastq -G -3 -n 1 -l 90 -w 1 -a CTGTCTCTTATACACATCTC
done

After that, conduct VITCOMIC2.

  1. download and install MAPseq from https://github.com/jfmrod/MAPseq
  2. gunzip gunzip Refs_14_04_11.fasta.one.fa.dup.gz
  3. Put all VITCOMIC2 local files and a MAPseq binary file symbolic link in the current directory
  4. If input files are fastq,
vi VITCOMIC2LocalFASTQ.sh
for i in *.fastq;do
sed '/^@[A-Z][A-Z0-9]/!d;s//>/;N' "$i" > "$i".fa
awk '!/^>/ { printf "%s", $0; n = "\n" } /^>/ { print n $0; n = "" } END { printf "%s", n }' "$i".fa > "$i".fa.one.fa
./mapseq "$i".fa.one.fa Refs_14_04_11.fasta.one.fa.dup Refs_14_04_11.SPlist.Pro.txt.mapseq > "$i".fa.one.fa.mapseq
perl Parse_Single.pl "$i".fa.one.fa.mapseq
perl PileupGenera.pl "$i".fa.one.fa.mapseq.parsed
perl MimicCluster.pl "$i".fa.one.fa.mapseq.parsed.genus.txt Refs_14_04_11.SPlist.Pro.txt
done

Please be careful, above sed command is not perfect. In some fastq files, this code will cause problems. If your fastq files are derived from INSDC DRA/ERA/SRA, replace above sed line to

sed '/^[DES]RR[0-9]/!d;s//>/;N' "$i" > "$i".fa

Otherwise, you can use

perl FASTQFASTA.pl "$i"
  1. If input files are fasta,
vi VITCOMIC2LocalFASTA.sh
for i in *.fasta;do
awk '!/^>/ { printf "%s", $0; n = "\n" } /^>/ { print n $0; n = "" } END { printf "%s", n }' "$i" > "$i".one.fa
./mapseq "$i".one.fa Refs_14_04_11.fasta.one.fa.dup Refs_14_04_11.SPlist.Pro.txt.mapseq > "$i".one.fa.mapseq
perl Parse_Single.pl "$i".one.fa.mapseq
perl PileupGenera.pl "$i".one.fa.mapseq.parsed
perl MimicCluster.pl "$i".one.fa.mapseq.parsed.genus.txt Refs_14_04_11.SPlist.Pro.txt
done
You can’t perform that action at this time.