Library and tools to deal with polyploid genomics
Ruby Shell
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Failed to load latest commit information.
bin
conf
lib
test
.gitignore
.travis.yml
Gemfile
README
README.md
Rakefile
VERSION
bio-polyploid-tools.gemspec

README.md

bio-polyploid-tools

Introduction

This tools are designed to deal with polyploid wheat. The first tool is to design KASP primers, making them as specific as possible.

Installation

gem install bio-polyploid-tools

You need to have in your $PATH the following programs:

The code was originally developed on ruby 2.1, 2.3 and 2.5. It may work on older version. However, it is only actively tested in currently supported ruby versions:

  • 2.1.10
  • 2.2.5
  • 2.3.5
  • 2.4.2
  • 2.5.0

PolyMarker

To run PolyMarker with the CSS wheat contigs, you need to unzip the reference file from ensembl.

polymarker.rb --contigs Triticum_aestivum.IWGSC2.25.dna.genome.fa --marker_list snp_list.csv --output output_folder

The snp_list file must follow the convention ID,Chromosome,SEQUENCE with the SNP inside the sequence in the format [A/T]. As a reference, look at test/data/short_primer_design_test.csv

If you want to use the web interface, visit the PolyMarker webservice at TGAC

The available command line arguments are:

Usage: polymarker.rb [options]
    -c, --contigs FILE               File with contigs to use as database
    -m, --marker_list FILE           File with the list of markers to search from
    -g, --genomes_count INT          Number of genomes (default 3, for hexaploid)
    -s, --snp_list FILE              File with the list of snps to search from, requires --reference to get the sequence using a position
    -t, --mutant_list FILE           File with the list of positions with mutation and the mutation line.
    requires --reference to get the sequence using a position
    -r, --reference FILE             Fasta file with the sequence for the markers (to complement --snp_list)
    -o, --output FOLDER              Output folder
    -e, --exonerate_model MODEL      Model to be used in exonerate to search for the contigs
    -i, --min_identity INT           Minimum identity to consider a hit (default 90)
    -a, --arm_selection arm_selection_embl|arm_selection_morex|arm_selection_first_two
                    Function to decide the chromome arm
    -p, --primer_3_preferences FILE  file with preferences to be sent to primer3
    -v, --variation_free_region INT  If present, avoid generating the common primer if there are homoeologous SNPs within the specified distance (not tested)
    -x, --extract_found_contigs      If present, save in a separate file the contigs with matches. Useful to debug.
    -P, --primers_to_order			 If present, saves a file named primers_to_order which contains the KASP tails

Input formats

The following formats are used to define the marker sequences:

Marker list

If the option --marker_list FILE is used, the SNP and the flanking sequence is included in the file. The format contains 3 columns (the order is important):

  • snp_name The ID of the marker. Must be unique.
  • target chromosome for the specific primers. Must be in line with the chromosome selection critieria.
  • sequence The sequence flanking the SNP with the SNP highligted on square brackets ([]) and the two alleles separated by a forward slash (/).

Example:

BS00068396_51,2A,CGAAGCGATCCTACTACATTGCGTTCCTTTCCCACTCCCAGGTCCCCCTA[T/C]ATGCAGGATCTTGATTAGTCGTGTGAACAACTGAAATTTGAGCGCCACAA

SNP list

If the flanking sequence is unknow, but the position on a reference is available, the option --snp_list can be used and the FASTA file with the reference sequence must be provided with the option --reference. This is to allow the use of a different assembly or set of contigs used for the discovery of the SNPs that are different to the reference given in the option --contigs. The format contains the following positional columns:

  • scaffold The sacffold where the SNP is.
  • reference allele The base in the reference (may or may not be the same as in the reference file.
  • position Position of the SNP. The first base in the scaffold is base 1.
  • alternative allele The base in the alternative allele.
  • target chromosome for the specific primers. Must be in line with the chromosome selection critieria.

Example

IWGSC_CSS_1AL_scaff_110,C,519,A,2A

This file format can be used with snp_positions_to_polymarker.rb to produce the input for the option--marker_list.

Custom reference sequences.

By default, the contigs and pseudomolecules from ensembl are used. However, it is possible to use a custom reference. To define the chromosome where each contig belongs the argument arm_selection is used. The defailt uses ids like: IWGSC_CSS_1AL_scaff_110, where the third field, separated by underscores is used. A simple way to add costum references is to rename the fasta file to follow that convention. Another way is to use the option --arm_selection arm_selection_first_two, where only the first two characters in each contig is used as identifier, useful when pseudomolecules are named after the chromosomes (ie: ">1A" in the fasta file).

If your contigs follow a different convention, in the file ChromosomeArm.rb it is possible to define new parsers, by adding at the begining, with the rest of the parsers a new lambda like:

@@arm_selection_functions[:embl] = lambda do | contig_name|
  arr = contig_name.split('_')
  ret = "U"
  ret = arr[2][0,2] if arr.size >= 3
  ret = "3B" if arr.size == 2 and arr[0] == "v443"
  ret = arr[0][0,2] if arr.size == 1   
  return ret
end

The function should return a 2 character string, when the first is the chromosome number and the second the chromosome group. The symbol in the hash is the name to be used in the argument --arm_selection. If you want your parser to be added to the distribution, feel free to fork and make a pull request.

##Using blast

To use blast instead of exonerate, use the following command:

./bin/polymarker.rb --contigs test/data/BS00068396_51_contigs.fa --marker_list test/data/BS00068396_51_for_polymarker.fa  --aligner blast  -a arm_selection_first_two

Release Notes

0.8.4

  • Added script ```tag_stats.rb`` That gets the descriptive statistics for a tag in a bam file for each reference.
ruby tag_stats.rb -b HI.3206.006.Index_2.CS_125RNA_14d_Leaf8.sorted.bam -r /Users/ramirezr/Dropbox/JIC/expVIPMetadatas/RefSeq1.0/Genes/annotation/IWGSCv1.0_UTR_ALL.cdnas.fasta --tag 'NH'

0.8.3

  • BUGFIX: ChromosomeArm.rb was fixed to conform the module assumptions for the package.

0.8.2

  • FEATURE: The functions to select the chromosome arm are now in lib/bio/PolyploidTools/ChromosomeArm.rb and the help message is updated automatically with the valid options.
  • FEATURE: Added option filter_best to replicate the original behaviour of selecting the best hit of each chromosome. Still useful for assemblies which still contain synthetic duplications.

0.8.1

  • BUGFIX: There was an error which prevented the correct localisation of the SNP in markeres with gaps in the local alignment before the position with the snp.
  • FEATURE: PolyMarker now selects the best hit of the target chromosome. This improves the specificity in regions with a recent duplication. The drawback is that if your assembly has artificial repetitions, the primers won't be marked as 'chromosome specific', but as 'chromosome semi-specific '. In a future version this will be addressed.

0.8

  • FEATURE: polymarker.rb added the flag --aligner blast|exonerate which lets you pick between blast or exonerate as the aligner. For blast the default is to have the database with the same name as the --contigs file. However, it is possible to use a different name vua the option --database.

0.7.3

  • FEATURE: polymarker.rb Added to the flag --arm_selection the option scaffold, which now supports a scaffold specific primer.
  • FEATURE: snp_position_to_polymarker Added the option --mutant_list to prepare files for PolyMarker from files with the following columns ID,Allele_1,position,Allele_1,target_chromosome.

0.7.2

  • FEATURE: Added a flag min_identity to set the minimum identity to consider a hit. The default is 90

0.7.1

  • BUGFIX: Now the parser for arm_selection_embl works with the mixture of contigs and pseudomolecules
  • DOC: Added documentation on how to use custom references.

0.7.0

  • Added flag genomes_count for number of genomes, to be used on tetraploids, etc.

0.6.1

  • polymarker.rb now validates that all the files exist.
  • BUGFIX: A reference was required even when it was not used to generate contigs.

Notes

  • BUG: Blocks with NNNs are picked and treated as semi-specific.
  • BUG: If the name of the reference have space, the ID is not chopped. ">gene_1 (G12A)" shouls be treated as ">gene_1".
  • TODO: Add a parameter file to configure the alignments.
  • TODO: Produce primers for products of different sizes. This can probably be done with the primer_3_preferences option, but hasn't been tested.