Permalink
Branch: master
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
63 lines (57 sloc) 3.61 KB

SeqPurge tool help

SeqPurge (2018_11-127-gbd77909)

Removes adapter sequences from paired-end sequencing data.

Mandatory parameters:
  -in1 <filelist>     Forward input gzipped FASTQ file(s).
  -in2 <filelist>     Reverse input gzipped FASTQ file(s).
  -out1 <file>        Forward output gzipped FASTQ file.
  -out2 <file>        Reverse output gzipped FASTQ file.

Optional parameters:
  -a1 <string>        Forward adapter sequence (at least 15 bases).
                      Default value: 'AGATCGGAAGAGCACACGTCTGAACTCCAGTCA'
  -a2 <string>        Reverse adapter sequence (at least 15 bases).
                      Default value: 'AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGT'
  -match_perc <float> Minimum percentage of matching bases for sequence/adapter matches.
                      Default value: '80'
  -mep <float>        Maximum error probability of insert and adapter matches.
                      Default value: '1e-6'
  -qcut <int>         Quality trimming cutoff for trimming from the end of reads using a sliding window approach. Set to 0 to disable.
                      Default value: '15'
  -qwin <int>         Quality trimming window size.
                      Default value: '5'
  -qoff <int>         Quality trimming FASTQ score offset.
                      Default value: '33'
  -ncut <int>         Number of subsequent Ns to trimmed using a sliding window approach from the front of reads. Set to 0 to disable.
                      Default value: '7'
  -min_len <int>      Minimum read length after adapter trimming. Shorter reads are discarded.
                      Default value: '30'
  -threads <int>      The number of threads used for trimming (two additional threads are used for reading and writing).
                      Default value: '1'
  -out3 <file>        Name prefix of singleton read output files (if only one read of a pair is discarded).
                      Default value: ''
  -summary <file>     Write summary/progress to this file instead of STDOUT.
                      Default value: ''
  -qc <file>          If set, a read QC file in qcML format is created (just like ReadQC).
                      Default value: ''
  -prefetch <int>     Maximum number of reads that may be pre-fetched into memory to speed up trimming.
                      Default value: '1000'
  -ec                 Enable error-correction of adapter-trimmed reads (only those with insert match).
                      Default value: 'false'
  -debug              Enables debug output (use only with one thread).
                      Default value: 'false'
  -progress <int>     Enables progress output at the given interval in milliseconds (disabled by default).
                      Default value: '-1'

Special parameters:
  --help              Shows this help and exits.
  --version           Prints version and exits.
  --changelog         Prints changeloge and exits.
  --tdx               Writes a Tool Definition Xml file. The file name is the application name with the suffix '.tdx'.

SeqPurge changelog

SeqPurge 2018_11-127-gbd77909

2019-02-11 Added writer thread to make SeqPurge scale better when using many threads.
2017-06-15 Changed default value of 'min_len' parameter from 15 to 30.
2016-08-10 Fixed bug in binomial calculation (issue #1).
2016-04-15 Removed large part of the overtrimming described in the paper (~75% of reads overtrimmed, ~50% of bases overtrimmed).
2016-04-06 Added error correction (optional).
2016-03-16 Version used in the SeqPurge paper: http://bmcbioinformatics.biomedcentral.com/articles/10.1186/s12859-016-1069-7

back to ngs-bits