Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
branch: master
Fetching contributors…

Cannot retrieve contributors at this time

49 lines (30 sloc) 4.766 kb
Version:1.0 StartHTML:0000000167 EndHTML:0000012270 StartFragment:0000000457 EndFragment:0000012254
>cs01MM_pCherry1224f
ATNGGGAAGNNCGAACGCGCCGAGGGCCGTCACTCCACCGGGCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGAGCAGGTTCTCCTACTGCCCCTCCTGGTTCTTCCAAATCCGCCGTCGGTTCTATGGCATCAATGCAGAAGCTGATCTCAGAGGAGGACCTGTGAGGATCCACCGGATCTAGATAACTGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAAGGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACGCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCCGCTACAGGGCGCGTCAGGNGGGCACTTTTTCGGGGAAATGTGCNCCGGAACCCCNANTTGGTTTATTTTTCNAAAACNTTNCAAAAATGTATCCGCTCANGNNNACAANAAACCCTGAAAAAATGCTTNNAAAANNATTGAAAAAGGAANNAGTCCNTGNNGGNNGNAAANAANCCANCTNNNGNAATGGGTNNNANTTNAGGGNNGNGGAAAGNNCCCCAGGCNCCCCNNNNGGGNNNAAANTTTNCNAAGNNNNGCNNNNCNANTTANNNCCNNCACCCNGGNGNGGGAANNTNCCC
CS01MM
I1SalI primer M2 motif linker
GTCGACGGAGCAGGTTCTCCTACTGCCCCTCCTGGTTCT
M5 motif w/ mutation linker T1BamHI reverse primer
TCCAAATCCGCCGTCGGTTCTATGGCATCAATGCAGAAGCTGATCTCAGAGGAGGACCTGTGAGGATCC
>cs02MM_pCherry1224f
ATGGGGAAGTCGACGCGCCGAGGGCCGTCACTCCACCGGCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGAGCAGGTTCTGGAAGAAAGAAGAGAAGACAGAGAGAGAGAGCGCACCAGGGTTCTGCATCTGTGCTTGGTGGTGAGCTCGACAGAGGTTCTAGGTACTCCACCCAAGTCGACGGTTCTACGGAGACGCTCCTCGGTTCTATGGCATCAATGCAGAAGCTGATCTCAGAGGAGGACCTGTGAGGATCCACCGGATCTAGATAACTGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAAGGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAAACCCTAAAGGGAGCCCCCCGATTTTANAGCTTGACNGGGNAAAGCCNGNCNAANCNTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCCANGTGTANCGGTCACGCTGCGCGTAACCACCAANCCCGCCGCGCNTAATGCNCCNCTACAGGGCGCGTCAGGGGGCACTTTTCGGGGAAATGGGCCCGGAACCCCCAATTGTTTATTTTTCCNAANACCTTCAANATTTANCCCCCCCNTGNANAANANAACCCCNGAAAAANGCTTNCAAAANTNTTNAAAAAGGGAAAAANTCNTTNGGNNGGNAANAAACCCCCNTNNGGGNAAGNGNGGTCCCNTTTNGGGGGNGGGGAAAA
CS02MM
I1SalI primer M22 motif
GTCGACGGAGCAGGTTCTGGAAGAAAGAAGAGAAGACAGAGAGAGAGAGCGCACCAG
linker M21 motif linker
GGTTCTGCATCTGTGCTTGGTGGTGAGCTCGACAGAGGTTCT
M15 motif linker M25 motif
AGGTACTCCACCCAAGTCGACGGTTCTACGGAGACGCTCCTC
linker T1BamHI primer
GGTTCTATGGCATCAATGCAGAAGCTGATCTCAGAGGAGGACCTGTGAGGATCC
>cs06MM_pCherry1224f
GNTCGAACGCGCCGAGGGCCGTCACTCCACCGGGCGGCATGGACGAGCTGTACAAGTCCGGACTCAGATCTCGAGCTCAAGCTTCGAATTCTGCAGTCGACGGAGCAGGTTCTCCTCCTCTTGAAAGACTCACCCTCGGTTCTTACCCAATCGTCGGTTCTGGAAGAAAGAAGAGAAGACAGAGGAGGACCTGTGAGGATCCACCGGATCTAGATAACTGATCATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCTCCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTGTTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATCACAAATTTCACAAATAAAGCATTTTTTTCACTGCATTCTAGTTGTGGTTTGTCCAAACTCATCAATGTATCTTAAGGCGTAAATTGTAAGCGTTAATATTTTGTTAAAATTCGCGTTAAATTTTTGTTAAATCAGCTCATTTTTTAACCAATAGGCCGAAATCGGCAAAATCCCTTATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGTTGTTCCAGTTTGGAACAAGAGTCCACTATTAAAGAACGTGGACTCCAACGTCAAAGGGCGAAAAACCGTCTATCAGGGCGATGGCCCACTACGTGAACCATCACCCTAATCAAGTTTTTTGGGGTCGAGGTGCCGTAAAGCACTAAATCGGAACCCTAAAGGGAGCCCCCGATTTAGAGCNTGACGGGGAAAGCCGGCGAACGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCGCTGGCAAGTGTAGCGGTCACNCTGCGCGTAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGGCGCGTCAGGTTGGCACNNTTTCGGGGAAATGTGCGCGGAACCCCCTATTTGGTTTAATTTTTCNAAANANCATTCCAAATNAGNTANCCCNCTCAGGAANACAATNAACCCTGAANAAANGGCTTCCAANAAANATTGNAAAAAGGAAGGAGNTCCTTGNNGGCGGAAAAGAAACCCNGCNTGTNGGAANTNTGGGTCNANTNNNGGGGGNGGGNAAANTTCCCCCAGGGCTNCCCCNNNNNGGNNAAAANTNTTGCNAAANNCNTGNCNTTNNCAATTNNNNTCNNCNAACCCGGGNGGGGAANNTTCCCCCGGGNCCCCCCNNNNGGGNAAAAANTTNTNNNAANNNNNTNCNTTNNCANTTNNNNNNNCCCCCNNANNNCCCCCCCCCAA
CS06MM
I1SalI primer M08 motif linker
GTCGACGGAGCAGGTTCTCCTCCTCTTGAAAGACTCACCCTCGGTTCT
M30 motif linker M22 motif partial T1BamHI primer
TACCCAATCGTCGGTTCTGGAAGAAAGAAGAGAAGACAGAGGAGGACCTGTGAGGATCC
Restriction sites: SalI (GTCGAC) & BamHI (GGATCC)
I1SalI: GTCGACGGAGCAGGTTCT
T1BamHI: GGTTCTATGGCATCAATGCAGAAGCTGATCTCAGAGGAGGACCTGTGAGGATCC
Linker: GGTTCT
Jump to Line
Something went wrong with that request. Please try again.