Small non-coding RNA annotation Pipeline Optimized for rRNA- and tRNA-Derived Small RNAs
Switch branches/tags
Nothing to show
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Failed to load latest commit information.
Sample_output
source
LICENSE
README.md
README.pdf
precompiled_annotation_database.md
precompiled_annotation_database.pdf

README.md

SPORTS1.0

Small non-coding RNA annotation Pipeline Optimized for rRNA- and tRNA-Derived Small RNAs

If you use SPORTS1.0 in your work, please cite this paper:

SPORTS1.0: a tool for annotating and profiling non-coding RNAs optimized for rRNA-and tRNA-derived small RNAs

Junchao Shi, Eun-A Ko, Kenton M. Sanders, Qi Chen, Tong Zhou. SPORTS1.0: a tool for annotating and profiling non-coding RNAs optimized for rRNA-and tRNA-derived small RNAs. Genomics, Proteomics & Bioinformatics (2018) doi.org/10.1016/j.gpb.2018.04.004

Requirements

Installation

Script description

Appendix

Copyright and licensing information

History

Disclaimer

Contact information

Requirements

Linux system, enough disk space and Ram depending on the size of RNA deep sequencing data. (Tested system: ubuntu 12.04 LTS, ubuntu 16.04 LTS)

Installation

  1. Download SPORTS1.0 pipeline package.

    wget https://github.com/junchaoshi/sports1.0/archive/master.zip

  2. Download necessary software, packages and reference databases as listed below:

    1. Perl 5 (https://www.perl.org) (Tested version: v5.14.2, v5.22.1); Perl 5 might be already installed in the linux system.

    2. Bowtie [1] (http://bowtie-bio.sourceforge.net/index.shtml) (Tested version: 1.1.2, 1.2.1.1)

    3. SRA Toolkit (https://ncbi.github.io/sra-tools/) (Tested version: 2.8.2)

    4. cutadapt [2] (http://cutadapt.readthedocs.io/en/stable/index.html) (Tested version: 1.11)

    5. R (https://www.r-project.org/) (Tested version: 3.2.3, 3.2.5)

    6. Reference database (See lists and download link of all pre-compiled species’ databases in appendix)

  3. Installation tutorial for software and packages.

    1. Install SPORTS1.0

      1. Unpack SPORTS1.0 package.

        unzip sports1.0-master.zip

      2. Attach the SPORTS directory to your PATH:

        echo 'export PATH=$PATH:your_path_to_sports1.0-master/source' >> ~/.bashrc

        chmod 755 your_path_to_sports1.0-master/source/sports.pl

    2. Install Bowtie

      1. Unpack bowtie-1.x.x-linux-x86_64.zip.

        unzip bowtie-1.x.x-linux-x86_64.zip

      2. Attach the bowtie directory to your PATH:

        echo 'export PATH=$PATH:your_path_to_bowtie' >> ~/.bashrc

      If you are administrator user, type the following command and password to easily install bowtie:
      
      sudo apt-get install bowtie
      
    3. Install SRA Toolkit

      1. Unpack SRA toolkit files.

      2. Attach the SRA Toolkit executable path to your PATH:

        echo 'export PATH=$PATH:your_path_to_sra-toolkit/bin' >> ~/.bashrc

    4. Install cutadapt

      1. Use pip on the command line to install latest version of cutadapt:

        pip install --user --upgrade cutadapt

      2. Attach the cutadapt directory to your PATH:

        echo 'export PATH=$PATH:$HOME/.local/bin' >> ~/.bashrc

    5. Install R and R package

      1. Unpack R-x.y.z.tar.gz with:

        tar -xf R-x.y.z.tar.gz

      2. Enter into the R-x.y.z directory:

        cd R-x.y.z

      3. Type following command in terminal:

        ./configure
        
        make
        
        make check
        
        make install
        
      4. Install R packages by typing following command in terminal:

        R
        
        install.packages('ggplot2', dependencies=TRUE, repos='http://cran.rstudio.com/')
        
        install.packages('data.table', dependencies=TRUE, repos='http://cran.rstudio.com/')
        
        install.packages('stringr', dependencies=TRUE, repos='http://cran.rstudio.com/')
        
        q()
        
        n
        
  4. Start a new shell session to apply changes to environment variables:

    source ~/.bashrc

  5. Test if everything is installed properly:

    perl -v
    
    sports.pl -h
    
    bowtie
    
    fastq-dump
    
    cutadapt -h
    
    R --version
    
    If you get any error messages you should install the software once again.
    

Script description

sports.pl

  1. Input query format:

    1. .sra files.

    2. .fastq/.fq, .fasta/.fa files of deep sequencing reads.

    Attention: compressed files need to be unpacked before input!
    
  2. Options:

    --Input:

     -i <file> Input could be: 
     
         a .sra, .fastq/.fq or .fasta/.fa file;
    
         a directory (will run all qualified files in the directory recursively); 
    
         a text document with absolute path information for each file/folder (when processing multiple data, input each file/folder path per line)
    

    --Output:

     -o <str> output address of annotation results (default: input address)
      
     -k keep all the intermediate files generated during the running progress
    

    --Alignment:

     -l <int> the minimal length of the output sequences (default = 15)
    
     -L <int> the maximal length of the output sequences (default = 45)
    
     -M <int> the total number of mismatches in the entire alignment (default = 0)
     
     -a  Remove 5' / 3' adapters
    
         -x <str> (if -a applied) 5' adapter sequence. Default = "GTTCAGAGTTCTACAGTCCGACGATC"
    
         -y <str> (if -a applied) 3' adapter sequence. Default = "TGGAATTCTCGGGTGCCAAGG"
    

    --Others:

     -v print version information
     
     -h print this usage message
    
  3. Example

    • Example use 1:

    The user wants to map a single fasta file against rat reference genome to get the mapping genome annotation only. (No output figures)

    Type following command in terminal:

    sports.pl -i reads.fa -g /foo/bar/Rattus_norvegicus/UCSC/rn6/Sequence/BowtieIndex/genome

    • Example use 2:

    The user wants to map several already trimed human sequencing files to human reference genome, miRNA database, tRNA database, rRNA database and piRNA database by using 4 CPU threads, then to output the result to the address: '/foo/bar/output/'.

    Write all the fastq files' addresses into a text document, e.g.:

    seq_address.txt
    ---------------------------
    /foo/bar/fold_1/seq_1.fastq
    /foo/bar/fold_2/seq_2.fq
    /foo/bar/fold_2/seq_3.fq
    /foo/bar/fold_3/seq_4.fasta
    /foo/bar/fold_4/seq_5.fa
    ---------------------------
    

    Type following command in terminal:

    sports.pl -i seq_address.txt -p 4 -g /foo/bar/Homo_sapiens/UCSC/hg38/Sequence/BowtieIndex/genome -m /Homo_sapiens/miRBase_21/miRBase_21-has -r /foo/bar/Homo_sapiens/rRNA_db/human_rRNA -t /foo/bar/Homo_sapiens/GtRNAdb/hg19-tRNAs -w /foo/bar/Homo_sapiens/piRBase/piR_human -o /foo/bar/output/

    • Example use 3:

    The user wants to map several untrimmed mouse sequencing files downloaded from NCBI or somewhere else to mouse reference genome, miRNA database, tRNA database, rRNA database, piRNA database, ensembl noncoding RNA database and Rfam database by using 4 CPU threads, then to output the result to the address: '/foo/bar/output/' and keep all the intermediate files generated during the running progress.

    Put all the sequencing files into a folder, e.g.:
    
    folder structure:
    
    ------------------------
    download_seq
       │
       ├─fold_1
       │   │
       │   ├─seq_1.sra
       │   │
       │   └─seq_2.sra
       │
       ├─fold_2
       │   │
       │   ├─fold_3
       │   │   │
       │   │   ├─seq_3.fastq
       │   │   │
       │   │   └─seq_4.fq
       │   │
       │   └─seq_5.fasta
       │
       └─seq_6.fa
    ------------------------
    

    Type following command in terminal:

    sports.pl -i /foo/bar/download_seq/ -p 4 -a -x GTTCAGAGTTCTACAGTCCGACGATC -y TGGAATTCTCGGGTGCCAAGG -g /foo/bar/Mus_musculus/UCSC/mm10/Sequence/BowtieIndex/Genome -m /foo/bar/Mus_musculus/miRBase_21/miRbase_21-mmu -r /foo/bar/Mus_musculus/rRNA_db/mouse_rRNA -t /foo/bar/Mus_musculus/GtRNAdb/mm10-tRNAs -w /foo/bar/Mus_musculus/piRBase/piR_mouse -e /foo/bar/Mus_musculus/Ensembl/Mus_musculus.GRCm38.ncrna -f /foo/bar/Mus_musculus/Rfam_12.3/Rfam-12.3-mouse -o /foo/bar/output/ -k

  4. Example output file structure for 1 query file input (e.g. SeqFile):

    Output folder structure
       │
       ├─1_SeqFile
       │   │
       │   ├─SeqFile_fa (if -k applied)
       │   │   │
       │   │   ├SeqFile.fa					---unique seqs with reads number
       │   │   │
       │   │   ├SeqFile_disgarded_reads.fa			---seqs that cannot pass adapter removing process  
       │   │   │
       │   │   ├SeqFile_too_short_reads.fa			---seqs that are lower than required minimal length threshold
       │   │   │
       │   │   ├SeqFile_too_long_reads.fa			---seqs that are higher than required maximal length threshold
       │   │   │
       │   │   ├SeqFile_match_genome.fa				---seqs that can match to reference genome
       │   │   │
       │   │   ├SeqFile_unmatch_genome.fa			---seqs that cannot match to reference genome
       │   │   │
       │   │   ├SeqFile_match_<X>_match_genome.fa		---seqs that can match to both <X> database and reference genome
       │   │   │
       │   │   ├SeqFile_match_<X>_unmatch_genome.fa		---seqs that can match to <X> database but not reference genome
       │   │   │
       │   │   ├SeqFile_unmatch_<X>_match_genome.fa		---seqs that cannot match to <X> database but can match to reference genome
       │   │   │
       │   │   └SeqFile_unmatch_<X>_unmatch_genome.fa		---seqs that match to <X> rfam database nor reference genome
       │   │
       │   ├SeqFile_processed (if -k applied)
       │   │   │
       │   │   ├SeqFile_output_match_genome			---seqs that match to reference genome in BOWTIE format
       │   │   │
       │   │   ├SeqFile_output_<X>_match_genome			---seqs that match to both miRNA database and reference genome in BOWTIE format
       │   │   │
       │   │   └SeqFile_output_<X>_unmatch_genome		---seqs that match to miRNA database but not reference genome in BOWTIE format
       │   │
       │   └SeqFile_result
       │       │
       │       ├SeqFile_output.txt				---6 column table file including annotation information for every unique sequence
       │       │
       │       ├SeqFile_summary.txt				---3 column table file including reads number of each major- (e.g. rRNA) and sub- (e.g. 5S rRNA) classes
       │       │
       │       ├SeqFile_length_distribution.txt			---3 column table file including reads number of each length distribution of each major class
       │       │
       │       ├SeqFile_mismatch_summary.txt			---11 column table file including mismatch statistics information for each mismatch loci (if -M >0)
       │       │
       │       ├SeqFile_sncRNA_distribution.pdf			---figure of length distribution of miRNA, rsRNA, tsRNA, piRNA and other RNAs, if sequence matches existed
       │       │
       │       ├SeqFile_rRNA_distribution.pdf			---figure of length distribution of different types of rRNAs, if sequence matches existed
       │       │
       │       ├SeqFile_rRNA_mapping.pdf			---figure of rsRNAs mapping against different types of rRNAs, if sequence matches existed
       │       │
       │       └SeqFile_tRNA_mapping.pdf			---figure of length distribution of different types of tRNAs, if sequence matches existed
       │
       ├─processing_report (if -k applied)
       │   │
       │   └1_SeqFile.txt					---processing log file
       │
       └─sh_file (if -k applied)
           │   
           └1__SeqFile.sh					---rocessing script file
    Some output folders only exist when '-k' parameter is applied in sports.pl;
    
    SeqFile_mismatch_summary.txt only exist when '-M' parameter is lager than 0 in sports.pl;
    
    Some output files might not exist if the file size is zero.

fastq2fasta.pl

Extracted from miRDeep2 [3] (https://github.com/rajewsky-lab/mirdeep2)

  1. Description:

    Parses fastq format files into fasta format.

  2. Input:

    A fastq file.

  3. Output:

    A fasta file, one sequence per line (the sequences are expanded).

  4. options:

    -

  5. Example usage:

    fastq2fasta.pl reads.fq > reads.fa

fastaparse.pl

Extracted from miRDeep2 [3] (https://github.com/rajewsky-lab/mirdeep2)

  1. Description:

    Performs simple filtering of entries in a fasta file.

  2. Input:

    A fasta file

  3. Output:

    A filtered fasta file

  4. Options:

    -a only output entries where the sequence is minimum int nts long

    -b remove all entries that have a sequence that contains letters other than a,c,g,t,u,n,A,C,G,T,U,N.

    -s output progress

  5. Example usage:

    fastaparse.pl reads.fa -a 15 -s > reads_no_short.fa 2> reads_discarded.fa

combine_reads.pl

  1. Description:

    Combine reads in the fasta file to get unique sequence and its read number.

  2. Input:

    A fasta file

  3. Output:

    A filtered fasta file.
    --------------------------------
    >t00000001 1234567
    TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGC
    --------------------------------
    't00000001' is the unique ID of the sequence, representing the abundance ranking among all the sequences. In this case, the abundance of this sequence is the highest.
    '1234567' represents the reads number of sequence 'TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGC'
  1. Options:

    -

  2. Example usage:

    combine_reads.pl reads.fa > combined_reads.fa

tRNA_db_processing.pl

  1. Description:

    This script adds CCA end to original genomic tRNA 3’ end and add G to Histidine tRNA 5’ end.

  2. Input:

    The reference tRNA database file in .fa format

    A fasta file

  3. Options: -

  4. Example usage:

    tRNA_db_processing.pl input_tRNA_file.fa

annotation.pl

  1. Description:

    Combine the annotation information generated from sports.pl

  2. Input:

    sports.pl output folder address: <SPORTS_output_fold_address>

  3. Output:

    1. <seq_fold>_output.txt: A 6 column table file including annotation information for every unique sequence.
        -------------------------------------------------------------------------------------------------------------
        ID           Sequence                            Length    Reads      Match_Genome    Annotation
        t00000001    TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGC    32        1234567    Yes             tRNA-Glu-CTC_5_end
        -------------------------------------------------------------------------------------------------------------
    
        -ID: t00000001                                 --Represents the unique ID of the sequence, represents the abundance ranking among all the sequences. In this case, the abundance of this sequence is the highest.
    
        -Sequence: TCCCTGGTGGTCTAGTGGTTAGGATTCGGCGC    --Represents the sequence.
    
        -Length: 32                                    --Length of the sequence.
    
        -Reads: 1234567                                --Reads number of the sequence.
    
        -Match_Genome: Yes                             --If the sequence can match the reference genome.
    
        -Annotation: tRNA-Glu-CTC_5_end                --The annotation of the sequence. This sequence mapped against the 5' end of tRNA-Glu-CTC sequence.
    
    1. <seq_fold>_summary.txt: A 3 column table file including reads number of each major- and sub- classes.
        -------------------------------------------------------------------------------------------------------------
        Class                             Sub_Class             Reads
        tRNAdb-tRNA_5_end_Match_Genome    -                     123456
        -                                 tRNA-Glu-CTC_5_end    78910
        -------------------------------------------------------------------------------------------------------------
    
        -Class: tRNAdb-tRNA_5_end_Match_Genome    --The major class name.
        -Sub_Class: tRNA-Glu-CTC_5_end            --The sub class name.
        -Reads: 123456                            --The reads number of the class.
    
    1. <seq_fold>_length_distribution.txt: A 3 column table file including reads number of each length distribution of each major class.
        -------------------------------------------------------------------------------------------------------------
        Class                             Length    Reads
        tRNAdb-tRNA_5_end_Match_Genome    30        1234
        tRNAdb-tRNA_5_end_Match_Genome    31        23456
        tRNAdb-tRNA_5_end_Match_Genome    32        34567
        tRNAdb-tRNA_5_end_Match_Genome    33        4567
        ......
        -------------------------------------------------------------------------------------------------------------
    
        -Class: tRNAdb-tRNA_5_end_Match_Genome    --The major class name.
        -Length: 30                               --Length of the sequence.
        -Reads: 1234                              --The reads number of the class.
    
  4. Options:

    -

  5. Example usage:

    annotation.pl <SPORTS_output_fold_address>

tRNA_mapping.pl

  1. Description:

    Perl script calculates expression level of genomic loci by bowtie 1 output information.

  2. Input:

    bowtie 1 output file

  3. Output:

    expression summary file

  4. Options:

    -

  5. Example usage:

    tRNA_mapping.pl bowtie_output_file summary_file

mismatch_summary.pl

  1. Description:

    Perl script summarizes mismatch information generated by Bowtie 1 if parameter '-M' >0 applied in sports.pl

  2. Input:

    bowtie 1 output file and threshold of reads number.

  3. Output:

    mismatch summary file

  4. Options:

    -

  5. Example usage:

    mismatch_summary.pl bowtie_output_file 10 > mismatch_summary.txt

overall_RNA_length_distribution.R

  1. Description:

    Generate figure of length distribution of miRNA, rsRNA, tsRNA, piRNA and other RNAs, if sequence matches exists.

  2. Input:

    Files generated by annotation.pl

  3. Output:

    <seq_fold>_sncRNA_distribution.pdf Generate figure of length distribution of different types of rRNAs, if sequence matches exists.

  4. Options:

    -

  5. Example usage:

    Rscript --vanilla overall_RNA_length_distribution.R <SPORTS_output_fold_address> <dataset_name>

rRNA_length_distribution.R

  1. Description:

    Generate figure of length distribution of different types of rRNAs, if sequence matches exists. (e.g. 4.5S, 5S, 5.3S, 5.8S, 12S, 16S, 18S, 28S, 45S ...)

  2. Input:

    Files generated by annotation.pl

  3. Output:

    <seq_fold>_rRNA_distribution.pdf

  4. Options:

    -

  5. Example usage:

    Rscript --vanilla r_RNA_length_distribution.R <SPORTS_output_fold_address> <dataset_name>

rRNA_mapping.R

  1. Description:

    Generate figure of rsRNAs mapping against different types of rRNAs if sequence matches existed. (e.g. 4.5S, 5S, 5.3S, 5.8S, 12S, 16S, 18S, 28S, 45S ...)

  2. Input:

    Files generated by annotation.pl

  3. Output:

    <seq_fold>_rRNA_mapping.pdf

  4. Options:

    -

  5. Example usage:

    Rscript --vanilla rRNA_mapping.R <SPORTS_output_fold_address> <dataset_name>

tRNA_mapping.R

  1. Description:

    Generate figure of rsRNAs mapping against different types of tRNAs if sequence matches existed.

  2. Input:

    Files generated by tRNA_mapping.pl

  3. Output:

    <seq_fold>_tRNA_mapping.pdf

  4. Options:

    -

  5. Example usage:

    Rscript --vanilla tRNA_mapping.R <SPORTS_output_fold_address>_tRNA_mapping.txt <dataset_name>_tRNA_mapping.pdf

mismatch_stat.R

  1. Description:

    Generate statistics result for mismatch information generated from mismatch_summary.pl

  2. Input:

    File generated by mismatch_summary.pl and base-calling error

  3. Output:

    <seq_fold>_mismatch_summary.txt

  4. Options:

    -

  5. Example usage:

    Rscript --vanilla mismatch_stat.R <SPORTS_output_fold_address>_mismatch_summary.txt 0.01

Appendix

Available species lists of bowtie-index based reference database

    To build bowtie-index of your own:
        cd /foo/bar/your_reference_database/
        bowtie-build <your_reference_database_name>.fa <your_reference_database_name>
    The built bowtie index will be: /foo/bar/your_reference_database/your_reference_database_name
	
    Unpack reference genome (e.g. human genome):
        tar zxvf Homo_sapiens_UCSC_hg38.tar.gz

Main database source:

-mirbase 21 database [4] (Original source: http://www.mirbase.org/index.shtml)

-rRNA database (Original source: https://www.ncbi.nlm.nih.gov/nuccore)

-GtRNAdb 2.0 database [5] (Original source: http://gtrnadb.ucsc.edu/)

-piRBase database [6] (Original source: http://www.regulatoryrna.org/database/piRNA/)

-piRNABank [7] (Original source: http://pirnabank.ibab.ac.in/index.shtml)

-ensembl ncRNA database [8] (Original source: http://www.ensembl.org/index.html)

-rfam 12.3 database [9] (Original source: http://rfam.xfam.org/)
  1. Homo sapiens (Human)

    1. annotation databases: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0773ed3d5f6b74f35bbd643e1af221c31&authkey=AcRxf8walnGUIEhgI--8CDc)
        -genome with bowtie-index (UCSC hg38) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Homo_sapiens/UCSC/hg38/Homo_sapiens_UCSC_hg38.tar.gz)
        -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
        -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
        -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/genomes/eukaryota/Hsapi19/hg19-tRNAs.fa)
        -piRNA database with bowtie-index (Original source: http://www.regulatoryrna.org/database/piRNA/ && http://pirnabank.ibab.ac.in/request.html)
        -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/homo_sapiens/ncrna/)
        -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
    
    1. SPORTS1.0 related parameters if you download recommended reference database:
        -g /<your_defined_address>/Homo_sapiens/UCSC/hg38/Sequence/BowtieIndex/genome
        -m /<your_defined_address>/Homo_sapiens/miRBase_21/miRBase_21-hsa
        -r /<your_defined_address>/Homo_sapiens/rRNA_db/human_rRNA
        -t /<your_defined_address>/Homo_sapiens/GtRNAdb/hg19-tRNAs
        -w /<your_defined_address>/Homo_sapiens/piRBase/piR_human
        -e /<your_defined_address>/Homo_sapiens/Ensembl/Homo_sapiens.GRCh38.ncrna
        -f /<your_defined_address>/Homo_sapiens/Rfam_12.3/Rfam-12.3-human
    
  2. Gorilla gorilla gorilla (Gorilla)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=03a9a8d26cca14b458007e9c6ee4541f7&authkey=Aag33OX-IjvagRWePhYNF3k)

      -genome with bowtie-index (UCSC gorGor5) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/gorGor5/bigZips/gorGor5.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Acaro2/anoCar2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Gorilla_gorilla/UCSC/gorGor5/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Gorilla_gorilla/miRBase_21/miRBase_21-ggo
      -t /<your_defined_address>/Gorilla_gorilla/GtRNAdb/gorGor3-tRNAs
      -f /<your_defined_address>/Gorilla_gorilla/Rfam_12.3/Rfam-12.3-gorilla
      
  3. Pan paniscus (Bonobo)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=03a74e9f6c2594f1e86a31acd8e554621&authkey=AYrgOm8rrAY7hrFYQ03gmTA)

      -genome with bowtie-index (UCSC panPan1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/panPan1/bigZips/panPan1.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Pan_paniscus/UCSC/panPan1/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Pan_paniscus/miRBase_21/miRBase_21-ppa
      -f /<your_defined_address>/Pan_paniscus/Rfam_12.3/Rfam-12.3-Bonobo    
      
  4. Pan troglodytes (Chimp)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=09c13507ee7414365843de3450aa9ad3e&authkey=AdsLOHA5q2--SbiP2C6Qjpc)

      -genome with bowtie-index (Ensembl CHIMP2.1.4) (ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Pan_troglodytes/UCSC/panTro4/Pan_troglodytes_UCSC_panTro4.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Ptrog4/panTro4-tRNAs.fa)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/pan_troglodytes/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Pan_troglodytes/UCSC/panTro4/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Pan_troglodytes/miRBase_21/miRBase_21-ptr
      -t /<your_defined_address>/Pan_troglodytes/GtRNAdb/panTro4-tRNAs
      -e /<your_defined_address>/Pan_troglodytes/Ensembl/Pan_troglodytes.CHIMP2.1.4.ncrna
      -f /<your_defined_address>/Pan_troglodytes/Rfam_12.3/Rfam-12.3-chimp
      
  5. Pongo abelii (Orangutan)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=037168296877942ecb9735f26afcb450a&authkey=AZkU5ib3A0KOiT4KxrhgTGQ)

      -genome with bowtie-index (UCSC ponAbe2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/ponAbe2/bigZips/chromFa.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Ppygm2/ponAbe2-tRNAs.fa)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/pongo_abelii/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Pongo_abelii/UCSC/ponAbe2/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Pongo_abelii/miRBase_21/miRBase_21-ppy
      -t /<your_defined_address>/Pongo_abelii/GtRNAdb/ponAbe2-tRNAs
      -e /<your_defined_address>/Pongo_abelii/Ensembl/Pongo_abelii.PPYG2.ncrna
      -f /<your_defined_address>/Pongo_abelii/Rfam_12.3/Rfam-12.3-orangutan    
      
  6. Nomascus leucogenys (Gibbon)

    6.1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=068ef6629d31b4fb28100f667050be1d1&authkey=AWEPi3HUmOVD_PPPnkMhdvs)

     ``` 
     -genome with bowtie-index (UCSC nomLeu3) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/nomLeu3/bigZips/nomLeu3.fa.gz)
     -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Nleuc3/nomLeu3-tRNAs.fa)
     -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
     ``` 
    

    6.2 SPORTS1.0 related parameters if you download recommended reference database:

     ``` 
     -g /<your_defined_address>/Nomascus_leucogenys/UCSC/nomLeu3/Sequence/BowtieIndex/genome
     -t /<your_defined_address>/Nomascus_leucogenys/GtRNAdb/nomLeu3-tRNAs
     -f /<your_defined_address>/Nomascus_leucogenys/Rfam_12.3/Rfam-12.3-gibbon
     ``` 
    
  7. Macaca mulatta (Rhesus)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=07fededf7468444ba9b863b74316b8504&authkey=Aa6X06J4ExLvKtH8mJ-CESs)

      -genome with bowtie-index (UCSC rheMac8) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/rheMac8/bigZips/rheMac8.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Mmula3/rheMac3-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Macaca_mulatta/UCSC/rheMac8/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Macaca_mulatta/miRBase_21/miRBase_21-mml
      -r /<your_defined_address>/Macaca_mulatta/rRNA_db/rhesus_rRNA
      -t /<your_defined_address>/Macaca_mulatta/GtRNAdb/rheMac3-tRNAs
      -f /<your_defined_address>/Macaca_mulatta/Rfam_12.3/Rfam-12.3-rhesus
      
  8. Papio anubis (Baboon)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=03a22a2092c7b46fb93a8fc49cf234720&authkey=Ad_hzH3MUIMh0-9BLoH_Vmw)

      -genome with bowtie-index (UCSC papAnu2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/papAnu2/bigZips/papAnu2.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Panub2/papAnu2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Papio_anubis/UCSC/papAnu2/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Papio_anubis/GtRNAdb/papAnu2-tRNAs
      -f /<your_defined_address>/Papio_anubis/Rfam_12.3/Rfam-12.3-baboon
      
  9. Callithrix jacchus (Marmoset)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=077698888fa8d40408df8c979e91146e4&authkey=AeoDYl5a3lKyF-CWgupu6IA)

      -genome with bowtie-index (UCSC calJac3) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/calJac3/bigZips/calJac3.fa.gz)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Cjacc3/calJac3-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Callithrix_jacchus/UCSC/calJac3/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Callithrix_jacchus/rRNAdb/marmoset_rRNA
      -t /<your_defined_address>/Callithrix_jacchus/GtRNAdb/calJac3-tRNAs
      -f /<your_defined_address>/Callithrix_jacchus/Rfam_12.3/Rfam-12.3-marmoset
      
  10. Carlito syrichta (Tarsier)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0c761313792b64396b87a66a6e04101be&authkey=AZBsjTA5-hXdASOIimxNL4I)

      -genome with bowtie-index (UCSC tarSyr2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/tarSyr2/bigZips/tarSyr2.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Tsyri2/tarSyr2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Carlito_syrichta/UCSC/tarSyr2/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Carlito_syrichta/GtRNAdb/tarSyr2-tRNAs
      -f /<your_defined_address>/Carlito_syrichta/Rfam_12.3/Rfam-12.3-tarsier
      
  11. Rattus norvegicus (rat)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0b2cacd8453104b2abb60298863fc4c16&authkey=AZAYeCOsLKuc_ml-QMqBJoQ)

      -genome with bowtie-index (UCSC rn6) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Rattus_norvegicus/UCSC/rn6/Rattus_norvegicus_UCSC_rn6.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Rnorv5/rn5-tRNAs.fa)
      -piRNA database with bowtie-index (Original source: http://www.regulatoryrna.org/database/piRNA/ && http://pirnabank.ibab.ac.in/request.html)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/rattus_norvegicus/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Rattus_norvegicus/UCSC/rn6/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Rattus_norvegicus/miRBase_21/miRBase_21-rno
      -r /<your_defined_address>/Rattus_norvegicus/rRNA_db/mouse_rRNA
      -t /<your_defined_address>/Rattus_norvegicus/GtRNAdb/rn5-tRNAs
      -w /<your_defined_address>/Rattus_norvegicus/piRBase/piR_rat
      -e /<your_defined_address>/Rattus_norvegicus/Ensembl/Rattus_norvegicus.Rnor_6.0.ncrna
      -f /<your_defined_address>/Rattus_norvegicus/Rfam_12.3/Rfam-12.3-rat
      
  12. Mus musculus (mouse)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0833653a140eb47f098267d7a23d3b63c&authkey=Ab8aoYC8paqFI2yRabIo7Ok)

      -genome with bowtie-index (UCSC mm10) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Mus_musculus/UCSC/mm10/Mus_musculus_UCSC_mm10.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/genomes/eukaryota/Mmusc10/mm10-tRNAs.fa)
      -piRNA database with bowtie-index (Original source: http://www.regulatoryrna.org/database/piRNA/ && http://pirnabank.ibab.ac.in/request.html)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/mus_musculus/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Mus_musculus/UCSC/mm10/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Mus_musculus/miRBase_21/miRBase_21-mmu
      -r /<your_defined_address>/Mus_musculus/rRNA_db/mouse_rRNA
      -t /<your_defined_address>/Mus_musculus/GtRNAdb/mm10-tRNAs
      -w /<your_defined_address>/Mus_musculus/piRBase/piR_mouse
      -e /<your_defined_address>/Mus_musculus/Ensembl/Mus_musculus.GRCm38.ncrna
      -f /<your_defined_address>/Mus_musculus/Rfam_12.3/Rfam-12.3-mouse
      
  13. Cricetulus griseus (Hamster)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0b0ac3830026f4007958774cbdb421632&authkey=AZnURBxU1PYzUO1yyrcoZ_M)

      -genome with bowtie-index (UCSC criGri1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/criGri1/bigZips/criGri1.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Cgris1/criGri1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Cricetulus_griseus/UCSC/criGri1/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Cricetulus_griseus/miRBase_21/miRBase_21-cgr
      -r /<your_defined_address>/Cricetulus_griseus/rRNA_db/hamster_rRNA
      -t /<your_defined_address>/Cricetulus_griseus/GtRNAdb/criGri1-tRNAs
      -f /<your_defined_address>/Cricetulus_griseus/Rfam_12.3/Rfam-12.3-hamster
      
  14. Cavia porcellus (Guinea pig)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0d27261e6ae9c4402bbc9465addb544de&authkey=Ad1xlk56DNm0StozUWDqCYw)

      -genome with bowtie-index (UCSC cavPor3) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/cavPor3/bigZips/cavPor3.fa.gz)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Cporc3/cavPor3-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Cavia_porcellus/UCSC/cavPor3/Sequence/BowtieIndex/genome
      -r /<your_defined_address>/Cavia_porcellus/rRNA_db/guinea_rRNA
      -t /<your_defined_address>/Cavia_porcellus/GtRNAdb/cavPor3-tRNAs
      -f /<your_defined_address>/Cavia_porcellus/Rfam_12.3/Rfam-12.3-guinea
      
  15. Heterocephalus glaber (Naked mole-rat)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0ceff76c620884395899bcd385bfaa098&authkey=ATiBTnSjWKqY0zPKQOmM6kU)

      -genome with bowtie-index (UCSC hetGla2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/hetGla2/bigZips/hetGla2.fa.gz)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Hglab2/hetGla2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Heterocephalus_glaber/UCSC/hetGla2/Sequence/BowtieIndex/genome
      -r /<your_defined_address>/Heterocephalus_glaber/rRNA_db/mole_rRNA
      -t /<your_defined_address>/Heterocephalus_glaber/GtRNAdb/hetGla2-tRNAs
      -f /<your_defined_address>/Heterocephalus_glaber/Rfam_12.3/Rfam-12.3-mole
      
  16. Ictidomys tridecemlineatus (Squirrel)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0419ea57bd00548cc94574d8ce9717fcd&authkey=Aa1pkb9R7850Ss3GFmB6GzM)

      -genome with bowtie-index (UCSC speTri2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/speTri2/bigZips/speTri2.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Strid2/speTri2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Ictidomys_tridecemlineatus/UCSC/speTri2/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Ictidomys_tridecemlineatus/GtRNAdb/speTri2-tRNAs
      -f /<your_defined_address>/Ictidomys_tridecemlineatus/Rfam_12.3/Rfam-12.3-squirrel
      
  17. Ochotona princeps (Pika)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=068d8da8388b74c38943e50237a259a88&authkey=AemP73yDCDiObexIk-DcRVQ)

      -genome with bowtie-index (UCSC ochPri3) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/ochPri3/bigZips/ochPri3.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Oprin3/ochPri3-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Ochotona_princeps/UCSC/ochPri3/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Ochotona_princeps/GtRNAdb/ochPri3-tRNAs
      -f /<your_defined_address>/Ochotona_princeps/Rfam_12.3/Rfam-12.3-pika
      
  18. Oryctolagus cuniculus (Rabbit)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=01b2d69333c97448196cc69b212e92fc9&authkey=ARbwyo0-WJX10nDdXwvNygc)

      -genome with bowtie-index (UCSC oryCun2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/oryCun2/bigZips/oryCun2.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Ocuni2/oryCun2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Oryctolagus_cuniculus/UCSC/oryCun2/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Oryctolagus_cuniculus/miRBase_21/miRBase_21-ocu
      -r /<your_defined_address>/Oryctolagus_cuniculus/rRNA_db/rabbit_rRNA
      -t /<your_defined_address>/Oryctolagus_cuniculus/GtRNAdb/oryCun2-tRNAs
      -f /<your_defined_address>/Oryctolagus_cuniculus/Rfam_12.3/Rfam-12.3-rabbit
      
  19. Ovis aries (Sheep)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0e880ae29a16747bebf5b9afdb5956921&authkey=AYIP0UkTwtVuiul45XA7mYE)

      -genome with bowtie-index (UCSC oviAri3) (Original source: http://hgdownload.cse.ucsc.edu/goldenPath/oviAri3/bigZips/oviAri3.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Zmays5/zeaMay5-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Ovis_aries/UCSC/oviAri3/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Ovis_aries/miRBase_21/miRBase_21-oar
      -t /<your_defined_address>/Ovis_aries/GtRNAdb/oviAri1-tRNAs
      -f /<your_defined_address>/Ovis_aries/Rfam_12.3/Rfam-12.3-sheep
      
  20. Bos taurus (Cow)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0a58e56dc7cb743299631fec15b72e69d&authkey=AeosGslpVMdvtZa6qtKJBCE)

      -genome with bowtie-index (UCSC bosTau8) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Bos_taurus/UCSC/bosTau8/Bos_taurus_UCSC_bosTau8.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Btaur8/bosTau8-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/bos_taurus/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Bos_taurus/UCSC/bosTau8/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Bos_taurus/miRBase_21/miRBase_21-bta
      -r /<your_defined_address>/Bos_taurus/rRNA_db/cow_rRNA
      -t /<your_defined_address>/Bos_taurus/GtRNAdb/bosTau8-tRNAs
      -e /<your_defined_address>/Bos_taurus/Ensembl/Bos_taurus.UMD3.1.ncrna
      -f /<your_defined_address>/Bos_taurus/Rfam_12.3/Rfam-12.3-cow
      
  21. Sus scrofa (Pig)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0e15d39ac05b24a9b899e7a9dfcf96773&authkey=AYaNWQ9KLlkqq7f2qbWzchc)

      -genome with bowtie-index (UCSC susScr3) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Sus_scrofa/UCSC/susScr3/Sus_scrofa_UCSC_susScr3.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Sscro3/susScr3-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Sus_scrofa/UCSC/susScr3/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Sus_scrofa/miRBase_21/miRBase_21-ssc
      -r /<your_defined_address>/Sus_scrofa/rRNA_db/pig_rRNA
      -t /<your_defined_address>/Sus_scrofa/GtRNAdb/susScr3-tRNAs
      -f /<your_defined_address>/Sus_scrofa/Rfam_12.3/Rfam-12.3-pig
      
  22. Tursiops truncatus (Dolphin)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=08396ad3619a247d695508aee771e3991&authkey=AVKuiimDuoOGVKfGvZcK_ik)

      -genome with bowtie-index (UCSC turTru2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/turTru2/bigZips/turTru2.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Ttrun2/turTru2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Tursiops_truncatus/UCSC/turTru2/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Tursiops_truncatus/GtRNAdb/turTru2-tRNAs
      -f /<your_defined_address>/Tursiops_truncatus/Rfam_12.3/Rfam-12.3-dolphin
      
  23. Balaenoptera acutorostrata (Minke whale)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0d27ad173ffdb4dcc8a4954f9ba5426eb&authkey=AUdYvbA-_q0lzVEEBlth8V8)

      -genome with bowtie-index (UCSC balAcu1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/balAcu1/bigZips/balAcu1.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Bacut1/balAcu1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Balaenoptera_acutorostrata/UCSC/balAcu1/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Balaenoptera_acutorostrata/GtRNAdb/balAcu1-tRNAs
      -f /<your_defined_address>/Balaenoptera_acutorostrata/Rfam_12.3/Rfam-12.3-whale
      
  24. Erinaceus europaeus (Hedgehog)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0633e2d7781ab4aefb59fc03f1347657b&authkey=AXrP4XnyiHQqkC5WOUhhS5w)

      -genome with bowtie-index (UCSC eriEur2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/eriEur2/bigZips/eriEur2.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Eeuro2/eriEur2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Erinaceus_europaeus/UCSC/eriEur2/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Erinaceus_europaeus/GtRNAdb/eriEur2-tRNAs
      -f /<your_defined_address>/Erinaceus_europaeus/Rfam_12.3/Rfam-12.3-hedgehog
      
  25. Sorex araneus (Shrew)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0399046c56fb246c39630c84db61a23ad&authkey=AWE7pAlGt1TAAUylD4qoE9A)

      -genome with bowtie-index (UCSC sorAra2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/sorAra2/bigZips/sorAra2.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Saran2/sorAra2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Sorex_araneus/UCSC/sorAra2/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Sorex_araneus/GtRNAdb/sorAra2-tRNAs
      -f /<your_defined_address>/Sorex_araneus/Rfam_12.3/Rfam-12.3-shrew
      
  26. Canis familiaris (Dog)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=06a45d60105a04796b5e96a9417d86f4c&authkey=AY37yxKX-C5u9DG71tzrFEI)

      -genome with bowtie-index (UCSC canFam3) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Canis_familiaris/UCSC/canFam3/Canis_familiaris_UCSC_canFam3.tar.gz) 
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Cfami3/canFam3-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Canis_familiaris/UCSC/canFam3/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Canis_familiaris/miRBase_21/miRBase_21-cfa
      -t /<your_defined_address>/Canis_familiaris/GtRNAdb/canFam3-tRNAs
      -f /<your_defined_address>/Canis_familiaris/Rfam_12.3/Rfam-12.3-dog
      
  27. Mustela putorius furo (Ferret)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0ef4e067d42f241359e2e606b14e0d8f9&authkey=AUW2yr7SM356KpD5uhBNOeM)

      -genome with bowtie-index (UCSC musFur1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/musFur1/bigZips/musFur1.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Mputo1/musFur1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Mustela_furo/UCSC/musFur1/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Mustela_furo/GtRNAdb/musFur1-tRNAs
      -f /<your_defined_address>/Mustela_furo/Rfam_12.3-ferret
      
  28. Ailuropoda melanoleuca (Panda)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0215799b172f94c909c5251061e317540&authkey=AdE82hkEi1MHl3OL1vY92b8)

      -genome with bowtie-index (UCSC ailMel1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/ailMel1/bigZips/ailMel1.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Amela1/ailMel1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Ailuropoda_melanoleuca/UCSC/ailMel1/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Ailuropoda_melanoleuca/GtRNAdb/ailMel1-tRNAs
      -f /<your_defined_address>/Ailuropoda_melanoleuca/Rfam-12.3-panda
      
  29. Felis catus (Cat)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0203fe1a0c8954879878ef8cabcfe37cf&authkey=AZ32jdZI7FoFU_t8_NFb9o0)

      -genome with bowtie-index (UCSC felCat8) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/felCat8/bigZips/felCat8.fa.gz)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Ocuni2/oryCun2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Felis_catus/UCSC/felCat8/Sequence/BowtieIndex/genome
      -r /<your_defined_address>/Felis_catus/rRNA_db/cat_rRNA
      -t /<your_defined_address>/Felis_catus/GtRNAdb/felCat5-tRNAs
      -f /<your_defined_address>/Felis_catus/Rfam_12.3/Rfam-12.3-cat
      
  30. Equus caballus (Horse)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0e7011a73d57545ea8be3c71335b3cf4c&authkey=AWHkBfbzVmwz_HjmQXo8IJU)

      -genome with bowtie-index (UCSC equCab2) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Equus_caballus/UCSC/equCab2/Equus_caballus_UCSC_equCab2.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Ecaba2/equCab2-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Equus_caballus/UCSC/equCab2/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Equus_caballus/miRBase_21/miRBase_21-eca
      -r /<your_defined_address>/Equus_caballus/rRNA_db/horse_rRNA
      -t /<your_defined_address>/Equus_caballus/GtRNAdb/equCab2-tRNAs
      -f /<your_defined_address>/Equus_caballus/Rfam_12.3/Rfam-12.3-horse
      
  31. Ceratotherium simum (White rhinoceros)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0f836e7106664459bacda6f94dc15e22d&authkey=AVSh1b1dr84q53sLTqD9sRA)

      -genome with bowtie-index (UCSC cerSim1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/cerSim1/bigZips/cerSim1.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Csimu1/cerSim1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Ceratotherium_simum/UCSC/cerSim1/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Ceratotherium_simum/GtRNAdb/cerSim1-tRNAs
      -f /<your_defined_address>/Ceratotherium_simum/Rfam_12.3/Rfam-12.3-rhinoceros
      
  32. Myotis lucifugus (Microbat)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=03dcc351bbc274cfc8692e5f2b1f5d0f3&authkey=AbjlxSozqu1c-2sRUrTGn7k)

      -genome with bowtie-index (UCSC myoLuc2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/myoLuc2/bigZips/myoLuc2.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Mluci2/myoLuc2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Myotis_lucifugus/UCSC/myoLuc2/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Myotis_lucifugus/GtRNAdb/myoLuc2-tRNAs
      -f /<your_defined_address>/Myotis_lucifugus/Rfam_12.3/Rfam-12.3-bat
      
  33. Trichechus manatus (Manatee)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=06448172c574b4b9cbe0d906cf75bc68b&authkey=AX_fEuPmr18NZPEFbcg9nEQ)

      -genome with bowtie-index (UCSC triMan1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/triMan1/bigZips/triMan1.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Tmana1/triMan1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Trichechus_manatus/UCSC/triMan1/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Trichechus_manatus/GtRNAdb/triMan1-tRNAs
      -f /<your_defined_address>/Trichechus_manatus/Rfam_12.3/Rfam-12.3-manatee
      
  34. Loxodonta africana (Elephant)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0e0146e32fe4745bba50bbede409efddc&authkey=AT8bNP2DhjKysDaGD4Qy-7s)

      -genome with bowtie-index (UCSC loxAfr3) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/loxAfr3/bigZips/loxAfr3.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Lafri3/loxAfr3-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Loxodonta_africana/UCSC/loxAfr3/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Loxodonta_africana/GtRNAdb/loxAfr3-tRNAs
      -f /<your_defined_address>/Loxodonta_africana/Rfam_12.3/Rfam-12.3-elephant
      
  35. Dasypus novemcinctus (Armadillo)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0c68adc6b2afc447a9dfe45a1a5eedd49&authkey=AUPTS51dr88E3AMvcZtljrk)

      -genome with bowtie-index (UCSC dasNov3) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/dasNov3/bigZips/dasNov3.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Dnove3/dasNov3-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Dasypus_novemcinctus/UCSC/dasNov3/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Dasypus_novemcinctus/GtRNAdb/dasNov3-tRNAs
      -f /<your_defined_address>/Dasypus_novemcinctus/Rfam_12.3/Rfam-12.3-armadillo
      
  36. Notamacropus eugenii (Wallaby)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=076db8740d2e34caabb25669fd6297e36&authkey=AWv-dFi1Mm7C0QH9K00WHH4)

      -genome with bowtie-index (UCSC macEug2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/macEug2/bigZips/macEug2.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Meuge2/macEug2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Notamacropus_eugenii/UCSC/macEug2/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Notamacropus_eugenii/miRBase_21/miRBase_21-meu
      -t /<your_defined_address>/Notamacropus_eugenii/GtRNAdb/macEug2-tRNAs
      -f /<your_defined_address>/Notamacropus_eugenii/Rfam_12.3/Rfam-12.3-wallaby
      
  37. Sarcophilus harrisii (Tasmanian devil)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0469dc3788cbb40bab7472ee70a230dc0&authkey=AXA1nDb4QpYeuIJFC-D6mL0)

      -genome with bowtie-index (UCSC sarHar1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/sarHar1/bigZips/sarHar1.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Sharr1/sarHar1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Sarcophilus_harrisii/UCSC/sarHar1/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Sarcophilus_harrisii/miRBase_21/miRBase_21-sha
      -t /<your_defined_address>/Sarcophilus_harrisii/GtRNAdb/sarHar1-tRNAs
      -f /<your_defined_address>/Sarcophilus_harrisii/Rfam_12.3/Rfam-12.3-tasmanian
      
  38. Monodelphis domestica (Opossum)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=05e9cd2f3891a4761ade95d98aa3ebc78&authkey=Ae_jBKIdBC7HypVTN7S98Rw)

      -genome with bowtie-index (UCSC monDom5) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/monDom5/bigZips/chromFa.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Mdome5/monDom5-tRNAs.fa)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/monodelphis_domestica/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Monodelphis_domestica/UCSC/monDom5/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Monodelphis_domestica/miRBase_21/miRBase_21-mdo
      -t /<your_defined_address>/Monodelphis_domestica/GtRNAdb/monDom5-tRNAs
      -e /<your_defined_address>/Monodelphis_domestica/Ensembl/Monodelphis_domestica.BROADO5.ncrna
      -f /<your_defined_address>/Monodelphis_domestica/Rfam_12.3/Rfam-12.3-opossum
      
  39. Ornithorhynchus anatinus (Platypus)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=07f0f4ed088844a86afa5db763407699c&authkey=AUFx9yWXHtg1CQc-wfpJ81M)

      -genome with bowtie-index (UCSC ornAna2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/ornAna2/bigZips/ornAna2.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Oanat1/ornAna1-tRNAs.fa)
      -piRNA database with bowtie-index (Original source: http://pirnabank.ibab.ac.in/request.html)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/ornithorhynchus_anatinus/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Ornithorhynchus_anatinus/UCSC/ornAna2/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Ornithorhynchus_anatinus/miRBase_21/miRBase_21-oan
      -t /<your_defined_address>/Ornithorhynchus_anatinus/GtRNAdb/ornAna1-tRNAs
      -w /<your_defined_address>/Ornithorhynchus_anatinus/piRBase/piR_platypus
      -e /<your_defined_address>/Ornithorhynchus_anatinus/Ensembl/Ornithorhynchus_anatinus.OANA5.ncrna
      -f /<your_defined_address>/Ornithorhynchus_anatinus/Rfam_12.3/Rfam-12.3-platypus
      
  40. Taeniopygia guttata (Zebra finch)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0defbf712045f4e7f85b373b0eba4cd1b&authkey=AbieXkq6akbsD8tY1oGctDI)

      -genome with bowtie-index (UCSC taeGut2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/taeGut2/bigZips/taeGut2.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Tgutt2/taeGut2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Taeniopygia_guttata/UCSC/taeGut2/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Taeniopygia_guttata/miRBase_21/miRBase_21-tgu
      -t /<your_defined_address>/Taeniopygia_guttata/GtRNAdb/taeGut2-tRNAs
      -f /<your_defined_address>/Taeniopygia_guttata/Rfam_12.3/Rfam-12.3-finch
      
  41. Melopsittacus undulatus (Budgerigar)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0e0046ab3b1a9458a9a183b45507ea0c3&authkey=AWiCroVnVDQcPENZDX_76VM)

      -genome with bowtie-index (UCSC melUnd1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/melUnd1/bigZips/melUnd1.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Mundu1/melUnd1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Melopsittacus_undulatus/UCSC/melUnd1/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Melopsittacus_undulatus/GtRNAdb/melUnd1-tRNAs
      -f /<your_defined_address>/Melopsittacus_undulatus/Rfam_12.3/Rfam-12.3-budgerigar        
      
  42. Gallus gallus (Chicken)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0abafb326c4074fe9971d60a26497126c&authkey=AcRw_9ltjRXbdNAfmLRl_gg)

      -genome with bowtie-index (UCSC galGal5) (Original source: ftp://igenome2:u7NMwVkm@ftp.illumina.com/Gallus_gallus/UCSC/galGal5/Gallus_gallus_UCSC_galGal5.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Ggall4/galGal4-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -piRNA database with bowtie-index (Original source: http://www.regulatoryrna.org/database/piRNA/)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/gallus_gallus/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. PORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Gallus_gallus/UCSC/galGal5/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Gallus_gallus/miRBase_21/miRBase_21-gga
      -r /<your_defined_address>/Gallus_gallus/rRNA_db/chicken_rRNA
      -t /<your_defined_address>/Gallus_gallus/GtRNAdb/galGal4-tRNAs
      -w /<your_defined_address>/Gallus_gallus/piRBase/piR_gga_v1.0
      -e /<your_defined_address>/Gallus_gallus/Ensembl/Gallus_gallus.Gallus_gallus-5.0.ncrna
      -f /<your_defined_address>/Gallus_gallus/Rfam_12.3/Rfam-12.3-chicken
      
  43. Meleagris gallopavo (Turkey)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0c88e1661f08e4b6d945d87e8120bdf07&authkey=AWlCjj414nXNuNbrNM7mbE4)

      -genome with bowtie-index (UCSC melGal1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/melGal1/bigZips/melGal1.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Mgall1/melGal1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Meleagris_gallopavo/UCSC/melGal1/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Meleagris_gallopavo/GtRNAdb/melGal1-tRNAs
      -f /<your_defined_address>/Meleagris_gallopavo/Rfam_12.3/Rfam-12.3-turkey
      
  44. Chrysemys picta (Painted Turtle)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0fbd62d91eb4442a88525f89684a74242&authkey=AY3fgBdvPRzWpqqD4yd_Sqw)

      -genome with bowtie-index (UCSC chrPic1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/chrPic1/bigZips/chrPic1.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Ocuni2/oryCun2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Chrysemys_picta/UCSC/chrPic1/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Chrysemys_picta/GtRNAdb/chrPic1-tRNAs
      -f /<your_defined_address>/Chrysemys_picta/Rfam_12.3/Rfam-12.3-turtle
      
  45. Anolis carolinensis (Lizard)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=06986df31c45c4a00a6a2b47ce4ee7af2&authkey=AaE-i58-1fjJeqcDHZUpLLo)

      -genome with bowtie-index (UCSC anoCar2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/anoCar2/bigZips/anoCar2.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Acaro2/anoCar2-tRNAs.fa)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/anolis_carolinensis/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Anolis_carolinensis/UCSC/anoCar2/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Anolis_carolinensis/miRBase_21/miRBase_21-aca
      -t /<your_defined_address>/Anolis_carolinensis/GtRNAdb/anoCar2-tRNAs
      -e /<your_defined_address>/Anolis_carolinensis/Ensembl/Anolis_carolinensis.AnoCar2.0.ncrna
      -f /<your_defined_address>/Anolis_carolinensis/Rfam_12.3/Rfam-12.3-lizard
      
  46. Xenopus laevis (Frog)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0d9b3d45b3bf3483c826c36d2b340f0fd&authkey=AdGZ969RHd1lpwBpm7lsGEQ)

      -genome with bowtie-index (UCSC xenTro7) (Original source: ftp://hgdownload.soe.ucsc.edu/goldenPath/xenTro7/bigZips/xenTro7.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Xtrop3/xenTro3-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -piRNA database with bowtie-index (Original source: http://www.regulatoryrna.org/database/piRNA/)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/xenopus_tropicalis/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Xenopus_laevis/UCSC/xenTro7/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Xenopus_laevis/miRBase_21/miRBase_21-xtr
      -r /<your_defined_address>/Xenopus_laevis/rRNA_db/frog_rRNA
      -t /<your_defined_address>/Xenopus_laevis/GtRNAdb/xenTro3-tRNAs
      -w /<your_defined_address>/Xenopus_laevis/piRBase/piR_xtr_v1.0
      -e /<your_defined_address>/Xenopus_laevis/Ensembl/Xenopus_tropicalis.JGI_4.2.ncrna
      -f /<your_defined_address>/Xenopus_laevis/Rfam_12.3/Rfam-12.3-frog
      
  47. Latimeria chalumnae (Coelacanth)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0be8104aeb59d4ff89909d0c62d0a2f4e&authkey=AasK4DZcbB12a8wB8CNz6Ak)

      -genome with bowtie-index (UCSC latCha1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/latCha1/bigZips/latCha1.fa.gz)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Lchal1/latCha1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Latimeria_chalumnae/UCSC/latCha1/Sequence/BowtieIndex/genome
      -r /<your_defined_address>/Latimeria_chalumnae/rRNA_db/coelacanth_rRNA
      -t /<your_defined_address>/Latimeria_chalumnae/GtRNAdb/latCha1-tRNAs
      -f /<your_defined_address>/Latimeria_chalumnae/Rfam_12.3/Rfam-12.3-coelacanth
      
  48. Tetraodon nigroviridis (Tetraodon)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=06252eaadd5894a3795afce052716fd17&authkey=AWZ9FVt-iphiQFRDzuKoJtA)

      -genome with bowtie-index (UCSC tetNig2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/tetNig2/bigZips/chromFa.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Tnigr2/tetNig2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Tetraodon_nigroviridis/UCSC/tetNig2/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Tetraodon_nigroviridis/miRBase_21/miRBase_21-tni
      -t /<your_defined_address>/Tetraodon_nigroviridis/GtRNAdb/tetNig2-tRNAs
      -f /<your_defined_address>/Tetraodon_nigroviridis/Rfam_12.3/Rfam-12.3-tetraodon
      
  49. Takifugu rubripes (Fugu)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=026501a5c4aa54930a00289acf9691f5f&authkey=AWUaDYW0_VZx-1dy5wnCfdQ)

      -genome with bowtie-index (UCSC fr3) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/fr3/bigZips/fr3.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Trubr3/fr3-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Takifugu_rubripes/UCSC/fr3/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Takifugu_rubripes/GtRNAdb/fr3-tRNAs
      -f /<your_defined_address>/Takifugu_rubripes/Rfam_12.3/Rfam-12.3-fugu
      
  50. Gasterosteus aculeatus (Stickleback)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0268db779d3654712b39d5450bac55894&authkey=AQwh0wJeAcvF78JRu4RHddM)

      -genome with bowtie-index (UCSC gasAcu1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/gasAcu1/bigZips/chromFa.tar.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Gacul1/gasAcu1-tRNAs.fa)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/gasterosteus_aculeatus/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Gasterosteus_aculeatus/UCSC/gasAcu1/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Gasterosteus_aculeatus/GtRNAdb/gasAcu1-tRNAs
      -e /<your_defined_address>/Gasterosteus_aculeatus/Ensembl/Gasterosteus_aculeatus.BROADS1.ncrna
      -f /<your_defined_address>/Gasterosteus_aculeatus/Rfam_12.3/Rfam-12.3-stickleback
      
  51. Oryzias latipes (Medaka)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0f5089e2cc47245f28dca1a3f8f75343c&authkey=AV8N2wRviWth_LjhJqpB0zk)

      -genome with bowtie-index (UCSC oryLat2) (http://hgdownload.soe.ucsc.edu/goldenPath/oryLat2/bigZips/oryLat2.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Olati2/oryLat2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Oryzias_latipes/UCSC/oryLat2/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Oryzias_latipes/miRBase_21/miRBase_21-ola
      -t /<your_defined_address>/Oryzias_latipes/GtRNAdb/oryLat2-tRNAs
      -f /<your_defined_address>/Oryzias_latipes/Rfam_12.3/Rfam-12.3-medaka
      
  52. Oreochromis niloticus (Nile tilapia)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0cf791d1d99de4f4c8ed7f8de6d5694f8&authkey=AZZgbe3d1aKb7GDuCDlv81w)

      -genome with bowtie-index (UCSC oreNil2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/oreNil2/bigZips/oreNil2.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Onilo2/oreNil2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Oreochromis_niloticus/UCSC/oreNil2/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Oreochromis_niloticus/GtRNAdb/oreNil2-tRNAs
      -f /<your_defined_address>/Oreochromis_niloticus/Rfam_12.3/Rfam-12.3-tilapia
      
  53. Gadus morhua (Atlantic cod)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=08f5a65a279f34d518cc4017cb04fe469&authkey=ASMQLIwmWReD_bVW922N0Io)

      -genome with bowtie-index (UCSC gadMor1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/gadMor1/bigZips/gadMor1.fa.gz)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Gmorh1/gadMor1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Gadus_morhua/UCSC/gadMor1/Sequence/BowtieIndex/genome
      -r /<your_defined_address>/Gadus_morhua/rRNA_db/cod_rRNA
      -t /<your_defined_address>/Gadus_morhua/GtRNAdb/gadMor1-tRNAs
      -f /<your_defined_address>/Gadus_morhua/Rfam_12.3/Rfam-12.3-cod
      
  54. Danio rerio (Zebrafish)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=07d3448d6cd29485498e70f8f067a619d&authkey=Aa1-VjshX-GKLZI7limHFIo)

      -genome with bowtie-index (UCSC danRer10) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Danio_rerio/UCSC/danRer10/Danio_rerio_UCSC_danRer10.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Dreri_v8/danRer6-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -piRNA database with bowtie-index (Original source: http://www.regulatoryrna.org/database/piRNA/)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensembl.org/pub/release-89/fasta/danio_rerio/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Danio_rerio/UCSC/danRer10/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Danio_rerio/miRBase_21/miRBase_21-dre
      -r /<your_defined_address>/Danio_rerio/rRNA_db/zebrafish_rRNA
      -t /<your_defined_address>/Danio_rerio/GtRNAdb/danRer6-tRNAs
      -w /<your_defined_address>/Danio_rerio/piRBase/piR_dre_v1.0
      -e /<your_defined_address>/Danio_rerio/Ensembl/Danio_rerio.GRCz10.ncrna
      -f /<your_defined_address>/Danio_rerio/Rfam_12.3/Rfam-12.3-zebrafish
      
  55. Callorhinchus milii (Elephant shark)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=053976e5c17b9435982d22223b9389eba&authkey=ASL1VUPU4Ol2PskRXpj94t4)

      -genome with bowtie-index (UCSC calMil1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/calMil1/bigZips/calMil1.fa.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Cmili1/calMil1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Callorhinchus_milii/UCSC/calMil1/Sequence/BowtieIndex/genome
      -t /<your_defined_address>/Callorhinchus_milii/GtRNAdb/calMil1-tRNAs
      -f /<your_defined_address>/Callorhinchus_milii/Rfam_12.3/Rfam-12.3-shark
      
  56. Petromyzon marinus (Lamprey)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=013a1f7a5585b462b801f1cfe3faf2cdd&authkey=AVN94xcHd1_Aa2ofYovsw8Q)

      -genome with bowtie-index (UCSC petMar2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/petMar2/bigZips/petMar2.fa.gz)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Pmari2/petMar2-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Petromyzon_marinus/UCSC/petMar2/Sequence/BowtieIndex/genome
      -r /<your_defined_address>/Petromyzon_marinus/rRNA_db/lamprey_rRNA
      -t /<your_defined_address>/Petromyzon_marinus/GtRNAdb/petMar2-tRNAs
      -f /<your_defined_address>/Petromyzon_marinus/Rfam_12.3/Rfam-12.3-lamprey
      
  57. Strongylocentrotus purpuratus (Sea urchin)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0840567689dbe4ff49852c8744056f172&authkey=AWhmaQmPgN5fuB1RXlKc69U)

      -genome with bowtie-index (UCSC strPur2) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/strPur2/bigZips/strPur2.fa.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Spurp/Spurp-tRNAs.fa)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensemblgenomes.org/pub/metazoa/release-36/fasta/strongylocentrotus_purpuratus/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Strongylocentrotus_purpuratus/UCSC/strPur2/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Strongylocentrotus_purpuratus/miRBase_21/miRBase_21-spu
      -r /<your_defined_address>/Strongylocentrotus_purpuratus/rRNA_db/urchin_rRNA
      -t /<your_defined_address>/Strongylocentrotus_purpuratus/GtRNAdb/Spurp-tRNAs
      -e /<your_defined_address>/Strongylocentrotus_purpuratus/Ensembl/Strongylocentrotus_purpuratus.GCA_000002235.2.ncrna
      -f /<your_defined_address>/Strongylocentrotus_purpuratus/Rfam_12.3/Rfam-12.3-urchin
      
  58. Drosophila melanogaster (Drosophila)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=06d15ec2032e141648ce4eedd413b0e0c&authkey=ARejQLC8ofAhQq9IwwoB0Pw)

      -genome with bowtie-index (UCSC dm6) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Drosophila_melanogaster/UCSC/dm6/Drosophila_melanogaster_UCSC_dm6.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/genomes/eukaryota/Dmela6/dm6-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -piRNA database with bowtie-index (Original source: http://www.regulatoryrna.org/database/piRNA/)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensemblgenomes.org/pub/metazoa/release-36/fasta/drosophila_melanogaster/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Drosophila_melanogaster/UCSC/dm6/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Drosophila_melanogaster/miRBase_21/miRBase_21-dme
      -r /<your_defined_address>/Drosophila_melanogaster/rRNA_db/drosophila_rRNA
      -t /<your_defined_address>/Drosophila_melanogaster/GtRNAdb/dm6-tRNAs
      -w /<your_defined_address>/Drosophila_melanogaster/piRBase/piR_dme
      -e /<your_defined_address>/Drosophila_melanogaster/Ensembl/Drosophila_melanogaster.BDGP6.ncrna
      -f /<your_defined_address>/Drosophila_melanogaster/Rfam_12.3/Rfam-12.3-drosophila
      
  59. Anopheles gambiae (Mosquito)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=003bfc542d06b42edb24a94969bb12b36&authkey=AdgdWQ5emWRWTYvXcgPT0Fo)

      -genome with bowtie-index (UCSC anoGam1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/anoGam1/bigZips/chromFa.zip)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Agamb/Agamb-tRNAs.fa)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensemblgenomes.org/pub/metazoa/release-36/fasta/anopheles_gambiae/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Anopheles_gambiae/UCSC/anoGam1/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Anopheles_gambiae/miRBase_21/miRBase_21-aga
      -t /<your_defined_address>/Anopheles_gambiae/GtRNAdb/Agamb-tRNAs
      -e /<your_defined_address>/Anopheles_gambiae/Ensembl/Anopheles_gambiae.AgamP4.ncrna
      -f /<your_defined_address>/Anopheles_gambiae/Rfam_12.3/Rfam-12.3-mosquito
      
  60. Pristionchus pacificus (Roundworm)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0877c09c8493b47e9b9fb6c2c0bdc6015&authkey=AQJrbZlyZz9MDnPB9uYxMYE)

      -genome with bowtie-index (UCSC priPac1) (Original source: http://hgdownload.soe.ucsc.edu/goldenPath/priPac1/bigZips/chromFa.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Ppaci1/priPac1-tRNAs.fa)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Pristionchus_pacificus/UCSC/priPac1/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Pristionchus_pacificus/miRBase_21/miRBase_21-ppc
      -r /<your_defined_address>/Pristionchus_pacificus/rRNA_db/roundworm_rRNA
      -t /<your_defined_address>/Pristionchus_pacificus/GtRNAdb/priPac1-tRNAs
      -f /<your_defined_address>/Pristionchus_pacificus/Rfam_12.3/Rfam-12.3-roundworm
      
  61. Caenorhabditis elegans (Nematode):

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0cffdc7d5a3844567bc5303adca47fb81&authkey=AdA1jCVLRJkz2k8oSVU-pCI)

      -genome with bowtie-index (UCSC ce10) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Caenorhabditis_elegans/UCSC/ce10/Caenorhabditis_elegans_UCSC_ce10.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/genomes/eukaryota/Celeg_WS220/ce10-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -piRNA database with bowtie-index (Original source: http://www.regulatoryrna.org/database/piRNA/)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensemblgenomes.org/pub/metazoa/release-36/fasta/caenorhabditis_elegans/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Caenorhabditis_elegans/UCSC/ce10/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Caenorhabditis_elegans/miRBase_21/miRBase_21-cel
      -r /<your_defined_address>/Caenorhabditis_elegans/rRNA_db/cel_rRNA
      -t /<your_defined_address>/Caenorhabditis_elegans/GtRNAdb/ce10-tRNAs
      -w /<your_defined_address>/Caenorhabditis_elegans/piRBase/piR_cel_v1.0
      -e /<your_defined_address>/Caenorhabditis_elegans/Ensembl/Caenorhabditis_elegans.WBcel235.ncrna
      -f /<your_defined_address>/Caenorhabditis_elegans/Rfam_12.3/Rfam-12.3-nematode
      
  62. Saccharomyces cerevisiae (Yeast)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0a974d08ffcb842dea8d18462dcfaf2f4&authkey=AQ6wsr9hNwVfCfqvuScKStE)

      -genome with bowtie-index UCSC sacCer3) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Saccharomyces_cerevisiae/UCSC/sacCer3/Saccharomyces_cerevisiae_UCSC_sacCer3.tar.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Scere3/sacCer3-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensemblgenomes.org/pub/fungi/release-36/fasta/saccharomyces_cerevisiae/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Saccharomyces_cerevisiae/UCSC/sacCer3/Sequence/BowtieIndex/genome
      -r /<your_defined_address>/Saccharomyces_cerevisiae/rRNA_db/yeast_rRNA
      -t /<your_defined_address>/Saccharomyces_cerevisiae/GtRNAdb/sacCer3-tRNAs
      -e /<your_defined_address>/Saccharomyces_cerevisiae/Ensembl/Saccharomyces_cerevisiae.R64-1-1.ncrna
      -f /<your_defined_address>/Saccharomyces_cerevisiae/Rfam_12.3/Rfam-12.3-yeast
      
  63. Zea mays (Corn)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0abdce07adf9449e89bdcb89d4d4609a4&authkey=AViNEp3y6Y4hNBYSEuW_sYg)

      -genome with bowtie-index (Ensembl AGPv4) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Zea_mays/Ensembl/AGPv4/Zea_mays_Ensembl_AGPv4.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Zmays5/zeaMay5-tRNAs.fa)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensemblgenomes.org/pub/plants/release-36/fasta/zea_mays/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Zea_mays/Ensembl/AGPv4/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Zea_mays/miRBase_21/miRBase_21-zma
      -r /<your_defined_address>/Zea_mays/rRNA_db/corn_rRNA
      -t /<your_defined_address>/Zea_mays/GtRNAdb/zeaMay5-tRNAs
      -e /<your_defined_address>/Zea_mays/Ensembl/Zea_mays.AGPv4.ncrna
      -f /<your_defined_address>/Zea_mays/Rfam_12.3/Rfam-12.3-corn        
      
  64. Sorghum bicolor (Sorghum)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0335fb9b05a024e61819c04db7ffd2a51&authkey=AdMT31NWtny7F1NzJNn3zZI)

      -genome with bowtie-index (Ensembl Sbi1) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Sorghum_bicolor/Ensembl/Sbi1/Sorghum_bicolor_Ensembl_Sbi1.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Sbico/Sbico-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensemblgenomes.org/pub/plants/release-36/fasta/sorghum_bicolor/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Sorghum_bicolor/Ensembl/Sbi1/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Sorghum_bicolor/miRBase_21/miRBase_21-sbi
      -r /<your_defined_address>/Sorghum_bicolor/rRNA_db/sorghum_rRNA
      -t /<your_defined_address>/Sorghum_bicolor/GtRNAdb/Sbico-tRNAs
      -e /<your_defined_address>/Sorghum_bicolor/Ensembl/Sorghum_bicolor.Sorghum_bicolor_v2.ncrna
      -f /<your_defined_address>/Sorghum_bicolor/Rfam_12.3/Rfam-12.3-sorghum        
      
  65. Oryza sativa (Rice)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0510818bde4a342868928f982420dd07c&authkey=ASfslUL0BX2HYew7xrw2x1A)

      -genome with bowtie-index (Ensembl IRGSP-1.0) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Oryza_sativa_japonica/Ensembl/IRGSP-1.0/Oryza_sativa_japonica_Ensembl_IRGSP-1.0.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Osati/Osati-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensemblgenomes.org/pub/plants/release-36/fasta/oryza_sativa/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommend reference database:

      -g /<your_defined_address>/Oryza_sativa/Ensembl/IRGSP-1.0/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Oryza_sativa/miRBase_21/miRBase_21-osa
      -r /<your_defined_address>/Oryza_sativa/rRNA_db/rice_rRNA
      -t /<your_defined_address>/Oryza_sativa/GtRNAdb/Osati-tRNAs
      -e /<your_defined_address>/Oryza_sativa/Ensembl/Oryza_sativa.IRGSP-1.0.ncrna
      -f /<your_defined_address>/Oryza_sativa/Rfam_12.3/Rfam-12.3-rice
      
  66. Arabidopsis thaliana (Arabidopsis)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=08ec312d8fc7d4211952170468dfbb202&authkey=AeVag9p4ifZJG58C5UbXstE)

      -genome with bowtie-index (Ensembl TAIR10) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Arabidopsis_thaliana/Ensembl/TAIR10/Arabidopsis_thaliana_Ensembl_TAIR10.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Athal10/araTha1-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensemblgenomes.org/pub/plants/release-36/fasta/arabidopsis_thaliana/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Arabidopsis_thaliana/Ensembl/TAIR10/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Arabidopsis_thaliana/miRBase_21/miRBase_21-ath
      -r /<your_defined_address>/Arabidopsis_thaliana/rRNA_db/Arabidopsis_rRNA
      -t /<your_defined_address>/Arabidopsis_thaliana/GtRNAdb/araTha1-tRNAs
      -e /<your_defined_address>/Arabidopsis_thaliana/Ensembl/Arabidopsis_thaliana.TAIR10.ncrna
      -f /<your_defined_address>/Arabidopsis_thaliana/Rfam_12.3/Rfam-12.3-arabidopsis
      
  67. Glycine max (Soybean)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=079974655bb2e4f62b669c3d1701fffeb&authkey=AWVriz_LNaTMDsBjbMXDS60)

      -genome with bowtie-index (Ensembl Gm01) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Glycine_max/Ensembl/Gm01/Glycine_max_Ensembl_Gm01.tar.gz)
      -mirbase 21 with bowtie-index (Original source: http://www.mirbase.org/ftp.shtml)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/eukaryota/Gmax2/glyMax2-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Glycine_max/Ensembl/Gm01/Sequence/BowtieIndex/genome
      -m /<your_defined_address>/Glycine_max/miRBase_21/miRBase_21-gma
      -r /<your_defined_address>/Glycine_max/rRNA_db/soybean_rRNA
      -t /<your_defined_address>/Glycine_max/GtRNAdb/glyMax2-tRNAs
      -f /<your_defined_address>/Glycine_max/Rfam_12.3/Rfam-12.3-soybean
      
  68. Escherichia coli (E.coli)

    1. annotation database: (We provide a download link for all databases listed below: https://ncrnainfo-my.sharepoint.com/personal/sports_ncrna_info/_layouts/15/guestaccess.aspx?docid=0645cc2a0024d41fdba5be31a17bd5374&authkey=AaR4ui2QEXqh2-SpOIxaUik)

      -genome with bowtie-index (Ensembl EB1) (Original source: ftp://igenome:G3nom3s4u@ussd-ftp.illumina.com/Escherichia_coli_K_12_DH10B/Ensembl/EB1/Escherichia_coli_K_12_DH10B_Ensembl_EB1.tar.gz)
      -tRNA database with bowtie-index (Original source: http://gtrnadb.ucsc.edu/GtRNAdb2/genomes/bacteria/Esch_coli/eschColi-tRNAs.fa)
      -rRNA database with bowtie-index (Original source: https://www.ncbi.nlm.nih.gov/nuccore)
      -ensembl ncRNA database with bowtie-index (Original source: ftp://ftp.ensemblgenomes.org/pub/bacteria/release-36/fasta/bacteria_91_collection/escherichia_coli/ncrna/)
      -rfam 12.3 database with bowtie-index (Original source: ftp://ftp.ebi.ac.uk/pub/databases/Rfam/12.3/fasta_files/)
      
    2. SPORTS1.0 related parameters if you download recommended reference database:

      -g /<your_defined_address>/Escherichia_coli/Ensembl/EB1/Sequence/BowtieIndex/genome
      -r /<your_defined_address>/Escherichia_coli/rRNA_db/e_coli_rRNA
      -t /<your_defined_address>/Escherichia_coli/GtRNAdb/eschColi-tRNAs
      -e /<your_defined_address>/Escherichia_coli/Ensembl/Escherichia_coli.HUSEC2011CHR1.ncrna
      -f /<your_defined_address>/Escherichia_coli/Rfam_12.3/Rfam-12.3-e_coli
      

References

  1. Langmead B, Trapnell C, Pop M, Salzberg SL. Ultrafast and memory-efficient alignment of short DNA sequences to the human genome. Genome Biol. 2009;10(3):R25. doi: 10.1186/gb-2009-10-3-r25.
  2. Martin M. Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnetjournal. 2011;17(1):3. doi: http://dx.doi.org/10.14806/ej.17.1.200.
  3. Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, et al. Discovering microRNAs from deep sequencing data using miRDeep. Nat Biotechnol. 2008;26(4):407-15. doi: 10.1038/nbt1394.
  4. Kozomara A, Griffiths-Jones S. miRBase: annotating high confidence microRNAs using deep sequencing data. Nucleic acids research. 2014;42(Database issue):D68-73. doi: 10.1093/nar/gkt1181.
  5. Chan PP, Lowe TM. GtRNAdb 2.0: an expanded database of transfer RNA genes identified in complete and draft genomes. Nucleic acids research. 2016;44(D1):D184-9. doi: 10.1093/nar/gkv1309.
  6. Zhang P, Si X, Skogerbo G, Wang J, Cui D, Li Y, et al. piRBase: a web resource assisting piRNA functional study. Database (Oxford). 2014;2014:bau110. doi: 10.1093/database/bau110.
  7. Sai Lakshmi S, Agrawal S. piRNABank: a web resource on classified and clustered Piwi-interacting RNAs. Nucleic acids research. 2008;36(Database issue):D173-7. doi: 10.1093/nar/gkm696.
  8. Yates A, Akanni W, Amode MR, Barrell D, Billis K, Carvalho-Silva D, et al. Ensembl 2016. Nucleic acids research. 2016;44(D1):D710-6. doi: 10.1093/nar/gkv1157.
  9. Nawrocki EP, Burge SW, Bateman A, Daub J, Eberhardt RY, Eddy SR, et al. Rfam 12.0: updates to the RNA families database. Nucleic acids research. 2015;43(Database issue):D130-7. doi: 10.1093/nar/gku1063.

History

1.0.5 - 09/25/2018

  1. Changed annotation strategy to fit more species tRNA annotation in GtRNAdb.
  2. Fixed some bugs in the previous version. Thanks Catrin Lloyd to figure one out!

1.0.4 - 03/25/2018

  1. New function added: if '-M' > 0 applied in sports.pl, statistics of mismatch information will generated to predict potential nucleic acid modification loci;
  2. The figure of tRNA mapping information will generated if tRNA database is defined;
  3. A sample output with the parameter '-M 1' of dataset GSM2304822 (mouse sperm) is uploaded here.

1.0.3 - 01/27/2018

  1. Changed the mapping order to make the mapping results more accurate according to the paper " Juan Pablo Tosar, Carlos Rovira, Alfonso Cayota. Non-coding RNA fragments account for the majority of annotated piRNAs expressed in somatic non-gonadal tissues. Communications Biology. 2018;1, Article number: 2. doi: 10.1038/s42003-017-0001-7 ".

1.0.2 - 01/22/2018

  1. Fixed bugs to generate more accurate mature tRNA database.

1.0.1 - 01/13/2018

  1. Fixed bugs that caused unexpected exit.
  2. Optimized script to speed up tRNA annotation process.

Copyright and licensing information

SPORTS1.0 is available under the GNU General Public License version 3 (GPLv3).

Disclaimer

The SPORTS1.0 package is provided as is without any guarantees or warranty for correctness. The authors are not responsible for any damage or loss of any kind caused by the use or misuse of the scripts included in the software package. The authors are not under obligation to provide support, service, corrections, or upgrades to the package.

Contact information

Contact author: Junchao Shi

E-mail: sports.rna@gmail.com; junchao.shi@yahoo.com