Permalink
Browse files

Added solution for PROT

  • Loading branch information...
1 parent 31edd10 commit d8c657f388169774f6e85bfcae010fc5a28441d7 @jvoorhis committed Nov 10, 2012
Showing with 78 additions and 0 deletions.
  1. +1 −0 data/rosalind_prot.txt
  2. +77 −0 src/prot.rb
View
@@ -0,0 +1 @@
+AUGCAAUUAAUCGCGCUAGACGCUCAGAGGUGGAUAUUAAGUGGAGUAAUAAUUAAUCCGAACCCUGUUAACAAAAGGAUAACUACAGACGUUACUUAUAUGCAUCAGAAGGCGGUCACCAGUGCCCAGACUUUGCCUAGAACGCAGUCUAUGCGGGGUUCUUCAACGUCAGUUAUCUCUACCGAAGGGCGUGCGAAUCCCACACCUUGUCCACAGAACGUGCCGGCGUCAAUUGGUCCUACCACUUUAGCCUCGCAUGCCCCAUUGGUAUUCUUUCAACGCUUCCCCUCAAGGGACGGUCGGGGCACGGUUCUACAAAAUGCACGAGCUCAAGUAAUGGUGAUAUCCCGCCCUUUGUGUGCCAUAGUGAACCCGGCCGAUAUCCCGGGUCAAUGUACGUUGGUACUACUCAAAGCGUGUAUCACUUGCCCGAGUAGGGGUUACCUUGUAUCCCACUCAGUACCUCCUAACCAGCAACCGAGGGCUACACGGAAUCAACCAAAGGACAUACCCUCGAUUGGCGAGAUCUUGCUCGAAAAUUUUCCGUUAGUUAAGUCUCGUAUCUCGACCGACUGUGGCAGUGCGAGCCCACGAAGCACAAGGUGUACUAUAUCUAUCACUCAUAUAAGAUACUCAGGCUUGCGGAUUAAGGAUAUCCUUGGGACCUGGAGGCUUGUUCUGAUUUUAUCACAAUAUCGAGUCGGUCAAUUGACUCGCACUGGUUUUCCGGUGGAUAGCAUAGGUAACUCCUGGGUCUGGUUCAUGACAUGUCAUUACCUCACCCCAUCAAACGGACAGACUACGAGUCGAUUUUUAUCCCCGCCUACCAAGUGGUGGGGCCUUCAUUCAGUUAGGAUAAUGAAUGGGCGACAAGACGUAGCGCAUCCGUACGUGAGGUUCGGGUUGAGAAACAAAAAAGAGUGGGAUGAGCACAAAUAUAACGGAGUAUUACCUCUCGGCGGGACCGCAAUAGACGUAGGGUCCGUAGGUACGUCAGUGAAUGAUUCUCAGGAAAAGACCUACUUAGACUGUACUCCGAUUCAAUCUCUCUUAAUUCCUCAAAUCCCACUUAGUAGGAAAAAAACAAUCUUUAGUACCGCGUACUGUGAAGUCUGGCUUCAGAGAGCACUCGGCGACAGUUGGACUUAUGAUUUAGAUUCCAGGGUUACCCUCACAAGAGUAUAUCCUAAGGUCCUCCGUCCAAAAUGGCACCAUACAUAUAUAGUGCUACGCCCAAUGCAGGUGGGCUCCUCCAACCUACCUGUUGACCGUUAUUGUAGUCCUUGCCUCUCUCAGAUCGUUCCGGAGCUAGUUCCGUGUGCAGGUAUACGUGCCGAGACGCCCCCACAUAUGCCAACUUUCAUAUGCACAGCAUUCAAAACAAAGGUUAUGCUAGCGGGUGGGGACGGCAGUAUGCAAGUAGUUCCCAUGAAGUCUAGACUUCCCAUACCCUGUUCUUCUUCUUUUCUGAUCGGGCCAGCCGAUCGAAUUCGAUGUGCGGGCCACAGUAAAACACUUUUCGUAUCUCGGAUCGGGCCCAUGUAUCUACUCCUUCACUUACUAUCGAUGGAGUCUUUAGGCUUACUCUCCACGGCUCCAUGUAUUUGCUCGGUGGGUGCGACGAGGUCAAAUGAAGCGUCCUGGAAUAUUUCCUUGAAGCUCGUAACAACUUUUGGAGGCGCUAGUGAGGCUUGUAUAUUCUUGAAGCGACUCGACGGCAGGUACGUGUUCGUUCCGAACAGGUCUUCUGGUGACCCCUAUAAAGCAACAAGCCAGUUCAAUGCCAAAGUUGAUGACGCCUUCGAGCAUCCUUCGUACAGCAAACUUGAAUGUCUCGCGAAGGGCAUAUUACUAAAACCGCCGAGUGUCCUAAGAGCCGGUGUUUUGUAUGUAUGGAAGACUACAGAGAGCUUCCGAUCAGUUCCAUUCGUAACAAACAAAGCUAUAUUAUCCCAAGUACACAAGUUCACCAUCCCCGGCACCGUCGGCAGGGAGCGACAUAAGAAGUCGAUGCCGGGGAGUCGUCGGCAUGCUGACGUAGUCAAUUGGAACUGUAGUGGGAAAUUGGGUCCACGGACUUCACCAAUGUGGAAAUUCCUAAGCAAUCCCGGUGGGCCAAAUAGAAAGCUUGAGGCACCAAUCCCCAUUCGAUUGAAGUCCCCAGGAGAACACACAGCGGGCUUCAAGUCACAUGAAGCCUCCUUCCCUUUGCCAUGGAAGUCAUCCGGAAACUCACCUUUAUUCGUAGAUCAGCAGAAUACGAGCACAAGCCAUCGCAAAGUUUACUACGUGCUCUCGCUACACGUAAAAAUACGAGGAACGGUACAUGCUUGUGUGGUUUUAGUCUCUCUAAGGAGUGUGCAAGGAAUAUUGGAUACGGCAAUCACACUAGGAACAGGGGGCAUGAUAAAGCGCACUCCGCAAGACGGUCCAGAAGAACAGGCAUCUGGGCCACAUGGUUGUAGGGAAUGCAAUAUGCCACCGAAAAGUUUAUUGGAAGAGGAGAGCAACUCAAGAGUCCAGCAUAAGGGGCAUGCCCCCAUGGUCCACGUCUCGCGCGGCACAAGCUCAACAAAGUGGUUGCCAUCCAAAGUAAGUUAUACAGAAUCGCCGACGGGUGAGCUGGUGUCAUCGCCUUGCGACUUAUUAGUUACCGAUAAUUUGGCUAUUAUCGGCGGUAGAGAAUCGUCGCGCGACAUCUCUCCUCUAACCUGUGUUGAUAGCGCCUGCGCUUGUAAAAUGGACGUAUACAAGGGCGAACUCAGAUAUGUGGAAAGGGAUAAGUGGCAUGUGGUCGGUGGUGAACAGUUAAGUAGACGCCUUCAAAGAGUCAUUGACUCCAUCAGCCCCAGAAGAUUGUUGAUCUUAUGUGGUAAUAGUGUAAACGUCAACGAUCUCUCUAGUCGGUGGUUAAGUUGUAGCUAUGUGGUGCGGGGUAGGCUUAAACUAAUCUCGUCUAGCGCCUCCGUGCUGGGGAUCAGGAAAAUCAACGCACAUUACCGGUGUUUAGUCAAUCUUAAUGGGGCAAAGGCGGCCACGUCAUUUCGUGUAAAAGGCUGGCGUGCUGUCCCGGAAUGGUGUCAAUCAAGCACACAUCCUUCGCAGAACUCUGAUCAUUCCGUGUUUUACGUGUCAUGUUCCGACCAAGAAACGCUUCAUUGGACAAGCCCGGGUAGUGCGGCCGUUGGGAAUCGUUGCAGACCAUGCAGCCUUCAAGCUCAGCAGCUCACCUUGGUUACGCCGGUUUUUUUCCCAUUUGGUGCGGUCCUGCACCGUUCGAAUCUUAGGACUAUCAUGGAGACAGCGAGCAAACAACUCUUGGCUCUCCUUCGUACAACGGACCGCGUUCUGGAAUGUGAGUCGUCUUGUCUAGAUGUUAUCAGUAGUGCGCUAGAUCAAGCUGGGAGAGCCGGAAGCACCCUCUGUUCUGAUUUUCCUGACUGGAAUGGCUUUAUAGUAAAGACUGCACCCCAGGUUGACCUAGCGUUACGUGACGAGUCCACCCCACCGUUAAGCGUCUAUUGUCAAACUAACCGGUGCCCAAGCGAAUAUACGCCCACAUGGGCAUUUCCGGUUAUUGGAGUGUAUCGAGCUAUAUUGGUUUUAAUCAGGGACUGGAAGAAGUUCGGCAGUGGAACAUACGACAAUGUAGGAACGGGCGCAUGUCUGUCACUAAAGCCGAACUCAGGCAGCUGCUUGUGCCCCGGGGGCUCGUUCAAGGUACAGUGGCUUUGCGGUCUCAUGCCUUUAUGUAGCCCCCGCCAAGCGUACGCAACACCGCGCUCCCACCAAGGUUGGGGCCCGGCCUGGGUCCAGCGUGAACGCCUAGUAAACGUUUCAUACGACCGCGGGAAUCUCAGGGGCAGAAGGGCACAUAAGAACAGACGGCCCACAGGCAAGACGAGAGGAAACAUGGGUCUCCCAAUCAUGCGGCCUGCGCUCCCCCGGCAUCAUUCUAGUGUGCAUGAAUCGCAUGUAAGAUGCCUAAAGAUCGUUCACGCCCCUUGCGCGUGUACGAUCUGUAUACCAACGCAACCGGAGCACGUAACCGCAAUCGGUAGGCGCAAGGGGCACGACCGGACGCGGGGCACCAGGCGAGGCUGUGAUACCUGGUUUUACAAGUACAAUUCGAGGAUACCAAGAGGCAUAUUGCUAGCAAGAUUGCAUCGUAGGCAACCCAGGGCUCUUCUACAAGGACCUCCUACAAAUUUAGCCAAAGACAUUGUACUAUUAUAUGAUACAUCAGACGUAAGCCCCAACGCAUACGGACAGUCGGUAAUGGGGGUCUUGGGAUCAAGGGGUCCGAUCAAUUGUUUAUCGGCUCCCAAGAGAAAUUAUGGUACGUUGGUUAGUCACACAAUGCCACGUUCUAGCUAUCAGAGCUUAGUGAGAGAACCUGUGGCAAUUUCUGGUGUCAGCGGACCUACCCCGUCAGGGCAGCGGCGCGCACUCACGGUUCGGUGCACAUCAGAGGAGGAACAGCCCUACUGGAUAUCCUUUAUCGCGGAGGAUGUACUGAAACUGCCACGGUUUCGUAACAAUUGUAAAUGGGGGGCUCCCACAGUAAAUUCCCUGUACAAAGAAUCCUUCGUUAGGAACCAUGCUGCCCCAAAGAACAAAGGAGUUCGAAUUCUGCUUUUCCUCUCAAGGCAGGCUCGAGCACGAGCAGGUAGAUCUGAUACUGUUUUAGUCCUGCUCCACACGUACCAAGGGGUCAUCGGUGUACUCAGAUGCUUGGUUACCAACGAGGGUAGCGCUACUGAGCCCAACGCCCUGGCAACUCAUGACGAAGACAACGAUGUUACCGCGUUAUCUCGUGCCGGUGUGAGUUGCCAAAGCGAUAUGGAGUCGAAGAAGGUGACAAGGGGGGAUGCCUCCGACAGCUUCAAUCAGAAUUCCACUCGCGUUAACCAAGGUAAGUUACAUACAGAGAGCAGCGUCGCACUGCGUCACCUGGAUGGCAGUGGUUUAAAUGGCCGCUACGGGGUCGUCAGGACACCUUGGUCUGCCAAGUCUCUCAGGGACAUCCUGCAGCUUCCAACCACACCGAAACAGCACCGUUCCUCCACGCAUGGCAGAGGCAUUCGACUUCGUUCGUUCGCCAUUGGCCGUCCAUUGAGCGCUUCAGUUACGACUUCCACACGCUGCAUACUAAUCGGCGAAGCGACAUGUGUGUGUACGGUUGGGAUUGUGACCGGGUCCAGCGGGAGCAGCUUUUUGUUAUCUCUUUACCUCGCGCCUGGGCUUUCUCAUAUACCGACAGUCCAUCCCCGGUCAGCACCAUUUUCCUCCACCAUGGCUGCGAUAAUGGUAAUGGAUAUGAGUGUUCUUUCGUCAGGCGCUCCGGGCAUUUUUUCCGAUCUACACACACCCAAUGUGCCCCCCUUAACGACACAGACCAGUUUGCGCAGCAUACAUCAUGAUCUAGUCCGCUCAGGAUGCGGAGUACAAUCUGUUCGAAGCCAUGUACUACACGACGACGAUUCCGGAAGUCACUCGUACUGUCUGUACUCUAGCGUCAGAAUUCCGGGGGACUGGUUUGUCGUGUCACUCGUGUUGGCAGGGAAAUUGCUUUUCAAGAUUGCUUGGCCUUUGAGGUUAUUAGACACGGAGCCGGAGUGGAUCAAGGGGGAAAGCCUCGGCACAAAUCACGCAGAAAGUAAUCGCACCUGGGAAGUACAGAUGAUUUUCACCUCAAUGCCUUUGGUUGUGUAUUCACCAUCAUUGUUCAGGGACGGCUGGUUCUGUUGCCAAGGAAUGCUCCGGGGAACGCCGCAAACGAUGUCGGGAUACAGAUACGAACCAUGCCAAAUCCUCAAUCCCGGUGUAAUCCAAGGCGUAAGGUAUCCGCCCUUGCUUAGCAUAAUCGGUUUAUCAUGCGGUGGUACCACUGAAACGUUGAAAGGAAUUCUCGGGAGGCCGCGGUUACGUUGGUUCAGGCACGUCCUAGCCUACAGCUGCAGAAGGAGCGCCGGUCCUACACGGGACGUGACGACCUCCCCACUACUUAUCGACAGCCGUUGCUGUCGUGCCGACGACGGAUCAGUCGAAGAGUUAGUGCAAAAGGGACGAGGUUUGAAGUCUACAGACAUACCAGUUUUACUAGACUCGGUGGUUCGGAUACACGUGAUCAAGUCUACAUCCGACAAACGAAUAGCGUGCGGAUUGUGCCUACGACUGCAGAGCAUUGCCACGGACAAGCUAAGCGGCAGGGAAACAAUAAAAAAGCUAGCUGACGCCAUACGGUCCGAUUACCACUACUGGCUGUCGCACAUGCGCAGUAGUCUACUUGCCCUGCACGGGUGGAUUCGCGCAUGCGUAUACCCCCAUGAGCGCUCAGACGGGAACUACGGUGUCCGCAAACCAUAUGCCGUGAACAUGGGCCACUGUCCCAUAGACCAUGCGAUACGAUCUCACGGCCGCACGUCUUGGGACGGAGUUUACCCGGUGCUAUCUUCUGACCAAUCUAGGCCGAAGGAAGUCUUUCGACCCGGUGGUAAGAGCGUCUGCUAUUCAACCCUGGCGUCCCUGGGCGCCCGUACCGGGGCUAACGUGGGGCUGGUAAUGAGUGCAGAACGUGCUUCAAUCACAGAUUGCUAUCGGCAAUGCUAUGAGAACGUCAUGUUGGGGUGUCAAUCGGUCAUCGGACGUUAUGGGUCUGGCGGUUACGAGAGAGGGAUCGGAUCGGUUGAACAAAACGCCCUCCGAUCCGUUUUCAAAUGUCAUAAUGAGCUGCCUAUGCCGCUUGACGGCAUGAGCAAGAGGCCAACACGUGAAACCAUCUACAUACAAAAGUUCAGUUUGAUAAAAAUGUCCUCACGAAGACACGGAUUGGCCCGGAGAAUGGCCAGAAGAGUAUCGGAGCGCAGUACCGAGAACUUAGUGGUUAGGUCUGCGUUGCGAAGAAUGGAGAAGCAGACUGCCACGUCAAGCCAUGUAACAGAUGAAAACCCUCACACCCCGUCUAUUGCGAAAACUUGUGUUCCUUACCUGUGGCGAAUAGAGGGGAGGCCCCGGUCUGGUGCUGCCACGCUCGGCAGAACCAGACUAUCGCGUCGAAGGUUUACCGAGGGUCCGUCAAGAUUACGUUCGACGACCGGGAAGACGCCGCUCUUUCGGCAUGCGCUGGCCCGACGUUUCUAUGAAUUACCUUUGGUGAUGGCGUGCAACUUAAGAGUGGAACCAUUUUACAGCUGUCUCGAGACUUCAACAUACUCCGGUGCACCCGGUCACAAGUAUCAGUAUUGGGCUAGUGCGUGUUUGAGUCUUGCCUAUUCCACAGCGUUCUGGGCCCGCACCAUCUUUGUUGUGUACCCUCAGAACCUUUCUCACAAAUCCCACACAUUGCGCGCAAGUUCCUCAAGCCCUAAUAUCCCGAGGUUCCCCCGUCGCGGUUGGCAUCCGUCAGCACCCAGAAGACAGGUGCUGGUCGUAGGCCUUGGACAGUCGGCUUUUCCGCGUACUAAGCAAGGAUUAGGCCCUGUAUCCCUACGUGGAUGGGCCCAGAACGCGUUAAUCGCCCCGUCCACUUAUCCCGGAAAUGCGGGGCUGGAGGACCGUACCUCUAGGUCCUGGAAUUCAAGUAUUGCGAUUAUUAUCACGCGCGACUCGGUUACCACGCCGCUUUUUGUUGUACGCUUUGGUGAGCUGUCGCUUAGAGUCACGUGGAUGUUCUCAACCCACGCGAGCCUCCUCAUCCGCCCGGGCCUACCCAAGGCCGAUCAAGGCGUUCACAAUCUGCCCCUGCAAGGGCACUUCGCUCCAUUACCCCUUACAAAGCAAGCUGCGGAGCAGCGCCGCUCCGAAUUUCUGCCUGCAUUUCGAACAGCUGGAUAUGAGCUAACGUGCGAGGGUCGCAGCGUAGCCGGUAAUGUUCAGCAUGGUAACUGUACGGUGCAUCCCACCGGAUCACGUAUCUCAGAUAGAUUUUACUGUCGAUUUAUAUCAUCCGGGUAUAAGUAUGAAGACGGUGCUCGCUUCCCCGUACUUAGAGCCUCUACAUUUGAGAAUUGUCGCUGCGAACCCUGUCAGCGCGUGACCGCUAGUAAUAUAUGCGUCAUUUGGUGUACGUGUUGCGAAAGGUCUCGUGACGGAGGGCAAGGAUCUAUAGAUUUCCUCCUCACUGCAGGAGCAUACCUCAUAUUCAACCUUACUAUGCAAGUGCUGGUACUUGCACUGUGUUACUUCUUGUCGGACAACGCGACCGGUUAUACAGCUAUCAGAAGGCAUUUGUCGACCGCAGACAGAACACCGGGGCUCUUACAGGGAUUAACAUUAACGGUAGCCUGGGCGCUGGUUUUGUUGUCUACCCCGGAGUUUCACAAACCUAAUUACGCGCCUCGAAAUACAGCUGGUAGAACUCCAUCUAGGGUGUCGGAACCCCAGUAUGUCAGUACUUUUAUCCCUUUAAGUGGCUACUUAUUCUUUUCCUCAUUAAUAGAGGAAACGAAGCGCUAUCUGGUUUUCCGGGCUCGGCGCAAAAUUUCAGGCGGAACGCUCCAUAAAGGUCCUAAUCCAAGCUCUCCGACAAAACCGCAGAUCGUUUGUACACGAUCUGAAGGCGCUAGAGUCCGCUGUCGACGACAUCGCUUCAUUAGGAGGCUCAAGUAUAGCGGCUCAUAUGGUGUAAGGGGCUUCCCUCGCUUAGGUGGCGGGUUAACACAAUCCAGGGCAGUUGAACGCUUGGACGCAUCAAGAAUCAAGAGUGUGUCGGGAAGAUUCACUAGCUCGUGCUGCGAUUUCCUCUGGAGUAUUCCUAUACGGAUCUAUACCUUUGUGGGGUUGAGAUAUGUGGCCCGGUUUUUUUUUAUAGUUUGCGUACGAGAGGGCAAGAGCGUUUGUCACAGCUAA
View
@@ -0,0 +1,77 @@
+rna = "AUGCAAUUAAUCGCGCUAGACGCUCAGAGGUGGAUAUUAAGUGGAGUAAUAAUUAAUCCGAACCCUGUUAACAAAAGGAUAACUACAGACGUUACUUAUAUGCAUCAGAAGGCGGUCACCAGUGCCCAGACUUUGCCUAGAACGCAGUCUAUGCGGGGUUCUUCAACGUCAGUUAUCUCUACCGAAGGGCGUGCGAAUCCCACACCUUGUCCACAGAACGUGCCGGCGUCAAUUGGUCCUACCACUUUAGCCUCGCAUGCCCCAUUGGUAUUCUUUCAACGCUUCCCCUCAAGGGACGGUCGGGGCACGGUUCUACAAAAUGCACGAGCUCAAGUAAUGGUGAUAUCCCGCCCUUUGUGUGCCAUAGUGAACCCGGCCGAUAUCCCGGGUCAAUGUACGUUGGUACUACUCAAAGCGUGUAUCACUUGCCCGAGUAGGGGUUACCUUGUAUCCCACUCAGUACCUCCUAACCAGCAACCGAGGGCUACACGGAAUCAACCAAAGGACAUACCCUCGAUUGGCGAGAUCUUGCUCGAAAAUUUUCCGUUAGUUAAGUCUCGUAUCUCGACCGACUGUGGCAGUGCGAGCCCACGAAGCACAAGGUGUACUAUAUCUAUCACUCAUAUAAGAUACUCAGGCUUGCGGAUUAAGGAUAUCCUUGGGACCUGGAGGCUUGUUCUGAUUUUAUCACAAUAUCGAGUCGGUCAAUUGACUCGCACUGGUUUUCCGGUGGAUAGCAUAGGUAACUCCUGGGUCUGGUUCAUGACAUGUCAUUACCUCACCCCAUCAAACGGACAGACUACGAGUCGAUUUUUAUCCCCGCCUACCAAGUGGUGGGGCCUUCAUUCAGUUAGGAUAAUGAAUGGGCGACAAGACGUAGCGCAUCCGUACGUGAGGUUCGGGUUGAGAAACAAAAAAGAGUGGGAUGAGCACAAAUAUAACGGAGUAUUACCUCUCGGCGGGACCGCAAUAGACGUAGGGUCCGUAGGUACGUCAGUGAAUGAUUCUCAGGAAAAGACCUACUUAGACUGUACUCCGAUUCAAUCUCUCUUAAUUCCUCAAAUCCCACUUAGUAGGAAAAAAACAAUCUUUAGUACCGCGUACUGUGAAGUCUGGCUUCAGAGAGCACUCGGCGACAGUUGGACUUAUGAUUUAGAUUCCAGGGUUACCCUCACAAGAGUAUAUCCUAAGGUCCUCCGUCCAAAAUGGCACCAUACAUAUAUAGUGCUACGCCCAAUGCAGGUGGGCUCCUCCAACCUACCUGUUGACCGUUAUUGUAGUCCUUGCCUCUCUCAGAUCGUUCCGGAGCUAGUUCCGUGUGCAGGUAUACGUGCCGAGACGCCCCCACAUAUGCCAACUUUCAUAUGCACAGCAUUCAAAACAAAGGUUAUGCUAGCGGGUGGGGACGGCAGUAUGCAAGUAGUUCCCAUGAAGUCUAGACUUCCCAUACCCUGUUCUUCUUCUUUUCUGAUCGGGCCAGCCGAUCGAAUUCGAUGUGCGGGCCACAGUAAAACACUUUUCGUAUCUCGGAUCGGGCCCAUGUAUCUACUCCUUCACUUACUAUCGAUGGAGUCUUUAGGCUUACUCUCCACGGCUCCAUGUAUUUGCUCGGUGGGUGCGACGAGGUCAAAUGAAGCGUCCUGGAAUAUUUCCUUGAAGCUCGUAACAACUUUUGGAGGCGCUAGUGAGGCUUGUAUAUUCUUGAAGCGACUCGACGGCAGGUACGUGUUCGUUCCGAACAGGUCUUCUGGUGACCCCUAUAAAGCAACAAGCCAGUUCAAUGCCAAAGUUGAUGACGCCUUCGAGCAUCCUUCGUACAGCAAACUUGAAUGUCUCGCGAAGGGCAUAUUACUAAAACCGCCGAGUGUCCUAAGAGCCGGUGUUUUGUAUGUAUGGAAGACUACAGAGAGCUUCCGAUCAGUUCCAUUCGUAACAAACAAAGCUAUAUUAUCCCAAGUACACAAGUUCACCAUCCCCGGCACCGUCGGCAGGGAGCGACAUAAGAAGUCGAUGCCGGGGAGUCGUCGGCAUGCUGACGUAGUCAAUUGGAACUGUAGUGGGAAAUUGGGUCCACGGACUUCACCAAUGUGGAAAUUCCUAAGCAAUCCCGGUGGGCCAAAUAGAAAGCUUGAGGCACCAAUCCCCAUUCGAUUGAAGUCCCCAGGAGAACACACAGCGGGCUUCAAGUCACAUGAAGCCUCCUUCCCUUUGCCAUGGAAGUCAUCCGGAAACUCACCUUUAUUCGUAGAUCAGCAGAAUACGAGCACAAGCCAUCGCAAAGUUUACUACGUGCUCUCGCUACACGUAAAAAUACGAGGAACGGUACAUGCUUGUGUGGUUUUAGUCUCUCUAAGGAGUGUGCAAGGAAUAUUGGAUACGGCAAUCACACUAGGAACAGGGGGCAUGAUAAAGCGCACUCCGCAAGACGGUCCAGAAGAACAGGCAUCUGGGCCACAUGGUUGUAGGGAAUGCAAUAUGCCACCGAAAAGUUUAUUGGAAGAGGAGAGCAACUCAAGAGUCCAGCAUAAGGGGCAUGCCCCCAUGGUCCACGUCUCGCGCGGCACAAGCUCAACAAAGUGGUUGCCAUCCAAAGUAAGUUAUACAGAAUCGCCGACGGGUGAGCUGGUGUCAUCGCCUUGCGACUUAUUAGUUACCGAUAAUUUGGCUAUUAUCGGCGGUAGAGAAUCGUCGCGCGACAUCUCUCCUCUAACCUGUGUUGAUAGCGCCUGCGCUUGUAAAAUGGACGUAUACAAGGGCGAACUCAGAUAUGUGGAAAGGGAUAAGUGGCAUGUGGUCGGUGGUGAACAGUUAAGUAGACGCCUUCAAAGAGUCAUUGACUCCAUCAGCCCCAGAAGAUUGUUGAUCUUAUGUGGUAAUAGUGUAAACGUCAACGAUCUCUCUAGUCGGUGGUUAAGUUGUAGCUAUGUGGUGCGGGGUAGGCUUAAACUAAUCUCGUCUAGCGCCUCCGUGCUGGGGAUCAGGAAAAUCAACGCACAUUACCGGUGUUUAGUCAAUCUUAAUGGGGCAAAGGCGGCCACGUCAUUUCGUGUAAAAGGCUGGCGUGCUGUCCCGGAAUGGUGUCAAUCAAGCACACAUCCUUCGCAGAACUCUGAUCAUUCCGUGUUUUACGUGUCAUGUUCCGACCAAGAAACGCUUCAUUGGACAAGCCCGGGUAGUGCGGCCGUUGGGAAUCGUUGCAGACCAUGCAGCCUUCAAGCUCAGCAGCUCACCUUGGUUACGCCGGUUUUUUUCCCAUUUGGUGCGGUCCUGCACCGUUCGAAUCUUAGGACUAUCAUGGAGACAGCGAGCAAACAACUCUUGGCUCUCCUUCGUACAACGGACCGCGUUCUGGAAUGUGAGUCGUCUUGUCUAGAUGUUAUCAGUAGUGCGCUAGAUCAAGCUGGGAGAGCCGGAAGCACCCUCUGUUCUGAUUUUCCUGACUGGAAUGGCUUUAUAGUAAAGACUGCACCCCAGGUUGACCUAGCGUUACGUGACGAGUCCACCCCACCGUUAAGCGUCUAUUGUCAAACUAACCGGUGCCCAAGCGAAUAUACGCCCACAUGGGCAUUUCCGGUUAUUGGAGUGUAUCGAGCUAUAUUGGUUUUAAUCAGGGACUGGAAGAAGUUCGGCAGUGGAACAUACGACAAUGUAGGAACGGGCGCAUGUCUGUCACUAAAGCCGAACUCAGGCAGCUGCUUGUGCCCCGGGGGCUCGUUCAAGGUACAGUGGCUUUGCGGUCUCAUGCCUUUAUGUAGCCCCCGCCAAGCGUACGCAACACCGCGCUCCCACCAAGGUUGGGGCCCGGCCUGGGUCCAGCGUGAACGCCUAGUAAACGUUUCAUACGACCGCGGGAAUCUCAGGGGCAGAAGGGCACAUAAGAACAGACGGCCCACAGGCAAGACGAGAGGAAACAUGGGUCUCCCAAUCAUGCGGCCUGCGCUCCCCCGGCAUCAUUCUAGUGUGCAUGAAUCGCAUGUAAGAUGCCUAAAGAUCGUUCACGCCCCUUGCGCGUGUACGAUCUGUAUACCAACGCAACCGGAGCACGUAACCGCAAUCGGUAGGCGCAAGGGGCACGACCGGACGCGGGGCACCAGGCGAGGCUGUGAUACCUGGUUUUACAAGUACAAUUCGAGGAUACCAAGAGGCAUAUUGCUAGCAAGAUUGCAUCGUAGGCAACCCAGGGCUCUUCUACAAGGACCUCCUACAAAUUUAGCCAAAGACAUUGUACUAUUAUAUGAUACAUCAGACGUAAGCCCCAACGCAUACGGACAGUCGGUAAUGGGGGUCUUGGGAUCAAGGGGUCCGAUCAAUUGUUUAUCGGCUCCCAAGAGAAAUUAUGGUACGUUGGUUAGUCACACAAUGCCACGUUCUAGCUAUCAGAGCUUAGUGAGAGAACCUGUGGCAAUUUCUGGUGUCAGCGGACCUACCCCGUCAGGGCAGCGGCGCGCACUCACGGUUCGGUGCACAUCAGAGGAGGAACAGCCCUACUGGAUAUCCUUUAUCGCGGAGGAUGUACUGAAACUGCCACGGUUUCGUAACAAUUGUAAAUGGGGGGCUCCCACAGUAAAUUCCCUGUACAAAGAAUCCUUCGUUAGGAACCAUGCUGCCCCAAAGAACAAAGGAGUUCGAAUUCUGCUUUUCCUCUCAAGGCAGGCUCGAGCACGAGCAGGUAGAUCUGAUACUGUUUUAGUCCUGCUCCACACGUACCAAGGGGUCAUCGGUGUACUCAGAUGCUUGGUUACCAACGAGGGUAGCGCUACUGAGCCCAACGCCCUGGCAACUCAUGACGAAGACAACGAUGUUACCGCGUUAUCUCGUGCCGGUGUGAGUUGCCAAAGCGAUAUGGAGUCGAAGAAGGUGACAAGGGGGGAUGCCUCCGACAGCUUCAAUCAGAAUUCCACUCGCGUUAACCAAGGUAAGUUACAUACAGAGAGCAGCGUCGCACUGCGUCACCUGGAUGGCAGUGGUUUAAAUGGCCGCUACGGGGUCGUCAGGACACCUUGGUCUGCCAAGUCUCUCAGGGACAUCCUGCAGCUUCCAACCACACCGAAACAGCACCGUUCCUCCACGCAUGGCAGAGGCAUUCGACUUCGUUCGUUCGCCAUUGGCCGUCCAUUGAGCGCUUCAGUUACGACUUCCACACGCUGCAUACUAAUCGGCGAAGCGACAUGUGUGUGUACGGUUGGGAUUGUGACCGGGUCCAGCGGGAGCAGCUUUUUGUUAUCUCUUUACCUCGCGCCUGGGCUUUCUCAUAUACCGACAGUCCAUCCCCGGUCAGCACCAUUUUCCUCCACCAUGGCUGCGAUAAUGGUAAUGGAUAUGAGUGUUCUUUCGUCAGGCGCUCCGGGCAUUUUUUCCGAUCUACACACACCCAAUGUGCCCCCCUUAACGACACAGACCAGUUUGCGCAGCAUACAUCAUGAUCUAGUCCGCUCAGGAUGCGGAGUACAAUCUGUUCGAAGCCAUGUACUACACGACGACGAUUCCGGAAGUCACUCGUACUGUCUGUACUCUAGCGUCAGAAUUCCGGGGGACUGGUUUGUCGUGUCACUCGUGUUGGCAGGGAAAUUGCUUUUCAAGAUUGCUUGGCCUUUGAGGUUAUUAGACACGGAGCCGGAGUGGAUCAAGGGGGAAAGCCUCGGCACAAAUCACGCAGAAAGUAAUCGCACCUGGGAAGUACAGAUGAUUUUCACCUCAAUGCCUUUGGUUGUGUAUUCACCAUCAUUGUUCAGGGACGGCUGGUUCUGUUGCCAAGGAAUGCUCCGGGGAACGCCGCAAACGAUGUCGGGAUACAGAUACGAACCAUGCCAAAUCCUCAAUCCCGGUGUAAUCCAAGGCGUAAGGUAUCCGCCCUUGCUUAGCAUAAUCGGUUUAUCAUGCGGUGGUACCACUGAAACGUUGAAAGGAAUUCUCGGGAGGCCGCGGUUACGUUGGUUCAGGCACGUCCUAGCCUACAGCUGCAGAAGGAGCGCCGGUCCUACACGGGACGUGACGACCUCCCCACUACUUAUCGACAGCCGUUGCUGUCGUGCCGACGACGGAUCAGUCGAAGAGUUAGUGCAAAAGGGACGAGGUUUGAAGUCUACAGACAUACCAGUUUUACUAGACUCGGUGGUUCGGAUACACGUGAUCAAGUCUACAUCCGACAAACGAAUAGCGUGCGGAUUGUGCCUACGACUGCAGAGCAUUGCCACGGACAAGCUAAGCGGCAGGGAAACAAUAAAAAAGCUAGCUGACGCCAUACGGUCCGAUUACCACUACUGGCUGUCGCACAUGCGCAGUAGUCUACUUGCCCUGCACGGGUGGAUUCGCGCAUGCGUAUACCCCCAUGAGCGCUCAGACGGGAACUACGGUGUCCGCAAACCAUAUGCCGUGAACAUGGGCCACUGUCCCAUAGACCAUGCGAUACGAUCUCACGGCCGCACGUCUUGGGACGGAGUUUACCCGGUGCUAUCUUCUGACCAAUCUAGGCCGAAGGAAGUCUUUCGACCCGGUGGUAAGAGCGUCUGCUAUUCAACCCUGGCGUCCCUGGGCGCCCGUACCGGGGCUAACGUGGGGCUGGUAAUGAGUGCAGAACGUGCUUCAAUCACAGAUUGCUAUCGGCAAUGCUAUGAGAACGUCAUGUUGGGGUGUCAAUCGGUCAUCGGACGUUAUGGGUCUGGCGGUUACGAGAGAGGGAUCGGAUCGGUUGAACAAAACGCCCUCCGAUCCGUUUUCAAAUGUCAUAAUGAGCUGCCUAUGCCGCUUGACGGCAUGAGCAAGAGGCCAACACGUGAAACCAUCUACAUACAAAAGUUCAGUUUGAUAAAAAUGUCCUCACGAAGACACGGAUUGGCCCGGAGAAUGGCCAGAAGAGUAUCGGAGCGCAGUACCGAGAACUUAGUGGUUAGGUCUGCGUUGCGAAGAAUGGAGAAGCAGACUGCCACGUCAAGCCAUGUAACAGAUGAAAACCCUCACACCCCGUCUAUUGCGAAAACUUGUGUUCCUUACCUGUGGCGAAUAGAGGGGAGGCCCCGGUCUGGUGCUGCCACGCUCGGCAGAACCAGACUAUCGCGUCGAAGGUUUACCGAGGGUCCGUCAAGAUUACGUUCGACGACCGGGAAGACGCCGCUCUUUCGGCAUGCGCUGGCCCGACGUUUCUAUGAAUUACCUUUGGUGAUGGCGUGCAACUUAAGAGUGGAACCAUUUUACAGCUGUCUCGAGACUUCAACAUACUCCGGUGCACCCGGUCACAAGUAUCAGUAUUGGGCUAGUGCGUGUUUGAGUCUUGCCUAUUCCACAGCGUUCUGGGCCCGCACCAUCUUUGUUGUGUACCCUCAGAACCUUUCUCACAAAUCCCACACAUUGCGCGCAAGUUCCUCAAGCCCUAAUAUCCCGAGGUUCCCCCGUCGCGGUUGGCAUCCGUCAGCACCCAGAAGACAGGUGCUGGUCGUAGGCCUUGGACAGUCGGCUUUUCCGCGUACUAAGCAAGGAUUAGGCCCUGUAUCCCUACGUGGAUGGGCCCAGAACGCGUUAAUCGCCCCGUCCACUUAUCCCGGAAAUGCGGGGCUGGAGGACCGUACCUCUAGGUCCUGGAAUUCAAGUAUUGCGAUUAUUAUCACGCGCGACUCGGUUACCACGCCGCUUUUUGUUGUACGCUUUGGUGAGCUGUCGCUUAGAGUCACGUGGAUGUUCUCAACCCACGCGAGCCUCCUCAUCCGCCCGGGCCUACCCAAGGCCGAUCAAGGCGUUCACAAUCUGCCCCUGCAAGGGCACUUCGCUCCAUUACCCCUUACAAAGCAAGCUGCGGAGCAGCGCCGCUCCGAAUUUCUGCCUGCAUUUCGAACAGCUGGAUAUGAGCUAACGUGCGAGGGUCGCAGCGUAGCCGGUAAUGUUCAGCAUGGUAACUGUACGGUGCAUCCCACCGGAUCACGUAUCUCAGAUAGAUUUUACUGUCGAUUUAUAUCAUCCGGGUAUAAGUAUGAAGACGGUGCUCGCUUCCCCGUACUUAGAGCCUCUACAUUUGAGAAUUGUCGCUGCGAACCCUGUCAGCGCGUGACCGCUAGUAAUAUAUGCGUCAUUUGGUGUACGUGUUGCGAAAGGUCUCGUGACGGAGGGCAAGGAUCUAUAGAUUUCCUCCUCACUGCAGGAGCAUACCUCAUAUUCAACCUUACUAUGCAAGUGCUGGUACUUGCACUGUGUUACUUCUUGUCGGACAACGCGACCGGUUAUACAGCUAUCAGAAGGCAUUUGUCGACCGCAGACAGAACACCGGGGCUCUUACAGGGAUUAACAUUAACGGUAGCCUGGGCGCUGGUUUUGUUGUCUACCCCGGAGUUUCACAAACCUAAUUACGCGCCUCGAAAUACAGCUGGUAGAACUCCAUCUAGGGUGUCGGAACCCCAGUAUGUCAGUACUUUUAUCCCUUUAAGUGGCUACUUAUUCUUUUCCUCAUUAAUAGAGGAAACGAAGCGCUAUCUGGUUUUCCGGGCUCGGCGCAAAAUUUCAGGCGGAACGCUCCAUAAAGGUCCUAAUCCAAGCUCUCCGACAAAACCGCAGAUCGUUUGUACACGAUCUGAAGGCGCUAGAGUCCGCUGUCGACGACAUCGCUUCAUUAGGAGGCUCAAGUAUAGCGGCUCAUAUGGUGUAAGGGGCUUCCCUCGCUUAGGUGGCGGGUUAACACAAUCCAGGGCAGUUGAACGCUUGGACGCAUCAAGAAUCAAGAGUGUGUCGGGAAGAUUCACUAGCUCGUGCUGCGAUUUCCUCUGGAGUAUUCCUAUACGGAUCUAUACCUUUGUGGGGUUGAGAUAUGUGGCCCGGUUUUUUUUUAUAGUUUGCGUACGAGAGGGCAAGAGCGUUUGUCACAGCUAA"
+
+codons = {
+ 'UUU' => 'F',
+ 'CUU' => 'L',
+ 'AUU' => 'I',
+ 'GUU' => 'V',
+ 'UUC' => 'F',
+ 'CUC' => 'L',
+ 'AUC' => 'I',
+ 'GUC' => 'V',
+ 'UUA' => 'L',
+ 'CUA' => 'L',
+ 'AUA' => 'I',
+ 'GUA' => 'V',
+ 'UUG' => 'L',
+ 'CUG' => 'L',
+ 'AUG' => 'M',
+ 'GUG' => 'V',
+ 'UCU' => 'S',
+ 'CCU' => 'P',
+ 'ACU' => 'T',
+ 'GCU' => 'A',
+ 'UCC' => 'S',
+ 'CCC' => 'P',
+ 'ACC' => 'T',
+ 'GCC' => 'A',
+ 'UCA' => 'S',
+ 'CCA' => 'P',
+ 'ACA' => 'T',
+ 'GCA' => 'A',
+ 'UCG' => 'S',
+ 'CCG' => 'P',
+ 'ACG' => 'T',
+ 'GCG' => 'A',
+ 'UAU' => 'Y',
+ 'CAU' => 'H',
+ 'AAU' => 'N',
+ 'GAU' => 'D',
+ 'UAC' => 'Y',
+ 'CAC' => 'H',
+ 'AAC' => 'N',
+ 'GAC' => 'D',
+ 'UAA' => 'Stop',
+ 'CAA' => 'Q',
+ 'AAA' => 'K',
+ 'GAA' => 'E',
+ 'UAG' => 'Stop',
+ 'CAG' => 'Q',
+ 'AAG' => 'K',
+ 'GAG' => 'E',
+ 'UGU' => 'C',
+ 'CGU' => 'R',
+ 'AGU' => 'S',
+ 'GGU' => 'G',
+ 'UGC' => 'C',
+ 'CGC' => 'R',
+ 'AGC' => 'S',
+ 'GGC' => 'G',
+ 'UGA' => 'Stop',
+ 'CGA' => 'R',
+ 'AGA' => 'R',
+ 'GGA' => 'G',
+ 'UGG' => 'W',
+ 'CGG' => 'R',
+ 'AGG' => 'R',
+ 'GGG' => 'G',
+}
+
+prot = ""
+rna.chars.each_slice(3) do |x|
+ sym = codons[x.join]
+ case sym
+ when 'Stop' then puts prot and break
+ else prot << sym
+ end
+end

0 comments on commit d8c657f

Please sign in to comment.