Skip to content


Subversion checkout URL

You can clone with
Download ZIP
Browse files

r329: ditch stdaln.{c,h}; no changes to bwa-mem

stdaln.{c,h} was written ten years ago. Its local and SW extension code are
actually buggy (though that rarely happens and usually does not affect the
results too much). ksw.{c,h} is more concise, potentially faster, less buggy,
and richer in features.
  • Loading branch information...
commit 98f896675094c3bb12203717f29b45757e5fd056 1 parent bb37e14
@lh3 authored
6 Makefile
@@ -4,7 +4,7 @@ CXXFLAGS= $(CFLAGS)
AR= ar
LOBJS= utils.o kstring.o ksw.o bwt.o bntseq.o bwa.o bwamem.o bwamem_pair.o
-AOBJS= QSufSort.o bwt_gen.o stdaln.o bwase.o bwaseqio.o bwtgap.o bwtaln.o bamlite.o \
+AOBJS= QSufSort.o bwt_gen.o bwase.o bwaseqio.o bwtgap.o bwtaln.o bamlite.o \
is.o bwtindex.o bwape.o kopen.o \
bwtsw2_core.o bwtsw2_main.o bwtsw2_aux.o bwt_lite.o \
bwtsw2_chain.o fastmap.o bwtsw2_pair.o
@@ -48,8 +48,8 @@ fastmap.o:bwt.h bwamem.h
bwtaln.o:bwt.h bwtaln.h kseq.h
bwtgap.o:bwtgap.h bwtaln.h bwt.h
-bwtsw2_core.o:bwtsw2.h bwt.h bwt_lite.h stdaln.h
-bwtsw2_aux.o:bwtsw2.h bwt.h bwt_lite.h stdaln.h
+bwtsw2_core.o:bwtsw2.h bwt.h bwt_lite.h
+bwtsw2_aux.o:bwtsw2.h bwt.h bwt_lite.h
41 bwape.c
@@ -8,9 +8,9 @@
#include "kvec.h"
#include "bntseq.h"
#include "utils.h"
-#include "stdaln.h"
#include "bwase.h"
#include "bwa.h"
+#include "ksw.h"
typedef struct {
int n;
@@ -397,16 +397,17 @@ int bwa_cal_pac_pos_pe(const bntseq_t *bns, const char *prefix, bwt_t *const _bw
#define SW_MIN_MAPQ 17
// cnt = n_mm<<16 | n_gapo<<8 | n_gape
-bwa_cigar_t *bwa_sw_core(bwtint_t l_pac, const ubyte_t *pacseq, int len, const ubyte_t *seq, int64_t *beg, int reglen,
- int *n_cigar, uint32_t *_cnt)
+bwa_cigar_t *bwa_sw_core(bwtint_t l_pac, const ubyte_t *pacseq, int len, const ubyte_t *seq, int64_t *beg, int reglen, int *n_cigar, uint32_t *_cnt)
+ kswr_t r;
+ uint32_t *cigar32 = 0;
bwa_cigar_t *cigar = 0;
ubyte_t *ref_seq;
bwtint_t k, x, y, l;
- int path_len, ret, subo;
- AlnParam ap = aln_param_bwa;
- path_t *path, *p;
+ int xtra;
+ int8_t mat[25];
+ bwa_fill_scmat(1, 3, mat);
// check whether there are too many N's
if (reglen < SW_MIN_MATCH_LEN || (int64_t)l_pac - *beg < len) return 0;
for (k = 0, x = 0; k < len; ++k)
@@ -417,15 +418,19 @@ bwa_cigar_t *bwa_sw_core(bwtint_t l_pac, const ubyte_t *pacseq, int len, const u
ref_seq = (ubyte_t*)calloc(reglen, 1);
for (k = *beg, l = 0; l < reglen && k < l_pac; ++k)
ref_seq[l++] = pacseq[k>>2] >> ((~k&3)<<1) & 3;
- path = (path_t*)calloc(l+len, sizeof(path_t));
// do alignment
- ret = aln_local_core(ref_seq, l, (ubyte_t*)seq, len, &ap, path, &path_len, 1, &subo);
- if (ret < 0 || subo == ret) { // no hit or tandem hits
- free(path); free(cigar); free(ref_seq); *n_cigar = 0;
+ xtra = KSW_XSUBO | KSW_XSTART | (len < 250? KSW_XBYTE : 0);
+ r = ksw_align(len, (uint8_t*)seq, l, ref_seq, 5, mat, 5, 1, xtra, 0);
+ ksw_global(r.qe - r.qb + 1, &seq[r.qb], r.te - r.tb + 1, &ref_seq[r.tb], 5, mat, 5, 1, 50, n_cigar, &cigar32);
+ cigar = (bwa_cigar_t*)cigar32;
+ for (k = 0; k < *n_cigar; ++k)
+ cigar[k] = __cigar_create((cigar32[k]&0xf), (cigar32[k]>>4));
+ if (r.score < SW_MIN_MATCH_LEN || r.score2 == r.score) { // poor hit or tandem hits
+ free(cigar); free(ref_seq); *n_cigar = 0;
return 0;
- cigar = bwa_aln_path2cigar(path, path_len, n_cigar);
// check whether the alignment is good enough
for (k = 0, x = y = 0; k < *n_cigar; ++k) {
@@ -435,17 +440,14 @@ bwa_cigar_t *bwa_sw_core(bwtint_t l_pac, const ubyte_t *pacseq, int len, const u
else y += __cigar_len(c);
if (x < SW_MIN_MATCH_LEN || y < SW_MIN_MATCH_LEN) { // not good enough
- free(path); free(cigar); free(ref_seq);
+ free(cigar); free(ref_seq);
*n_cigar = 0;
return 0;
{ // update cigar and coordinate;
- int start, end;
- p = path + path_len - 1;
- *beg += (p->i? p->i : 1) - 1;
- start = (p->j? p->j : 1) - 1;
- end = path->j;
+ int start = r.qb, end = r.qe + 1;
+ *beg += r.tb;
cigar = (bwa_cigar_t*)realloc(cigar, sizeof(bwa_cigar_t) * (*n_cigar + 2));
if (start) {
memmove(cigar + 1, cigar, sizeof(bwa_cigar_t) * (*n_cigar));
@@ -462,8 +464,7 @@ bwa_cigar_t *bwa_sw_core(bwtint_t l_pac, const ubyte_t *pacseq, int len, const u
{ // set *cnt
int n_mm, n_gapo, n_gape;
n_mm = n_gapo = n_gape = 0;
- p = path + path_len - 1;
- x = p->i? p->i - 1 : 0; y = p->j? p->j - 1 : 0;
+ x = r.tb; y = r.qb;
for (k = 0; k < *n_cigar; ++k) {
bwa_cigar_t c = cigar[k];
if (__cigar_op(c) == FROM_M) {
@@ -479,7 +480,7 @@ bwa_cigar_t *bwa_sw_core(bwtint_t l_pac, const ubyte_t *pacseq, int len, const u
*_cnt = (uint32_t)n_mm<<16 | n_gapo<<8 | n_gape;
- free(ref_seq); free(path);
+ free(ref_seq);
return cigar;
6 bwase.c
@@ -4,7 +4,6 @@
#include <stdlib.h>
#include <math.h>
#include <time.h>
-#include "stdaln.h"
#include "bwase.h"
#include "bwtaln.h"
#include "bntseq.h"
@@ -205,8 +204,8 @@ bwa_cigar_t *bwa_refine_gapped_core(bwtint_t l_pac, const ubyte_t *pacseq, int l
if (__cigar_op(cigar[*n_cigar-1]) == FROM_D) --(*n_cigar); // deletion at the 3'-end
// change "I" at either end of the read to S. just in case. This should rarely happen...
- if (__cigar_op(cigar[*n_cigar-1]) == FROM_I) cigar[*n_cigar-1] = __cigar_create(3, (__cigar_len(cigar[*n_cigar-1])));
- if (__cigar_op(cigar[0]) == FROM_I) cigar[0] = __cigar_create(3, (__cigar_len(cigar[0])));
+ if (__cigar_op(cigar[*n_cigar-1]) == FROM_I) cigar[*n_cigar-1] = __cigar_create(FROM_S, (__cigar_len(cigar[*n_cigar-1])));
+ if (__cigar_op(cigar[0]) == FROM_I) cigar[0] = __cigar_create(FROM_S, (__cigar_len(cigar[0])));
*_pos = (bwtint_t)__pos;
@@ -589,5 +588,6 @@ int bwa_sai2sam_se(int argc, char *argv[])
return 0;
bwa_sai2sam_se_core(prefix, argv[optind+1], argv[optind+2], n_occ, rg_line);
+ free(prefix);
return 0;
15 bwtaln.c
@@ -312,18 +312,3 @@ int bwa_aln(int argc, char *argv[])
free(opt); free(prefix);
return 0;
-/* rgoya: Temporary clone of aln_path2cigar to accomodate for bwa_cigar_t,
-__cigar_op and __cigar_len while keeping stdaln stand alone */
-bwa_cigar_t *bwa_aln_path2cigar(const path_t *path, int path_len, int *n_cigar)
- uint32_t *cigar32;
- bwa_cigar_t *cigar;
- int i;
- cigar32 = aln_path2cigar32((path_t*) path, path_len, n_cigar);
- cigar = (bwa_cigar_t*)cigar32;
- for (i = 0; i < *n_cigar; ++i)
- cigar[i] = __cigar_create( (cigar32[i]&0xf), (cigar32[i]>>4) );
- return cigar;
12 bwtaln.h
@@ -28,6 +28,11 @@
#define bns_pac(pac, k) ((pac)[(k)>>2] >> ((~(k)&3)<<1) & 3)
+#define FROM_M 0
+#define FROM_I 1
+#define FROM_D 2
+#define FROM_S 3
typedef struct {
bwtint_t w;
int bid;
@@ -138,13 +143,6 @@ extern "C" {
void bwa_cs2nt_core(bwa_seq_t *p, bwtint_t l_pac, ubyte_t *pac);
- /* rgoya: Temporary clone of aln_path2cigar to accomodate for bwa_cigar_t,
- __cigar_op and __cigar_len while keeping stdaln stand alone */
-#include "stdaln.h"
- bwa_cigar_t *bwa_aln_path2cigar(const path_t *path, int path_len, int *n_cigar);
#ifdef __cplusplus
2  main.c
@@ -4,7 +4,7 @@
#include "utils.h"
-#define PACKAGE_VERSION "0.7.0-r324-beta"
+#define PACKAGE_VERSION "0.7.0-r329-beta"
static int usage()
1,070 stdaln.c
@@ -1,1070 +0,0 @@
-/* The MIT License
- Copyright (c) 2003-2006, 2008, 2009, by Heng Li <>
- Permission is hereby granted, free of charge, to any person obtaining
- a copy of this software and associated documentation files (the
- "Software"), to deal in the Software without restriction, including
- without limitation the rights to use, copy, modify, merge, publish,
- distribute, sublicense, and/or sell copies of the Software, and to
- permit persons to whom the Software is furnished to do so, subject to
- the following conditions:
- The above copyright notice and this permission notice shall be
- included in all copies or substantial portions of the Software.
-#include <stdlib.h>
-#include <stdio.h>
-#include <string.h>
-#include <stdint.h>
-#include "stdaln.h"
-/* char -> 17 (=16+1) nucleotides */
-unsigned char aln_nt16_table[256] = {
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,16 /*'-'*/,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15,
- 15, 1,14, 4, 11,15,15, 2, 13,15,15,10, 15, 5,15,15,
- 15,15, 3, 6, 8,15, 7, 9, 0,12,15,15, 15,15,15,15,
- 15, 1,14, 4, 11,15,15, 2, 13,15,15,10, 15, 5,15,15,
- 15,15, 3, 6, 8,15, 7, 9, 0,12,15,15, 15,15,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15,
- 15,15,15,15, 15,15,15,15, 15,15,15,15, 15,15,15,15
-char *aln_nt16_rev_table = "XAGRCMSVTWKDYHBN-";
-/* char -> 5 (=4+1) nucleotides */
-unsigned char aln_nt4_table[256] = {
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 5 /*'-'*/, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 0, 4, 2, 4, 4, 4, 1, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 0, 4, 2, 4, 4, 4, 1, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 3, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4,
- 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4, 4
-char *aln_nt4_rev_table = "AGCTN-";
-/* char -> 22 (=20+1+1) amino acids */
-unsigned char aln_aa_table[256] = {
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,20,21, 21,22 /*'-'*/,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21,
- 21, 0,21, 4, 3, 6,13, 7, 8, 9,21,11, 10,12, 2,21,
- 14, 5, 1,15, 16,21,19,17, 21,18,21,21, 21,21,21,21,
- 21, 0,21, 4, 3, 6,13, 7, 8, 9,21,11, 10,12, 2,21,
- 14, 5, 1,15, 16,21,19,17, 21,18,21,21, 21,21,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21,
- 21,21,21,21, 21,21,21,21, 21,21,21,21, 21,21,21,21
-char *aln_aa_rev_table = "ARNDCQEGHILKMFPSTWYV*X-";
- /* 01234567890123456789012 */
-/* translation table. They are useless in stdaln.c, but when you realize you need it, you need not write the table again. */
-unsigned char aln_trans_table_eu[66] = {
- 11,11, 2, 2, 1, 1,15,15, 16,16,16,16, 9,12, 9, 9,
- 6, 6, 3, 3, 7, 7, 7, 7, 0, 0, 0, 0, 19,19,19,19,
- 5, 5, 8, 8, 1, 1, 1, 1, 14,14,14,14, 10,10,10,10,
- 20,20,18,18, 20,17, 4, 4, 15,15,15,15, 10,10,13,13, 21, 22
- /* 01234567890123456789012345678901234567890123456789012345678901234 */
-int aln_sm_blosum62[] = {
-/* A R N D C Q E G H I L K M F P S T W Y V * X */
- 4,-1,-2,-2, 0,-1,-1, 0,-2,-1,-1,-1,-1,-2,-1, 1, 0,-3,-2, 0,-4, 0,
- -1, 5, 0,-2,-3, 1, 0,-2, 0,-3,-2, 2,-1,-3,-2,-1,-1,-3,-2,-3,-4,-1,
- -2, 0, 6, 1,-3, 0, 0, 0, 1,-3,-3, 0,-2,-3,-2, 1, 0,-4,-2,-3,-4,-1,
- -2,-2, 1, 6,-3, 0, 2,-1,-1,-3,-4,-1,-3,-3,-1, 0,-1,-4,-3,-3,-4,-1,
- 0,-3,-3,-3, 9,-3,-4,-3,-3,-1,-1,-3,-1,-2,-3,-1,-1,-2,-2,-1,-4,-2,
- -1, 1, 0, 0,-3, 5, 2,-2, 0,-3,-2, 1, 0,-3,-1, 0,-1,-2,-1,-2,-4,-1,
- -1, 0, 0, 2,-4, 2, 5,-2, 0,-3,-3, 1,-2,-3,-1, 0,-1,-3,-2,-2,-4,-1,
- 0,-2, 0,-1,-3,-2,-2, 6,-2,-4,-4,-2,-3,-3,-2, 0,-2,-2,-3,-3,-4,-1,
- -2, 0, 1,-1,-3, 0, 0,-2, 8,-3,-3,-1,-2,-1,-2,-1,-2,-2, 2,-3,-4,-1,
- -1,-3,-3,-3,-1,-3,-3,-4,-3, 4, 2,-3, 1, 0,-3,-2,-1,-3,-1, 3,-4,-1,
- -1,-2,-3,-4,-1,-2,-3,-4,-3, 2, 4,-2, 2, 0,-3,-2,-1,-2,-1, 1,-4,-1,
- -1, 2, 0,-1,-3, 1, 1,-2,-1,-3,-2, 5,-1,-3,-1, 0,-1,-3,-2,-2,-4,-1,
- -1,-1,-2,-3,-1, 0,-2,-3,-2, 1, 2,-1, 5, 0,-2,-1,-1,-1,-1, 1,-4,-1,
- -2,-3,-3,-3,-2,-3,-3,-3,-1, 0, 0,-3, 0, 6,-4,-2,-2, 1, 3,-1,-4,-1,
- -1,-2,-2,-1,-3,-1,-1,-2,-2,-3,-3,-1,-2,-4, 7,-1,-1,-4,-3,-2,-4,-2,
- 1,-1, 1, 0,-1, 0, 0, 0,-1,-2,-2, 0,-1,-2,-1, 4, 1,-3,-2,-2,-4, 0,
- 0,-1, 0,-1,-1,-1,-1,-2,-2,-1,-1,-1,-1,-2,-1, 1, 5,-2,-2, 0,-4, 0,
- -3,-3,-4,-4,-2,-2,-3,-2,-2,-3,-2,-3,-1, 1,-4,-3,-2,11, 2,-3,-4,-2,
- -2,-2,-2,-3,-2,-1,-2,-3, 2,-1,-1,-2,-1, 3,-3,-2,-2, 2, 7,-1,-4,-1,
- 0,-3,-3,-3,-1,-2,-2,-3,-3, 3, 1,-2, 1,-1,-2,-2, 0,-3,-1, 4,-4,-1,
- -4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4,-4, 1,-4,
- 0,-1,-1,-1,-2,-1,-1,-1,-1,-1,-1,-1,-1,-1,-2, 0, 0,-2,-1,-1,-4,-1
-int aln_sm_blosum45[] = {
-/* A R N D C Q E G H I L K M F P S T W Y V * X */
- 5,-2,-1,-2,-1,-1,-1, 0,-2,-1,-1,-1,-1,-2,-1, 1, 0,-2,-2, 0,-5, 0,
- -2, 7, 0,-1,-3, 1, 0,-2, 0,-3,-2, 3,-1,-2,-2,-1,-1,-2,-1,-2,-5,-1,
- -1, 0, 6, 2,-2, 0, 0, 0, 1,-2,-3, 0,-2,-2,-2, 1, 0,-4,-2,-3,-5,-1,
- -2,-1, 2, 7,-3, 0, 2,-1, 0,-4,-3, 0,-3,-4,-1, 0,-1,-4,-2,-3,-5,-1,
- -1,-3,-2,-3,12,-3,-3,-3,-3,-3,-2,-3,-2,-2,-4,-1,-1,-5,-3,-1,-5,-2,
- -1, 1, 0, 0,-3, 6, 2,-2, 1,-2,-2, 1, 0,-4,-1, 0,-1,-2,-1,-3,-5,-1,
- -1, 0, 0, 2,-3, 2, 6,-2, 0,-3,-2, 1,-2,-3, 0, 0,-1,-3,-2,-3,-5,-1,
- 0,-2, 0,-1,-3,-2,-2, 7,-2,-4,-3,-2,-2,-3,-2, 0,-2,-2,-3,-3,-5,-1,
- -2, 0, 1, 0,-3, 1, 0,-2,10,-3,-2,-1, 0,-2,-2,-1,-2,-3, 2,-3,-5,-1,
- -1,-3,-2,-4,-3,-2,-3,-4,-3, 5, 2,-3, 2, 0,-2,-2,-1,-2, 0, 3,-5,-1,
- -1,-2,-3,-3,-2,-2,-2,-3,-2, 2, 5,-3, 2, 1,-3,-3,-1,-2, 0, 1,-5,-1,
- -1, 3, 0, 0,-3, 1, 1,-2,-1,-3,-3, 5,-1,-3,-1,-1,-1,-2,-1,-2,-5,-1,
- -1,-1,-2,-3,-2, 0,-2,-2, 0, 2, 2,-1, 6, 0,-2,-2,-1,-2, 0, 1,-5,-1,
- -2,-2,-2,-4,-2,-4,-3,-3,-2, 0, 1,-3, 0, 8,-3,-2,-1, 1, 3, 0,-5,-1,
- -1,-2,-2,-1,-4,-1, 0,-2,-2,-2,-3,-1,-2,-3, 9,-1,-1,-3,-3,-3,-5,-1,
- 1,-1, 1, 0,-1, 0, 0, 0,-1,-2,-3,-1,-2,-2,-1, 4, 2,-4,-2,-1,-5, 0,
- 0,-1, 0,-1,-1,-1,-1,-2,-2,-1,-1,-1,-1,-1,-1, 2, 5,-3,-1, 0,-5, 0,
- -2,-2,-4,-4,-5,-2,-3,-2,-3,-2,-2,-2,-2, 1,-3,-4,-3,15, 3,-3,-5,-2,
- -2,-1,-2,-2,-3,-1,-2,-3, 2, 0, 0,-1, 0, 3,-3,-2,-1, 3, 8,-1,-5,-1,
- 0,-2,-3,-3,-1,-3,-3,-3,-3, 3, 1,-2, 1, 0,-3,-1, 0,-3,-1, 5,-5,-1,
- -5,-5,-5,-5,-5,-5,-5,-5,-5,-5,-5,-5,-5,-5,-5,-5,-5,-5,-5,-5, 1,-5,
- 0,-1,-1,-1,-2,-1,-1,-1,-1,-1,-1,-1,-1,-1,-1, 0, 0,-2,-1,-1,-5,-1
-int aln_sm_nt[] = {
-/* X A G R C M S V T W K D Y H B N */
- -2,-2,-2,-2,-2,-2,-2,-2,-2,-2,-2,-2,-2,-2,-2,-2,
- -2, 2,-1, 1,-2, 1,-2, 0,-2, 1,-2, 0,-2, 0,-2, 0,
- -2,-1, 2, 1,-2,-2, 1, 0,-2,-2, 1, 0,-2,-2, 0, 0,
- -2, 1, 1, 1,-2,-1,-1, 0,-2,-1,-1, 0,-2, 0, 0, 0,
- -2,-2,-2,-2, 2, 1, 1, 0,-1,-2,-2,-2, 1, 0, 0, 0,
- -2, 1,-2,-1, 1, 1,-1, 0,-2,-1,-2, 0,-1, 0, 0, 0,
- -2,-2, 1,-1, 1,-1, 1, 0,-2,-2,-1, 0,-1, 0, 0, 0,
- -2, 0, 0, 0, 0, 0, 0, 0,-2, 0, 0, 0, 0, 0, 0, 0,
- -2,-2,-2,-2,-1,-2,-2,-2, 2, 1, 1, 0, 1, 0, 0, 0,
- -2, 1,-2,-1,-2,-1,-2, 0, 1, 1,-1, 0,-1, 0, 0, 0,
- -2,-2, 1,-1,-2,-2,-1, 0, 1,-1, 1, 0,-1, 0, 0, 0,
- -2, 0, 0, 0,-2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
- -2,-2,-2,-2, 1,-1,-1, 0, 1,-1,-1, 0, 1, 0, 0, 0,
- -2, 0,-2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
- -2,-2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
- -2, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0
-int aln_sm_read[] = {
-/* X A G R C M S V T W K D Y H B N */
- -17,-17,-17,-17,-17,-17,-17,-17,-17,-17,-17,-17,-17,-17,-17,-17,
- -17, 2,-17, 1,-17, 1,-17, 0,-17, 1,-17, 0,-17, 0,-17, 0,
- -17,-17, 2, 1,-17,-17, 1, 0,-17,-17, 1, 0,-17,-17, 0, 0,
- -17, 1, 1, 1,-17,-17,-17, 0,-17,-17,-17, 0,-17, 0, 0, 0,
- -17,-17,-17,-17, 2, 1, 1, 0,-17,-17,-17,-17, 1, 0, 0, 0,
- -17, 1,-17,-17, 1, 1,-17, 0,-17,-17,-17, 0,-17, 0, 0, 0,
- -17,-17, 1,-17, 1,-17, 1, 0,-17,-17,-17, 0,-17, 0, 0, 0,
- -17, 0, 0, 0, 0, 0, 0, 0,-17, 0, 0, 0, 0, 0, 0, 0,
- -17,-17,-17,-17,-17,-17,-17,-17, 2, 1, 1, 0, 1, 0, 0, 0,
- -17, 1,-17,-17,-17,-17,-17, 0, 1, 1,-17, 0,-17, 0, 0, 0,
- -17,-17, 1,-17,-17,-17,-17, 0, 1,-17, 1, 0,-17, 0, 0, 0,
- -17, 0, 0, 0,-17, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
- -17,-17,-17,-17, 1,-17,-17, 0, 1,-17,-17, 0, 1, 0, 0, 0,
- -17, 0,-17, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
- -17,-17, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0,
- -17, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0
-int aln_sm_hs[] = {
-/* A G C T N */
- 91, -31,-114,-123, -44,
- -31, 100,-125,-114, -42,
- -123,-125, 100, -31, -42,
- -114,-114, -31, 91, -42,
- -44, -42, -42, -42, -43
-int aln_sm_maq[] = {
- 11, -19, -19, -19, -13,
- -19, 11, -19, -19, -13,
- -19, -19, 11, -19, -13,
- -19, -19, -19, 11, -13,
- -13, -13, -13, -13, -13
-int aln_sm_blast[] = {
- 1, -3, -3, -3, -2,
- -3, 1, -3, -3, -2,
- -3, -3, 1, -3, -2,
- -3, -3, -3, 1, -2,
- -2, -2, -2, -2, -2
-/* START OF align.c */
-AlnParam aln_param_blast = { 5, 2, 2, aln_sm_blast, 5, 50 };
-AlnParam aln_param_bwa = { 26, 9, 5, aln_sm_maq, 5, 50 };
-AlnParam aln_param_nt2nt = { 8, 2, 2, aln_sm_nt, 16, 75 };
-AlnParam aln_param_rd2rd = { 1, 19, 19, aln_sm_read, 16, 75 };
-AlnParam aln_param_aa2aa = { 10, 2, 2, aln_sm_blosum62, 22, 50 };
-AlnAln *aln_init_AlnAln()
- AlnAln *aa;
- aa = (AlnAln*)malloc(sizeof(AlnAln));
- aa->path = 0;
- aa->out1 = aa->out2 = aa->outm = 0;
- aa->path_len = 0;
- return aa;
-void aln_free_AlnAln(AlnAln *aa)
- free(aa->path); free(aa->cigar32);
- free(aa->out1); free(aa->out2); free(aa->outm);
- free(aa);
-/* START OF common_align.c */
-#define NT_LOCAL_SCORE int
-#define NT_LOCAL_SHIFT 16
-#define NT_LOCAL_MASK 0xffff
-#define SET_INF(s) (s).M = (s).I = (s).D = MINOR_INF;
-#define set_M(MM, cur, p, sc) \
-{ \
- if ((p)->M >= (p)->I) { \
- if ((p)->M >= (p)->D) { \
- (MM) = (p)->M + (sc); (cur)->Mt = FROM_M; \
- } else { \
- (MM) = (p)->D + (sc); (cur)->Mt = FROM_D; \
- } \
- } else { \
- if ((p)->I > (p)->D) { \
- (MM) = (p)->I + (sc); (cur)->Mt = FROM_I; \
- } else { \
- (MM) = (p)->D + (sc); (cur)->Mt = FROM_D; \
- } \
- } \
-#define set_I(II, cur, p) \
-{ \
- if ((p)->M - gap_open > (p)->I) { \
- (cur)->It = FROM_M; \
- (II) = (p)->M - gap_open - gap_ext; \
- } else { \
- (cur)->It = FROM_I; \
- (II) = (p)->I - gap_ext; \
- } \
-#define set_end_I(II, cur, p) \
-{ \
- if (gap_end >= 0) { \
- if ((p)->M - gap_open > (p)->I) { \
- (cur)->It = FROM_M; \
- (II) = (p)->M - gap_open - gap_end; \
- } else { \
- (cur)->It = FROM_I; \
- (II) = (p)->I - gap_end; \
- } \
- } else set_I(II, cur, p); \
-#define set_D(DD, cur, p) \
-{ \
- if ((p)->M - gap_open > (p)->D) { \
- (cur)->Dt = FROM_M; \
- (DD) = (p)->M - gap_open - gap_ext; \
- } else { \
- (cur)->Dt = FROM_D; \
- (DD) = (p)->D - gap_ext; \
- } \
-#define set_end_D(DD, cur, p) \
-{ \
- if (gap_end >= 0) { \
- if ((p)->M - gap_open > (p)->D) { \
- (cur)->Dt = FROM_M; \
- (DD) = (p)->M - gap_open - gap_end; \
- } else { \
- (cur)->Dt = FROM_D; \
- (DD) = (p)->D - gap_end; \
- } \
- } else set_D(DD, cur, p); \
-typedef struct
- unsigned char Mt:3, It:2, Dt:2;
-} dpcell_t;
-typedef struct
- int M, I, D;
-} dpscore_t;
-/* build score profile for accelerating alignment, in theory */
-void aln_init_score_array(unsigned char *seq, int len, int row, int *score_matrix, int **s_array)
- int *tmp, *tmp2, i, k;
- for (i = 0; i != row; ++i) {
- tmp = score_matrix + i * row;
- tmp2 = s_array[i];
- for (k = 0; k != len; ++k)
- tmp2[k] = tmp[seq[k]];
- }
- * banded global alignment *
- ***************************/
-int aln_global_core(unsigned char *seq1, int len1, unsigned char *seq2, int len2, const AlnParam *ap,
- path_t *path, int *path_len)
- register int i, j;
- dpcell_t **dpcell, *q;
- dpscore_t *curr, *last, *s;
- path_t *p;
- int b1, b2, tmp_end;
- int *mat, end, max;
- unsigned char type, ctype;
- int gap_open, gap_ext, gap_end, b;
- int *score_matrix, N_MATRIX_ROW;
- /* initialize some align-related parameters. just for compatibility */
- gap_open = ap->gap_open;
- gap_ext = ap->gap_ext;
- gap_end = ap->gap_end;
- b = ap->band_width;
- score_matrix = ap->matrix;
- N_MATRIX_ROW = ap->row;
- if (len1 == 0 || len2 == 0) {
- *path_len = 0;
- return 0;
- }
- /* calculate b1 and b2 */
- if (len1 > len2) {
- b1 = len1 - len2 + b;
- b2 = b;
- } else {
- b1 = b;
- b2 = len2 - len1 + b;
- }
- if (b1 > len1) b1 = len1;
- if (b2 > len2) b2 = len2;
- --seq1; --seq2;
- /* allocate memory */
- end = (b1 + b2 <= len1)? (b1 + b2 + 1) : (len1 + 1);
- dpcell = (dpcell_t**)malloc(sizeof(dpcell_t*) * (len2 + 1));
- for (j = 0; j <= len2; ++j)
- dpcell[j] = (dpcell_t*)malloc(sizeof(dpcell_t) * end);
- for (j = b2 + 1; j <= len2; ++j)
- dpcell[j] -= j - b2;
- curr = (dpscore_t*)malloc(sizeof(dpscore_t) * (len1 + 1));
- last = (dpscore_t*)malloc(sizeof(dpscore_t) * (len1 + 1));
- /* set first row */
- SET_INF(*curr); curr->M = 0;
- for (i = 1, s = curr + 1; i < b1; ++i, ++s) {
- SET_INF(*s);
- set_end_D(s->D, dpcell[0] + i, s - 1);
- }
- s = curr; curr = last; last = s;
- /* core dynamic programming, part 1 */
- tmp_end = (b2 < len2)? b2 : len2 - 1;
- for (j = 1; j <= tmp_end; ++j) {
- q = dpcell[j]; s = curr; SET_INF(*s);
- set_end_I(s->I, q, last);
- end = (j + b1 <= len1 + 1)? (j + b1 - 1) : len1;
- mat = score_matrix + seq2[j] * N_MATRIX_ROW;
- ++s; ++q;
- for (i = 1; i != end; ++i, ++s, ++q) {
- set_M(s->M, q, last + i - 1, mat[seq1[i]]); /* this will change s->M ! */
- set_I(s->I, q, last + i);
- set_D(s->D, q, s - 1);
- }
- set_M(s->M, q, last + i - 1, mat[seq1[i]]);
- set_D(s->D, q, s - 1);
- if (j + b1 - 1 > len1) { /* bug fixed, 040227 */
- set_end_I(s->I, q, last + i);
- } else s->I = MINOR_INF;
- s = curr; curr = last; last = s;
- }
- /* last row for part 1, use set_end_D() instead of set_D() */
- if (j == len2 && b2 != len2 - 1) {
- q = dpcell[j]; s = curr; SET_INF(*s);
- set_end_I(s->I, q, last);
- end = (j + b1 <= len1 + 1)? (j + b1 - 1) : len1;
- mat = score_matrix + seq2[j] * N_MATRIX_ROW;
- ++s; ++q;
- for (i = 1; i != end; ++i, ++s, ++q) {
- set_M(s->M, q, last + i - 1, mat[seq1[i]]); /* this will change s->M ! */
- set_I(s->I, q, last + i);
- set_end_D(s->D, q, s - 1);
- }
- set_M(s->M, q, last + i - 1, mat[seq1[i]]);
- set_end_D(s->D, q, s - 1);
- if (j + b1 - 1 > len1) { /* bug fixed, 040227 */
- set_end_I(s->I, q, last + i);
- } else s->I = MINOR_INF;
- s = curr; curr = last; last = s;
- ++j;
- }
- /* core dynamic programming, part 2 */
- for (; j <= len2 - b2 + 1; ++j) {
- SET_INF(curr[j - b2]);
- mat = score_matrix + seq2[j] * N_MATRIX_ROW;
- end = j + b1 - 1;
- for (i = j - b2 + 1, q = dpcell[j] + i, s = curr + i; i != end; ++i, ++s, ++q) {
- set_M(s->M, q, last + i - 1, mat[seq1[i]]);
- set_I(s->I, q, last + i);
- set_D(s->D, q, s - 1);
- }
- set_M(s->M, q, last + i - 1, mat[seq1[i]]);
- set_D(s->D, q, s - 1);
- s->I = MINOR_INF;
- s = curr; curr = last; last = s;
- }
- /* core dynamic programming, part 3 */
- for (; j < len2; ++j) {
- SET_INF(curr[j - b2]);
- mat = score_matrix + seq2[j] * N_MATRIX_ROW;
- for (i = j - b2 + 1, q = dpcell[j] + i, s = curr + i; i < len1; ++i, ++s, ++q) {
- set_M(s->M, q, last + i - 1, mat[seq1[i]]);
- set_I(s->I, q, last + i);
- set_D(s->D, q, s - 1);
- }
- set_M(s->M, q, last + len1 - 1, mat[seq1[i]]);
- set_end_I(s->I, q, last + i);
- set_D(s->D, q, s - 1);
- s = curr; curr = last; last = s;
- }
- /* last row */
- if (j == len2) {
- SET_INF(curr[j - b2]);
- mat = score_matrix + seq2[j] * N_MATRIX_ROW;
- for (i = j - b2 + 1, q = dpcell[j] + i, s = curr + i; i < len1; ++i, ++s, ++q) {
- set_M(s->M, q, last + i - 1, mat[seq1[i]]);
- set_I(s->I, q, last + i);
- set_end_D(s->D, q, s - 1);
- }
- set_M(s->M, q, last + len1 - 1, mat[seq1[i]]);
- set_end_I(s->I, q, last + i);
- set_end_D(s->D, q, s - 1);
- s = curr; curr = last; last = s;
- }
- /* backtrace */
- i = len1; j = len2;
- q = dpcell[j] + i;
- s = last + len1;
- max = s->M; type = q->Mt; ctype = FROM_M;
- if (s->I > max) { max = s->I; type = q->It; ctype = FROM_I; }
- if (s->D > max) { max = s->D; type = q->Dt; ctype = FROM_D; }
- p = path;
- p->ctype = ctype; p->i = i; p->j = j; /* bug fixed 040408 */
- ++p;
- do {
- switch (ctype) {
- case FROM_M: --i; --j; break;
- case FROM_I: --j; break;
- case FROM_D: --i; break;
- }
- q = dpcell[j] + i;
- ctype = type;
- switch (type) {
- case FROM_M: type = q->Mt; break;
- case FROM_I: type = q->It; break;
- case FROM_D: type = q->Dt; break;
- }
- p->ctype = ctype; p->i = i; p->j = j;
- ++p;
- } while (i || j);
- *path_len = p - path - 1;
- /* free memory */
- for (j = b2 + 1; j <= len2; ++j)
- dpcell[j] += j - b2;
- for (j = 0; j <= len2; ++j)
- free(dpcell[j]);
- free(dpcell);
- free(curr); free(last);
- return max;
- * local alignment combined with banded strategy *
- *************************************************/
-int aln_local_core(unsigned char *seq1, int len1, unsigned char *seq2, int len2, const AlnParam *ap,
- path_t *path, int *path_len, int _thres, int *_subo)
- register NT_LOCAL_SCORE *s;
- register int i;
- int q, r, qr, tmp_len, qr_shift;
- int **s_array, *score_array;
- int e, f;
- int is_overflow, of_base;
- NT_LOCAL_SCORE *eh, curr_h, last_h, curr_last_h;
- int j, start_i, start_j, end_i, end_j;
- path_t *p;
- int score_f, score_r, score_g;
- int start, end, max_score;
- int thres, *suba, *ss;
- int gap_open, gap_ext;
- int *score_matrix, N_MATRIX_ROW;
- /* initialize some align-related parameters. just for compatibility */
- gap_open = ap->gap_open;
- gap_ext = ap->gap_ext;
- score_matrix = ap->matrix;
- N_MATRIX_ROW = ap->row;
- thres = _thres > 0? _thres : -_thres;
- if (len1 == 0 || len2 == 0) return -1;
- /* allocate memory */
- suba = (int*)malloc(sizeof(int) * (len2 + 1));
- eh = (NT_LOCAL_SCORE*)malloc(sizeof(NT_LOCAL_SCORE) * (len1 + 1));
- s_array = (int**)malloc(sizeof(int*) * N_MATRIX_ROW);
- for (i = 0; i != N_MATRIX_ROW; ++i)
- s_array[i] = (int*)malloc(sizeof(int) * len1);
- /* initialization */
- aln_init_score_array(seq1, len1, N_MATRIX_ROW, score_matrix, s_array);
- q = gap_open;
- r = gap_ext;
- qr = q + r;
- qr_shift = (qr+1) << NT_LOCAL_SHIFT;
- tmp_len = len1 + 1;
- start_i = start_j = end_i = end_j = 0;
- for (i = 0, max_score = 0; i != N_MATRIX_ROW * N_MATRIX_ROW; ++i)
- if (max_score < score_matrix[i]) max_score = score_matrix[i];
- /* convert the coordinate */
- --seq1; --seq2;
- for (i = 0; i != N_MATRIX_ROW; ++i) --s_array[i];
- /* forward dynamic programming */
- for (i = 0, s = eh; i != tmp_len; ++i, ++s) *s = 0;
- score_f = 0;
- is_overflow = of_base = 0;
- suba[0] = 0;
- for (j = 1, ss = suba + 1; j <= len2; ++j, ++ss) {
- int subo = 0;
- last_h = f = 0;
- score_array = s_array[seq2[j]];
- if (is_overflow) { /* adjust eh[] array if overflow occurs. */
- /* If LOCAL_OVERFLOW_REDUCE is too small, optimal alignment might be missed.
- * If it is too large, this block will be excuted frequently and therefore
- * slow down the whole program.
- * Acually, smaller LOCAL_OVERFLOW_REDUCE might also help to reduce the
- * number of assignments because it sets some cells to zero when overflow
- * happens. */
- int tmp, tmp2;
- is_overflow = 0;
- for (i = 1, s = eh; i <= tmp_len; ++i, ++s) {
- tmp = *s >> NT_LOCAL_SHIFT; tmp2 = *s & NT_LOCAL_MASK;
- if (tmp2 < LOCAL_OVERFLOW_REDUCE) tmp2 = 0;
- if (tmp < LOCAL_OVERFLOW_REDUCE) tmp = 0;
- *s = (tmp << NT_LOCAL_SHIFT) | tmp2;
- }
- }
- for (i = 1, s = eh; i != tmp_len; ++i, ++s) {
- /* prepare for calculate current h */
- curr_h = (*s >> NT_LOCAL_SHIFT) + score_array[i];
- if (curr_h < 0) curr_h = 0;
- if (last_h > 0) { /* initialize f */
- f = (f > last_h - q)? f - r : last_h - qr;
- if (curr_h < f) curr_h = f;
- }
- if (*(s+1) >= qr_shift) { /* initialize e */
- curr_last_h = *(s+1) >> NT_LOCAL_SHIFT;
- e = ((*s & NT_LOCAL_MASK) > curr_last_h - q)? (*s & NT_LOCAL_MASK) - r : curr_last_h - qr;
- if (curr_h < e) curr_h = e;
- *s = (last_h << NT_LOCAL_SHIFT) | e;
- } else *s = last_h << NT_LOCAL_SHIFT; /* e = 0 */
- last_h = curr_h;
- if (subo < curr_h) subo = curr_h;
- if (score_f < curr_h) {
- score_f = curr_h; end_i = i; end_j = j;
- if (score_f > LOCAL_OVERFLOW_THRESHOLD) is_overflow = 1;
- }
- }
- *s = last_h << NT_LOCAL_SHIFT;
- *ss = subo + of_base;
- }
- score_f += of_base;
- if (score_f < thres) { /* no matching residue at all, 090218 */
- if (path_len) *path_len = 0;
- goto end_func;
- }
- if (path == 0) goto end_func; /* skip path-filling */
- /* reverse dynamic programming */
- for (i = end_i, s = eh + end_i; i >= 0; --i, --s) *s = 0;
- if (end_i == 0 || end_j == 0) goto end_func; /* no local match */
- score_r = score_matrix[seq1[end_i] * N_MATRIX_ROW + seq2[end_j]];
- is_overflow = of_base = 0;
- start_i = end_i; start_j = end_j;
- eh[end_i] = ((NT_LOCAL_SCORE)(qr + score_r)) << NT_LOCAL_SHIFT; /* in order to initialize f and e, 040408 */
- start = end_i - 1;
- end = end_i - 3;
- if (end <= 0) end = 0;
- /* second pass DP can be done in a band, speed will thus be enhanced */
- for (j = end_j - 1; j != 0; --j) {
- last_h = f = 0;
- score_array = s_array[seq2[j]];
- if (is_overflow) { /* adjust eh[] array if overflow occurs. */
- int tmp, tmp2;
- is_overflow = 0;
- for (i = start, s = eh + start + 1; i >= end; --i, --s) {
- tmp = *s >> NT_LOCAL_SHIFT; tmp2 = *s & NT_LOCAL_MASK;
- if (tmp2 < LOCAL_OVERFLOW_REDUCE) tmp2 = 0;
- if (tmp < LOCAL_OVERFLOW_REDUCE) tmp = 0;
- *s = (tmp << NT_LOCAL_SHIFT) | tmp2;
- }
- }
- for (i = start, s = eh + start + 1; i != end; --i, --s) {
- /* prepare for calculate current h */
- curr_h = (*s >> NT_LOCAL_SHIFT) + score_array[i];
- if (curr_h < 0) curr_h = 0;
- if (last_h > 0) { /* initialize f */
- f = (f > last_h - q)? f - r : last_h - qr;
- if (curr_h < f) curr_h = f;
- }
- curr_last_h = *(s-1) >> NT_LOCAL_SHIFT;
- e = ((*s & NT_LOCAL_MASK) > curr_last_h - q)? (*s & NT_LOCAL_MASK) - r : curr_last_h - qr;
- if (e < 0) e = 0;
- if (curr_h < e) curr_h = e;
- *s = (last_h << NT_LOCAL_SHIFT) | e;
- last_h = curr_h;
- if (score_r < curr_h) {
- score_r = curr_h; start_i = i; start_j = j;
- if (score_r + of_base - qr == score_f) {
- j = 1; break;
- }
- if (score_r > LOCAL_OVERFLOW_THRESHOLD) is_overflow = 1;
- }
- }
- *s = last_h << NT_LOCAL_SHIFT;
- /* recalculate start and end, the boundaries of the band */
- if ((eh[start] >> NT_LOCAL_SHIFT) <= qr) --start;
- if (start <= 0) start = 0;
- end = start_i - (start_j - j) - (score_r + of_base + (start_j - j) * max_score) / r - 1;
- if (end <= 0) end = 0;
- }
- if (_subo) {
- int tmp2 = 0, tmp = (int)(start_j - .33 * (end_j - start_j) + .499);
- for (j = 1; j <= tmp; ++j)
- if (tmp2 < suba[j]) tmp2 = suba[j];
- tmp = (int)(end_j + .33 * (end_j - start_j) + .499);
- for (j = tmp; j <= len2; ++j)
- if (tmp2 < suba[j]) tmp2 = suba[j];
- *_subo = tmp2;
- }
- if (path_len == 0) {
- path[0].i = start_i; path[0].j = start_j;
- path[1].i = end_i; path[1].j = end_j;
- goto end_func;
- }
- score_r += of_base;
- score_r -= qr;
-#ifdef DEBUG
- /* this seems not a bug */
- if (score_f != score_r)
- fprintf(stderr, "[aln_local_core] unknown flaw occurs: score_f(%d) != score_r(%d)\n", score_f, score_r);
- if (_thres > 0) { /* call global alignment to fill the path */
- score_g = 0;
- j = (end_i - start_i > end_j - start_j)? end_i - start_i : end_j - start_j;
- ++j; /* j is the maximum band_width */
- for (i = ap->band_width;; i <<= 1) {
- AlnParam ap_real = *ap;
- ap_real.gap_end = -1;
- ap_real.band_width = i;
- score_g = aln_global_core(seq1 + start_i, end_i - start_i + 1, seq2 + start_j,
- end_j - start_j + 1, &ap_real, path, path_len);
- if (score_g == score_r || score_f == score_g) break;
- if (i > j) break;
- }
- if (score_r > score_g && score_f > score_g) {
- fprintf(stderr, "[aln_local_core] Potential bug: (%d,%d) > %d\n", score_f, score_r, score_g);
- score_f = score_r = -1;
- } else score_f = score_g;
- /* convert coordinate */
- for (p = path + *path_len - 1; p >= path; --p) {
- p->i += start_i - 1;
- p->j += start_j - 1;
- }
- } else { /* just store the start and end */
- *path_len = 2;
- path[1].i = start_i; path[1].j = start_j;
- path->i = end_i; path->j = end_j;
- }
- /* free */
- free(eh); free(suba);
- for (i = 0; i != N_MATRIX_ROW; ++i) {
- ++s_array[i];
- free(s_array[i]);
- }
- free(s_array);
- return score_f;
-AlnAln *aln_stdaln_aux(const char *seq1, const char *seq2, const AlnParam *ap,
- int type, int thres, int len1, int len2)
- unsigned char *seq11, *seq22;
- int score;
- int i, j, l;
- path_t *p;
- char *out1, *out2, *outm;
- AlnAln *aa;
- if (len1 < 0) len1 = strlen(seq1);
- if (len2 < 0) len2 = strlen(seq2);
- aa = aln_init_AlnAln();
- seq11 = (unsigned char*)malloc(sizeof(unsigned char) * len1);
- seq22 = (unsigned char*)malloc(sizeof(unsigned char) * len2);
- aa->path = (path_t*)malloc(sizeof(path_t) * (len1 + len2 + 1));
- if (ap->row < 10) { /* 4-nucleotide alignment */
- for (i = 0; i < len1; ++i)
- seq11[i] = aln_nt4_table[(int)seq1[i]];
- for (j = 0; j < len2; ++j)
- seq22[j] = aln_nt4_table[(int)seq2[j]];
- } else if (ap->row < 20) { /* 16-nucleotide alignment */
- for (i = 0; i < len1; ++i)
- seq11[i] = aln_nt16_table[(int)seq1[i]];
- for (j = 0; j < len2; ++j)
- seq22[j] = aln_nt16_table[(int)seq2[j]];
- } else { /* amino acids */
- for (i = 0; i < len1; ++i)
- seq11[i] = aln_aa_table[(int)seq1[i]];
- for (j = 0; j < len2; ++j)
- seq22[j] = aln_aa_table[(int)seq2[j]];
- }
- if (type == ALN_TYPE_GLOBAL) score = aln_global_core(seq11, len1, seq22, len2, ap, aa->path, &aa->path_len);
- else if (type == ALN_TYPE_LOCAL) score = aln_local_core(seq11, len1, seq22, len2, ap, aa->path, &aa->path_len, thres, &aa->subo);
- else if (type == ALN_TYPE_EXTEND) score = aln_extend_core(seq11, len1, seq22, len2, ap, aa->path, &aa->path_len, 1, 0);
- else {
- free(seq11); free(seq22); free(aa->path);
- aln_free_AlnAln(aa);
- return 0;
- }
- aa->score = score;
- if (thres > 0) {
- out1 = aa->out1 = (char*)malloc(sizeof(char) * (aa->path_len + 1));
- out2 = aa->out2 = (char*)malloc(sizeof(char) * (aa->path_len + 1));
- outm = aa->outm = (char*)malloc(sizeof(char) * (aa->path_len + 1));
- --seq1; --seq2;
- --seq11; --seq22;
- p = aa->path + aa->path_len - 1;
- for (l = 0; p >= aa->path; --p, ++l) {
- switch (p->ctype) {
- case FROM_M: out1[l] = seq1[p->i]; out2[l] = seq2[p->j];
- outm[l] = (seq11[p->i] == seq22[p->j] && seq11[p->i] != ap->row)? '|' : ' ';
- break;
- case FROM_I: out1[l] = '-'; out2[l] = seq2[p->j]; outm[l] = ' '; break;
- case FROM_D: out1[l] = seq1[p->i]; out2[l] = '-'; outm[l] = ' '; break;
- }
- }
- out1[l] = out2[l] = outm[l] = '\0';
- ++seq11; ++seq22;
- }
- free(seq11);
- free(seq22);
- p = aa->path + aa->path_len - 1;
- aa->start1 = p->i? p->i : 1;
- aa->end1 = aa->path->i;
- aa->start2 = p->j? p->j : 1;
- aa->end2 = aa->path->j;
- aa->cigar32 = aln_path2cigar32(aa->path, aa->path_len, &aa->n_cigar);
- return aa;
-AlnAln *aln_stdaln(const char *seq1, const char *seq2, const AlnParam *ap, int type, int thres)
- return aln_stdaln_aux(seq1, seq2, ap, type, thres, -1, -1);
-/* for backward compatibility */
-uint16_t *aln_path2cigar(const path_t *path, int path_len, int *n_cigar)
- uint32_t *cigar32;
- uint16_t *cigar;
- int i;
- cigar32 = aln_path2cigar32(path, path_len, n_cigar);
- cigar = (uint16_t*)cigar32;
- for (i = 0; i < *n_cigar; ++i)
- cigar[i] = (cigar32[i]&0xf)<<14 | (cigar32[i]>>4&0x3fff);
- return cigar;
-/* newly added functions (2009-07-21) */
-int aln_extend_core(unsigned char *seq1, int len1, unsigned char *seq2, int len2, const AlnParam *ap,
- path_t *path, int *path_len, int G0, uint8_t *_mem)
- int q, r, qr;
- int32_t **s_array, *score_array;
- int is_overflow, of_base;
- uint32_t *eh;
- int i, j, end_i, end_j;
- int score, start, end;
- int *score_matrix, N_MATRIX_ROW;
- uint8_t *mem, *_p;
- /* initialize some align-related parameters. just for compatibility */
- q = ap->gap_open;
- r = ap->gap_ext;
- qr = q + r;
- score_matrix = ap->matrix;
- N_MATRIX_ROW = ap->row;
- if (len1 == 0 || len2 == 0) return -1;
- /* allocate memory */
- mem = _mem? _mem : calloc((len1 + 2) * (N_MATRIX_ROW + 1), 4);
- _p = mem;
- eh = (uint32_t*)_p, _p += 4 * (len1 + 2);
- s_array = calloc(N_MATRIX_ROW, sizeof(void*));
- for (i = 0; i != N_MATRIX_ROW; ++i)
- s_array[i] = (int32_t*)_p, _p += 4 * len1;
- /* initialization */
- aln_init_score_array(seq1, len1, N_MATRIX_ROW, score_matrix, s_array);
- start = 1; end = 2;
- end_i = end_j = 0;
- score = 0;
- is_overflow = of_base = 0;
- /* convert the coordinate */
- --seq1; --seq2;
- for (i = 0; i != N_MATRIX_ROW; ++i) --s_array[i];
- /* dynamic programming */
- memset(eh, 0, 4 * (len1 + 2));
- eh[1] = (uint32_t)G0<<16;
- for (j = 1; j <= len2; ++j) {
- int _start, _end;
- int h1 = 0, f = 0;
- score_array = s_array[seq2[j]];
- /* set start and end */
- _start = j - ap->band_width;
- if (_start < 1) _start = 1;
- if (_start > start) start = _start;
- _end = j + ap->band_width;
- if (_end > len1 + 1) _end = len1 + 1;
- if (_end < end) end = _end;
- if (start == end) break;
- /* adjust eh[] array if overflow occurs. */
- if (is_overflow) {
- int tmp, tmp2;
- is_overflow = 0;
- for (i = start; i <= end; ++i) {
- uint32_t *s = &eh[i];
- tmp = *s >> 16; tmp2 = *s & 0xffff;
- if (tmp2 < LOCAL_OVERFLOW_REDUCE) tmp2 = 0;
- if (tmp < LOCAL_OVERFLOW_REDUCE) tmp = 0;
- *s = (tmp << 16) | tmp2;
- }
- }
- _start = _end = 0;
- /* the inner loop */
- for (i = start; i < end; ++i) {
- /* At the beginning of each cycle:
- eh[i] -> h[j-1,i-1]<<16 | e[j,i]
- f -> f[j,i]
- h1 -> h[j,i-1]
- */
- uint32_t *s = &eh[i];
- int h = (int)(*s >> 16);
- int e = *s & 0xffff; /* this is e[j,i] */
- *s = (uint32_t)h1 << 16; /* eh[i] now stores h[j,i-1]<<16 */
- h += h? score_array[i] : 0; /* this is left_core() specific */
- /* calculate h[j,i]; don't need to test 0, as {e,f}>=0 */
- h = h > e? h : e;
- h = h > f? h : f; /* h now is h[j,i] */
- h1 = h;
- if (h > 0) {
- if (_start == 0) _start = i;
- _end = i;
- if (score < h) {
- score = h; end_i = i; end_j = j;
- if (score > LOCAL_OVERFLOW_THRESHOLD) is_overflow = 1;
- }
- }
- /* calculate e[j+1,i] and f[j,i+1] */
- h -= qr;
- h = h > 0? h : 0;
- e -= r;
- e = e > h? e : h;
- f -= r;
- f = f > h? f : h;
- *s |= e;
- }
- eh[end] = h1 << 16;
- /* recalculate start and end, the boundaries of the band */
- if (_end <= 0) break; /* no cell in this row has a positive score */
- start = _start;
- end = _end + 3;
- }
- score += of_base - 1;
- if (score <= 0) {
- if (path_len) *path_len = 0;
- goto end_left_func;
- }
- if (path == 0) goto end_left_func;
- if (path_len == 0) {
- path[0].i = end_i; path[0].j = end_j;
- goto end_left_func;
- }
- { /* call global alignment to fill the path */
- int score_g = 0;
- j = (end_i - 1 > end_j - 1)? end_i - 1 : end_j - 1;
- ++j; /* j is the maximum band_width */
- for (i = ap->band_width;; i <<= 1) {
- AlnParam ap_real = *ap;
- ap_real.gap_end = -1;
- ap_real.band_width = i;
- score_g = aln_global_core(seq1 + 1, end_i, seq2 + 1, end_j, &ap_real, path, path_len);
- if (score == score_g) break;
- if (i > j) break;
- }
- if (score > score_g)
- fprintf(stderr, "[aln_left_core] no suitable bandwidth: %d < %d\n", score_g, score);
- score = score_g;
- }
- /* free */
- free(s_array);
- if (!_mem) free(mem);
- return score;
-uint32_t *aln_path2cigar32(const path_t *path, int path_len, int *n_cigar)
- int i, n;
- uint32_t *cigar;
- unsigned char last_type;
- if (path_len == 0 || path == 0) {
- *n_cigar = 0;
- return 0;
- }
- last_type = path->ctype;
- for (i = n = 1; i < path_len; ++i) {
- if (last_type != path[i].ctype) ++n;
- last_type = path[i].ctype;
- }
- *n_cigar = n;
- cigar = (uint32_t*)malloc(*n_cigar * 4);
- cigar[0] = 1u << 4 | path[path_len-1].ctype;
- last_type = path[path_len-1].ctype;
- for (i = path_len - 2, n = 0; i >= 0; --i) {
- if (path[i].ctype == last_type) cigar[n] += 1u << 4;
- else {
- cigar[++n] = 1u << 4 | path[i].ctype;
- last_type = path[i].ctype;
- }
- }
- return cigar;
-int main()
- AlnAln *aln_local, *aln_global, *aln_left;
- int i;
- aln_local = aln_stdaln("CGTGCGATGCactgCATACGGCTCGCCTAGATCA", "AAGGGATGCTCTGCATCgCTCGGCTAGCTGT", &aln_param_blast, 0, 1);
- aln_global = aln_stdaln("CGTGCGATGCactgCATACGGCTCGCCTAGATCA", "AAGGGATGCTCTGCATCGgCTCGGCTAGCTGT", &aln_param_blast, 1, 1);
-// aln_left = aln_stdaln( "GATGCACTGCATACGGCTCGCCTAGATCA", "GATGCTCTGCATCGgCTCGGCTAGCTGT", &aln_param_blast, 2, 1);
- printf(">%d,%d\t%d,%d\n", aln_local->start1, aln_local->end1, aln_local->start2, aln_local->end2);
- printf("%s\n%s\n%s\n", aln_local->out1, aln_local->outm, aln_local->out2);
- printf(">%d,%d\t%d,%d\t", aln_global->start1, aln_global->end1, aln_global->start2, aln_global->end2);
- for (i = 0; i != aln_global->n_cigar; ++i)
- printf("%d%c", aln_global->cigar32[i]>>4, "MID"[aln_global->cigar32[i]&0xf]);
- printf("\n%s\n%s\n%s\n", aln_global->out1, aln_global->outm, aln_global->out2);
- printf(">%d\t%d,%d\t%d,%d\t", aln_left->score, aln_left->start1, aln_left->end1, aln_left->start2, aln_left->end2);
- for (i = 0; i != aln_left->n_cigar; ++i)
- printf("%d%c", aln_left->cigar32[i]>>4, "MID"[aln_left->cigar32[i]&0xf]);
- printf("\n%s\n%s\n%s\n", aln_left->out1, aln_left->outm, aln_left->out2);
- aln_free_AlnAln(aln_local);
- aln_free_AlnAln(aln_global);
- aln_free_AlnAln(aln_left);
- return 0;
162 stdaln.h
@@ -1,162 +0,0 @@
-/* The MIT License
- Copyright (c) 2003-2006, 2008, by Heng Li <>
- Permission is hereby granted, free of charge, to any person obtaining
- a copy of this software and associated documentation files (the
- "Software"), to deal in the Software without restriction, including
- without limitation the rights to use, copy, modify, merge, publish,
- distribute, sublicense, and/or sell copies of the Software, and to
- permit persons to whom the Software is furnished to do so, subject to
- the following conditions:
- The above copyright notice and this permission notice shall be
- included in all copies or substantial portions of the Software.
- 2009-07-23, 0.10.0
- - Use 32-bit to store CIGAR
- - Report suboptimal aligments
- - Implemented half-fixed-half-open DP
- 2009-04-26, 0.9.10
- - Allow to set a threshold for local alignment
- 2009-02-18, 0.9.9
- - Fixed a bug when no residue matches
- 2008-08-04, 0.9.8
- - Fixed the wrong declaration of aln_stdaln_aux()
- - Avoid 0 coordinate for global alignment
- 2008-08-01, 0.9.7
- - Change gap_end penalty to 5 in aln_param_bwa
- - Add function to convert path_t to the CIGAR format
- 2008-08-01, 0.9.6
- - The first gap now costs (gap_open+gap_ext), instead of
- gap_open. Scoring systems are modified accordingly.
- - Gap end is now correctly handled. Previously it is not correct.
- - Change license to MIT.
- */
-#ifndef LH3_STDALN_H_
-#define LH3_STDALN_H_
-#define STDALN_VERSION 0.11.0
-#include <stdint.h>
-#define FROM_M 0
-#define FROM_I 1
-#define FROM_D 2
-#define FROM_S 3
-#define ALN_TYPE_LOCAL 0
-#define ALN_TYPE_GLOBAL 1
-#define ALN_TYPE_EXTEND 2
-/* This is the smallest integer. It might be CPU-dependent in very RARE cases. */
-#define MINOR_INF -1073741823
-typedef struct
- int gap_open;
- int gap_ext;
- int gap_end;
- int *matrix;
- int row;
- int band_width;
-} AlnParam;
-typedef struct
- int i, j;
- unsigned char ctype;
-} path_t;
-typedef struct
- path_t *path; /* for advanced users... :-) */
- int path_len; /* for advanced users... :-) */
- int start1, end1; /* start and end of the first sequence, coordinations are 1-based */
- int start2, end2; /* start and end of the second sequence, coordinations are 1-based */
- int score, subo; /* score */
- char *out1, *out2; /* print them, and then you will know */
- char *outm;
- int n_cigar;
- uint32_t *cigar32;
-} AlnAln;
-#ifdef __cplusplus
-extern "C" {
- AlnAln *aln_stdaln_aux(const char *seq1, const char *seq2, const AlnParam *ap,
- int type, int do_align, int len1, int len2);
- AlnAln *aln_stdaln(const char *seq1, const char *seq2, const AlnParam *ap, int type, int do_align);
- void aln_free_AlnAln(AlnAln *aa);
- int aln_global_core(unsigned char *seq1, int len1, unsigned char *seq2, int len2, const AlnParam *ap,
- path_t *path, int *path_len);
- int aln_local_core(unsigned char *seq1, int len1, unsigned char *seq2, int len2, const AlnParam *ap,
- path_t *path, int *path_len, int _thres, int *_subo);
- int aln_extend_core(unsigned char *seq1, int len1, unsigned char *seq2, int len2, const AlnParam *ap,
- path_t *path, int *path_len, int G0, uint8_t *_mem);
- uint16_t *aln_path2cigar(const path_t *path, int path_len, int *n_cigar);
- uint32_t *aln_path2cigar32(const path_t *path, int path_len, int *n_cigar);
-#ifdef __cplusplus
- * global variables *
- ********************/
-extern AlnParam aln_param_bwa; /* = { 37, 9, 0, aln_sm_maq, 5, 50 }; */
-extern AlnParam aln_param_blast; /* = { 5, 2, 2, aln_sm_blast, 5, 50 }; */
-extern AlnParam aln_param_nt2nt; /* = { 10, 2, 2, aln_sm_nt, 16, 75 }; */
-extern AlnParam aln_param_aa2aa; /* = { 20, 19, 19, aln_sm_read, 16, 75 }; */
-extern AlnParam aln_param_rd2rd; /* = { 12, 2, 2, aln_sm_blosum62, 22, 50 }; */
-/* common nucleotide score matrix for 16 bases */
-extern int aln_sm_nt[], aln_sm_bwa[];
-/* BLOSUM62 and BLOSUM45 */
-extern int aln_sm_blosum62[], aln_sm_blosum45[];
-/* common read for 16 bases. note that read alignment is quite different from common nucleotide alignment */
-extern int aln_sm_read[];
-/* human-mouse score matrix for 4 bases */
-extern int aln_sm_hs[];
Please sign in to comment.
Something went wrong with that request. Please try again.