No description, website, or topics provided.
Switch branches/tags
Nothing to show
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Failed to load latest commit information.
data
output
ELMSeq.py
LICENSE.txt
README.txt

README.txt

[What is ELMSeq?]
ELM-seq (expression level monitoring by DNA methylation) uses DamID (Escherichia coli DNA adenine methylase as a reporter coupled with methylation-sensitive restriction enzyme digestion and high-throughput sequencing) to enable in vivo quantitative analyses of upstream regulatory sequences.

[ELMSeq.py]
This program is taking ELMSeq sequencing files and generating DAMRatios to correponding sequences.

[How to use]
We assumed that the sequencing format is the same as we described in Nature Communication 2017 Paper.

# 1. Need to set proper parameter in ELMSeq.py file 

# User needs to setup output file folder path
OUTPUT_FOLDER = "./output"

# User needs to setup corresponding fastq file path
# Example sequencing data for transcription study (promoter)
UNCUT_FASTQ_PATH = "./data/dam_screen_lib_2_12466_CGTGAT.fastq.gz"            # No Enzyme treated sample
DPNI_FASTQ_PATH = "./data/dam_screen_lib_2_12466_ACATCG.fastq.gz"             # DpnI treated sample
MBOI_FASTQ_PATH = "./data/dam_screen_lib_2_12466_GCCTAA.fastq.gz"             # MboI treated sample

# User needs to specify which experiment it is among followings: ( promoter / utr_with_strong_promoter / utr_with_weak_promoter )
EXPERIMENT_TYPE = "promoter" # "promoter", "utr_with_strong_promoter", "utr_with_weak_promoter" 

# 2. After properly setting the parameters, User can run the program as following command

# python ELMSeq.py

# 3. This is the typical command line output

[ Starting ELMSeq Analysis ] It might take a long time (more than hours) depending on sequencing size
[ Read No Enzyme Treated Sequence File ] ./data/dam_screen_lib_2_12466_CGTGAT.fastq.gz
[ Read DpnI Treated Sequence File ] ./data/dam_screen_lib_2_12466_ACATCG.fastq.gz
[ Read MboI Treated Sequence File ] ./data/dam_screen_lib_2_12466_GCCTAA.fastq.gz
[ Calculating DAMRatios ]
[ Finishing ELMSeq Analysis ]

# 4. In the output folder, you can see DAMRatios for all the sequences


[Output File Format]
# 1. The first three line is commented. It gives number of processed reads.
# 2. The following results show the DAMRatio and corresponding sequence. Results were sorted by DAMRatio. 

# uncut_all_cnt	uncut_match_cnt	DpnI_all_cnt	DpnI_match_cnt	MboI_all_cnt	MboI_match_cnt
# 2000000	363302	2000000	353958	2000000	350541
# DAMRatio	motif	uncut_cnt	DpnI_cnt	MboI_cnt	uncut_CPM	DpnI_CPM	MboI_CPM
1.575207e+02	TTGTTACGGCGTCGTTCTAAAACATTATAATTATCGAT	17	0	155	49.545557	2.825194	445.026402
1.322770e+02	TCGCTTACGTCAAACAGATCTTTAGTATAATTGACCCT	14	0	130	41.287964	2.825194	373.708068
...