Design CRISPR/Cas9 gRNAs using CRISPRdirect web server
Switch branches/tags
Nothing to show
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Failed to load latest commit information.
CRISPRdirect_input
CRISPRdirect_result
CRISPRdirect_crawl.pl
README.md

README.md

CRISPRdirect_crawl.pl

This script uses LWP::UserAgent to get CRISPR/Cas9 gRNAs from CRISPRdirect.
LWP::UserAgent module is available at CPAN.

Usage

% ./CRISPRdirect_crawl.pl  sequence.txt

sequence.txt is a single FASTA file or a plain nucleotide sequence file (i.e., only contains nucleotide sequence). Characters other than A,T,G,C and U are ignored. Both lower-case and upper-case letters are accepted.

Example of sequence.txt

>sample sequence
atgccgcgcgtcgtgcccgaccagagaagcaagttcgagaacgaggagttttttaggaag
ctgagccgcgagtgtgagattaagtacacgggcttcagggaccggccccacgaggaacgc
caggcacgcttccagaacgcctgccgcgacggccgctcggaaatcgcttttgtggccaca
ggaaccaatctgtctctccagttttttccggccagctggcagggagaacagcgacaaaca
cctagccgagagtatgtcgacttagaaagagaagcaggcaaggtatatttgaaggctccc
atgattctgaatggagtctgtgttatctggaaaggctggattgatctccaaagactggat
ggtatgggctgtctggagtttgatgaggagcgagcccagcaggaggatgcattagcacaa
caggcctttgaagaggctcggagaaggacacgcgaatttgaagatagagacaggtctcat
cgggaggaaatggaggcaagaagacaacaagaccctagtcctggttccaatttaggtggt
ggtgatgacctcaaacttcgttaa

If you plan to submit a large number of queries, please insert 'sleep' command to prevent overloading CRISPRdirect web server.

Example

% ls
CRISPRdirect_crawl.pl    CRISPRdirect_input/    CRISPRdirect_result/
% cd  CRISPRdirect_input/
% ls
NM_000014.fa    NM_000015.fa    NM_000016.fa    [...]
% foreach  n  ( * )
../CRISPRdirect_crawl.pl  $n >  ../CRISPRdirect_result/$n.CRISPR
sleep  5
end
% cd ../CRISPRdirect_result/
% ls
NM_000014.fa.CRISPR    NM_000015.fa.CRISPR    NM_000016.fa.CRISPR    [...]

Options

CRISPRdirect options can be set using %param. All of the parameters and values are described in the API section of CRISPRdirect help page.

parameters

Example 1. Parameters for designing human gRNAs with 'NGG' for PAM:

my %param = (
	'userseq'   => $input_seq,
	'pam'       => 'NGG',
	'db'        => 'hg19',
	'format'    => 'txt',
) ;

Example 2. Parameters to get NM_001187 sequence in FASTA format:

my %param = (
	'accession' => 'NM_001187',
	'format'    => 'txt',
) ;

CRISPRdirect web server

http://crispr.dbcls.jp/

Reference

Naito Y, Hino K, Bono H, Ui-Tei K. (2014)
CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites.
Bioinformatics http://dx.doi.org/10.1093/bioinformatics/btu743

License

Copyright © 2014 Yuki Naito (@meso_cacase) at
Database Center for Life Science (DBCLS), Japan.
This software is distributed under modified BSD license.