Design CRISPR/Cas9 gRNAs using CRISPRdirect web server
Switch branches/tags
Nothing to show
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Type Name Latest commit message Commit time
Failed to load latest commit information.
CRISPRdirect_input
CRISPRdirect_result
CRISPRdirect_crawl.pl
README.md

README.md

CRISPRdirect_crawl.pl

This script uses LWP::UserAgent to get CRISPR/Cas9 gRNAs from CRISPRdirect.
LWP::UserAgent module is available at CPAN.

Usage

% ./CRISPRdirect_crawl.pl  sequence.txt

sequence.txt is a single FASTA file or a plain nucleotide sequence file (i.e., only contains nucleotide sequence). Characters other than A,T,G,C and U are ignored. Both lower-case and upper-case letters are accepted.

Example of sequence.txt

>sample sequence
atgccgcgcgtcgtgcccgaccagagaagcaagttcgagaacgaggagttttttaggaag
ctgagccgcgagtgtgagattaagtacacgggcttcagggaccggccccacgaggaacgc
caggcacgcttccagaacgcctgccgcgacggccgctcggaaatcgcttttgtggccaca
ggaaccaatctgtctctccagttttttccggccagctggcagggagaacagcgacaaaca
cctagccgagagtatgtcgacttagaaagagaagcaggcaaggtatatttgaaggctccc
atgattctgaatggagtctgtgttatctggaaaggctggattgatctccaaagactggat
ggtatgggctgtctggagtttgatgaggagcgagcccagcaggaggatgcattagcacaa
caggcctttgaagaggctcggagaaggacacgcgaatttgaagatagagacaggtctcat
cgggaggaaatggaggcaagaagacaacaagaccctagtcctggttccaatttaggtggt
ggtgatgacctcaaacttcgttaa

If you plan to submit a large number of queries, please insert 'sleep' command to prevent overloading CRISPRdirect web server.

Example

% ls
CRISPRdirect_crawl.pl    CRISPRdirect_input/    CRISPRdirect_result/
% cd  CRISPRdirect_input/
% ls
NM_000014.fa    NM_000015.fa    NM_000016.fa    [...]
% foreach  n  ( * )
../CRISPRdirect_crawl.pl  $n >  ../CRISPRdirect_result/$n.CRISPR
sleep  5
end
% cd ../CRISPRdirect_result/
% ls
NM_000014.fa.CRISPR    NM_000015.fa.CRISPR    NM_000016.fa.CRISPR    [...]

Options

CRISPRdirect options can be set using %param. All of the parameters and values are described in the API section of CRISPRdirect help page.

parameters

Example 1. Parameters for designing human gRNAs with 'NGG' for PAM:

my %param = (
	'userseq'   => $input_seq,
	'pam'       => 'NGG',
	'db'        => 'hg19',
	'format'    => 'txt',
) ;

Example 2. Parameters to get NM_001187 sequence in FASTA format:

my %param = (
	'accession' => 'NM_001187',
	'format'    => 'txt',
) ;

CRISPRdirect web server

http://crispr.dbcls.jp/

Reference

Naito Y, Hino K, Bono H, Ui-Tei K. (2014)
CRISPRdirect: software for designing CRISPR/Cas guide RNA with reduced off-target sites.
Bioinformatics http://dx.doi.org/10.1093/bioinformatics/btu743

License

Copyright © 2014 Yuki Naito (@meso_cacase) at
Database Center for Life Science (DBCLS), Japan.
This software is distributed under modified BSD license.