Skip to content
A pipeline for profiling TE-derived small RNAs
Branch: master
Clone or download
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Type Name Latest commit message Commit time
Failed to load latest commit information.
tesmall
.gitignore
LICENSE
MANIFEST.in
README.md
environment.txt
requirements.txt
setup.py

README.md

TEsmall

A pipeline for profiling TE-derived small RNAs

Install Miniconda (Linux)

$ wget https://repo.continuum.io/miniconda/Miniconda3-latest-Linux-x86_64.sh
$ bash Miniconda3-latest-Linux-x86_64.sh

Setup channels

$ conda config --add channels conda-forge
$ conda config --add channels bioconda

Install TEsmall

$ git clone git@github.com:wwliao/tesmall.git
$ cd tesmall
$ conda env create -f environment.txt -n tesmall
$ source activate tesmall
$ python setup.py install

How to run TEsmall

  1. Before executing TEsmall, make sure you have activated the environment

    $ source activate tesmall
    
  2. For example, you would like to apply TEsmall on 2 FASTQ files: Parental_1.fastq.gz and DroKO_1.fastq.gz

    $ tesmall -f Parental_1.fastq.gz DroKO_1.fastq.gz -l Parental DroKO
    
  3. When it's done, deactivate the environment

    $ source deactivate
    
  4. If you would like to specify the directory to which the genomes TEsmall uses for annotation are downloaded and read from please use the export command as follows

    $ source activate tesmall
    $ export TESMALLROOT=/your/desired/directory
    $ tesmall -f Parental_1.fastq.gz DroKO_1.fastq.gz -l Parental DroKO
    $ source deactivate
    

For more information

$ tesmall -h
usage: TEsmall [-h] [-a STR] [-m INT] [-M INT] [-g STR] [--maxaln INT]
               [--mismatch INT] [-o STR [STR ...]] [-p INT] [-f STR [STR ...]]
               [-l STR [STR ...]] [--verbose INT] [-v]

optional arguments:
  -h, --help            show this help message and exit
  -a STR, --adapter STR
                        Sequence of an adapter that was ligated to the 3' end.
                        The adapter itself and anything that follows is
                        trimmed. (default: TGGAATTCTCGGGTGCCAAGG)
  -m INT, --minlen INT  Discard trimmed reads that are shorter than INT. Reads
                        that are too short even before adapter removal are
                        also discarded. (default: 16)
  -M INT, --maxlen INT  Discard trimmed reads that are longer than INT. Reads
                        that are too long even before adapter removal are also
                        discarded. (default: 36)
  -g STR, --genome STR  Version of reference genome (default: hg19)
  --maxaln INT          Suppress all alignments for a particular read if more
                        than INT reportable alignments exist for it. (default:
                        100)
  --mismatch INT        Report alignments with at most INT mismatches.
                        (default: 0)
  -o STR [STR ...], --order STR [STR ...]
                        Annotation priority. (default: structural_RNA miRNA
                        hairpin exon TE intron piRNA_cluster)
  -p INT, --parallel INT
                        Parallel execute by INT CPUs. (default: 1)
  -f STR [STR ...], --fastq STR [STR ...]
                        Input in FASTQ format. Compressed input is supported
                        and auto-detected from the filename extension (.gz).
  -l STR [STR ...], --label STR [STR ...]
                        Unique label for each sample.
  --verbose INT         Set verbose level. 0: only show critical message, 1:
                        show additional warning message, 2: show process
                        information, 3: show debug messages. DEFAULT:2
  -v, --version         show program's version number and exit
You can’t perform that action at this time.