Merge branch 'feature/dbxref' into develop

michaelbarton · Mar 4, 2013 · ce1c73f · ce1c73f
2 parents 7c3105d + 8deed8a
commit ce1c73f
Show file tree

Hide file tree

Showing 5 changed files with 76 additions and 5 deletions.
diff --git a/features/table/cds_entries.feature b/features/table/cds_entries.feature
@@ -303,7 +303,7 @@ Feature: Producing cds annotation view from a scaffold
         """
 
   @disable-bundler
-  Scenario: A CDS entry with duplicate note attributes
+  Scenario: A CDS entry with a single db_xref attribute
     Given I successfully run `genomer init project`
       And I cd to "project"
       And I write to "assembly/scaffold.yml" with:
@@ -320,7 +320,7 @@ Feature: Producing cds annotation view from a scaffold
       And I write to "assembly/annotations.gff" with:
         """
         ##gff-version 3
-        contig1	.	gene	1	3	.	-	1	ID=gene1;Note=val1;Note=val2
+	contig1	.	gene	1	3	.	-	1	ID=gene1;db_xref=GO:000001
         """
       And I append to "Gemfile" with:
         """
@@ -335,8 +335,43 @@ Feature: Producing cds annotation view from a scaffold
         			locus_tag	gene1
         3	1	CDS
         			protein_id	gene1
-        			note	val1
-        			note	val2
+        			db_xref	GO:000001
 
         """
 
+  @disable-bundler
+  Scenario: A CDS entry with multiple db_xref attributes
+    Given I successfully run `genomer init project`
+      And I cd to "project"
+      And I write to "assembly/scaffold.yml" with:
+        """
+        ---
+          - sequence:
+              source: contig1
+        """
+      And I write to "assembly/sequence.fna" with:
+        """
+        >contig1
+        AAAAATTTTTGGGGGCCCCC
+        """
+      And I write to "assembly/annotations.gff" with:
+        """
+        ##gff-version 3
+	contig1	.	gene	1	3	.	-	1	ID=gene1;db_xref=GO:000001;db_xref=InterPro:IPR000111
+        """
+      And I append to "Gemfile" with:
+        """
+        gem 'genomer-plugin-view', :path => '../../../'
+        """
+     When I run `genomer view table --identifier=genome --generate_encoded_features`
+     Then the exit status should be 0
+      And the output should contain:
+        """
+        >Feature	genome	annotation_table
+        3	1	gene
+        			locus_tag	gene1
+        3	1	CDS
+        			protein_id	gene1
+        			db_xref	GO:000001
+        			db_xref	InterPro:IPR000111
+        """
diff --git a/lib/genomer-plugin-view/gff_record_helper.rb b/lib/genomer-plugin-view/gff_record_helper.rb
@@ -2,7 +2,7 @@
 
 module GenomerPluginView::GffRecordHelper
 
-  DEFAULT_GFF_MAPPING = {'product' => 'product', 'Note' => 'note' }
+  DEFAULT_GFF_MAPPING = {'product' => 'product', 'Note' => 'note', 'db_xref' => 'db_xref'}
 
   GFF_TO_TABLE = {
     'gene' => {

diff --git a/man/genomer-view.ronn b/man/genomer-view.ronn
@@ -99,6 +99,10 @@ section.
     **product** attributes are present. See the next section for an explanation 
     of this.
 
+  * `db_xref`: Used to link the annotation to other database references. This
+    field is added to verbatim to generated output. Multiple entires of this
+    field may be used.
+
 ### OVERLAP BETWEEN NAME, PRODUCT AND FUNCTION FIELD
 
 The genbank annotation table **product** fields may contain either a short four 

diff --git a/spec/genomer-view-plugin/gff_record_helper_spec.rb b/spec/genomer-view-plugin/gff_record_helper_spec.rb
@@ -216,6 +216,7 @@
        ['Note',      'note']],
       :CDS => [
        ['ec_number', 'EC_number'],
+       ['db_xref',   'db_xref'],
        ['function',  'function'],
        ['product',   'product'],
        ['Note',      'note'],

diff --git a/spec/genomer-view-plugin/table_spec.rb b/spec/genomer-view-plugin/table_spec.rb
@@ -306,6 +306,37 @@
 
     end
 
+    describe "passed a gene with a single db_xref attribute" do
+
+      let(:attributes) do
+        {'db_xref' => 'InterPro:IPR000111'}
+      end
+
+      let(:annotations) do
+        [gene({:attributes => attributes})]
+      end
+
+      it "should not change attributes" do
+        subject.should have_identical_attributes cds({:attributes => attributes})
+      end
+
+    end
+
+    describe "passed a gene with multiple db_xref attribute" do
+
+      let(:attributes) do
+        {'db_xref' => 'InterPro:IPR000111','db_xref' => 'GO:000001'}
+      end
+
+      let(:annotations) do
+        [gene({:attributes => attributes})]
+      end
+
+      it "should not change attributes" do
+        subject.should have_identical_attributes cds({:attributes => attributes})
+      end
+
+    end
   end
 
 end