Skip to content
master
Go to file
Code

Latest commit

 

Git stats

Files

Permalink
Failed to load latest commit information.
Type
Name
Latest commit message
Commit time
 
 
 
 
 
 
 
 
 
 
 
 
 
 

readme.md

DNA Sequencing tools

Tools to help sequence and visualize binary and non-binary files.

The nucleotide in DNA consists of a sugar (deoxyribose), one of four bases (cytosine (C), thymine (T), adenine (A), guanine (G)), and a phosphate. Cytosine and thymine are pyrimidine bases, while adenine and guanine are purine bases. The sugar and the base together are called a nucleoside.

Table of contents

Included tools

  • dna-encoder
  • fasta-to-image

dna-encoder

Takes a file (binary or non-binary) and encodes it to DNA sequence.

Binary representation of every byte is translated into DNA by encoding the following.

00    A    Adenine     color.RGBA{0, 0, 255, 255}
01    G    Guanine     color.RGBA{0, 100, 0, 255}
10    C    Cytosine    color.RGBA{255, 0, 0, 255}
11    T    Thymine     color.RGBA{255, 255, 0, 255}

Usage screencast

fasta-to-image

Takes FASTA file which is outputed from dna-encoder and creates PNG image.

Usage screencast

Example with normal text file

Original

Lorem ipsum dolor sit amet, consectetur adipiscing elit. Duis et consectetur turpis. Integer quis pharetra turpis. Donec dui mauris, dignissim eu elementum nec, euismod id orci.

FASTA file

>SEQ1
GAAGCGACGCGGGCGACAAGCCGGAAGAGGGGCGACAAGCGAGCGCAGCGACACAAGAGC
CGGGAACAAGCAGGCGGCGGGGAACAACAAGCAGCGCCGAGCGGGCAGGAGCGGGGAGGG
GACACAAGCAGGCGAGCCGGAAGCCGGAGCAGCCGGCCGCGACAAGCGGGCAGCCGGGAA
CCACAAGAGAGGGGCCGGAACAAGCGGGGAACAAGCAGCGCCGAGCGGGCAGGAGCGGGG
AGGGGACACAAGGAGGGGACGAAGCCGGAACCACAAGACGGCCGGAGCGGGCGGCGGGAC
ACAAGAGGGGGCCGGAACAAGAAGCCAGCAGGACGCGGGGAGACGCAGACAAGGAGGGGA
CGAAGCCGGAACCACAAGAGAGCGCCGCGGGCAACAAGCGAGGGGCCGACAAGCGGCAGG
GGGACGCCGGAACAACAAGCGAGCCGGCGGCCGCCGGAGAGCCGGCGACAAGCGGGGGAC
AAGCGGGCAGCGGGCGGCGGGCCGGAGGGGCGACAAGCCGCGGGCAACAACAAGCGGGGG
GCCGGAGCGGCGCGAACAAGCCGGCGAACAAGCGACGCAGCCGACC

Encoded into image

dna