Encoding of strings in base 4, using {a,c,g,t} for digits.
OCaml
Switch branches/tags
Nothing to show
Fetching latest commit…
Cannot retrieve the latest commit at this time.
Permalink
Failed to load latest commit information.
README.md
dna.ml
dna.mli

README.md

Encoding of strings using base 4 with the digits { a, c, g, t }.

"hello, world\n" gives "cggacgcccgtacgtacgttagtaagaactctcgttctagcgtacgcaaagg".