diff --git a/.gitignore b/.gitignore deleted file mode 100644 index f852435..0000000 --- a/.gitignore +++ /dev/null @@ -1,5 +0,0 @@ -PhyloCSF.Linux.x86_64 -PhyloCSF.Darwin.x86_64 -_build -*.native -ForkMaybe.ml diff --git a/.travis-ci.sh b/.travis-ci.sh deleted file mode 100644 index d7bf67f..0000000 --- a/.travis-ci.sh +++ /dev/null @@ -1,18 +0,0 @@ -OPAM_DEPENDS="batteries gsl ocaml+twt forkwork ounit should" - -sudo add-apt-repository -y ppa:avsm -sudo apt-get update -qq -sudo apt-get install -qq libgsl0-dev ocaml ocaml-native-compilers camlp4-extra opam -export OPAMYES=1 -echo OCaml version -ocaml -version -echo OPAM versions -opam --version - -opam init -opam install ${OPAM_DEPENDS} -eval `opam config env` -bash -c "while :; do date; sleep 60; done" & -killme=$! -make test -kill $killme || true diff --git a/.travis.yml b/.travis.yml deleted file mode 100644 index 959dcaf..0000000 --- a/.travis.yml +++ /dev/null @@ -1,6 +0,0 @@ -language: c -script: bash -ex .travis-ci.sh -env: - matrix: - - SKIP_SLOW=1 - - FORKWORK=1 diff --git a/Makefile b/Makefile deleted file mode 100644 index 9667ce0..0000000 --- a/Makefile +++ /dev/null @@ -1,22 +0,0 @@ -all: PhyloCSF - -.PHONY: PhyloCSF CamlPaml clean - -ARCH := $(shell uname).$(shell uname -m) - -PhyloCSF: CamlPaml - $(MAKE) -C src clean - $(MAKE) -C src $(MFLAGS) - cp src/_build/PhyloCSF.native PhyloCSF.$(ARCH) - -CamlPaml: - $(MAKE) -C lib/CamlPaml $(MFLAGS) reinstall - -test: PhyloCSF - $(MAKE) -C lib/CamlPaml $(MFLAGS) test - $(MAKE) -C src $(MFLAGS) test - -clean: - $(MAKE) -C lib/CamlPaml clean - $(MAKE) -C src clean - rm -f PhyloCSF.* diff --git a/PhyloCSF b/PhyloCSF index f5580d0..aa04ee1 100755 --- a/PhyloCSF +++ b/PhyloCSF @@ -6,10 +6,11 @@ case $0 in * ) export PHYLOCSF_BASE=`dirname $0` esac -if [ -f "$PHYLOCSF_BASE/PhyloCSF.$ARCH" ]; then - $PHYLOCSF_BASE/PhyloCSF.$ARCH $@ +if [ -f "$PHYLOCSF_BASE/cde-package.$ARCH.tar" ]; then + if [ ! -d "$PHYLOCSF_BASE/cde-package.$ARCH" ]; then + tar x -C $PHYLOCSF_BASE -f $PHYLOCSF_BASE/cde-package.$ARCH.tar + fi + $PHYLOCSF_BASE/cde-package.$ARCH/cde-exec /home/mlin/src/PhyloCSF/PhyloCSF.$ARCH $@ else - echo "No PhyloCSF executable found for architecture: $ARCH" - echo "You may need to compile/install it according to the README." - exit 1 + echo "No executable available for architecture: $ARCH" fi diff --git a/PhyloCSF_Parameters/100vertebrates.nh b/PhyloCSF_Parameters/100vertebrates.nh deleted file mode 100644 index d9039f2..0000000 --- a/PhyloCSF_Parameters/100vertebrates.nh +++ /dev/null @@ -1,100 +0,0 @@ -((((((((((((((((((Human:0.00655, - Chimp:0.00684):0.00422, - Gorilla:0.008964):0.009693, - Orangutan:0.01894):0.003471, - Gibbon:0.02227):0.01204, - (((Rhesus:0.004991, - Crab_eating_macaque:0.004991):0.003, - Baboon:0.008042):0.01061, - Green_monkey:0.027):0.025):0.02183, - (Marmoset:0.03, - Squirrel_monkey:0.01035):0.01965):0.07261, - Bushbaby:0.13992):0.013494, - Chinese_tree_shrew:0.174937):0.002, - (((Squirrel:0.125468, - (Lesser_Egyptian_jerboa:0.1, - ((Prairie_vole:0.08, - (Chinese_hamster:0.04, - Golden_hamster:0.04):0.04):0.06, - (Mouse:0.084509, - Rat:0.091589):0.047773):0.06015):0.1):0.022992, - (Naked_mole_rat:0.1, - (Guinea_pig:0.065629, - (Chinchilla:0.06, - Brush_tailed_rat:0.1):0.06):0.05):0.06015):0.025746, - (Rabbit:0.114227, - Pika:0.201069):0.101463):0.015313):0.020593, - (((Pig:0.12, - ((Alpaca:0.047275, - Wild_bactrian_camel:0.04):0.04, - ((Dolphin:0.034688, - Killer_whale:0.039688):0.03, - (Tibetan_antelope:0.1, - (Cow:0.1, - (Sheep:0.05, - Domestic_goat:0.05):0.05):0.01):0.013592):0.025153):0.020335):0.02, - (((Horse:0.059397, - White_rhinoceros:0.025):0.05, - (Cat:0.098612, - (Dog:0.052458, - (Ferret:0.05, - (Panda:0.02, - (Pacific_walrus:0.02, - Weddell_seal:0.02):0.02):0.03):0.03):0.02):0.049845):0.006219, - ((Black_flying_fox:0.05, - Megabat:0.063399):0.05, - (Big_brown_bat:0.02, - (Davids_myotis:0.04, - Microbat:0.04254):0.05):0.06):0.033706):0.004508):0.011671, - (Hedgehog:0.221785, - (Shrew:0.169562, - Star_nosed_mole:0.1):0.1):0.056393):0.021227):0.023664, - (((((Elephant:0.002242, - Cape_elephant_shrew:0.05):0.04699, - Manatee:0.1):0.049697, - (Cape_golden_mole:0.03, - Tenrec:0.235936):0.01):0.03, - Aardvark:0.03):0.02, - Armadillo:0.169809):0.006717):0.234728, - (Opossum:0.125686, - (Tasmanian_devil:0.1, - Wallaby:0.072008):0.05):0.2151):0.071664, - Platypus:0.456592):0.109504, - (((((Rock_pigeon:0.1, - ((Saker_falcon:0.1, - Peregrine_falcon:0.1):0.03, - (((Collared_flycatcher:0.04, - ((White_throated_sparrow:0.034457, - Medium_ground_finch:0.041261):0.015, - Zebra_finch:0.06):0.01):0.052066, - Tibetan_ground_jay:0.06):0.025, - (Budgerigar:0.046985, - (Puerto_Rican_parrot:0.026, - Scarlet_macaw:0.026):0.01):0.04):0.064703):0.06):0.05, - (Mallard_duck:0.1, - (Chicken:0.041254, - Turkey:0.085718):0.031045):0.09):0.22, - American_alligator:0.25):0.045143, - ((Green_seaturtle:0.1, - Painted_turtle:0.1):0.05, - (Chinese_softshell_turtle:0.1, - Spiny_softshell_turtle:0.1):0.05):0.04):0.01, - Lizard:0.447):0.122):0.05, - Frog_X._tropicalis:0.977944):0.1, - Coelacanth:0.977944):0.111354, - (((((((Tetraodon:0.124159, - (Fugu:0.103847, - Yellowbelly_pufferfish:0.1):0.1):0.09759, - (Nile_tilapia:0.1, - (Princess_of_Burundi:0.05, - (Burtons_mouthbreeder:0.05, - (Zebra_mbuna:0.05, - Pundamilia_nyererei:0.05):0.05):0.05):0.1):0.1):0.09759, - (Medaka:0.38197, - Southern_platyfish:0.4):0.1):0.015, - Stickleback:0.246413):0.045, - Atlantic_cod:0.25):0.22564, - (Zebrafish:0.430752, - Mexican_tetra:0.4):0.3):0.143632, - Spotted_gar:0.4):0.326688):0.2, -Lamprey:0.975747); diff --git a/PhyloCSF_Parameters/100vertebrates_coding.ECM b/PhyloCSF_Parameters/100vertebrates_coding.ECM deleted file mode 100644 index f894011..0000000 --- a/PhyloCSF_Parameters/100vertebrates_coding.ECM +++ /dev/null @@ -1,72 +0,0 @@ -0.771493279396 -14.5180982851 0.547433994462 -0.829799770357 31.1892114825 0.7020007509 -1.2357249048 0.0591436724948 0.143021129459 0.0723670336788 -0.0491379655094 1.68015082454 0.0198294354489 0.039540785463 10.4536837099 -0.0705620171551 0.0966709944264 1.69743422922 0.142387839362 91.937054195 27.5243026465 -0.0429527042192 0.105163194816 0.0172649210373 2.25040676661 10.8921310832 29.7216988175 32.0319353336 -7.4338524426 0.17080527673 0.354723692547 0.186750900063 1.57462078709 0.053744234112 0.0267286337571 0.0670392311205 -0.15475952294 7.04751773186 0.133727701692 0.272371840933 0.0995168546074 2.91545126347 0.241247972617 0.30307911252 1.14819950914 -0.523684400979 0.193336177917 7.27785844907 0.248082744588 0.28292064082 0.0737402201706 2.22444630107 0.0911973524823 39.1328554206 1.20406413448 -0.173018086183 0.206353768518 0.171683630752 10.768130388 0.0919414494248 0.0323218254172 0.205978125948 4.34740100489 1.16358434945 33.6941468224 1.7233728365 -0.72844506036 0.0408900267574 0.0984268008214 0.0606490247723 6.27625068709 0.108522818556 0.732902667282 0.156984045956 1.27333682927 0.0371320946863 0.190371215329 0.0649658426497 -0.0107338084319 0.332629598166 0.0135926658879 0.022093725551 0. 2.18866127674 0.143671679617 0.121521316476 0.0119565599453 0.549500917257 0.0356995023641 0.0243544304587 12.7843674905 -0.0520823421344 0.0350655628839 0.405289748819 0.067795684311 1.27336050355 0.160287788944 6.57922720905 0.299427412867 0.0786854813099 0.0488940935773 0.960805451861 0.0665927661081 5.34516996652 0.736796631636 -0.0216049508162 0.0160718839072 0.0223163001706 0.605907271879 0.0245681166778 0.0205049564898 0.158269973844 3.87244486996 0.0304252144396 0.0317223740088 0.0589426989831 0.873730975438 9.99938453006 25.8255751638 1.22569015347 -2.18663674868 0.111696040966 0.0634197481102 0.154784667253 0.211944334747 0.0142851196137 0.0249872010961 0.0178329430869 0.632866998477 0.0456544602052 0.155643358185 0.0852409113534 0.114188793132 0.00538347477404 0.0172684858959 0.00982443430665 -0.0806194749382 1.82202603689 0.0700874839516 0.139029576933 0.0180592441769 0.131956497224 0.0167764425897 0.0204819995985 0.0337369858375 0.495354204564 0.0430768582 0.0598964584571 0.00958027358921 0.0336402412939 0.0100876385187 0. 2.33982994684 -0.0813812527058 0.072537901315 0.967025850778 0.0745340778643 0.0311639252932 0.00984056819269 0.180306689601 0.00854548443289 0.0545028256988 0.042940471875 0.398138428286 0.0395461759513 0.0155719958588 0.00453736963474 0.0574916836341 0.00557974117017 23.6795913232 1.61299074838 -0.0890303815424 0.0309711104056 0.075284329732 2.72022205635 0.0173828570078 0.00889347376972 0.0250244061361 0.189896560082 0.0470550538246 0.0369691647928 0.0517741235211 0.814461875725 0.0113513697564 7.49810654027e-05 0.0161305091349 0.0857488913528 2.52155138217 51.8301587085 1.73431675231 -0.0831502869336 0.00623291475441 0.0140485960681 0.00222815351908 1.85271487285 0.0142595343747 0. 0.0240393018298 0.100035548941 0.00744094731676 0.0208705373804 0.00714801356087 0.202643068745 0.00840395811706 0.0485674719118 0. 2.58108992655 0.0610588913053 0.288098926224 0.0640178651307 -0.0121507251646 0.0924520030781 0.00836826924209 0.0186151696838 0.0836537312744 1.54107027962 0.0440270652618 0.131930258067 0.00717636251265 0.120684206891 0.0125595231276 0.0212153052835 0.000324249078674 0.075269096427 0.0148448619927 0.0162954435488 0.135980978245 1.38509214833 0.0582990476554 0.097001138788 10.3565106085 -0.0327561377247 0.0194019854761 0.151645046369 0.0216308024113 0.16219698802 0.0736088846667 3.56703356477 0.0906683018246 0.0211444376486 0.0293098893392 0.213048465069 0.030853222824 0.105229675827 0.0117895396449 0.238615514744 0.00758025850283 0.383949439837 0.217940094945 3.42317049457 0.151800096828 80.196430788 26.5641853165 -0.00712174354816 0.00723985090453 0.00595505344662 0.0975294587912 0.0438607458733 0.0573004108171 0. 2.03540765518 0.0049271871924 0.0089011742123 0.00755042591788 0.131884297209 0.0101448079456 0.00832642054426 0.0156458916585 0.109023373526 0.0378815314904 0.0463207771448 0.0165605454301 1.6138138067 9.1542408524 28.6750081769 21.9548306605 -0.342652952354 0. 0.00831817472204 0.0019578776316 0.0256561801987 0.00396518185496 0. 0.00828598360004 24.819368396 0. 0.692289530387 0.00221688308001 0.0423207748289 0. 0.00421964524011 0.0102462249253 9.72150853477 0.287135700558 0.111035024588 0.161520784401 0.987246541018 0.0268612351287 0.14984953371 0.0013382555295 -0.0274952800589 0.239907400328 0.130619934855 0.0199908101654 0.00651256013327 0.0940574219685 0.0188049255523 0.0154651516836 0.731121345902 1.44205827826 1.47351708949 0.0159273184405 0. 0.0478071542405 0.00524987299297 0. 0.337092192699 7.2223642138 0.298762023217 0. 0.0197476073108 0.971106449371 0.23665637847 0.000783759865199 22.6147561126 -0.126747246284 0.00525348090503 0.431201251443 0.00871397252545 0.00260008330902 0.00505104531015 0.154413324232 0. 1.38751553761 0.0069785180879 24.2115845119 0. 0.0154314907887 0. 0.026146215906 0.00674642096354 0.249262272475 0.264254321875 5.15802336393 0.282622534951 0.100276942636 0.0464677107833 2.8678028547 0.0103939496336 58.2624766604 19.1638370992 -0.0407572307445 0.0541760472627 0.0408884489312 0.594154801521 0.00637997251286 0.0198824741158 0.0398930112025 0.199496998649 0.131755897653 0.18449888875 0.326574404736 2.81319866554 0.014151320102 0.0153460674176 0.00990532258908 0.0946255220831 0.573596562106 0.632515608499 0.283840725565 16.0063596615 0.075905929081 0.0826477869133 0.145510045956 1.80628209641 29.347029641 79.0811920949 24.1343195351 -0.0670321669475 0.000563067043618 0.00709263218583 0.0160730475881 0.397475218922 0.0108774166451 0.0224531700364 0.0117432492443 0.110217799898 0.00741770540948 0.0106037107321 0.00421212203971 6.34377872097 0. 0.30644392794 0.0507575748744 1.9736613358 0.0556021195246 0.102283849299 0.0480436043823 4.00887120044 0.0417641609514 0.653798644135 0.0359958557139 1.53421130077 0.0163428855889 0.117515458291 0.0242819224677 -0.00643748166518 0.0295649828891 0.000637970407505 0.019754645672 0.0030508665228 0.178930335275 0. 0.00883618689765 0.0253554586766 0.0635021784113 0.0114766272275 0.0282686114778 0.159188805299 2.05296843661 0.0831033972167 0.158454009429 0.0790863053832 0.843181005219 0.0366298173461 0.107941366273 0.0245725600104 1.92780227841 0.103817357813 0.139569513175 0.0230997188178 0.954192866331 0.0226992195858 0.144293124685 11.6702094631 -0. 0.000741264056699 0.0321762732716 0.00876551202277 0.0409627203061 0.0066341456828 0.289776596366 0.0104730362024 0.00188148859201 0.00415933999863 0.0531027228242 0.00397499828712 0.277347255409 0.081204120774 1.47530308516 0.0831617109488 0.0348369494271 0.0330910542007 0.514722517892 0.0315293996595 0.448937601962 0.0560895061976 3.50959324007 0.0672410028933 0.000363858402076 0.0325302162526 0.698509928297 0.0222160316559 31.3936914479 7.82675950727 -0.0103057326894 0.0209560410928 0. 0.0432390313139 0. 0.000598674783837 0. 0.331194702356 0.0159021216996 0.0263734927337 0.0229446661305 0.0793998208566 0.0655491795789 0.0771818086854 0.0755945133111 2.56835350509 0.0801848672594 0.0780599264085 0.0459870926371 1.38822655563 0.0245587112418 0.105445060089 0.157688337733 2.56327777985 0.00606283188176 0.0292401665627 0.0516866860149 1.68499310101 9.08011950879 26.1164046404 6.89513673659 -1.52942036217 0.0973183013281 0.0388353247448 0.117166119514 0.201990514263 0.015333596402 0.0128796043445 0.0124927834828 0.391532889031 0.0313292278453 0.0213395537798 0.046335054843 0.111001960231 0.00549068726692 0.0162640654866 0.00404973027084 1.6718235251 0.0500267310822 0.0517100980774 0.0537247281374 0.0619851968551 0.00546186911396 0.00987533716152 0.00386417990485 0.0791417803087 0.0355024148452 0. 0.0324557541248 0.0530512896758 0.0027411404153 0.003400456723 0.00422901561025 -0.0827672478108 2.45968541101 0.0634654669355 0.173632559347 0.0131604282059 0.164795491269 0.0131791154447 0.0351360772548 0.0335412538099 0.474036367211 0.03667071173 0.0671758266016 0.0124420599637 0.0313192578121 0.00897011881742 0.0123210571936 0.0862780006103 0.62622938248 0.0460793037594 0.0418612404259 0.00488689931062 0.0558122415879 0.0175672823754 0.00628262205823 0.00715550696459 0.0910460725338 0.00443029935197 0.0287613924571 0.00313419211364 0.0319575833704 0.00226776365132 0. 1.70115845114 -0.0522505604502 0.0898926251941 1.06240549924 0.112920569564 0.0463514147993 0.0149556757989 0.290216053777 0.0126916204037 0.0444314578346 0.0425138927353 0.346736063384 0.0532746125015 0.0239887410771 0.00428625042153 0.0806840702641 0.00726198943985 0.0617898168537 0.0606229656609 0.929748659037 0.0607814405512 0.0130660362186 0.00815276835162 0.144015583909 0.00475002529722 0.0297003498473 0. 0.132271963252 0.0101996218813 0.00843968014492 0.00444182503798 0.0259434869283 0.00418488182163 13.9895365789 1.74259584965 -0.069879625366 0.0502569650608 0.0601726449853 3.10841773214 0.0194174772813 0.00880592559668 0.026064139331 0.183837737792 0.0384232333402 0.0386598563856 0.028491177004 0.66561597344 0.0178802430678 0.0106144479446 0.010721316501 0.0584953860606 0.0488555874011 0.0240956518334 0.0447701807091 0.81606944054 0.00601727190495 0.00644546124483 0.00707166378557 0.0505635979412 0. 0.00103456844645 0.00427279006237 0.187146494621 0.00269164053833 0. 0.00100987468273 0.047653345948 1.4140884143 23.7236399779 1.55601401505 -0.181158453397 0.0260123477086 0.0397790253368 0.0100844740285 8.86889734423 0.0461483266391 0. 0.107929568028 0.256807798045 0.0320388886734 0.0695661905816 0.0188244726856 0.942228107881 0. 0.280430428925 0. 0.177260190745 0.0103616000988 0.0309089068449 0.00733443583341 2.08534651761 0.0619419333752 0.0385046664547 0.040395753471 0.063159608537 0.00541444268653 0.00590389620526 0.00982289064588 0.298133346746 0.00680478222793 0.0432921772456 0.00757149486997 1.03013073458 0.0486682637201 0.188686676483 0.0246949247744 -0.0122577305366 0.191980971044 0.0161067868229 0.0275695037423 0.14003002796 5.91146468912 0.134860570052 0.387425224734 0.0209047479093 0.400275840087 0.021321233877 0.0329212682449 0.00736037530406 0.286707031154 0.0674343529579 0.0311016087688 0.01510330413 0.0812436776202 0.00951252481602 0.0089036753564 0.0500637131568 1.53342839158 0.129298933272 0.11420040671 0.00657888694428 0.0901221706124 0.00747913674455 0.0199622847226 0.0126688373082 0.175994119126 0.0118295798482 0.00036469247377 0.0486596453358 0.628137800632 0.0473421611494 0.0308176979667 8.69450787125 -0.0555064568149 0.0480629442424 0.276262166032 0.0331518765262 0.562775127606 0.281398177498 15.7085436131 0.333136469932 0.0406317413376 0.107810107191 0.523491550083 0.0915018349276 0.234333738224 0.0552067621755 1.18046200077 0.0590812702434 0.043050916247 0.0231734472692 0.204509977331 0.0233882916335 0. 0.16346581468 6.09067753677 0.0888615500043 0.0279377722441 0.0701278427092 0.269656981301 0.0300336306608 0.0285534734776 0.0334291528371 0.323865691396 0.0205253370633 0.126702292889 0.134698271566 1.9279992831 0.0830503615842 68.895319709 18.1269451688 -0.0105930094914 0.0197467947894 0.00672572148301 0.219652037737 0.0569481631527 0.192199885757 0.0770026769259 8.2030334245 0.00992272063324 0.0406733489963 0.0200757655693 0.465563570471 0.00648442428788 0.0322131056713 0.0652316603109 0.434810615786 0.00266089608895 0.00461778904828 0.00596362923912 0.0916196214411 0.0124266748599 0.0905298871638 0.0352078645817 1.75296746263 0. 0.011915518628 0.0064691624691 0.117966135277 0. 0. 0.00641417426938 0.263264203083 0.0294620633383 0.0517569597285 0.0297106128632 0.775854199415 9.25329006582 21.8046714515 21.0184122059 -0.254177076964 0.0466163962153 0.013775505342 0.0165752917716 0.2541994313 0. 0.0234895802647 0. 3.51441514201 0.0628800416072 0.126836526076 0.113077846139 0.202105100057 0.00982962599455 0.00967118786199 0.0052933427804 0.301915015348 0.0209447385129 0.0262482055616 0.021515034263 0.0805828810913 0.00282008757285 0.0242510782787 0. 0.874922102518 0.0133118469457 0.0278638597687 0.0256982967577 0.0830735772627 0.0140431178472 0.00152631760016 0.00512338828271 2.14076248522 0.109913868096 0.127066667315 0.0860586763677 1.85126960484 0.0189655004627 0.22577819126 0.02214203147 -0.0187961223364 0.536260801381 0.0187201885281 0.0570722129956 0. 0.249122534002 0.0247618945167 0.0347282919429 0.119844529013 5.89713390113 0.135529295696 0.37862421452 0. 0.0716822297298 0.0139552063489 0.0090504051125 0.0143990351069 0.218599982006 0.0201367961938 0.0288787666884 0. 0.0953004938169 0.0184742524512 0.0163365894936 0.0148614517249 0.91696743349 0.010473158236 0.102230161422 0.00781085519074 0.0411893350182 0.00772386312203 7.845967971e-05 0.0513084582793 1.83647544751 0.0711026312034 0.0484847347439 0.0136165169786 1.40745470677 0.258157562514 0.135820730719 8.13762983681 -0.0328636713303 0.0187769783312 0.235179486576 0.0733364272614 0.0926161334728 0.00838022497616 0.408607171412 0.0113896740303 0.230797267043 0.166509619107 4.62098300244 0.355598938915 0.0707469720138 0.00499944094366 0.1819732433 0.0220544026913 0.0721575489303 0.0276836910024 0.222982276164 0.0331777831189 0.0244250690124 0.00613550182328 0.289795200046 0.00732929200673 0.0844588490175 0.0304535572718 1.0957917311 0.0567580546743 0.0173063494738 0.00490556988502 0.0661130308739 0.0183619577456 0.0948448651991 0.101343657162 1.83229308595 0.0912091468367 0.433113687149 0.0715023194908 4.13594806656 0.0258080154165 30.5908569921 10.0811942943 -0.0243094808513 0.0577216517943 0.0200297769648 0.877392683846 0.00616672142884 0.0133710129811 0.0101473425531 0.425742741255 0.141560490571 0.443900074406 0.191187943803 9.36899545687 0. 0.018888775476 0.0149073518673 0.13913130704 0.0462748737881 0.0379647006055 0.0137169525908 0.459494094526 0. 0.0190014624053 0.00446871333479 0.110939295873 0. 0.0330973044641 0.020129035622 1.80187002398 0. 0.00776890685305 0.000484586777783 0.0693812551183 0.0801448777091 0.218228314494 0.10116895754 3.17665838205 0.0223213571149 0.107982033724 0.190590547393 2.20919088952 7.91138478576 34.3882055135 12.7244322854 -0.15434282613 0.00935208126288 0.0151733883381 0.013729475622 1.71785898184 0.0271358624608 0.146655133895 0.0177553776853 0.30178866371 0.0182577297541 0.0375645028041 0.0274235268157 26.8094991811 0. 0.612478351302 0. 0.142234190974 0.0114076697294 0.011520354398 0.0142505051056 0.280313823039 0.00876817134547 0.0630840357167 0.0103192072714 0.0826066155485 0.0047477806076 0.00469973766013 0.00628193768667 4.58278302533 0.0291050999455 0.0296673134073 0.0479828667289 0.725647477002 0.0270877926263 0.0588757234687 0.0273951850099 6.40325605509 0.0438568294629 0.732225073977 0.00651736008295 1.44810954129 0.0184942984015 0.172245324759 0.0349897269167 -0.00969533647635 0.0999488616985 0.0052454488918 0.0131800710292 0.0337929099917 1.0749439893 0.0326869238681 0.111456192054 0.0264268584625 0.224134039428 0.0199444908588 0.0290530701962 0.562736693539 10.7237952641 0.118229726105 0.506770835596 0.0102800806728 0.0606173209593 0.00751054512132 0.0133113286074 0.0105443090872 0.183782605146 0.0204709347631 0.0276985652596 0.00129705656982 0.0754620175889 0. 0.025804891967 0.030298070793 2.03508410924 0.0447055642363 0.132059900606 0.0301183881127 0.37615525312 0.015908228653 0.0213106603965 0.0431287073534 3.93391823581 0.275853026894 0.265254577006 0. 0.929017326538 0.0360346586025 0.121805115134 12.2774917757 -0.00781203656183 0.00305032194564 0.0716340021864 0.00950419017431 0.290444381626 0.0363585294956 1.48832591097 0.0531160643028 0.00529187417067 0.0181792465187 0.1898146219 0.0202367292531 1.25814605694 0.340506545072 3.55342590032 0.340626708068 0.00543938441184 0.00876335637772 0.0465035840453 0.00925919109869 0.0557620647879 0.0126977754034 0.284454447223 0.0133494203904 0. 0.00517806534409 0.0414239861961 0.0147777238638 0.0411492373521 0.0355017967194 1.07082122249 0.0287025328326 0.0124956170788 0.0109304744587 0.34347636804 0.0163556298762 1.02652889428 0.14159544335 6.96484884785 0.145598748684 0.0100539151045 0.00261004468069 1.03235017399 0.0320664273316 34.9286691378 8.23239114357 -0.0114083420209 0.0199984874197 0.00840313920552 0.139176400973 0.0135290119007 0.0655614948349 0.0271933719352 1.45516931 0.0142193129151 0.0186767358189 0.0235742444493 0.348139821213 0.292921217267 0.0772705614775 0.146955588856 13.0029095601 0.0128252811737 0.0160174998411 0.00344783997877 0.0854516604554 0. 0.0306215484952 0.00135298295599 0.197945344879 0.00398803702332 0. 0.0112408821513 0.130903293586 0.0345087851993 0.0350951206775 0.024019772453 2.51762209502 0.0236558879595 0.033012214447 0.0321554878851 0.53405164739 0.0272060510773 0.175337751612 0.294680297433 5.21552771342 0.0246904606628 0.0948001199036 0.0427269667822 1.71316918042 10.4885072326 28.6013786797 8.76793221684 -2.77594356032 0.0993047870626 0.258987813235 0.196747240033 0.159727053992 0.0201599544009 0.0456494718309 0.014416684875 0.453919642655 0.0552728098673 0.176877082092 0.105471229855 0.386772302504 0.00718586592846 0.0321231644917 0.025169217975 6.78299214328 0.375237957265 0.480908376528 0.294621559134 0.387630790093 0.0702904544528 0.169324529386 0.0583382719292 0.390108022986 0.150928696164 0.18405706465 0.0963763242996 0.894999246158 0.0063632664085 0.0562162829768 0.0486748216443 2.62332950228 0.20035925212 0.35459689191 0.134554657987 0.228256251997 0.0429382995137 0.0430277011087 0. 0.499835267232 0.0872802166146 0. 0.00901740735283 0.289857331321 0.0270375266701 0.04838186141 0.0374696887996 -0.0121894520849 0.410790063033 0.011133598533 0.00165056619402 0.0051843131731 0.0431018327577 0.00539237299706 0.0150623598867 0.0170708870198 0.0840406186667 0. 0.0242935664732 0.0080513219032 0.0398494896751 0.00545725560213 0. 0.0790745463878 3.2078145507 0.0532472065717 0.010043455522 0.00635188554487 0.0880596706435 0.013721224767 0.00651922284968 0.025457891714 0.304325536564 0.00707279853229 0.0675357009414 0.0172192049667 0.106767001377 0.00573203678181 0.0136987547062 0.013655212029 0.297543754748 0.0119723251101 0.00318746283208 0.00162010996025 0.0299444434255 0.0108699938489 0.0166143146908 0.00169048351502 0.0635594253576 0.00467473667675 0.0232766714606 0.00173091362045 0.0456155333578 0.00257003829396 0.00549671428511 3.59183812996 -0.0128603903345 0.155272434481 2.90473676882 0.0921884295404 0.018003235893 0.0088919464121 0.332278027108 0.029517979277 0.0950845378976 0.0814115848686 1.02293237377 0.0782302611672 0.124932670117 0.0147696168081 0.209777697594 0.0191860423374 1.17481497084 0.422005627993 7.16881310532 0.519389046385 0.138828982528 0.0537440354805 1.18848446499 0.053710043866 0.258890930878 0.191467019998 2.4094721595 0.233810974308 0.141415434357 0.0802249814486 0.478853644692 0.0570549680101 0.186570124039 0.158525054764 3.30106333889 0.127155955145 0.070267211767 0. 0.703384400913 0.0418228555285 0. 0. 0.981935304195 0.0968146005396 0.0783266440087 0.00763974452017 0.23785171402 0.0201171111811 507.765111884 2.44158816723 -0.0298412769399 0.0122551089064 0.0159708172401 0.662041901317 0.00734282838376 0.0100875430507 0.00631171792731 0.0627729308325 0.00317881402807 0.0217712378384 0.0380502109864 0.181154195019 0.0147807967765 0.000693398311567 0.0108043597623 0.083547251776 0.124351036848 0.181987183493 0.0659530747008 4.28844853026 0.00751655604012 0.0154663468996 0.00513218639619 0.101949747019 0. 0.00997028720563 0.0172390346722 0.836591636433 0.0182342555086 0.019835677565 0.0069782151758 0.16156444993 0.022796908347 0.0389716219568 0.0269186753463 0.441801768503 0.00596547916974 0.014701676295 0.00739562555348 0.0342721533618 0.00495950613705 0.0217814491004 0.00623597741371 0.141948440236 0.0124771328796 0.0118889570172 0.00259482001219 0.0781727135773 2.98967538063 49.2839591139 3.316675155 -0.0722278190998 0.00500866092764 0.0173192942569 0.023154035384 3.4470883287 0.0171508279517 0.0554954011444 0.091309482244 0.0662760011389 0.00829980119382 0.022354058005 0.0338946495945 0.235314951058 0. 0.0763098378531 0.0332331474469 0.286505793562 0.01505939157 0.0464968416988 0.0254099705532 6.29714726079 0.0976069040919 0.476439604983 0.0361553588411 0.122280514014 0. 0.040880462884 0.0107976740267 0.516163749196 0.011360889129 0.0121972794524 0.0203193196188 0.0695019404399 0.00472048511553 0.0113007052678 0.0118761160785 4.26073713503 0.0861649940812 0.310162417427 0.051843758979 0.103507527036 0. 0.0457793711362 0. 0.430028495412 0. 0.0801999766326 0.0205470075237 2.81788640408 0.00323540880644 0.44167841641 0.0268487689328 -0.0109315724616 0.144616714606 0.00821707597789 0.000456726857907 0.0764913882054 2.45357074876 0.0661435744316 0.176744922702 0.00819456481366 0.266597495417 0.0182759357264 0.00846119421793 0.0313617134389 0.0966495049223 0.0162790413192 0.00163711843708 0.0369439154618 0.234872736279 0.0123576787921 0.0265123221939 0.036042397569 4.81163765756 0.150265642397 0.164785582551 0. 0.180317458513 0.00458491922496 0.0367902105118 0. 0.389255850299 0.00174760112765 0. 0.00257753728933 0.0635580300716 0.0084535343221 0.00282624864339 0.0447019415675 2.88017138187 0.289532320254 0.123735336689 0.00324188461583 0.118078308966 0.0100812848724 0.0198277053741 0.0116340464762 0.243292793662 0.0120482062486 0.0176763288885 0.263693820924 0.709176626674 0.248550219855 0.0328825526141 12.6242878278 -0.0135254471713 0.0224138900757 0.096798546819 0.0154444374282 0.469113896116 0.22743490158 7.79328364964 0.213279371798 0.0161344840406 0.0784909371759 0.179648483473 0.0628751158954 0.0423341383387 0.00630178455457 0.312339853289 0.0234883695029 0.0322889750944 0.0291162192912 0.247846604119 0.0201655279496 0.0518907117023 0.0661747311717 12.1031163415 0.0342292472337 0.0670292507246 0.0263262931891 0.406923875717 0.00490776541097 0. 0.0160598832211 0.353791691237 0.026544047596 0.0118193968718 0.00791022068661 0.109843293866 0.0158225402976 0.333300299142 0.31958909408 12.0613669426 0.0616488096615 0.0107388318896 0.0148583295769 0.233395457926 0.0229189251464 0.0725987489501 0.0224009938245 0.366753524194 0.0033444418443 0.435154262392 0. 5.18531608176 0.0337930801197 103.370411838 30.2187145757 -0.00889801311401 0.014314272414 0.00733263507062 0.139923321215 0.0599475336812 0.151241438878 0.0626266723432 3.26792392121 0.0168047793112 0.0355345341123 0.00841349152452 0.279741113857 0.0269058261891 0.0203136714086 0.0172489856388 0.100526472268 0.00951741783187 0.0365100909268 0.0188076923165 0.311852144931 0.0234901851248 0.406481108084 0.118585605774 5.59567167405 0. 0.0209633844747 0.0017276477389 0.386993411551 0.0356811825554 0.00753007889328 0.0256322285828 0.467310381695 0.00386274806443 0.01299145289 0.00713480561887 0.0563915408293 0.0270058369068 0.251044072283 0.255733515669 3.20974363638 0.00242786317209 0.0191998396281 0.0137316622378 0.150868053414 0.0179523093513 0.0494934567133 0.0152084857496 0.22043068467 0.265435129553 0.0233293793875 0.240040834453 1.01421579934 10.035477583 28.3055731705 29.0099153961 -0.161412798087 0.00424480446191 0. 0. 0.0906916476566 0.00563968805371 0.0321857317281 0.00625169793881 2.32459802666 0.18028353771 0.402169481502 0.146021735821 0.180738849749 0.0152470119891 0.0594309552204 0. 1.59918269474 0.0878914404839 0.151488329592 0.0644464394055 0.433227437698 0.0415119312985 0.134563380307 0.0308938272344 12.8269080058 0.586851670675 1.37028858456 0.768958451975 0.504903662999 0.0401830542296 0.179516483383 0.0260615738593 0.320069615284 0.0514874328311 0.0730906239858 0.0500704875043 0.126989204283 0.0185452770624 0.120931812654 0.0233211166859 2.57821698158 0.137637074862 0.52477780815 0.185823198291 0.14069243508 0.0436555868557 0.0759002609233 0.0304916977712 351.484733517 0.0751625144229 26.381564856 0.10755263699 1.62508488908 0.117164738243 0.443351098266 0.125852859682 -0.00540817019885 0.109532143682 0.00466186168276 0.0119570850765 0.0158619374367 0.0807774228921 0.0133696167272 0.00519688621966 0.029392784273 1.27871496477 0.063722905148 0.04128067384 0.00632884583531 0.0453137431349 0.00843806244594 0.0123184356638 0.0549166610956 0.828580129577 0.0498266614372 0.0502292974892 0.0199171150784 0.185872475093 0.0251441786984 0.010719019886 0.089127529091 3.4296456957 0.103967035845 0.239907865574 0.00468334570237 0.206251061571 0.0138674587778 0.0283270941681 0.00773883894314 0.0717966354105 0.0039461417809 0.00130873744795 0.00796058746493 0.112416234141 0.0258843362023 0.0102273571283 0.0143618403641 1.09404680854 0.0371145501871 0.0742827896751 0.00597837009967 0.0989926626628 0.00732532644804 0.0141200991997 0.297694270758 1.90815280778 0.448236037837 0.0662766472026 0.0370265810511 1.47916590967 0.115943259122 0.102962006329 2.53689270085 -0.0102444412948 0.00509286785591 0.0526826133572 0.00865174390146 0.0167207453137 0.0078067338281 0.0680018616885 0.00652270728479 0.0529708932914 0.0317393901905 0.953237491747 0.0460080390141 0.0202225963419 0.00647460880487 0.0627457859646 0.00621514632303 0.0849084781118 0.0605758785434 0.430500146762 0.0760617630848 0.0368909715192 0.0130987377349 0.289812358407 0.0111800529475 0.15870666689 0.105782269501 3.01587355888 0.129715864077 0.0292980098652 0.0140236078572 0.161233068931 0.013554679652 0.00638065202681 0.00383023188484 0.0462524279848 0.00467115363075 0.0143634062062 0.00687250339689 0.106692653386 0.00553305812419 0.0427454939109 0.0298804720595 0.989563854742 0.0360911542865 0.0145669991601 0.00652825936214 0.0693258497758 0.00506439035447 0. 0.0616959880557 9.95680242469 0.105688196253 0.162332902184 0.0468444399235 1.27307344663 0.0459595842087 8.27606578348 0.715389857412 -0.00789939435885 0.01212501017 0.00773363835482 0.175301373497 0. 0.0143690209499 0.00126452851364 0.132117818087 0.0582018868707 0.0711103982248 0.0578686515489 1.756951756 0.00998972583202 0.0120449704688 0.0114545328219 0.0634532707085 0.0744891940437 0.0686263990691 0.0484135563166 1.44153871334 0.00450888748208 0.0272210780702 0.0240257116739 0.208900041641 0.0398056574747 0. 0.113109727358 5.32058987453 0.0150482576711 0.0314730538069 0.0119754249663 0.256988726401 0.00098902044467 0.0131515986558 0.0105575625281 0.10786533181 0.00903471281231 0.0072515426398 0.0277375045236 0.110148076992 0.0208083242687 0.0755742185728 0.0905113037895 1.71936164198 0.00966856631646 0.0179622299535 0.0146245333127 0.12178135613 0.294662757949 0.0974744910442 0.572307858294 3.67660894718 0.0571583781106 0.0395596260121 0.107882138908 2.20567784646 1.91713540938 48.0143648972 0.853169465851 -0.0531643487552 0.00046790400605 0.000838453691686 0.01812896729 0.208420547857 0.0343787330744 0. 0.0231920471902 0.043685055595 0.00732004830476 0. 0. 4.11106061846 0.048722096716 0.146088640727 0.0560625049253 0.0474926500595 0.00475721733224 0.00484972824452 0. 0.197182079712 0.0457824201776 0. 0. 0.058950641239 0.0289413524406 0.0136873269902 0.0229852647113 41.3472328531 1.0528307594 1.29285877772 0.306280922598 0.0345768065397 0.00451575537032 0.00714407574213 0.00383630480052 0.231578282487 0.027634098434 0.0463528990383 0. 0.0637039348201 0.0184746799941 0.00875762872995 0. 4.32985621739 0.117782272716 0.022019255005 0.0681679785543 3.64445607755 0.0592877548457 0.525086277223 0.0756449030113 4.56261330482 0.110131050888 0.0439052051569 0.0797889683874 2.06518561996 0.0666683510558 0.0762726044496 0.0517838499854 -0.0055199762485 0.0334289719786 0.00390763608714 0.00102384267646 0. 0.106196580492 0.00818508580281 0.0136642809574 0.00357284653328 0.0457468056207 0.00694679633975 0. 0.0911050824201 0.599678869518 0.0489300439061 0.0108088282083 0.0105832559291 0.145765335695 0.00690974052474 0.0114920430125 0.0175529106988 0.175936238339 0.0413270786918 0.00872752794066 0.00466216314537 0.0913950125537 0.00860719686636 0.0243677507458 0.0585882757321 2.80334749919 0.0872701701452 0.111401177662 0.00200006153919 0.0217250647562 0.00433905371471 0. 0. 0.110447906903 0.0173404257969 0.00995287043434 0.00388615508611 0.0438806416399 0.00902124309974 0.00312743519908 0.0425164571122 0.955534749424 0.0288747192586 0.0248716875581 0.206472713399 1.77357320853 0.123522093577 0.193297452822 0.0928470465172 1.53245881476 0.111006305099 0.117335749811 0.105553436644 0.742828630094 0.0622235265575 0.0423426485008 1.43526430491 -0.00783695049608 0.0250727545388 0.0365535857915 0. 0.104520783638 0.0175266123984 0.423097003684 0.0372719485901 0. 0.00118601758413 0.0980061451082 0.0165691637301 0.398423196665 0.0736727127086 1.87900199944 0.0923264680767 0.0174427982474 0. 0.0558435587249 0.0325636812093 0.0600891313087 0. 0.53367919355 0.0668040000349 0. 0.0149063765247 0.118853989326 0.0549025463859 2.14712512855 0.312763441889 20.1875336549 0.347860470677 0.0066552531376 0.00307323366926 0.0412644723982 0.00610625387445 0.0831499855006 0.0075476627928 0.537235020729 0.0317779628223 0. 0.0021195066801 0.103937315422 0.0444811941521 0.209725175735 0.0477753255181 1.65952099137 0.0698039587929 0.0802054038476 0.0387196706916 2.78319794878 0.061028317299 1.47838527252 0.204511470784 7.10912954036 0.256877041263 0.549142746907 0.0751592976177 1.26735185125 0.109280267489 34.4959393706 1.05085922221 -0.00746472259056 0.00204899373295 0.00581141364371 0.0491987450047 0.0279931733762 0. 0.0187164230282 0.139287436956 0.00599351063267 0. 0.00799680673582 0.0650958058285 0.0344787803875 0.0123348960029 0.0622609147898 0.851318265478 0.0137965285149 0.0171589122973 0.00792908114731 0.177351717033 0.0066528572533 0.0210605579391 0.0315464539473 0.18248378446 0.00953680519322 0.00890950686499 0.00910725738233 0.174716153118 0.0532132015906 0.106932799171 0.0628787450617 3.22751790841 0.00644393995935 0.002174043541 0.00377513820975 0.0273030924407 0.0338199259892 0.00125051939221 0.0390614305644 0.10632141054 0.00310445049144 0.00717703221063 0.00848650791657 0.0783047449268 0.0456723888635 0.0516488993956 0.0415544937568 1.15249307403 0.265892650003 0.126252301003 0.188030143058 2.21350162545 0.0711131598547 0.0498530038432 0.14039933692 1.62206226821 0.0927215536591 0.0268076213023 0.0997798597602 0.992253660267 1.28408120875 24.4950942036 1.65934183601 - -0.0255410031621 0.0196994410272 0.0329436805941 0.0171683371063 0.0149396985614 0.0183708104275 0.00645076614979 0.0131771277358 0.0119329780996 0.019404291813 0.0110661479582 0.0126066351598 0.00767281125434 0.0211476929741 0.0217199500715 0.0162144992548 0.0125788049362 0.0153824193819 0.0351900543795 0.0107925691178 0.016594963679 0.0192878934182 0.0069342750228 0.0174443586684 0.00639363526807 0.00974852461103 0.0111678900222 0.00443298791246 0.00723674640067 0.0193993823623 0.0394721937175 0.0134712866574 0.0308697977783 0.0261955025614 0.0398854098195 0.0222118074114 0.0157269211794 0.0271424443752 0.00716582944527 0.018409347815 0.015995194452 0.0210047367317 0.0151538538426 0.00983855721495 0.00727530179348 0.0147630423609 0.0279360948926 0.0111035450087 0.000586877417582 0.0155362448361 0.000536216447671 0.0120197877511 0.0121507344448 0.0176708896065 0.00473584340384 0.0155784373036 0.0010210997268 0.0121177246907 0.0119605502469 0.0104896896194 0.00812470878645 0.0202026177119 0.0134871493447 0.0175201850745 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT - diff --git a/PhyloCSF_Parameters/100vertebrates_noncoding.ECM b/PhyloCSF_Parameters/100vertebrates_noncoding.ECM deleted file mode 100644 index 2e3e718..0000000 --- a/PhyloCSF_Parameters/100vertebrates_noncoding.ECM +++ /dev/null @@ -1,72 +0,0 @@ -2.78592743423 -6.58600444004 3.19341169223 -1.63519457982 12.1399355041 2.45567860959 -2.43476285124 0.137196047767 0.462787891603 0.0687994720539 -0.0828676812999 4.64297827314 0.0583439047427 0.114333277922 4.54770228198 -0.569910594763 0.269905137878 10.0658717921 0.227536068622 36.0992488386 10.3039899411 -0.0485017841297 0.412819154555 0.0211222634573 2.74491138612 2.97356015436 14.4767642696 13.8730044691 -4.91172089731 0.155166943916 0.607308551579 0.0926673262207 2.93090865811 0.0568018331327 0.563736806771 0.0419502454502 -0.110594870229 14.1973016288 0.227814935065 0.348821740023 0.0698012930426 4.35673029912 0.320289189969 0.205259373689 3.19849897319 -0.200634258787 0.0561388860069 9.29335938844 0.0929695932917 0.395913544434 0.0764056737434 8.35592589299 0.0734485882052 10.2333897454 3.31735868963 -0.13798910766 1.0340072599 0.318823468155 10.7213291459 0.0794339571607 0.150236344311 0.308812958798 4.11390908902 2.34629268324 13.7678588818 3.75348569698 -1.61163899145 0.0903822534676 0.0978724405796 0.103846672592 13.0480744395 0.227582308607 2.33026717206 0.158960500271 2.75288101677 0.0415967285977 0.155011835538 0.0774147142431 -0.0539412039354 2.7175215174 0.0197134073579 0.160319614896 0.188046082887 17.3910431275 0.852712504949 0.990756643627 0.0714613184066 4.0085387173 0.0637586828172 0.239230657001 3.72498943433 -0.115504297981 0.0554316110801 2.62956148456 0.108596913546 3.44821535373 0.624122455894 46.1826203189 0.819390424217 0.144340307998 0.0767389836681 3.45253752203 0.0918946223283 11.0581166867 2.78890551354 -0.0686425149198 0.126358582519 0.0353234891621 1.62786654769 0.112834294186 0.366312347819 0.910925474064 10.8159929664 0.0420270072454 0.121652373835 0.041021549888 2.70393912639 1.97744280002 8.57968016608 3.32159829656 -2.7544269435 0.0893651329767 0.147541427462 0.045588254393 0.13118461025 3.18524470568e-05 0.00511362108266 0.00177951014407 0.415950418678 0.00274376193493 0.00295069255731 0. 0.0490110518677 0.0109095971916 0. 0. -0.0792482672501 3.8269663053 0.0600975342331 0.169229443099 0.0235434410828 0.20555593481 0.0187169473997 0.027489303549 0.00704240140764 0.842055408475 0.0204804845935 0.00228597224206 0.011244526864 0.0757896416031 0. 0. 3.49147912066 -0.140350659206 0.0519225842332 2.88395589756 0.0273793218983 0.0160717268365 0.00476194914635 0.256665151464 0.000945031287224 0.0457491179596 0.0221450577789 0.598936842192 0.0157356154024 0.000732141038617 0. 0.0653627423271 0.0024299228541 10.7164632866 3.57233983814 -0.0420703782816 0.245254684763 0.0661881569729 3.31052265197 0.00921779748141 0. 0.0187176169492 0.0941345819645 0.00889233349389 0. 0.00988308290204 0.825507301736 0.0116464934505 0.0265891275072 0.0121580600248 0.105930373584 2.27706263405 16.0355075221 2.99806680412 -0.0835624220006 0.00882220161046 0. 0. 3.08974563007 0.122047945762 0.580194800746 0.0527490707359 0.0735023766671 0.00433095387463 0.0343457304593 0.00511087269641 0.0846597799348 0. 0.0288920646816 0.00160328304007 3.89374822857 0.145724186109 0.859411475778 0.0977710846653 -0.0154152275448 0.104820298736 0. 0.0105463060181 0.115102782565 5.17009625533 0.237854650192 0.172608828294 0.00557693962982 0.118368017498 0.00724878346524 0. 0. 0.182319021431 0. 0. 0.138898774156 5.03284649814 0.138658093089 0.165678358789 4.79323321106 -0.00482910140346 0. 0.20777458312 0. 0.532995768631 0.254053586795 16.2610321 0.173403286842 0. 0. 0.157481114874 0. 0. 0. 0.394080739918 0. 0.69328323564 0.320689384456 9.88649042287 0.167025974959 34.8139406207 10.1133870094 -0. 0.00961312458577 0.00777720146138 0.0421416632552 0.0668430982448 0.316055827456 0.310161085324 3.80578081572 0. 0. 0.00286341134589 0.0655755234675 0. 0. 0.0111015655273 0.0940823246107 0.0501235340082 0.388529007176 0.100853422779 3.47803826662 3.01358288946 13.5549050105 9.5786073322 -0.468309814243 0. 0.00422239547645 0. 0.26830641753 0.00846178333649 0.154305577789 0. 11.2231238988 0.279262732154 0.668330937867 0.193652679992 0.219677620446 7.2077574577e-05 0.00604055276834 0. 33.2452989031 0.811222421625 2.55659342609 0.452160447674 7.64549509172 0.263216471122 4.7802784332 0.143871982185 -0.000860877233951 0.834462206337 0. 0. 0.00360228322614 0.414239512028 0.197936924501 0.00823935352163 0.11774285457 11.2493424316 0.201884259842 0.497799451235 0. 0.266084682123 0. 0. 0.266110848103 34.7258580282 0.547536957554 1.46118924155 0.160338489022 9.08023328703 2.77572496514 0.635232621196 20.7884238597 -0.00982618500386 0. 0.591865235112 0. 0. 0.00218531337504 1.27017090395 0. 0.339648545761 0.16161338633 9.56757283704 0.183239415868 0. 0. 0.190549769126 0. 0.939489900239 0.401541837309 30.6896731945 0.378631582678 0.49544403824 0.338076522141 40.5444710727 0.154867530415 51.5670070065 18.1748961464 -0. 0.00305450479455 0.0135564060988 0.917987071428 0.0121496291976 0.00940515686116 0.119119559264 0.323445066476 0.137627082052 0.973331878132 0.317403241123 13.7268039631 0. 0.00385237606388 0.0129442098625 0.2243721539 0.436381800076 4.66762939214 0.890960051922 46.0687746218 0.159821879484 0.606560651364 1.3124413836 8.44478548018 12.4665171004 49.6206423643 16.2525872954 -0.0480997542122 0. 0.0120069171917 0.00705871640247 0.365898539349 0.00331565177772 0.00828798187583 0.0190617177772 0.0566983820258 0.00206195136388 0. 0.000851243591405 4.13290256325 0.0778480013042 0.257064930071 0.0532942502359 2.58623674767 0.0627896589555 0.130295452685 0.0607415410117 12.6708354607 0.127040124001 2.19987609742 0.174617163404 12.8946521218 0.0747252598411 0.446429410446 0.0977030126566 -0.00562265261444 0.0764307547465 0. 0. 0.0063414974605 0.380861788353 0.00753424639752 0.0220559286448 0.00980976134525 0.101156083167 0. 0.0138619086514 0.072833456771 3.75912497016 0.0471465843163 0.106431837705 0.0803441627835 3.285182125 0.0552749886049 0.164538257304 0.2503607233 12.1799982117 0.873441856704 0.770053907325 0.397759952713 10.5237799774 0.22377862705 0.742945113248 4.04528522945 -0. 0. 0.0539015946056 0.00278364992127 0.0377957707833 0.0135963635668 0.89440013158 0.0147550321805 0. 0.000295662566089 0.101859214026 0.000945192222413 0.107777801947 0.0455856315413 2.95431984048 0.0299580499308 0.0692407005928 0.0777213018462 2.8342950611 0.0597295499215 3.20392772547 0.525791072418 30.2914067842 0.591091345872 0.778259117844 0.196799800294 9.7436291249 0.250287033284 14.0153836355 3.34075289278 -0.0029775553938 0.000481714381558 0.00995582674459 0.0354561987446 0. 0.00988402515618 0.00175895315694 0.319479264747 0. 0. 0.00856538884321 0.0181925584499 0.038841902373 0.144236561331 0.0680763995227 2.45864879147 0.0532891365325 0.207694885915 0.0544091024245 2.62133140043 0.124628865738 0.386482949994 0.605612447182 9.29643383867 0.193490205147 0.508707708341 0.224730774419 9.95732384776 2.2284772758 9.79481604528 2.83331650296 -6.56858255082 0.157040779976 0.412175038103 0.0941892466145 0.22602139234 0. 0. 0.000432028561943 0.578215659146 0. 0.0122850462384 0.0100014809361 0.11167679813 0.00640756227736 0. 0.00161147255275 2.46904674823 0.0456773806562 0.15229360324 0.0314539380676 0.0534554009708 0. 0. 0.00927397630364 0.447179203281 0. 0. 0. 0.0367299291555 0. 0. 0.00903617543561 -0.154254426169 12.0194888817 0.188385564082 0.404976306527 0.0330397145777 0.450121271064 0.0489176001655 0.0370399636967 0.05094694887 0.990991883141 0.0180840722072 0.00384380211183 0. 0.169457512386 0.00819708281146 0.00870799638103 0.0573145148162 3.61306377769 0.0855272437255 0.154782328737 0.00748232676517 0.0881927464735 0.0049964336753 0.012854379142 0.0301713814632 0.72400213014 0.00648062632878 0.0198374976478 0. 0.0571707574935 0. 0.00247035561626 4.34813916207 -0.227788108235 0.0799299082191 9.79896923451 0.103053796284 0. 0. 0.78255650198 0.015579837746 0.128340355924 0.046279605209 0.779068029741 0.0225234611853 0.00602103326625 0.00493313737968 0.161693747513 0. 0.0772646124819 0.0784651311818 3.39842393239 0.0430785142297 0.00319153334055 0.0200545515437 0.226232620884 0. 0.0820883049329 0.0265643135942 0.866371736819 0.0183432125543 0. 0.0250462788848 0.0482691177232 0. 10.1583124061 4.45404934624 -0.107881419785 0.624537506527 0.143524792543 8.57913984856 0. 0. 0. 0.243607905648 0.0376568369585 0. 0.0123913692603 0.977051019802 0.0286899775315 0.0401590208837 0.0222659759274 0.159355783736 0.0382060716859 0.180359387973 0.0471829513688 2.82761809762 0.00499074984672 0.00488669031459 0. 0.053752763036 0.00691320221159 0. 0. 0.829310276526 0.00323386746488 0.00593988613076 0. 0.021522244845 2.40542589088 19.5417991861 3.75671940857 -0.12834113079 0.000631024810323 0. 0.00370534372453 12.9755000578 0.249546857178 2.2428079352 0.16858926865 0.167087689576 0.02383686429 0.0439490546363 0. 0.655221811919 0. 0.0906015436812 0. 0.0942550375717 0.0144616778276 0.0351737751326 0.0112630245205 3.31439870246 0.0682789714328 0.43347001132 0.0516315018829 0.281101289081 0. 0.00916726942431 0. 0.230196247012 0. 0.0403187341028 0. 3.34331662861 0.0971515456628 0.781046975592 0.0872172134872 -0.00147272373388 0.231637836881 0.00034595435521 0. 0.239177344728 19.0321903198 0.682121242987 0.58023907979 0. 0.362869697142 0.00491708358301 0. 0. 0.711707470265 0. 0. 0. 0.117504471461 0.0121911148736 0. 0.111229457943 4.4199412059 0.306313105926 0.250843260075 0.0151977356619 0.530844103954 0.0200689115308 0.0183915886966 0. 0.240685558284 0.00716322812369 0.0025539038592 0.0720097295311 5.06653931434 0.0792452953844 0.173890272432 5.19879437497 -0.00584157821457 0.00981900567978 0.501161696619 0. 1.70123466465 0.457547343541 50.4645366614 0.516148327511 0. 0.0476676401932 0.633934534495 0.0154289667092 0. 0. 1.41536414927 0. 0. 0. 0.204730338169 0. 0.317299779043 0.262826758155 18.4505803511 0.196113664614 0.541248280455 0.708760121856 2.67512354266 0.181899268955 0. 0.0231037960197 0.546155668327 0.000709150651529 0.690762503945 0.31210703086 10.5525498701 0.251830847873 35.1062120167 9.24273876406 -0. 0. 0. 0.121219395501 0.173500127538 0.732707640921 0.967955772341 13.9456042856 0.0142592910443 0.0661696110665 0. 0.204245055816 0. 0. 0. 0.335284741585 0.00120828759341 0.000770045425943 0. 0.0762604530737 0.0474049343197 0.13927094387 0.17189083881 3.32796677053 0.00836207794708 0.0417538220573 0. 0.302116718197 0.0100602962328 0.0446388722815 0.0203652287305 0.233869284809 0.0606199672857 0.338796931585 0.101822437413 4.01419582769 3.59460760499 14.1246349223 11.2167674822 -0.305915296181 0.00387290678178 0.0283900521037 0.000168284862403 0.103145819992 0.00682213703837 0. 0.0069105622856 10.8506353065 0.143162318594 0.606240184459 0.101575092269 0.174857843309 0. 0. 0. 0.379874892195 0.0135188840515 0.0283892888726 0. 0.0866224362335 0.00680603807226 0.00423745111466 0.00363287262812 9.81027429037 0.148538407691 0.484853262019 0.110578511 0.0796243853214 0. 0. 0.00845303045711 10.3935417311 0.412884043486 0.946160277011 0.227669238572 3.3309009611 0.119274560321 0.88047907047 0.0227475613468 -0. 0.464728116785 0.00308746578916 0. 0. 0.199886815768 0.0125122178155 0. 0.180705625194 14.0947925672 0.252641224242 0.547186742156 0.00366396625264 0.171718229624 0. 0. 0.00256090204409 0.636746675067 0.00960274978496 0. 0. 0.146270560184 0.017249053838 0.000316098567487 0.285378211168 9.24014013085 0.305949089687 0.718193549725 0.00312219292709 0.0773155035163 0.00955123407451 0.00198881136206 0.144809836717 19.3056982127 0.243438772992 0.717540645624 0.151265661762 4.92211351063 0.504292174964 0.361202903197 4.49006892216 -0.087451981084 0.00842338129519 0.392290124716 0.00139847334073 0.027044155128 0.0139774661244 0.638507439152 0. 0.556961222423 0.13882239836 13.5150909923 0.166561693382 0. 0.000756205239141 0.188613940486 0.0144571766857 0. 0.0167131216833 0.532700702004 0. 0.0320969284915 0.02326036368 0.33353910299 0.0105399567991 0.600959423559 0.261734253996 10.1713107581 0.238032618109 0. 0.0199740705072 0.139539542607 0. 0.57217221198 0.216745519905 12.1940990023 0.178514589947 0.592929555019 0.137803794033 9.00742699427 0.129076334826 15.0682981859 4.38093295403 -0.00986884400482 0. 0.00714910857349 0.367847444687 0.0166385250797 0. 0.0210436940204 0.155361065995 0.170480142873 0.717744368709 0.312410321473 14.2913544055 0. 0. 0. 0.120387628276 0.000292448770617 0.0183996746206 0.0118009941572 0.612374176547 0. 0.00880187636181 0. 0.0810806480573 0.211302552782 0.467407092312 0.246211628106 10.2837358385 0.000671732121191 0. 0.00544000385484 0.0566344860084 0.152106508386 1.52277218051 0.373232827818 17.3834665486 0.088560075074 0.196177361201 0.380258104422 4.36085934855 3.18437134081 18.8510841125 5.14520276184 -0.140188964873 0. 0.0151920530983 0.0153098032383 1.21840798939 0.0200771021955 0.013828583721 0. 0.298711554809 0.013282000644 0. 0.0167204186218 17.9923373684 0.232696535903 0.984057841766 0.142431651545 0.0594158796265 0. 0. 0.0137989912116 0.12040947048 0. 0. 0. 0.311981750261 0. 0. 0.0153840209357 5.10599693577 0.060058085426 0.192867675621 0.0439372706467 2.29950758326 0.107264463125 0.122983893731 0.0764090093826 14.9222894425 0.206524497422 2.86780466508 0.159494635211 3.80306505617 0.0334445588107 0.325190963647 0.151947105188 -0. 0.207669384822 0.00189721251573 0.00553485636554 0. 1.52235490048 0.0214143749539 0. 0.0145960413034 0.32793862831 0.00705339082687 0.0457414280331 0.268825669828 19.5855144187 0.172589090786 0.409132980287 0.00554476834153 0.1076229582 0. 0.00240622379516 0.00804850693051 0.206710892449 0.00818525905021 0.0258785461201 0.000760289922815 0.311325590969 0.0118866698369 0.0359508735092 0.0658382096549 4.45507109341 0.0857620092788 0.184552789051 0.0797894222264 3.9481700794 0.0581303052042 0.16676938791 0.269272847366 19.2295897427 0.73594417452 0.978955856639 0.125122027026 5.05506631457 0.0973955577781 0.428928296452 4.82612419107 -0. 0.0187625080249 0.20621297091 0. 0.215475351118 0.00846225603838 4.56136559967 0.013451185552 0. 0. 0.397015828795 0.0315660915039 0.710900933484 0.189198512858 15.8999065484 0.160971621735 0.00628354924211 0.0161321594066 0.0723294391078 0. 0.0117968393571 0.0236982978919 0.433978791462 0.0143668477172 0.00817272892114 0. 0.316429262812 0.0198151164693 0.153450120451 0.0773647680014 3.50455393025 0.0618333636644 0.166520883576 0.0976239406896 3.24864400372 0.0837585483462 4.31483949393 0.648545185882 34.2984034321 0.819405183509 0.266907960006 0.122705495208 4.9548758249 0.199588957896 16.6777618142 3.57079368656 -0.0124471120403 0.0272087327615 0.00155187404069 0.125233490839 0. 0. 0.00895158073499 1.06491980832 0. 0. 0.00715827430729 0.414147587417 0.180211554628 0.623836427105 0.241870122255 12.2059095361 0.00658301673438 0.0125565086887 0. 0.058709761226 0. 0.0151374969764 0. 0.0571779694018 0. 0. 0. 0.285486228445 0.0388450921219 0.0813947228349 0.0513523513133 3.2140738289 0.0593540209486 0.20347229722 0.0794482293815 2.69456850247 0.178836946955 0.472832758926 0.844501463372 14.1545062979 0.111742476081 0.237178456371 0.101985554242 4.60324813954 2.89376135367 11.9743180489 3.79180138166 -1.85192230366 0.0693790157141 0.106402926385 0.0608024713276 0.0436329895839 0.00107179024991 0. 0.00390362798834 0.0808916951667 0. 0.00433532953897 0.00866563775885 0.115681448961 0.00244887631965 0.0122927075949 0.00307380568859 8.32999782753 0.126029974553 0.460073198431 0.120793949772 0.115673876081 0.00271733825314 0. 0.0047754974823 1.70598507161 0. 0. 0. 0.178363763058 0. 0. 0. 3.00967295837 0.0788741164722 0.103306012195 0.0385900978126 0.0418440750087 0.000122216607141 0. 0. 0.136527075723 0. 0.00566931440696 0.00251708868497 0.105111201226 0.00419097275684 0. 0.00485924133915 -0.0549154541207 3.03224643496 0.0428847156108 0.133703532383 0.0202336985508 0.140949578231 0.00900894226931 0.0250639669303 0.0048425257738 0.128268392937 0. 0.0115912491402 0. 0.0827492946191 0.0160830178931 0.0111482505672 0.24141129768 17.0668338244 0.206414807432 1.00003095748 0. 0.311079374201 0. 0. 0.0145169454496 3.04001941638 0. 0. 0.0331464951668 0.127673716292 0. 0.00965378489659 0.0589629693926 4.9678210571 0.0571303284523 0.248965454673 0. 0.0493384833039 0. 0.00239893485768 0. 0.230692698695 0. 0. 0.0422766872909 0.0920739167052 0. 0.00133058864128 4.29048773271 -0.101517404125 0.0343491447041 2.27313430775 0.0554319415663 0.0210799624769 0. 0.0821407508018 0. 0.0329140841083 0.0175891419447 0.184042580709 0.0134375573067 0.0238409003486 0.0035029716646 0.0557026739775 0.0110516944291 0.449722568316 0.159306400865 14.0744663646 0.253068276327 0.0121885022963 0. 0.46176793784 0. 0. 0. 2.26889710649 0.0224957316916 0.0300941303173 0. 0.127312288213 0.0124284578828 0.147104057547 0.0639672848033 4.10550614777 0.0825088546667 0. 0.00813367565483 0.0729990890482 0.00689730236854 0.00599463654984 0.00116099561615 0.127372168082 0. 0.0374612069485 0. 0.0641437950891 0. 8.9067174944 5.26727004749 -0.0634587178075 0.164446070886 0.0389132563161 1.99737117863 0.00282180434061 0. 0. 0.0774665806316 0.00868272364467 0. 0. 0.14300480576 0.0283602289446 0.023588473164 0.0105163231084 0.108103678501 0.14614846102 0.666021762766 0.113838834063 11.0648283984 0.00197426866049 0. 0. 0.151913570895 0. 0. 0. 2.32294437496 0.0235773309743 0.00278112713673 0. 0.0949326087762 0.0380151845809 0.268793047678 0.0730886004517 3.71246743415 0.00918507483228 0. 0. 0.046609892172 0.000579927622744 0. 0. 0.246691875092 0. 0. 0.0121177322723 0.0858990441967 2.11327446775 18.4850191794 4.13292946501 -0.0454886898633 0. 0.00608734618322 0.0016151106611 1.98767482394 0.0527684920215 0.210535924194 0.0536827040618 0.0420252303951 0.00588687958894 0. 0.00066928368527 0.154395852194 0.0186920369151 0.0166574139067 0.00359586340379 0.217447880351 0.0227868287022 0.0421451566115 0.0208986894064 9.79650280147 0.141230586854 0.926171845582 0.120065761888 0.483172002247 0. 0. 0.00519099356137 0.715526565594 0.0222416221031 0.134580169449 0.00972160824641 0.0897851212753 0.00130881885851 0.0166280705267 0.00142630838426 3.27162515516 0.0628333601292 0.197931476966 0.048359439559 0.0588224129141 0.00505944834557 0.00615546676895 0.00148701250206 0.266009222204 0.0152178532484 0.0375628245831 0.0051968742038 3.10505375421 0.0921325112832 0.494869259187 0.057954196026 -0. 0.10375058827 0.00895116015077 0. 0.0488589220103 3.23100578316 0.102852989537 0.0992758415717 0.00335181630037 0.0273009328923 0.00169258214181 0.0021720572221 0. 0.232980339437 0.00106980475086 0.00264157628508 0. 0.26583153922 0.000454703033684 0. 0.257433667291 15.0764556279 0.475982048683 0.612573787407 0.00127451046421 0.854042044641 0.010430565389 0. 0.00892929688638 0.951084070718 0.0305638428038 0.0291998661887 0.0103191984664 0.128858289569 0. 0. 0.065182747413 4.50215646981 0.141527513151 0.149054910944 0.00381937078567 0.113453281622 0.001544157525 0.0163706083748 0.00216907007472 0.425752972949 0.015172048448 0. 0.090884506002 3.94010288909 0.0822907479248 0.143448913247 3.94613664994 -0. 0. 0.17631552808 0. 0.541360468027 0.191544494061 12.9177085683 0.19141559287 0. 0.0077944473201 0.150455878283 0.00425317702852 0. 0.0157869881978 0.441933004077 0. 0. 0.0027451427081 0.813018154846 0.00629319249643 1.82975513433 0.614583853488 51.1610794325 0.680185321452 0.680808083455 0.482636692887 4.63806009414 0.190710087212 0.0255917056117 0.0788586973079 2.51305147376 0.0223075594435 0.00821325826844 0.0118380563154 0.387025791712 0. 0.731484041325 0.285688609037 20.8451309518 0.274016052876 0.00281011791009 0.00386208802479 0.271546419145 0.00882315670346 0.00814020975936 0.0353938170827 0.810935235854 0. 0.719888232788 0.317147489876 13.0266914958 0.209522978429 42.3850162604 9.79461368788 -0.0087248402762 0. 0. 0.0388028267706 0.0544601295802 0.167312785248 0.128592356538 2.38092749378 0. 0.0136994402801 0.00208139452493 0.0426199782934 0.00783642738883 0.0384048442744 0.00683574723219 0.0935666624087 0. 0. 0. 0.143036392756 0.145858915325 0.559774631266 0.33719131026 10.2273191348 0. 0.0102269689265 0. 0.517426541896 0.0328635291206 0.129812799345 0.0471040742776 0.610397195218 0.000429440743348 0.011649854694 0.00926334868987 0.0765859221309 0.0363917814826 0.183338074344 0.124125168139 3.20750017235 0.00108884405549 0. 0.00709815195924 0.0494190173154 0.00181848086765 0.0479824177173 0.0093094534245 0.152251675425 0.0411876400152 0.292750010335 0.0548809377424 2.76386105945 2.22257855879 10.8628930542 11.1413927804 -0.0760250538715 0.00700421836525 0.00866648194089 0.00435986152497 0.0540827397947 0. 0.00391636097676 0. 2.23283740478 0.0477354909763 0.119722467157 0.0512077291182 0.0582828087579 1.84450841094e-05 0.0212705156613 0.00347637118437 2.3444294707 0.0387767742541 0.13871448845 0.0161289290258 0.404228283439 0.00670727864772 0. 0. 42.6257611554 0.196792049636 0.929369177618 0.221868715408 0.489384967201 0.0168388452585 0.0398846300782 0.00512133729322 0.141547888798 0.01482634149 0.0254244831056 0.0210919924281 0.052656552978 0.0045449028405 0. 0.00716446340832 3.97333759429 0.0632861016144 0.142570150692 0.0496143346137 0.0894119344944 0.00143211187454 0.0202383137864 0. 7.73808578168 0.269236099363 0.714173337151 0.148482271426 2.27460367338 0.0612555216636 0.506093630745 0.0397805658951 -0.00335948534388 0.166811362037 0. 0. 0.00163245648269 0.0869115764053 0.00145131831787 0. 0.0366620864637 3.60332218814 0.0569434943281 0.162544597515 0.0101552271511 0.0862933628427 0.00997209836899 0.00614153543388 0.0143543479853 4.36503411421 0.0404557851182 0.0829539975305 0.0279204536382 0.591301367783 0.00185763764181 0.0353923010908 0.707502598715 35.0815245817 0.426555047875 2.24727598232 0. 0.78485920919 0.0292031839397 0. 0.00180239766365 0.267951329933 0. 0. 0.022120304753 0.153353668133 0.000864485448678 0.0247743262171 0.0575696359221 5.18508259902 0.0736462414271 0.260305286917 0. 0.0968691355895 0.0138850315085 0. 0.138838219983 15.4052198753 0.211229746893 0.59906033101 0.0515508895799 3.32129727819 0.27694555062 0.169235739566 3.26958964513 -0.00315205571841 0. 0.119858587196 0. 0.00965168066826 0.0035616261757 0.172854630017 0.0111622195472 0.148179057638 0.0410147698761 3.03403380457 0.0541614715481 0.000563097911286 0.00489601991308 0.0940862857026 0. 0.0217924575442 0.0129881466992 3.25778010704 0.028965386855 0.140292613723 0.0293657555445 0.484832092218 0.0345007483117 1.88077579645 0.325730094754 34.7467555829 0.561059668728 0.0149027296968 0.004157980621 0.846966791909 0. 0.00260535739846 0.00911471818673 0.243798651713 0.00180356314893 0.0271269185037 0. 0.165004321262 0. 0.256825819514 0.106302800681 4.81357755061 0.126885076615 0. 0.00848265494272 0.154125731765 0.00945871747585 0.250541358334 0.119835918567 12.7448935237 0.0835390299321 0.403266783084 0.0841562495728 7.56357418722 0.074228113326 9.80967504055 3.27871254942 -0.0103556018408 0. 0.0011816109884 0.113633952737 0.0118785975884 0.0125379387686 0.0104722121626 0.0788538391735 0.0533571273803 0.168525336551 0.0621319164848 2.95416541639 0.00242580625115 0.00146091373886 0.0100088353982 0.0663269954569 0.025369860271 0.22434540866 0.0343720715155 3.46956439231 0.0131447148201 0.0215679445196 0. 0.405073060412 0.556475593543 1.67817531836 0.545977564286 35.7061721804 0.0116939219962 0. 0.0183565441501 0.460092201302 0.00074238992399 0. 0.00579123310552 0.191431140758 0.00108942651377 0. 0.00297715155179 0.0726203290199 0.0534914770371 0.244946229554 0.115786843235 4.52310415665 0.0183960883988 0.0315494387759 0.0220921785763 0.138487740821 0.1498026314 1.20488541655 0.374457402337 13.0091599938 0.0516036232577 0.0991638339044 0.272220445341 2.92620666289 1.97016748469 12.8367518412 3.06689854949 -0.125733907422 0.00436972047946 0. 0.00353647416495 0.154469830792 0.00266701849446 0. 0.00747470692383 0.0428772107152 0. 0.00651486169726 0.0038758756817 2.12423784206 0.0396390768058 0.119676126216 0.0613113344595 0.0934530446047 0.00100486685685 0. 0.0099634245887 0.255867138922 0.00432278305936 0. 0.0033608119693 0.709920584226 0. 0. 0. 8.76488154869 0.108747954622 0.443139983406 0.108862992226 0.0592114869062 0.0021774332275 0. 0.00310486942886 0.146282632535 0. 0. 0. 0.0932659832328 0. 0.00226265698012 0.000437508156089 4.17379919929 0.0813437704349 0.132209517747 0.0702854009238 2.40862742376 0.105698824568 0.178043076253 0.112608616225 7.73500464643 0.139203650826 1.69519019403 0.0810436611991 3.09662064828 0.0385681117838 0.111269521996 0.0489347359831 -0. 0.0609872263047 0.00933842716192 0.000948328196705 0.00374889004249 0.15253027804 0. 0.00952953880298 0. 0.0572009319937 0.00837445788167 0. 0.039770266434 2.41207882465 0.0293270824384 0.0921186610183 0.0023267112147 0.166351748457 0. 0. 0.00216144889003 0.575616954777 0. 0.0148745203406 0.0015650455934 0.679423704369 0. 0.00801061566315 0.145315119018 10.0943879764 0.149402556355 0.412657654327 0.0098602040256 0.0757051733271 0. 0.00455281594064 0. 0.147595745939 0. 0. 0.0110837912317 0.0745131511445 0. 0. 0.0561028712269 4.3424873055 0.0450383438033 0.159410591003 0.0585146883274 2.37207001639 0.0359509499726 0.111435198427 0.139595758963 10.3724187684 0.454590596885 0.57005580893 0.0887282266365 3.33992114556 0.0553897405699 0.22588766036 2.97958638551 -0.00884501661763 0.00822019802007 0.0567978754604 0.00153576505523 0.0229617810989 0. 0.413469077511 0. 0. 0.00113601739474 0.044920740573 0. 0.149636695726 0.0400778032714 2.29007985767 0.0437062887372 0.00940439830966 0.00173005848216 0.0763644279553 0.00198872511095 0.0318057542977 0. 0.959001128734 0.00686764151641 0. 0. 0.69893106591 0.00227248143697 0.431545896385 0.0834627522463 10.4903910182 0.146065626468 0.000137938557632 0.00373652129917 0.0823752461755 0.00739167528714 0.0129600361132 0.00022436885351 0.262261843382 0.00530115881603 0. 0. 0.140415389848 0. 0.238536586546 0.0597236814982 3.45822422879 0.0896154132005 0.0942643358202 0.0515910631369 2.61062231714 0.0494450785923 2.33496905686 0.373558427272 32.9662411021 0.412373005557 0.212265840597 0.0992654681453 3.89618387928 0.130112261982 8.22472527244 2.42902491323 -0.0340591581891 0.012593100295 0.00323337401409 0.0685872694336 0.0105214233326 0.0112649491742 0. 0.139366554692 0.00843066624747 0. 0. 0.04777707531 0.0625981591408 0.106881090187 0.0405634111512 1.64631472157 0.00949918338782 0. 0.000604291454891 0.114526662756 0.00372564611188 0.0921689564017 0.00746205552917 0.200492727878 0. 0.000282518921569 0.00466192088992 0.57052517656 0.101107481918 0.229025687261 0.137716530929 6.54507791785 0. 0. 0.00460225123511 0.0532545275311 0.00269316586069 0. 0. 0.107055482973 0. 0.000186005327605 0.0156408180693 0.0835639144202 0.0562034194714 0.152712853513 0.0782557471793 2.78045654664 0.124962081181 0.143982562493 0.0473902723691 1.60216771614 0.0746132290942 0.308205816866 0.464655090752 4.89934528676 0.0455440791486 0.127170079697 0.0816795449481 2.41190068084 1.8126811407 6.5182404037 2.72920933193 - -0.0357983654718 0.0146634321466 0.0209916853044 0.0241608300459 0.0196605104347 0.0113786862615 0.0029009138093 0.0163015785126 0.0225609755057 0.0145991965297 0.0181825729424 0.0164781957079 0.0186856678405 0.0130405682814 0.0179309987722 0.0240968720195 0.0181775551111 0.0146957289426 0.0210180199751 0.0178777837456 0.0179375335248 0.014026410045 0.00304930001685 0.0181980546371 0.00237235102112 0.00247910724881 0.00304553476624 0.00292174613484 0.0129216428963 0.016886060241 0.0212194293029 0.021001239545 0.0207025677211 0.0101079314077 0.0168739180256 0.0130368421188 0.0145312058205 0.0117191223335 0.00248094305692 0.0145761834505 0.0160538354021 0.0117605522361 0.0140380390381 0.0114567437712 0.0112780796487 0.0101486396189 0.0148519084459 0.0147005486842 0.0206773071958 0.0111337585868 0.012890738691 0.0187059909187 0.0197741432688 0.0160489156219 0.00237751747496 0.0226108300737 0.0197730187728 0.0145713864549 0.0179588059761 0.0198394530312 0.0208205335746 0.0208303362555 0.0183984258157 0.0360132307673 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT - diff --git a/PhyloCSF_Parameters/20flies.nh b/PhyloCSF_Parameters/20flies.nh deleted file mode 100644 index 67ecba4..0000000 --- a/PhyloCSF_Parameters/20flies.nh +++ /dev/null @@ -1 +0,0 @@ -((dgri:0.183954, dvir:0.093575):0.000000, (dmoj:0.110563, ((((dbip:0.034265, dana:0.042476):0.121927, (dkik:0.097564, ((dfic:0.109823, (((dmel:0.023047, (dsim:0.015485, dsec:0.015184):0.013850):0.016088, (dyak:0.026909, dere:0.029818):0.008929):0.047596, (deug:0.102473, (dbia:0.069103, dtak:0.060723):0.015855):0.005098):0.010453):0.008044, (dele:0.062413, drho:0.051516):0.015405):0.046129):0.018695):0.078585, (dper:0.007065, dpse:0.005900):0.185269):0.068212, dwil:0.259408):0.097093):0.035250); diff --git a/PhyloCSF_Parameters/20flies_coding.ECM b/PhyloCSF_Parameters/20flies_coding.ECM deleted file mode 100644 index 13c9a37..0000000 --- a/PhyloCSF_Parameters/20flies_coding.ECM +++ /dev/null @@ -1,72 +0,0 @@ -0.856979977161 -21.3799807399 0.243048702626 -1.07282632554 23.2891199352 0.417014024371 -1.70189173492 0.188155975062 0. 0.179377976204 -0.0606628059885 1.25594389172 0.0229550444473 0.00328435713687 18.1364766697 -0. 0. 0.566942262009 0.137821071867 31.7666032929 13.2859098957 -0.363302169127 0.3216200572 0.0779713622622 2.07370722097 27.2607785838 28.7642437906 21.1732174575 -11.2727606341 0.582021939541 0.450519061187 0.520525692578 2.87314674986 0.160184415377 0.0417616105268 0.392943810626 -0.197373806562 3.66356232072 0.129128041228 0.379280117156 0.326199666848 2.74555693992 0.150499848254 0.667770340927 1.87830419013 -1.86834815872 0.345363208373 7.04665342055 0.577755480658 0.355521388131 0.0612681556016 1.5212484594 0.479173384021 91.0051457762 1.3573969268 -0.568971981177 0.457370202419 0.104759904219 3.91042274811 0.352600386489 0.20108530169 0.150446124992 5.47395727586 2.78281874049 33.1384407846 1.6359111141 -0.796825184123 0. 0.0403648471502 0.101591604765 2.6530525349 0.199481018682 0. 0. 1.47135196603 0. 0.224999116277 0.0620080781057 -0. 0.416451433015 0.0365778147437 0.024970392227 0.100800143598 0.874204165608 0.130583286588 0. 0.141999370164 0.485936631223 0.110543922695 0.0881051473082 16.2840553339 -0.12641874075 0.065507193128 0.253613039853 0.0876476849427 0.354732481143 0.0224235730108 1.13456690845 0.205922054122 0.256670135609 0.0609082999619 0.993578689887 0.102531431492 2.2112993571 0.489455389074 -0.142167147587 0.0841528499849 0.00545185023752 0.468645974403 0. 0. 0.0245735447417 2.73514077321 0.0321517883643 0.0681718672235 0.190961252265 0.564971900021 24.1383229355 25.0045526655 0.960565154999 -2.61068586388 0.212857299965 0.0161926638881 0.436376510995 0.488945589229 0.0490126748638 0.0436777528509 0.118779224993 0.825672501796 0.248397282773 0.124449316407 0. 0.189414008686 0.0401485471222 0.0881524691569 0. -0.101975766087 1.1738270611 0.127110430158 0.28355571795 0.014758840992 0.189405643318 0. 0.108577951241 0.15192674656 0.262657678883 0.186613378152 0.243660589481 0. 0.103957104833 0.0352873054316 0.00482802362259 1.79658789534 -0.0314277315691 0.169819246298 0.71866826475 0.165419543032 0.0377534774895 0.0241395904101 0.254563562124 0.0674618895841 0.0993905843497 0.0137652380848 0.619525928607 0.195521335534 0.026722114036 0.0130894039763 0.151205759774 0.0269324846295 24.088796861 0.961987674941 -0.344940619174 0.305455398829 0.0709676514016 1.60031795914 0.0704789063483 0.0159279589167 0.0877851061075 0.250696459521 0.0910258661535 0.17314633403 0.0620955543552 0.22104611078 0.0349971452587 0. 0.0470746037141 0.110016087229 2.54181455243 40.8651006557 1.46068774674 -0.306136639675 0.0365068756611 0. 0.0217224466725 2.73433734021 0.110586423354 0. 0.0381219899006 0.151571445904 0.0326945160705 0.267764377037 0. 0.441539418948 0. 0.0665640592016 0. 2.58642595246 0.109367108497 0.14611246525 0.118659911293 -0.000573614519137 0.104253395908 0.0250383204733 0.0533636462092 0.073014643704 0.473103940343 0.257984331274 0. 0.00615865469376 0.150482492584 0.00442777476089 0.0945035122737 0. 0.251993614389 0.00524930812503 0. 0. 0.603166504243 0. 0. 19.5110085343 -0. 0.0326516117459 0.105921316773 0. 0. 0.218109844754 0.880892812609 0.0206567660033 0.135717490267 0.0100217453445 0.0691830645025 0. 0.265895553088 0. 0.131840210044 0.0385783794127 0.0903101309711 0.0618145555718 1.02475793811 0.0557339105725 35.1407733276 15.6280698007 -0.114378433963 0.0755380229992 0.0334696841663 0.234076002893 0.109622016168 0. 0.043579809404 4.14976553074 0.124020445748 0.0276682901455 0. 0.420860301583 0. 0.0337486778241 0.0482465610908 0.384833201848 0.259016000851 0.0333608744166 0.0967913002381 1.77059360242 32.5414384022 37.4249875733 23.6322118109 -0.76872051314 0.0518496635313 0.206790445458 0.0103357986514 0. 0.0648947518157 0.155573814444 0. 41.6367496355 0.00897871779297 8.10178576716 0.0463408459908 0.010090972335 0.0200177545988 0.0153924623022 0. 4.03988737059 0.223383788962 0. 0.346561611784 1.15593423028 0. 0.0565558183642 0.0376120984804 -0.176940860673 0.0966444861601 0. 0.0785592690521 0. 0.0772313331586 0. 0. 4.89241326509 0.483964741726 5.93138982216 0. 0.0179416028768 0.059548694535 0. 0. 0.101310940279 1.40994629437 0.043866333123 0. 0. 0.309580947376 0. 0.0507115815889 21.2902489182 -0.0629795298351 0.0473604696912 0.688318325575 0.0412159006215 0.168097795855 0.0101942613411 0.0337230410753 0. 6.16756316069 0.0735969582839 42.0857806752 0. 0. 0. 0.0832000654832 0.0846535128153 0.379681833159 0.263413123194 2.16045669637 0.351469470996 0.0788557433647 0. 0.826518430639 0.128090672973 58.0453855015 20.923641997 -0.076094298316 0.135288219525 0.091294048816 0.0922485327941 0.0209863103834 0. 0. 0.226369136758 6.18143228454 0. 5.15573649415 1.07125192286 0. 0. 0.00125691002419 0.0937402627757 0.189747523371 0. 0.0665289703423 2.24488710932 0.0379550972204 0.0159773467171 0. 1.01770296266 37.3377363307 36.4584471667 29.0745428077 -0.158160420516 0.0120556276078 0.0238578426229 0.0160045795938 0.492716547477 0.0131875041541 0. 0.0403949866778 0.453580964347 0.00926804861436 0. 0. 3.34467930183 0.162615843816 0.670668819393 0.285564105445 1.96192533786 0.0700417989899 0.0707320089966 0.121981173462 2.44581946984 0. 0. 0.0576424452148 1.16342540608 0.011075412755 0.158559659269 0. -0.0193224380447 0.0923148288235 0.00365268936531 0.0102066825968 0. 0.316452253978 0. 0.0163413226077 0. 0.0900658323965 0.0912448768615 0.00658190908684 0.689809618606 1.64922141668 0.179746039009 0. 0.115396665688 0.717152347661 0.0138497664298 0.0176041997189 0. 0.667969566413 0.0655661331862 0. 0. 0.418688777634 0.0945356085407 0.053164878132 20.4544469922 -0.00863512879095 0. 0.0369467829568 0.0019694946879 0.0365641334362 0. 0.13284384295 0.0243929829242 0.0517560523386 0.0189830161506 0.0335419847401 0. 0.137834606237 0.135640691099 1.08284486544 0.26921951135 0.0109947403896 0.0402028321664 0.514219812106 0.0267652516336 0.0695645290054 0. 0.494204070935 0. 0.04564276207 0. 0.466875712102 0. 24.3036054086 11.1181661776 -0.0665448209559 0.0548921830946 0.0255372736646 0.1507258224 0.0917147710424 0.108998077057 0. 0.714672482528 0. 0.0329706332436 0.143626874104 0.24454328392 0.454910519719 0.19417661262 0.486820556809 3.68990164995 0.330541181565 0.0645236037793 0.0890425798061 1.62529759913 0.0855851253897 0. 0. 4.55168880801 0.408631955389 0.0763223679712 0. 0.997577985124 33.009352379 41.648977566 14.3264529944 -2.36523488606 0.149863093615 0. 0.388052184684 0.52351318356 0.0445107931652 0.0361304571772 0.146675648637 0.99510305123 0.252054393805 0.140935161049 0. 0.18178207578 0. 0.0469925022234 0.0740502996711 2.51861283466 0.0877276849259 0.01053357318 0.170037651281 0.332126116503 0.0147257337575 0. 0.114800469765 0.249414968805 0.0054522238743 0.0234992906199 0.0284634729163 0.161617184985 0.0132888628625 0. 0.0387208308101 -0.101044364903 1.12349591734 0.0964056709973 0.2949678621 0.0362440735034 0.209698409121 0. 0.115482498535 0.138591958729 0.347197050615 0.153933364371 0.186391760757 0. 0.0478883109412 0.0165935750516 0.0401249768569 0.114390244071 0.49073782611 0.102735060828 0. 0.0353325854985 0.0724307861011 0.0317606016453 0.0186358072982 0.00708915904149 0.0667930926635 0.0365349171106 0. 0. 0.0491828806638 0.000975790213379 0.0211275510994 2.2053619905 -0. 0.125850443125 0.469382098904 0.107088504706 0.0211899645054 0.012870331311 0.184537424832 0.0724449792169 0.0673464126781 0.00496543008336 0.444779446067 0.185963125037 0.0352736521034 0.0262935981441 0.0696281314347 0.00380919013691 0. 0.0789108992446 0.80195467336 0.073867922517 0.00129773029579 0.0152333914511 0.123120315853 0.0284519012919 0. 0.0107614194593 0.150140280137 0.00385025472898 0. 0.00301557967663 0.0454687658394 0.0154784915455 19.7948511659 1.21145935309 -0.232011173528 0.189044125172 0.0671282746214 1.4109043465 0.0604442877758 0.00258249629862 0.0744724196011 0.297633359298 0.121744849668 0.0995804707507 0.0631436303072 0.346908534413 0.0238862732448 0.0141354459264 0.0184355860263 0.0442828901294 0.161643875125 0. 0.10663812361 0.54656952131 0.0150492508722 0.0294819232815 0.00857969312713 0.178824935467 0.0273276064468 0.01153190045 0.00718248290439 0.0860298814355 0.0105820559511 0.00157089298236 0. 0.0834596470596 2.70870019447 22.1270471209 1.31422399551 -0.50529296361 0.133370235344 0.0498469357135 0.0867569048185 8.82982471481 0. 0.106854987591 0.315354807755 0.937948880112 0.100630138883 0.0469600368516 0.108537395112 0.609587756716 0.107449051201 0.202699480512 0. 0.464926806749 0.0274366896291 0.0685629106518 0.0267324573674 3.59299923769 0.130531963383 0.0440063078142 0.395885476632 0.338260573182 0.0014435613204 0. 0. 0.436574638249 0.0363221474819 0.0508433777347 0. 1.75460515603 0.158313429179 0.10276476705 0.0621464281103 -0.0284461790952 0.212253431123 0.0262704624699 0.119807369257 0. 1.69439137847 0. 0.0238200232328 0.0499311140125 0.42812763174 0.0433483934406 0.0779343651887 0.124238771678 0.21961026491 0.0394061124296 0.00784799084073 0.0370027169509 0.0818947112047 0.0252533899205 0.021747647579 0.0113094179791 0.724512682025 0.134472285662 0.0310957722831 0.0167745448161 0.057197304014 0.0272889977886 0. 0. 0.204127343375 0. 0.0576450975873 0.0922046679477 0.353390774491 0.041312983612 0.042153189286 12.3630468079 -0.0608058541496 0.148482722226 0.207943699078 0.027915342068 0.208619559066 0. 3.91408287845 0.0952994427658 0.0239980660381 0.103208669958 0.542149892427 0. 0.00398056690156 0.180172992896 0.396999764442 0. 0.101691932539 0.0381385297924 0.286539177894 0.0133204803183 0.101634701266 0.219858353351 1.59519726774 0.231309758435 0. 0.0118070853546 0.270096461369 0. 0. 0. 0.125163131058 0.0331786840056 0.209190222596 0.181921325117 0.779148128217 0. 29.3362421982 10.5727352608 -0.104224724824 0.149896543597 0.0408462440613 0.351541033243 0. 0.0470545780751 0. 6.29767077478 0.0638605912434 0.0203328796665 0.17882849221 0.863911458009 0. 0. 0.0945005781775 0.716896467078 0.0594344511385 0.0112326757614 0.0486622115963 0.155235197328 0.170785316863 0.0397408684506 0. 3.70884461498 0. 0. 0. 0.198998766469 0.187561459576 0. 0.0383346884399 0.655329719253 0.204713395657 0.0710634862878 0.0957111473389 0.724858046892 21.5035212342 20.2117021205 17.0975384559 -0.243814221546 0. 0.108824678522 0.264420182206 0.364793101017 0.108006155671 0.0205920780887 0.170326493076 4.50859744421 0.269800396052 0. 0.173323615768 0.225395739418 0. 0.0520477021147 0. 0.284281705356 0.0953344886278 0.0515911206625 0. 0.234186592483 0.0289777763915 0. 0.161158840873 0.796843962108 0. 0.115827793356 0. 0.0987136739611 0.00029047619079 0.0112748855466 0.0121835662905 1.77155307137 0.0169763500914 0. 0.18823403339 3.31343536517 0. 0.101946039966 0.368466135555 -0.105733514394 0.55778792064 0. 0.0456698894765 0. 0.152841815427 0.0976274621557 0.114331444121 0.138690469977 2.07292580293 0. 0.0995490839043 0. 0.11553472201 0.00936734365735 0. 0.0639926611674 0.0711496517083 0. 0.072945462527 0.0165240972727 0.0563383181792 0.0301863217865 0.072033684696 0.0895041669733 0.234873522908 0. 0. 0.00334416438512 0.0658256490442 0. 0.0201119425472 0.0142221784569 0.796802944169 0.00644729862263 0. 0. 0.969675795578 0. 0.259312270938 16.7988341937 -0.123747011131 0.148762152389 0.448086643454 0.341823632575 0.34476022895 0.110877804612 0.468103639003 0.0517409316386 0. 0.472120665461 6.98729985985 0.569550979079 0.129146686061 0.0224600289171 0.282942379039 0.0547809756015 0.0529083010131 0.126121884865 0.464817592539 0.0563535784111 0.157848239294 0.0690716512742 0.284621038424 0. 1.26223251509 0. 0.425919459795 0. 0.021314959391 0.040206047527 0.10390150134 0. 0.474503890347 0.253280616196 1.80381788864 0.35821099567 0.457002815235 0.154061170371 4.27766696355 0.386090358293 47.9325619303 19.6808295645 -0.0940392483601 0.156428897336 0. 0.555747149715 0.265719451989 0.0591439377268 0. 0.388837541416 0. 0.092604306386 0.707672059766 4.16244419308 0. 0. 0.017844959855 0.191326971468 0.0214867140775 0.038793811958 0.0231011617586 0.178575314934 0.0264742042909 0.0665555390941 0.00974038240155 0.233148293816 0. 0. 0.312691113373 0.796448296354 0.0276668298469 0. 0.00576986511196 0.161257921724 0.0740679232858 0.0435058827918 0.0146785759452 0.935073559881 0.130985969118 0.150459907519 0.104142974561 2.2937251156 25.9167566891 27.9672543534 30.3671736585 -0.434058116582 0.0243009357809 0.0664865836138 0.0549805741932 1.85695152847 0.145837441361 0.119526026661 0.451736279288 0.93810077143 0.0667330549159 0. 0.0784036993055 9.77530236961 0.436725089765 0.58316203681 0.977490399744 0.341726863473 0.0390561119246 0.0380593521652 0.0286543721396 0.781823693643 0.00218133774376 0.0685003177396 0. 0.271085249245 0.0104602785429 0. 0. 3.47120842402 0. 0. 2.30786650813 1.50791862083 0.0483963919454 0.0300621606704 0.0735252786412 5.61717661886 0. 0.634793867133 0.742661472684 1.55918666263 0. 0.841314002074 0. -0.0113667677619 0.139097021802 0.0266279055959 0.0649110059928 0.271165225002 0.356374200249 0.462447049335 0.0812554110799 0. 0.261906579666 0.214962406813 0.150876194512 0. 4.85246662164 0.112885739127 0.128479081658 0.00382441531228 0.0963471511583 0.0288968160516 0.0380575513004 0. 0.460646796364 0. 0.0526747725656 0. 0.0635182874082 0.0624795281108 0.0496585258215 0.249922297538 0.880126512364 0.104923430442 0.0475178691005 0.0469942044593 0.377726315 0.02396015719 0.0058029211923 0.400818155317 1.88399437755 0.0249683518635 0.276514482787 0.0333431132158 0.479895695338 0.0844193920514 0.0624254941258 21.7592101953 -0.0331799427383 0. 0.0666993209566 0. 0.0659147301184 0.256960995461 0.286462654957 0.0701466885296 0. 0.0107854883592 0.295165736711 0. 1.21447464954 0.180018476203 1.01556150887 0.426925008475 0.0425154209715 0.0198069960443 0.0949639914014 0.00626698048332 0.10953938333 0. 0.300853421045 0. 0. 0. 0.0831189682586 0.00455574777414 0.229147001649 0.243060751563 0.659201322877 0.00153006753369 0.0140756082878 0.0077442567221 0.264077928925 0.00835488167252 0.342760335106 0. 1.80433636682 0. 0. 0. 1.1713441614 0. 31.8153346162 13.500934857 -0.0753651521978 0.0829572682127 0.0469876926104 0.213057044827 0.276108755483 0. 0.205795926871 2.07448463232 0.414603494325 0.108654113555 0. 0.42829121982 0.438401644702 0.326753757929 0.233179693471 7.21268221952 0.0721202274211 0.0136132175223 0.0214700972484 0.181444564043 0.0226930454947 0.0998250535633 0. 1.02344251681 0.27821255631 0.0066081187679 0. 0.0411768797912 0. 0.18792017758 0.056173201874 2.58754316069 0.240544111649 0.0391893694734 0.0120639862744 0.591089276474 0.41302815344 0.0800084271644 0.145503183728 5.00734758378 0.188951138852 0.0153168225304 0.00275019000738 1.24518227851 30.5503637373 34.0462233841 18.6930893112 -3.5612805718 0.185576667155 0. 0.261882000557 0.552498356896 0. 0. 0.0454188913343 2.18033142306 0. 0.913055260815 0.148167561548 0.979499033508 0. 0.0276967036387 0.0462666186648 6.87550522201 0.409269139199 0. 0.385739048816 1.2307998883 0. 0.175887843684 0.0906161829493 0.735716867884 0. 0.600993186416 0. 0.729833033914 0. 0. 0.026483433212 2.74504384982 0.155811527469 0. 0.123461266078 0.427731161393 0.0289604446028 0. 0.0303196385124 0.493373112815 0. 0.222411828762 0. 0.699369865327 0. 0.00201358602267 0.0716169942232 -0.104325456084 0.463481189267 0. 0. 0.0326564812186 0.0193838763331 0.0364109108089 0.0460004723167 0. 0.098968148224 0. 0.0447017063462 0. 0. 0.0257930407901 0.263414933857 0.206483480307 1.24027101417 0.00160980668212 0.258419493927 0.0376900584074 0.045732253611 0. 0.0414234180165 0.064309867278 0.0667778675875 0.0394817700222 0.0782429690108 0.0462470882557 0.145607151232 0. 0.124089860161 0.120025598718 0.113313102447 0. 0.0293429859405 0. 0.0944873791495 0. 0.0538686904815 0.237650500843 0. 0.145663879182 0.0422859300375 0.0328957650127 0.0011783331156 0.0268609220906 0.109848171138 0.708962533642 -0.0440826539721 0.183543317224 1.31985453104 0.29760797105 0.0134450303614 0.0627229514106 0.31279883249 0.0806111169421 0. 0.157442294141 0.297999910948 0.109689823 0. 0.282760962173 0.218720526434 0.0560052611502 0.251959973649 0.420273990731 3.41918753696 0.491882578276 0.0896406707367 0.186494631066 0.439708062254 0.197947369192 0. 0.497223431254 1.2424461357 0.258879085594 0. 0.00808306260146 0.0470148067102 0.17542811997 0.0509391703359 0.148001904375 1.04860067906 0.194814679614 0.115927749447 0. 0.449370327984 0.0200324395713 0. 0.0892899979766 1.23078140878 0.079658732789 0. 0.0477979550569 0.168444216083 0.0449592501719 352.932298864 0.757542891626 -0.0260133112348 0. 0.0533392790958 0.709830630177 0. 0.0772589390514 0. 0.102456250928 0.164849778116 0.0404640512768 0.190001520841 0.135220074865 0.314847205215 0.153220567324 0.0365803390517 0. 0.060206598525 0.364682449198 0.133569747889 1.93244338701 0. 0.0246104772359 0.0254103916945 0.227563058626 0.0076539393152 0.0631550795105 0.0293457012601 0.108828143742 0.0226945449551 0.0322923760681 0.0514989763176 0.297520720886 0. 0.0872796679636 0.0728170451125 0.210120628582 0.0723105238391 0. 0.187833239399 0.0353299664323 0. 0.176256670958 0. 0.0721598798001 0.0450225348449 0.13074927379 0. 0.0585416392465 1.78059816087 39.161107698 1.08904133074 -0.32285906089 0.0859967474225 0.0561149741506 0.0997333958055 6.22297209977 0.0880669876225 0.726694491183 1.01646558779 1.08531977553 0.28612993001 0. 0.315673439399 0.410167922953 0.131920417886 0.104283886065 0. 0.778552681658 0.0466109104441 0.0770193625443 0.0954793310376 5.88489430467 0. 0.189290015679 1.20033163478 1.04257180512 0.0240800875658 0. 0. 0. 0.258693504552 0. 0. 0.410407385613 0.0417471510459 0.0229055164516 0.0633805100821 6.20291445659 0.268643999351 1.00503843064 0.172686305629 0.447784867539 0. 0.134286796325 0.220374931404 0.988209249538 0.132976168404 0. 0.323609598337 4.25915133684 0.0849966076834 0.374585594363 0.00669084346932 -0.0592120190495 0.317137404498 0.00996511224837 0.024970726587 0.184469819546 2.22580329794 0. 0.361810497613 0. 0.982607661126 0.136268953756 0.2043280624 0.45640423584 0. 0.0106817429255 0.0328444321006 0.0648093172502 0.237096986804 0.0178648037634 0.0197756543926 0.0919299997176 1.2554947586 0.164755867238 0.454088869701 0. 0.112459471987 0.0808505600423 0.0371170702525 0.169759857654 0.2913277705 0. 0.237002712084 0.0475003073893 0.184783472255 0.0192972493559 0.00777830381048 0.314901795686 2.11204235155 0.159218972699 0.385608776687 0.0617656827024 0.219401023947 0.0421932203634 0.0692095788129 0.0936204368 0. 0.21065062495 0. 0.146933837691 0.28561463973 0. 0.0412013552127 21.1669501142 -0.0214242844445 0. 0.0890509476222 0.106347387581 0.50477863564 0. 3.09784136779 0.0459525854663 0. 0.165204710987 0.445843862583 0.278213722528 0. 0.210736910449 0.177706552924 0.0380595760919 0.058570696183 0.0201420132449 0.258429258273 0.0560705901873 0.0251972854114 0.140893674403 1.42610603808 0. 0. 0. 0.317799605587 0.0506989312525 0.255831368443 0. 0.0806293001956 0.0168824151148 0.00475962470686 0. 0.0971995733402 0.0437031245498 0.500973292004 0.0774839884335 2.90438537811 0.202071520986 0.0937165711889 0.0216420775447 0.46085520615 0. 0. 0.386212730776 0. 0.0439111871227 0. 0.00142019617832 1.72372488346 0.00353564686792 39.2916179068 18.2449713723 -0.12772333616 0.202937477234 0.0456262887699 0.384240827481 0.750471298595 0.566716666735 0.329482300209 7.9730276104 0.348733256117 0.416616268506 0. 1.60604961709 0.153626160452 0. 0.051816532713 0.517553659832 0.191648788308 0.0783717598123 0.0620273916294 0.517147043007 0.757054829915 0.271320901834 0.0610169937309 7.83805440567 0.26049598552 0.0116099054579 0. 0.271192109703 0. 0.269401620363 0. 0.869217204478 0.173886539068 0.101559401417 0.0513360463705 0.25313978055 0.814021622311 0.542152688427 0.661009268928 6.26229632635 0.0789158873422 0.140136062493 0.459696135584 0.449218526527 0.242718586153 0. 0.036411591094 1.15509068397 0.3893585454 0.0424108621429 0.560890848122 1.09144238728 32.8955493322 38.4940460748 24.077551687 -0.892146421339 0.105792977881 0. 0.203727471191 0.937054097698 0. 0.11392298206 0.0306223345718 9.42292304392 0.368889170803 1.66077364659 0.579325085445 0.114146365789 0.149157964404 0.0775871861269 0.0452777917467 1.87236487125 0.253819545628 0.136018977537 0.389932585883 1.67509605282 0.0552503571781 0. 0.161064385475 15.4813846104 0. 0.20972813964 0. 0.675574459504 0. 0. 0. 0.942992935462 0.141984025502 0.0271301662091 0.0830153582675 0.959015469118 0. 0.279990642381 0. 5.26272896639 0. 1.3089471879 0. 0.932609036265 0.0129723246839 0.0293439782823 0.0631589397541 280.629762483 0.33921123514 61.6326568199 0.574254177642 6.51206780811 0. 0.154805300534 0.571105398762 -0.0543459569035 0. 0. 0.175082894371 0.0300029311488 0.152289336153 0.0213642624993 0.0474803694279 0.272378780882 1.11185426229 0.195192906777 0. 0. 0.0422434128828 0.0236417440157 0.153894931667 0. 0.159478557231 0.0581249296853 0.0888637596587 0.00774711463909 0.0797019570098 0.0220358018891 0. 0. 0.788772412095 0. 0. 0.0125193864137 0.157865057283 0. 0.053199968005 0. 0.103059554852 0.0214087156837 0. 0.036253294775 0.171112602984 0.0185506897953 0.0201440173115 0.180508780553 0.379647848599 0.165082219653 0. 0.0387162959041 0.17589011491 0.0166076794048 0.0888466997722 0.278144013414 0.516232169639 0.134276520095 0.0356284139123 0.110707261879 0.765365154596 0.0484784571802 0.105517140489 1.956996971 -0.0426453273696 0.0191205668943 0.0368964641593 0.0195993734266 0.020426687841 0.0071332799582 0.052440437308 0.0188225003564 0.137720655499 0.050220433979 0.791577703309 0.0569744636126 0.0490397005783 0.0154243449821 0.0854117057841 0.0247958613472 0.0837332655223 0.0474247246812 0.120026567666 0.0690972261089 0.0520473599944 0. 0.0770543128608 0.0275746063381 0.105528767172 0. 1.05765165507 0. 0.0503584622369 0.00540933675393 0.0512677354683 0.0567514547181 0.0241550573068 0.00713138366743 0.0322524761285 0.00510242031931 0.0275438433454 0.00454715835838 0.0660427342198 0.010682243118 0.066443063198 0. 1.06220346525 0. 0.0369033385963 0.0104664832187 0.053823143186 0.0247144334391 0.396443415435 0.162886463316 2.81533142291 0.303786834202 0.122329738726 0.0197654206404 0.301045311419 0.0927439142057 4.07574873867 0.297231398254 -0. 0.387694492842 0.0566264290759 0. 0.0420389430627 0.0372263203947 0.0284009571392 0.391280067504 0. 0. 0. 2.62120940939 0.235208821229 0.174126629446 0.0377333685393 0. 0.266507634665 0.140780997735 0. 0.274461791044 0.024251685869 0.0123437067252 0. 0.42174418179 0.386142599092 0. 0.280878402933 2.26656277487 0.0668300289241 0.00484107193822 0.0120421621438 0.467512964536 0.140861595319 0. 0. 0.152886951063 0.0726618429342 0.00881337066215 0.0765283799663 0.323564236667 0. 0.104293437079 0.0656777320123 1.27568533433 0.0936900727309 0.114534588299 0.0388409803721 0.261207870269 0.539598476857 0.057248937284 0.709959826108 1.31873341905 0.149748324813 0.0137692137083 0.021682240931 2.67377221412 3.34744003832 63.6215057037 0.552099970733 -0.262658101564 0.0330856130484 0.0318435467419 0.06434557919 0.956294914676 0. 0.0362010379979 0.210563484821 0.649823236136 0. 0. 0.178067726788 6.14046266775 0.484508818038 0.969822459383 0.0908273537571 0.569261086804 0.0475523632477 0. 0.0356114691876 1.12898507341 0.0473037858179 0. 0. 0.60621623873 0.00374427661168 0. 0. 49.6159095859 4.68022066218 5.91403524205 12.128423537 0.343023643831 0.0170291972708 0. 0.0286948987936 1.10355826045 0. 0. 0.247628287953 0.256927506886 0.00389918558072 0.0386987944657 0.0462994870786 4.38167122112 0.749142928044 0.326128125834 0.155704509341 6.93877030376 0.243950655216 0.795264519656 0.219296014971 6.28903338562 0.253404687172 0.350852805934 0.514188082347 7.10336662893 0.17185837391 0.250117723726 0.310340196655 -0.0836251079889 0. 0. 0.0759521765583 0.025061096046 0.128763746911 0.0365471490099 0. 0.0513270168229 0.115390559489 0.0136726811189 0. 0.494123395556 0.738187904377 0.113320681627 0. 0. 0.172946985827 0.0634101240401 0.0303155000782 0. 0.113804414616 0.0536675968956 0. 0. 0.0934146779956 0. 0. 0.157608968678 1.11946201469 0.163383148328 0. 0. 0.0151230114653 0.0171489957776 0.0145945353819 0.015584347954 0.11246152727 0.0672202658176 0. 0.102939183862 0. 0.0860115508942 0. 0.0968596103594 0.564102323427 0.0442859710728 0. 0.114886652857 1.58908101447 0.0640408949033 0.904737091043 0.0464952209978 0.55079298779 0.0350352055003 0. 0.223792473206 0.138240250676 0.128815431027 0.47979472309 1.00317623422 -0.0291577441272 0.00710949998472 0.0678309421565 0.0296178528991 0.0382507639617 0. 0.440552472665 0. 0. 0. 0.41775879454 0.0882600115553 0.481363126311 0.40262892409 2.18167671879 0.22263115552 0.0849711406145 0. 0.121560618927 0.0125624650954 0. 0.0428371422818 0.191018400085 0.137560451816 0. 0. 0.250171892144 0.0477011893207 9.6100077808 4.83686618095 20.5612112307 6.14952831179 0.0434614128121 0.00814219912045 0.0536473772114 0.00722447169821 0.0567220784066 0.0346109731334 0.477257172205 0. 0.0159230494094 0.00672775637493 0.312424461243 0. 0.926206563236 0.170008698136 1.00901362295 0.595253476155 0. 0.0829218608049 1.88426764212 0.0861787526896 0.826858434307 0. 1.08578916825 0.406345336454 0.693518216334 0.0723512495772 0.686787071396 0.139318568235 37.7467182911 0.407872757386 -0. 0.118017675903 0.0516491740649 0. 0.0245749501147 0. 0. 0.515743121688 0.00349160199675 0. 0.0461156753177 0.227277037273 0. 0. 0.195669278198 1.81813346514 0.222473192805 0.0396850438219 0. 0.267936923992 0.111696900826 0. 0. 0.551653259568 0.081951854164 0. 0.082737441961 0.133720495134 0.299280716335 0. 0. 3.68142435956 0.070474856968 0.0253494371084 0. 0.0186977483264 0.0484115177612 0. 0. 0.364949634323 0. 0.0637057162944 0. 0.118085161486 0.136351224149 0. 0.0098593477854 1.37279032042 0.347644700635 1.0187663532 0.267201375923 2.77745201989 0.207254836317 0. 0. 2.06876811139 0.505268712448 0.346609972923 0.303669059181 0.251430422297 3.04304016233 34.0403102714 1.13479757826 - -0.0181562543195 0.0237541470812 0.0374678167352 0.0229356112767 0.0128689037304 0.0198976366858 0.0146655632375 0.00919594319685 0.00472893318106 0.0211913632303 0.0055799304347 0.0110186011298 0.011298864648 0.0212572494848 0.0236085461411 0.0174040193786 0.0162290051584 0.0148443207067 0.0353528716219 0.0119611294267 0.0135951768286 0.0180305546134 0.0153945069058 0.0065457378099 0.0078695600931 0.0191529378739 0.0083646520671 0.0103291428757 0.00819577204868 0.0151009637038 0.0395263872133 0.00821847799094 0.0207915459753 0.0230931017409 0.0422829154308 0.0282726539789 0.0135792875468 0.0329056051667 0.0141017924951 0.0139740807157 0.0140824034252 0.0275383935595 0.00496476036542 0.0118834390088 0.00615824907675 0.0144300896903 0.0275466491572 0.0105317037816 0.000922468535899 0.0174195794121 0.000696348080875 0.01351829124 0.0078555121632 0.0176405660316 0.016049381888 0.00653336051055 0.000634022586315 0.0136299552106 0.0103827981635 0.0061971613548 0.00498147886533 0.021300710268 0.0173922639928 0.014968849752 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT - diff --git a/PhyloCSF_Parameters/20flies_noncoding.ECM b/PhyloCSF_Parameters/20flies_noncoding.ECM deleted file mode 100644 index 6b40287..0000000 --- a/PhyloCSF_Parameters/20flies_noncoding.ECM +++ /dev/null @@ -1,72 +0,0 @@ -2.60522165174 -5.52510067718 3.46892355586 -2.06752205896 4.87084817478 2.21791845944 -2.3195381658 0.29942855373 0.528228212208 0.26648971101 -0.330068073364 4.34832138922 0.432834075405 0.566200533823 4.59841842144 -0.552416252538 0.261795105 3.90539440681 0.215698594141 8.6764671226 4.28639980545 -0.295548791599 0.827336939107 0.393001102173 2.30234170923 3.81729458011 9.33029881664 4.31982049419 -5.82573631847 0.801834999525 1.86182286498 0.602393752325 3.81311102277 0.474788400945 0.721304810831 0.329054451704 -0.595892512437 9.69926539657 0.842946055917 0.971814913776 0.399337020469 5.15799117581 0.236792300614 0.73713375116 5.37263336106 -1.05273301983 0.621797096011 10.3561262134 0.615594998571 0.720352431384 0.636012240368 4.08598201643 0.288342417197 12.6654887488 4.68843038831 -0.511007461668 1.27482190234 0.770931708347 5.14006094873 0.263064404428 0.72057905066 0.31199670561 4.78418938995 4.77782550368 8.79650954363 4.02459238797 -2.45614751139 0.368323546282 0.896011440009 0.345330822663 6.38445607882 0.812447241133 1.22688836396 0.89846227661 3.86123785872 0.054624957844 0.807672411047 0.284218649159 -0.297071771517 3.3301080317 0.294244712813 0.594387565738 0.630325090791 8.22791956827 0.60941585104 1.39405066498 0.518559738627 3.74891441167 0.432486622264 0.886834747439 3.57278649553 -0.491952797003 0.211319243882 3.22926300477 0.288114933896 1.46193024122 0.664041941702 8.73877116939 0.711829787348 0.610050659555 0.26177882384 3.52009446056 0.282194809626 6.51970381022 2.46888502102 -0.270311769619 0.53701253113 0.253466034556 2.07899632569 0.389073083667 1.18867330633 0.366846269651 5.2275473054 0.266988648959 0.45562665342 0.293347630878 2.23924111386 2.99584349371 5.01115562509 2.53862842844 -2.54429183679 0.208897902088 0.690631250814 0.202027264705 0.244791690551 0. 0.102010744231 0.068623129321 0.718867473979 0.0861791543005 0.200678256294 0.0277198677359 0.358710455289 0.0198590262246 0.0727513233457 0.0181667907683 -0.205741251989 3.54878426463 0.282535784093 0.442820226573 0.0371097332821 0.472702213865 0.00924159247056 0.0270547897495 0.217166271741 0.809157527615 0.0731064332526 0.167555106759 0.0823809711156 0.233703673635 0.0507150524041 0.0118325287932 2.79594212608 -0.454462784752 0.221619695452 3.94980098948 0.192503544533 0.20057130093 0.110679640482 0.366954674621 0. 0.294065885262 0.0422692166612 1.19442307203 0.136885521587 0. 0.00705222137801 0.38732889744 0.0336198621798 7.61431848979 4.1790760497 -0.250017930855 0.600751819008 0.2532882811 2.48072248044 0. 0.096910416293 0.033071836568 0.3330380543 0.106896588224 0.221471925649 0.184154952423 0.71515124614 0.0787027589041 0.197544782653 0.00291609470126 0.293131845465 2.57577732798 6.94208324896 3.27585074853 -0.267538861181 0.0782973620584 0.140990405947 0.0415135512486 3.26788735517 0.391466887355 0.584485074743 0.223924105786 0.53967272806 0.030939550127 0.104490034188 0.0907393878631 0.706815630064 0.118344611019 0.181283524607 0.00908489560399 3.65214779623 0.43161700393 0.963510202506 0.268388623877 -0.122528796445 0.403492967439 0. 0.0753976110614 0.345763756346 7.95722267283 0.351981375839 0.660662480024 0. 0.519980399021 0.311961640455 0.087688748179 0. 0.665982021083 0.153361405173 0.157150510133 0.289733588913 4.91280159829 0.597746315167 0.783123601521 6.85421562286 -0.157896529141 0.125849840503 0.258837222819 0.0262407555021 0.546585213019 0.250136220871 6.1023022464 0.27858435627 0.0965962927904 0.0837203126736 0.41309497354 0.0651975505063 0.167610924662 0.0863019690749 0.523540972714 0.0356231133228 0.524246028168 0.427565464426 5.77089638668 0.309151292801 14.7964854058 6.03102821436 -0.170436883784 0.101171673737 0. 0.235477601463 0.290761451767 0.986145223945 0.298849243214 4.18240167889 0.0838301866341 0.217688815126 0. 0.367784454716 0. 0.171407551321 0.172665624586 0.622087066397 0.206350807788 0.679113628723 0.477771364745 3.59103421041 5.56204335797 17.2297122913 6.90886230132 -0.637707469457 0.0980845253209 0. 0.0386222159964 0.23291610923 0. 0.133387182059 0.140114698057 6.19099261505 0.286769228317 0.917424235416 0.222350439907 0.196014430766 0.0438704080348 0.171320870319 0.029495951056 8.61610724776 0.740338142792 1.897591966 0.504461228772 3.89883392169 0.303737900124 0.940750518231 0.582602259878 -0.0552030861191 0.406515753038 0.126757954568 0.17902632355 0.0429018761926 0.167792025667 0.088308826142 0. 0.397029203581 4.18595899237 0.361569523204 0.629291039745 0.012095057946 0.218555477593 0.0338811067771 0. 0.714975070526 9.88809944498 0.73947683568 1.01131929346 0.212139146705 4.47739869358 0.282032128892 0.788958556228 5.0147010624 -0.142317397722 0. 0.858132236596 0.0524028347981 0.0845413370276 0.223285798859 0.477504820704 0.0313574645896 0.741621629651 0.381515213112 6.79910727345 0.185605422378 0. 0. 0.307194239723 0.0334611209093 1.51778663185 0.633300960636 12.5139215776 0.52321566535 0.907058407988 0.803636621863 5.54890362758 0.353466300082 11.6791489514 5.62326450239 -0.0632604351817 0.293940871922 0.120172031706 0.408175611648 0. 0.168880218778 0. 0.226461793393 0.424688374337 0.644519008495 0.35940974446 4.21139730687 0.0533289483047 0.179151278901 0.0389341139928 0.233983621214 0.450540732963 1.44704264599 0.891610313991 8.79731335796 0.453587541817 0.501626596963 0.419745943993 4.04719461146 5.37510573152 11.5732278696 5.93235816792 -0.271934817808 0.0220389805083 0.360919166698 0.0306140044835 0.752318321992 0.463319481404 0.0237920653271 0.0472648305889 0.410951022594 0. 0.206617433612 0.0490180837447 4.19715565416 0.331859055831 0.636355522299 0.327688640142 3.84097030894 0.240503800507 0.665107401131 0.398453372736 9.89885147868 0.797924695707 1.41658091675 0.962105284807 4.14390656934 0.185723871788 0.927757405015 0.447505455533 -0.0441422651003 0.351697700152 0.0540161434958 0.0395732774663 0.203771372951 0.550631712994 0.174017431879 0.41203269941 0. 0.58734824068 0.119062840479 0.144323912746 0.232310518672 4.00520653295 0.346972105194 0.468054735393 0.25509398801 5.26566329901 0.623159418873 0.565609802428 0.854434133855 14.9117484413 0.845802974661 1.85608265587 0.403055949032 6.4442609397 0.519341640143 0.848589689817 5.39834773416 -0.0732180070149 0.0968521775348 0.228828756215 0.0184219094418 0.135688516825 0.0237881831167 0.859989660933 0.163967324751 0.0963793084962 0.050979981086 0.468537052022 0.0523032717653 0.495209908214 0.192641952809 3.0982481819 0.17865921222 0.416996695586 0.345414736546 5.03705465074 0.330159736313 1.67298903994 0.841108082877 11.9450323105 1.20722675626 0.740920305434 0.26598753344 5.3213295419 0.35148359416 11.7501313957 4.96184490401 -0.0221615561397 0. 0.18053780639 0.232847292427 0.0886419985582 0.311519768132 0.0782740903323 0.768657876222 0.20478676049 0.104330422709 0.0149957938401 0.355174837782 0.401325655323 0.669743397933 0.240594251687 2.21617894499 0.239479204102 0.463301114039 0.257639362336 3.21848934944 0.614917578254 1.24161518748 0.753701089267 10.3962486969 0.4724551404 0.72561003943 0.346683864076 3.8853095069 4.48167836817 11.5738315211 3.84920008886 -6.46152443068 0.688877807506 0.907244785869 0.467331091131 0.611857479133 0.38000697963 0.274957472129 0.0417115243384 1.78039895393 0.0931120924274 0.92558963629 0.11139615157 0.719672704195 0.108813780714 0.14630642316 0.108187658319 3.08393052516 0.224878585989 0.620023085921 0.308954907803 0.492547578464 0.174234124077 0.0130567187595 0. 0.675106424614 0. 0.254520863205 0.206575237598 0.501861233193 0.157443454569 0.0158713688637 0.0253774110209 -0.383814344165 6.97508651301 0.535744016959 0.869608553356 0.125634803092 1.1992165745 0.0482168945747 0.166215809035 0.385867165096 1.79183536119 0.134729159035 0.42852869417 0.0405646931802 0.896198342106 0.110650667529 0.062369015921 0.167364953657 3.41846809715 0.263196922934 0.481586151241 0.062064983602 0.31960756476 0.056698891866 0.0686419515445 0.163067764246 0.637468886748 0.0931119682843 0.152959353192 0.103874145219 0.320755915959 0.0585407497123 0.159114390453 3.3705044899 -1.05022340326 0.581026804078 11.2240678679 0.470465861776 0.317218721951 0.0630525248766 0.778161858589 0.181788766574 0.277449520997 0.361212044249 2.08515796396 0.43619236315 0.452696901317 0.173696696033 0.642502390054 0.0404014311909 0.682778351182 0.544672566316 5.21922208324 0.355151721135 0.107162523901 0.062248643198 0.663306402484 0.19162270899 0.522764714146 0.0335688758657 0.782763482094 0.163106673887 0. 0.0465122608892 0.585116516325 0.0171956340661 9.69575537066 5.40056188954 -0.463555302185 1.36885645104 0.629145708589 5.01894573147 0.116251331227 0.0907081671292 0.202939025922 0.905680697885 0.304403966397 0.432168130854 0.187380395451 1.35467307484 0.114572366551 0.0821882529413 0.176377339242 0.592215505168 0.305818323259 0.543871427782 0.216286614077 2.53109375099 0. 0.153558117059 0. 0.542581004971 0.20674612679 0.192504536483 0.0298525823301 0.547588985676 0.0805929436176 0.128518226387 0.0298694150466 0.255215461869 3.37416853428 8.46230911018 4.07152778919 -0.480383982717 0.113564278539 0.255623640736 0.00307653945662 7.39516897953 0.599690149253 1.27957922996 0.551895856538 0.710140444653 0.11711866548 0.203456778477 0.0768765888675 1.03022447997 0.13889393181 0.360875415287 0.143429116955 0.192790074292 0.0229978012169 0.0474128199143 0. 4.07431891567 0.348455094593 0.615092758097 0.2789288752 0.231998468985 0.16665458539 0.0999114485727 0. 0.545458431919 0.140425511194 0.252964601793 0.0641235109003 3.45150022822 0.25341181581 0.85537272809 0.336373802126 -0.0498994970469 0.659298255503 0.120756811598 0.110625856911 0.499397078742 13.156694884 0.527902627276 1.17450655751 0.0979999890977 0.783058133349 0. 0.234245741379 0.242028577174 1.27297503647 0.198144716023 0.226456646017 0.0392688783335 0.310112026688 0. 0.0478714335742 0.362254930416 5.85652628067 0.393384006798 0.85767141986 0.189282416135 0.204461461925 0. 0.249713282975 0.063213200208 0.772616833904 0.0880407062257 0.0621511474181 0.267377413205 4.93887836005 0.75208565002 0.499218431241 3.95581023001 -0.178490254361 0.113243779052 0.680601416525 0.0123851259926 1.07307674091 0.663960519495 11.4793867882 0.595067811349 0.255354019327 0.112138018559 0.72108127423 0. 0.2947402588 0.171527002844 1.04678252153 0.166942144533 0.0207482608192 0.0515545866334 0.294103848407 0.00675470149663 0.722558600771 0.21081306386 5.61878406624 0.353707057708 0.143153986138 0.0295066441118 0.27082080531 0.036527617573 0.392923461837 0.0543021739285 0.73796041319 0.111898158653 0.607469043142 0.42658669437 6.48078550527 0.214897870972 8.25817958502 3.64643404483 -0. 0.208975293263 0.113922477378 0.454907336945 0.527947416158 1.52290075472 0.499491662628 8.81867782892 0.162144537939 0.176899300708 0.339150496892 0.68155736895 0.243904893911 0.392613238257 0.235077576555 0.989929641162 0.0598904480749 0.0274939063586 0.0573185360404 0.220558213277 0.421217145809 0.469155144997 0.277763898137 4.77918871671 0. 0.0794382166745 0.130631183539 0.276353468502 0.158423765967 0.375150759131 0.0250784177391 0.818554705267 0.423651854092 0.932897423151 0.511556304679 3.77771578835 3.94974067907 10.060749705 4.3142715615 -1.06919091118 0.176544118626 0.62815843859 0.106929919545 0.625172320518 0.0983476708752 0.321057017741 0.0707726923527 13.0461448409 0.740214098892 0.5323200039 0.662033161825 0.555671637344 0.167882921301 0.254232048068 0.100907764286 0.612709770406 0.242146767217 0.324412275851 0.0715175841763 0.541526056137 0. 0.0203467517845 0.128916507747 4.65809384137 0.181788404383 1.09871502383 0.370878527838 0.517539462064 0.00597018697316 0.027004886244 0.130423699596 9.71419503953 0.996475979239 2.30362027852 0.771326354775 3.68110740354 0.574069449478 0.667747864717 0.357518830067 -0.124255890974 1.29327498652 0.049216033785 0.222982127914 0.0604731034924 0.80299117925 0.336520079351 0.239465907053 0.668765775192 10.0008088688 0.89905029628 1.10329562756 0.0812623827644 0.521666447963 0.020478509012 0.0788716826363 0.0723017837057 0.627028740646 0.0793409847722 0.183569879309 0. 0.535168096864 0. 0.154780680418 0.339970756151 3.70808312049 0.271651366993 0.458888099002 0.0631968307521 0.60855138889 0.000969590450287 0.129408342384 0.74578001827 10.9642335764 0.809321015463 1.26043846525 0.443541303106 6.32079872143 0.187046545446 0.779603904702 5.78656154224 -0.430633667495 0.216900752581 1.22423556589 0.1379606532 0.423782004361 0. 0.465596630589 0.125839128325 1.57018052588 0.499595707407 17.1424388709 0.630510821719 0.0770546407886 0.184781829392 0.80194232831 0.0778331486629 0.272675568284 0.154344824097 0.816164640218 0.181261351779 0. 0.289203423792 0.724311118449 0.430547822512 0.640397034316 0.185400847809 6.06769299227 0.336957380147 0. 0.0785717850552 0.563809365013 0. 0.879107248925 0.570402654692 15.1934005002 0.692558665128 0.543186719362 0.656469474346 4.55015113356 0.455496393966 14.8406602979 5.87378021279 -0.10782961655 0.397922832562 0.303043906275 1.15134235508 0.204418853685 0.371359365018 0.0922161117302 0.671905577877 0.407876429368 1.49131224744 1.22316074924 9.31364010052 0.0659344552593 0.144574201112 0.0925735408299 0.582475702388 0.0363355228639 0.297656428736 0.138440193879 0.659881107176 0.131631371164 0.0386775112254 0.149568084225 0.15703864353 0.245809837971 0.604325605926 0.462539132915 4.32018874731 0. 0.241384207368 0.00943776558503 0.474622377065 0.930923295825 1.57505991892 0.448160445025 8.27984902319 0.212526985917 0.662027832874 0.271951734254 5.3932152289 7.01796079889 13.2819260064 7.73152824174 -0.785114366281 0. 0.190582516962 0.0437245001644 1.60902617329 0.267703675237 0.172723544963 0.203174364247 0.24840311051 0.23889140142 0.287781434575 0.029901601348 8.72032227161 0.809949936009 1.27012921147 0.646006066362 0.263858017466 0.0911580000312 0. 0.0649890857122 0.588978777883 0.0593159278304 0.11311914885 0.127673720151 0.547537065571 0.00890813618702 0. 0.0160219806526 5.36614341439 0.321823878762 0.433766701507 0.153232412137 3.70023837835 0.451404912321 0.667859184893 0.381159496482 7.15133975759 0.765693663643 1.16326409239 0.756193823975 3.97556787065 0.0739449366022 1.30928853238 0.487292257318 -0.0932330048649 0.626458702051 0.147020840639 0.0783894286927 0.261572302761 1.54108436263 0.0203356376929 0.435931519232 0.163874623407 0.857984858575 0.215844705736 0.132020661072 0.581596595914 8.440142681 0.489582070011 0.887531645778 0.0330134663461 0.273150370312 0.142226319085 0.0929907118425 0.046271815886 0.616275281387 0.029319930779 0.139365079455 0. 0.44593197596 0.16281235461 0.131885848282 0.137662554377 5.38384064088 0.231910649926 0.405129195554 0.249998695284 4.60624374682 0.259025590052 0.940729844945 0.70354790234 10.809106611 0.673222830015 1.76599423259 0.383056109368 4.94461024512 0.324289399806 1.27641294791 3.64226215594 -0.115671087631 0.11099052262 0.523966729459 0.00825619242947 0.355096190579 0.273626760734 1.42924086577 0.190326900145 0.383735854706 0. 0.652083379392 0.0276221627974 1.28837929594 0.522186746577 6.74328786096 0.446545887313 0.109097648858 0.0210803305946 0.363099787521 0.0189067390323 0.207581570135 0.160645760092 0.651889079029 0.075801742214 0. 0.0473877911129 0.468659407859 0. 0.462535958607 0.518887856133 4.02344182321 0.297666753421 0.682490917891 0.251494236206 5.17276559213 0.229920577423 1.30998499607 0.620950341384 9.80097842168 0.792641443266 0.716049028897 0.340371268778 4.75383838917 0.398584556613 10.8895201843 3.39222524377 -0.0848119993015 0.0497111753355 0. 0.529676147046 0.218063169303 0.393785170806 0.389534896176 1.37035309167 0.181035586425 0.20545759066 0. 0.856323451482 0.631963013807 1.3992801786 0.563353589371 4.87278695277 0.0211020424287 0.0819252907359 0.0456965121717 0.197177035324 0.051473249901 0.188027970631 0.0844195663027 0.611932893809 0.0856434000193 0.161610141343 0.0593737882724 0.270441938039 0.169490119886 0.559077869937 0.245904264031 3.55100653969 0.328551756953 0.604424375658 0.392278042947 3.38035008941 0.520756692006 1.35443032822 0.371276014057 9.72265927134 0.398852401405 0.681732161833 0.397171209847 4.22304365899 4.28169336076 7.01100597142 3.51268072128 -2.2963661213 0.163164534263 0.572357770823 0.268914073677 0.329726654283 0. 0. 0. 0.618819652738 0.0340760214334 0.15660069592 0.137629051393 0.464863762542 0.0482339350431 0.0765141331328 0.0223618722052 4.93641399381 0.53919507183 0.778870379206 0.469274391055 0.529410506384 0.0102089226755 0.22936863473 0.00911296317807 0.951615777102 0.152092158452 0.195633518988 0.299143403733 0.792403150648 0.136536824369 0.292380158659 0.0634072465286 2.67929976566 0.111090266371 0.397993600546 0.273477085143 0.20004454144 0. 0. 0. 0.772323580557 0.0460467490792 0.274422295287 0.180438769889 0.345031512095 0.1169411809 0. 0.0862887154545 -0.36221886721 4.43749633365 0.198705602053 0.648323746956 0.068704432249 0.279665861526 0.00260402382336 0.141985679692 0.0423421376083 0.801368750052 0.223824905685 0.277391236847 0.0381087967915 0.497983733464 0.0469589556908 0.0268327207866 0.551348074861 10.1600786946 0.532862806093 1.2972973744 0. 1.35996071209 0. 0.457780412711 0.390328433347 1.35639448115 0.0821727427381 0.153319290359 0.407256454251 0.513142352844 0.0111661994826 0.336157828438 0.527409566821 3.84832736431 0.239717899947 0.829973779517 0.0644161274506 0.182748240199 0.0127517474922 0.174565348311 0.013411761878 0.849321327846 0.114319422746 0.116665223506 0.0177312509882 0.353509116466 0.108648716676 0.0492162804168 3.55997377287 -0.662844734956 0.24718672961 4.44643944812 0.312155165897 0.125249804856 0. 0.452865252824 0.0902557562959 0.780092420005 0. 1.08300931948 0.13064833238 0. 0.151981557649 0.403639021805 0.0102513824782 1.33684469853 0.5338563919 10.3812633396 0.691151745857 0.216592999189 0. 0.988823139793 0.297160088089 0.590577033043 0.412386887601 1.4165299385 0.0504868122996 0.308776833086 0. 0.765724055981 0.289704632468 0.598650479144 0.0352777339578 5.83174099423 0.37437356017 0.130108430271 0.114499334124 0.176488935715 0. 0. 0.281216744974 0.678643505586 0.216726769023 0.437232408654 0.0169010207316 0.193734873381 0.107114237976 7.62089842807 5.82215745173 -0.39718927436 0.582256314986 0.447372089267 3.00510556006 0.00523208328632 0.192717126765 0.0504732351332 0.271183148591 0.0739618424566 0.297135925765 0. 0.857837202389 0.0136678015112 0.112114970511 0.065541380167 0.354750352898 0.584297791039 1.24696119807 0.528300740757 6.53236720694 0.101472510413 0.110976638701 0. 0.70469406721 0.143001511783 0.292934968547 0.217703115206 1.18711697484 0.00759432390077 0.575520856236 0. 0.860908450835 0.326804098134 0.652075620805 0.265602198793 3.54052358699 0.0529274692445 0. 0. 0.13065909266 0.0921045261971 0.222944690332 0. 0.904397126722 0.0339390870035 0.0493798526259 0.077727243165 0.350455381219 3.06691219618 9.43091121002 4.23747456331 -0.266754024104 0.00650093716495 0.12800911926 0.0772980128718 2.86683009967 0.234582115115 0.445501850035 0.157126406069 0.290399172749 0.107595239865 0.108077202261 0.161561897413 0.699113848226 0.191697057858 0.162509316102 0. 0.607692951274 0.0469956221946 0.198918977485 0.0922159160776 7.58433037129 0.368490961564 1.08674774904 0.496812861248 0.666102043238 0.0990191396224 0.0920136908503 0.0821908436717 1.49081558785 0.154597741226 0.174755637165 0.146478461101 0.269216683997 0. 0.253567617568 0. 2.98327563942 0.233736190464 0.351757273558 0.139263081868 0.239430381403 0.0208928742124 0.222252319178 0.0175789101065 0.810861806823 0.279608431283 0.179458188958 0.195866758858 2.6854820791 0.398053984532 0.89809834227 0.247935202602 -0. 0.350679119366 0.171770055102 0.104925151245 0.27569187295 6.94829024374 0.334803148398 0.67706013313 0.193350480379 0.412581822479 0.0992653935902 0. 0.10635427699 0.699016591819 0.0539186926384 0.138446373546 0.153056250509 0.713312843099 0.0600509965939 0.255963010535 0.977892604151 14.4889648601 0.9706502979 0.881312161472 0.0346182115187 0.64545890404 0.134577713879 0.290715313336 0. 2.39103151387 0.273437271363 0.464611330894 0.246713626684 0.40332369024 0. 0.145163680564 0.372829638364 5.88638743233 0.226345198689 0.660313641705 0.190871514078 0.468824543611 0. 0.342786925459 0.0289876816848 0.926564298096 0.264713948349 0.168913634851 0.247713670257 4.30894205465 0.435130299606 0.538207204466 4.09158908846 -0.0852410654989 0.0511030057169 0.509274844394 0.0373529090687 0.702993747187 0.420627472897 5.42647743174 0.131536971718 0.0544918473889 0.0128070613042 0.524612151038 0.126370441821 0.153615064327 0.18902932533 0.51889155516 0.0343168562204 0.177500342967 0. 0.829123397045 0.142488350733 1.72654391503 0.629020310446 11.7406994673 0.890649274227 0.0675687379755 0.11742638392 1.01918916916 0.169065502496 0.563238316532 0.404080301794 1.757981046 0.033475292508 0.116203786627 0. 0.327480025776 0.0230249387485 0.594810129652 0.230254744366 5.0646899971 0.418798741428 0.104334665716 0.104697825563 0.407467483724 0.0406246231031 0.348189622419 0.21390374221 0.705834513063 0.0642328453938 0.553054947903 0.513442901514 4.26222018466 0.208573091283 10.5015585013 4.79812930239 -0.016450712606 0.216977814459 0.196903475283 0.251042590329 0.381360395441 0.413738227705 0.369887142101 4.88259977716 0.188049445316 0.176146965588 0.0503173213445 0.269668758345 0.0782349657847 0.280488056823 0.120251545162 0.618000796657 0.126134853645 0.401182869233 0.114756316467 0.597468154008 0.532005117974 1.72633341664 0.896161496941 12.3577660392 0.126652444404 0.183007805123 0.0120862345708 0.810724156403 0.546614503908 0.381149400912 0.262332528854 1.85559847553 0. 0.149062776866 0.0200114447219 0.530378592208 0.310737212864 0.615825997783 0.409391933973 5.39308092496 0.200657743084 0.0952515324537 0. 0.521862066811 0.0957681689554 0.441655874781 0.173274569629 0.711991153156 0.264993223104 0.150780925398 0.398721418433 3.85456065949 4.25450384849 13.2346289613 6.0736547061 -0.440603456097 0.175073392063 0.119622864329 0. 0.241873704132 0.0710770145015 0.0666045777945 0.13396754322 4.24467760612 0.219451207928 0.47068741368 0.159446593493 0.26107084768 0. 0.101681207607 0.0920335638825 1.24654760408 0.189595106863 0.221227691285 0.169635541932 0.565777108883 0.24512236772 0.122082481977 0.106034887959 10.4509269008 0.388387008742 1.12670684035 0.421873919179 0.887638019557 0.230073415723 0.215867259065 0.141579391234 0.747688670763 0.322956986932 0.151769782551 0.145090356887 0.19983239471 0. 0.138068910759 0.162894030212 4.12944027014 0.222269703418 0.334749332402 0.304982463476 0.380209684032 0. 0.0599817853084 0. 5.64715544394 0.843531318989 1.49518330985 0.696491513928 2.82691991286 0.272897891241 0.647969513561 0.270271138196 -0.0368326690502 0.516163584717 0.0402954019228 0.182113461448 0.0267329337356 0.295453650877 0. 0.0391106979068 0.346195590601 3.90722002563 0.251453752135 0.499977068872 0.0438768001794 0.3121885514 0. 0.0101561918638 0.194163815105 1.35154136626 0.256764960023 0.351956461653 0.170903537116 0.571102158636 0.106497372506 0.146134689188 0.650963876986 8.25974889116 0.620138351612 1.28022944042 0.122665881254 0.902940935388 0.0514628555172 0.223518006413 0.0584356644606 0.677203763896 0.159679451097 0.12007911109 0.00334815605962 0.3959196116 0.174551188289 0.159757167432 0.400908679613 3.8883577563 0.339738184481 0.655622431939 0.0665622505526 0.301088437109 0.0532895087776 0.074214780687 0.467362675757 7.53716823196 0.459313777385 0.972487425198 0.169797309845 3.67327701095 0.226350163374 0.743267916615 2.90494533079 -0.171217381999 0.0497713256843 0.703690916737 0.00377987735703 0.0210415170442 0.0860663292958 0.467325777053 0.128714715206 0.496303416213 0.423708568916 5.52927750422 0.209280636062 0.0873057422167 0. 0.259365039118 0.0275367980795 0.383471027046 0.204822857403 1.80740883282 0.200378182483 0.40275582395 0. 0.892186378848 0.0663342198387 1.69920321307 0.698565335305 14.5160708517 0.633401751827 0.234001345722 0.147947342925 0.935226991803 0.0778740557829 0.250771561241 0.0176325172834 0.747036852503 0.101064900471 0.139891600514 0.0267744784649 0.156853529895 0. 1.03113066727 0.393691514117 6.82845384705 0.361457674159 0. 0.0227540771818 0.432779186274 0.121581588911 1.00417952833 0.528467331925 10.1998063449 0.70292632121 0.575173027014 0.53026533446 3.85919571034 0.583793843694 7.55826014247 3.99957544825 -0.11046481743 0.259409163754 0.0640200209963 0.387824432047 0. 0.116530780141 0. 0.269206680089 0.396274595634 0.501678979087 0.285561984975 3.75701797435 0.0203002997396 0.117638129845 0. 0.276900338114 0.209721834182 0.425937609857 0.160289713534 1.42478289884 0.0133090770313 0.356482366509 0.0707080376994 0.809766978853 0.717499678142 1.05863963611 0.545701151656 8.66185832183 0.108602644392 0.230637865059 0.207292284638 0.538602837775 0.105996038363 0.180389920988 0.186551695414 0.654473921306 0.0307507719021 0.155170777697 0.0354792755932 0.326333864235 0.281965140344 0.534045303356 0.36860222882 4.52696158832 0.0512746128742 0.109908902216 0.031024119875 0.337401611895 0.399978877574 1.62914608647 0.776194566993 6.37590575281 0.26209124539 0.628104114236 0.229319936808 3.77378987738 2.82365702231 7.35426366874 3.24606543855 -0.28348427334 0.0699109092497 0.0115243665938 0.0247539692896 0.417015450631 0.135875392068 0.268295082193 0.145629497336 0.260780495373 0. 0. 0. 3.10401749226 0.233910519211 0.50550031745 0.274249624795 0.502928793045 0. 0.30256369977 0.102945787798 0.992034505912 0.241353238048 0.198457172634 0.154684893909 0.573358343749 0. 0.227077915261 0. 7.45434830156 0.424948012815 0.712630951997 0.524185596935 0.361367267025 0.0744190424464 0.112792427081 0.0734282242981 0.484091834767 0.111218952303 0.150743797934 0.0021339917222 0.293650150546 0. 0.02116599467 0. 3.38903656196 0.112898399837 0.478710281107 0.129217440647 3.21303018321 0.333544983719 0.784623002124 0.447344524196 5.70524160401 0.749006476972 0.94290384194 0.635394355901 2.6809463432 0.190350416362 0.506824958659 0.311522768636 -0.0441271017621 0.295578059389 0.00538296576352 0.110839307911 0.0967261383251 0.879962963336 0.239929977946 0.130401327035 0. 0.340950951096 0. 0.137440936288 0.346025987669 3.47636446237 0.278642779927 0.470025718811 0.112692964798 0.619099122427 0.00242780561576 0.173907015881 0.201742176005 0.999189599873 0.219477527941 0.921815929995 0.131841137033 0.676395318803 0. 0.194240135011 0.609370026677 9.57208990388 0.584905018757 0.898643131352 0.0236332695617 0.208932252302 0.217701165002 0.178589346395 0.0707708189865 0.75565077833 0. 0.0793080592395 0.179063482307 0.379112828132 0.176743685886 0.103537317554 0.461838184221 3.38109025265 0.227764370549 0.711382935742 0.33354958253 4.06165867022 0.524877361639 0.658211390383 0.735233306573 9.7497109579 0.731821772009 1.73956580152 0.265634075375 3.47770284375 0.463685252076 0.662645060954 2.65607159046 -0.0683387462584 0.0219629130994 0.277538132256 0.0218956105837 0.206201631706 0.0684822381157 0.407023501116 0.0451269026509 0.123393342911 0.072966956579 0.247768523847 0.0483266332068 0.606740463055 0.29820535935 2.6061321606 0.175109875588 0.144201033078 0.0824589690667 0.503437283862 0.0753138053082 0.392349366718 0.255603880722 1.52451708358 0.172409143922 0.189011576962 0.0325607363443 0.588467389971 0.0933720092444 1.2780171571 0.690762189525 7.24187169913 0.644942406325 0.0762203715741 0.045675693536 0.286183717598 0.0152119119626 0.180745081545 0.0659332293219 0.690175236215 0.126163675168 0.128302974079 0. 0.318741829473 0.0326199410537 0.498619723618 0.187967114517 2.82346513173 0.227608501656 0.505109007998 0.258054431799 3.92125357864 0.364902097321 1.24245726327 0.602397752765 8.63586700945 0.759728453173 0.583845430492 0.20994437703 3.64889395544 0.242635624424 4.90403632008 3.05311621448 -0.0306716260713 0.0814321197009 0.0263314010054 0.272678801329 0.106013680564 0.129532610405 0.0907157735716 0.532493488287 0.0109148306893 0. 0.162164771732 0.265180903915 0.392021613007 0.447741723488 0.282872330359 2.08107153488 0.0784322946977 0.148287907702 0.0731834628584 0.480938701331 0.194862987879 0.41943849415 0.136885175806 1.07543696247 0.0733045890116 0.170090519611 0.152154070687 0.575338518819 0.651042513614 0.990533484602 0.402752307023 5.51178277187 0.0423383577472 0.114394597746 0.0322564050447 0.290883488614 0.0176772594012 0.130997979349 0.0554591676 0.600771271188 0. 0.0290669346423 0.130598018554 0.373034762049 0.33093489787 0.412308156247 0.201480408382 2.63346193838 0.288284729936 0.743880049931 0.285467677785 2.4778577813 0.413816264532 1.08713768724 0.625062767287 5.87760116803 0.261761111281 0.472862376536 0.281657222631 2.33927651605 2.25924727523 6.49703836519 2.52893187835 - -0.0436588705204 0.0180416592111 0.0172705049816 0.0313059619256 0.0204318574391 0.00866565654901 0.00855826696922 0.0141519128344 0.0142075650725 0.0143506931474 0.00948176289506 0.0144385885967 0.0225118414231 0.0129557312092 0.0174966181456 0.0312026568728 0.0239028750731 0.014100885263 0.0142807205131 0.0174958592717 0.0150062262476 0.00953963818715 0.00766268420971 0.00948917307515 0.0109028479501 0.00974640899548 0.00766468852951 0.00853983079827 0.00982133662971 0.0113346471791 0.0146598494319 0.0173023151885 0.0185232762774 0.00942946755785 0.0112331321758 0.0129178678673 0.0182808830371 0.0124702528141 0.00976065350432 0.0142632664142 0.0110575600113 0.0125490239213 0.00953313419174 0.00870953731425 0.0110807056641 0.00941450435082 0.014224693302 0.0178827153121 0.0237376950165 0.0107759910236 0.00965035342006 0.0224624342706 0.015863351958 0.0110733401237 0.0109487196432 0.0142092703067 0.0157160768607 0.0182943776 0.015043406603 0.0204114839078 0.0240554444316 0.0186483208344 0.0239797623875 0.0436191635614 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT - diff --git a/PhyloCSF_Parameters/21mosquitoes.nh b/PhyloCSF_Parameters/21mosquitoes.nh deleted file mode 100644 index 7224695..0000000 --- a/PhyloCSF_Parameters/21mosquitoes.nh +++ /dev/null @@ -1,61 +0,0 @@ -( - ( - ( - ( - ( - ( - ( - ( - ( - ( - ( - ( - AgamP3:0.0215614, - AgamS1:0.024477 - ):0.0043965, - AgamM1:0.024387 - ):0.0104818, - AmerM1:0.0629455 - ):0.0030002, - AaraD1:0.0345156 - ):0.00779665, - AquaS1:0.0388612 - ):0.00756063, - AmelC1:0.049445 - ):0.139682, - AchrA1:0.289475 - ):0.0351051, - AepiE1:0.352782 - ):0.131654, - ( - ( - ( - AminM1:0.118983, - AculA1:0.144847 - ):0.0740457, - AfunF1:0.187614 - ):0.10651, - ( - ( - AsteS1:0.0111593, - AsteI2:0.010706 - ):0.142114, - AmacM1:0.173187 - ):0.131043 - ):0.19121 - ):0.0834903, - ( - AfarF1:0.233662, - AdirW1:0.181989 - ):0.291437 - ):0.150112, - ( - AsinS1:0.266825, - AatrE1:0.244782 - ):0.29688 - ):0.261338, - ( - AdarC2:0.163002, - AalbS1:0.152404 - ):0.261338 -); \ No newline at end of file diff --git a/PhyloCSF_Parameters/21mosquitoes_coding.ECM b/PhyloCSF_Parameters/21mosquitoes_coding.ECM deleted file mode 100644 index 13c9a37..0000000 --- a/PhyloCSF_Parameters/21mosquitoes_coding.ECM +++ /dev/null @@ -1,72 +0,0 @@ -0.856979977161 -21.3799807399 0.243048702626 -1.07282632554 23.2891199352 0.417014024371 -1.70189173492 0.188155975062 0. 0.179377976204 -0.0606628059885 1.25594389172 0.0229550444473 0.00328435713687 18.1364766697 -0. 0. 0.566942262009 0.137821071867 31.7666032929 13.2859098957 -0.363302169127 0.3216200572 0.0779713622622 2.07370722097 27.2607785838 28.7642437906 21.1732174575 -11.2727606341 0.582021939541 0.450519061187 0.520525692578 2.87314674986 0.160184415377 0.0417616105268 0.392943810626 -0.197373806562 3.66356232072 0.129128041228 0.379280117156 0.326199666848 2.74555693992 0.150499848254 0.667770340927 1.87830419013 -1.86834815872 0.345363208373 7.04665342055 0.577755480658 0.355521388131 0.0612681556016 1.5212484594 0.479173384021 91.0051457762 1.3573969268 -0.568971981177 0.457370202419 0.104759904219 3.91042274811 0.352600386489 0.20108530169 0.150446124992 5.47395727586 2.78281874049 33.1384407846 1.6359111141 -0.796825184123 0. 0.0403648471502 0.101591604765 2.6530525349 0.199481018682 0. 0. 1.47135196603 0. 0.224999116277 0.0620080781057 -0. 0.416451433015 0.0365778147437 0.024970392227 0.100800143598 0.874204165608 0.130583286588 0. 0.141999370164 0.485936631223 0.110543922695 0.0881051473082 16.2840553339 -0.12641874075 0.065507193128 0.253613039853 0.0876476849427 0.354732481143 0.0224235730108 1.13456690845 0.205922054122 0.256670135609 0.0609082999619 0.993578689887 0.102531431492 2.2112993571 0.489455389074 -0.142167147587 0.0841528499849 0.00545185023752 0.468645974403 0. 0. 0.0245735447417 2.73514077321 0.0321517883643 0.0681718672235 0.190961252265 0.564971900021 24.1383229355 25.0045526655 0.960565154999 -2.61068586388 0.212857299965 0.0161926638881 0.436376510995 0.488945589229 0.0490126748638 0.0436777528509 0.118779224993 0.825672501796 0.248397282773 0.124449316407 0. 0.189414008686 0.0401485471222 0.0881524691569 0. -0.101975766087 1.1738270611 0.127110430158 0.28355571795 0.014758840992 0.189405643318 0. 0.108577951241 0.15192674656 0.262657678883 0.186613378152 0.243660589481 0. 0.103957104833 0.0352873054316 0.00482802362259 1.79658789534 -0.0314277315691 0.169819246298 0.71866826475 0.165419543032 0.0377534774895 0.0241395904101 0.254563562124 0.0674618895841 0.0993905843497 0.0137652380848 0.619525928607 0.195521335534 0.026722114036 0.0130894039763 0.151205759774 0.0269324846295 24.088796861 0.961987674941 -0.344940619174 0.305455398829 0.0709676514016 1.60031795914 0.0704789063483 0.0159279589167 0.0877851061075 0.250696459521 0.0910258661535 0.17314633403 0.0620955543552 0.22104611078 0.0349971452587 0. 0.0470746037141 0.110016087229 2.54181455243 40.8651006557 1.46068774674 -0.306136639675 0.0365068756611 0. 0.0217224466725 2.73433734021 0.110586423354 0. 0.0381219899006 0.151571445904 0.0326945160705 0.267764377037 0. 0.441539418948 0. 0.0665640592016 0. 2.58642595246 0.109367108497 0.14611246525 0.118659911293 -0.000573614519137 0.104253395908 0.0250383204733 0.0533636462092 0.073014643704 0.473103940343 0.257984331274 0. 0.00615865469376 0.150482492584 0.00442777476089 0.0945035122737 0. 0.251993614389 0.00524930812503 0. 0. 0.603166504243 0. 0. 19.5110085343 -0. 0.0326516117459 0.105921316773 0. 0. 0.218109844754 0.880892812609 0.0206567660033 0.135717490267 0.0100217453445 0.0691830645025 0. 0.265895553088 0. 0.131840210044 0.0385783794127 0.0903101309711 0.0618145555718 1.02475793811 0.0557339105725 35.1407733276 15.6280698007 -0.114378433963 0.0755380229992 0.0334696841663 0.234076002893 0.109622016168 0. 0.043579809404 4.14976553074 0.124020445748 0.0276682901455 0. 0.420860301583 0. 0.0337486778241 0.0482465610908 0.384833201848 0.259016000851 0.0333608744166 0.0967913002381 1.77059360242 32.5414384022 37.4249875733 23.6322118109 -0.76872051314 0.0518496635313 0.206790445458 0.0103357986514 0. 0.0648947518157 0.155573814444 0. 41.6367496355 0.00897871779297 8.10178576716 0.0463408459908 0.010090972335 0.0200177545988 0.0153924623022 0. 4.03988737059 0.223383788962 0. 0.346561611784 1.15593423028 0. 0.0565558183642 0.0376120984804 -0.176940860673 0.0966444861601 0. 0.0785592690521 0. 0.0772313331586 0. 0. 4.89241326509 0.483964741726 5.93138982216 0. 0.0179416028768 0.059548694535 0. 0. 0.101310940279 1.40994629437 0.043866333123 0. 0. 0.309580947376 0. 0.0507115815889 21.2902489182 -0.0629795298351 0.0473604696912 0.688318325575 0.0412159006215 0.168097795855 0.0101942613411 0.0337230410753 0. 6.16756316069 0.0735969582839 42.0857806752 0. 0. 0. 0.0832000654832 0.0846535128153 0.379681833159 0.263413123194 2.16045669637 0.351469470996 0.0788557433647 0. 0.826518430639 0.128090672973 58.0453855015 20.923641997 -0.076094298316 0.135288219525 0.091294048816 0.0922485327941 0.0209863103834 0. 0. 0.226369136758 6.18143228454 0. 5.15573649415 1.07125192286 0. 0. 0.00125691002419 0.0937402627757 0.189747523371 0. 0.0665289703423 2.24488710932 0.0379550972204 0.0159773467171 0. 1.01770296266 37.3377363307 36.4584471667 29.0745428077 -0.158160420516 0.0120556276078 0.0238578426229 0.0160045795938 0.492716547477 0.0131875041541 0. 0.0403949866778 0.453580964347 0.00926804861436 0. 0. 3.34467930183 0.162615843816 0.670668819393 0.285564105445 1.96192533786 0.0700417989899 0.0707320089966 0.121981173462 2.44581946984 0. 0. 0.0576424452148 1.16342540608 0.011075412755 0.158559659269 0. -0.0193224380447 0.0923148288235 0.00365268936531 0.0102066825968 0. 0.316452253978 0. 0.0163413226077 0. 0.0900658323965 0.0912448768615 0.00658190908684 0.689809618606 1.64922141668 0.179746039009 0. 0.115396665688 0.717152347661 0.0138497664298 0.0176041997189 0. 0.667969566413 0.0655661331862 0. 0. 0.418688777634 0.0945356085407 0.053164878132 20.4544469922 -0.00863512879095 0. 0.0369467829568 0.0019694946879 0.0365641334362 0. 0.13284384295 0.0243929829242 0.0517560523386 0.0189830161506 0.0335419847401 0. 0.137834606237 0.135640691099 1.08284486544 0.26921951135 0.0109947403896 0.0402028321664 0.514219812106 0.0267652516336 0.0695645290054 0. 0.494204070935 0. 0.04564276207 0. 0.466875712102 0. 24.3036054086 11.1181661776 -0.0665448209559 0.0548921830946 0.0255372736646 0.1507258224 0.0917147710424 0.108998077057 0. 0.714672482528 0. 0.0329706332436 0.143626874104 0.24454328392 0.454910519719 0.19417661262 0.486820556809 3.68990164995 0.330541181565 0.0645236037793 0.0890425798061 1.62529759913 0.0855851253897 0. 0. 4.55168880801 0.408631955389 0.0763223679712 0. 0.997577985124 33.009352379 41.648977566 14.3264529944 -2.36523488606 0.149863093615 0. 0.388052184684 0.52351318356 0.0445107931652 0.0361304571772 0.146675648637 0.99510305123 0.252054393805 0.140935161049 0. 0.18178207578 0. 0.0469925022234 0.0740502996711 2.51861283466 0.0877276849259 0.01053357318 0.170037651281 0.332126116503 0.0147257337575 0. 0.114800469765 0.249414968805 0.0054522238743 0.0234992906199 0.0284634729163 0.161617184985 0.0132888628625 0. 0.0387208308101 -0.101044364903 1.12349591734 0.0964056709973 0.2949678621 0.0362440735034 0.209698409121 0. 0.115482498535 0.138591958729 0.347197050615 0.153933364371 0.186391760757 0. 0.0478883109412 0.0165935750516 0.0401249768569 0.114390244071 0.49073782611 0.102735060828 0. 0.0353325854985 0.0724307861011 0.0317606016453 0.0186358072982 0.00708915904149 0.0667930926635 0.0365349171106 0. 0. 0.0491828806638 0.000975790213379 0.0211275510994 2.2053619905 -0. 0.125850443125 0.469382098904 0.107088504706 0.0211899645054 0.012870331311 0.184537424832 0.0724449792169 0.0673464126781 0.00496543008336 0.444779446067 0.185963125037 0.0352736521034 0.0262935981441 0.0696281314347 0.00380919013691 0. 0.0789108992446 0.80195467336 0.073867922517 0.00129773029579 0.0152333914511 0.123120315853 0.0284519012919 0. 0.0107614194593 0.150140280137 0.00385025472898 0. 0.00301557967663 0.0454687658394 0.0154784915455 19.7948511659 1.21145935309 -0.232011173528 0.189044125172 0.0671282746214 1.4109043465 0.0604442877758 0.00258249629862 0.0744724196011 0.297633359298 0.121744849668 0.0995804707507 0.0631436303072 0.346908534413 0.0238862732448 0.0141354459264 0.0184355860263 0.0442828901294 0.161643875125 0. 0.10663812361 0.54656952131 0.0150492508722 0.0294819232815 0.00857969312713 0.178824935467 0.0273276064468 0.01153190045 0.00718248290439 0.0860298814355 0.0105820559511 0.00157089298236 0. 0.0834596470596 2.70870019447 22.1270471209 1.31422399551 -0.50529296361 0.133370235344 0.0498469357135 0.0867569048185 8.82982471481 0. 0.106854987591 0.315354807755 0.937948880112 0.100630138883 0.0469600368516 0.108537395112 0.609587756716 0.107449051201 0.202699480512 0. 0.464926806749 0.0274366896291 0.0685629106518 0.0267324573674 3.59299923769 0.130531963383 0.0440063078142 0.395885476632 0.338260573182 0.0014435613204 0. 0. 0.436574638249 0.0363221474819 0.0508433777347 0. 1.75460515603 0.158313429179 0.10276476705 0.0621464281103 -0.0284461790952 0.212253431123 0.0262704624699 0.119807369257 0. 1.69439137847 0. 0.0238200232328 0.0499311140125 0.42812763174 0.0433483934406 0.0779343651887 0.124238771678 0.21961026491 0.0394061124296 0.00784799084073 0.0370027169509 0.0818947112047 0.0252533899205 0.021747647579 0.0113094179791 0.724512682025 0.134472285662 0.0310957722831 0.0167745448161 0.057197304014 0.0272889977886 0. 0. 0.204127343375 0. 0.0576450975873 0.0922046679477 0.353390774491 0.041312983612 0.042153189286 12.3630468079 -0.0608058541496 0.148482722226 0.207943699078 0.027915342068 0.208619559066 0. 3.91408287845 0.0952994427658 0.0239980660381 0.103208669958 0.542149892427 0. 0.00398056690156 0.180172992896 0.396999764442 0. 0.101691932539 0.0381385297924 0.286539177894 0.0133204803183 0.101634701266 0.219858353351 1.59519726774 0.231309758435 0. 0.0118070853546 0.270096461369 0. 0. 0. 0.125163131058 0.0331786840056 0.209190222596 0.181921325117 0.779148128217 0. 29.3362421982 10.5727352608 -0.104224724824 0.149896543597 0.0408462440613 0.351541033243 0. 0.0470545780751 0. 6.29767077478 0.0638605912434 0.0203328796665 0.17882849221 0.863911458009 0. 0. 0.0945005781775 0.716896467078 0.0594344511385 0.0112326757614 0.0486622115963 0.155235197328 0.170785316863 0.0397408684506 0. 3.70884461498 0. 0. 0. 0.198998766469 0.187561459576 0. 0.0383346884399 0.655329719253 0.204713395657 0.0710634862878 0.0957111473389 0.724858046892 21.5035212342 20.2117021205 17.0975384559 -0.243814221546 0. 0.108824678522 0.264420182206 0.364793101017 0.108006155671 0.0205920780887 0.170326493076 4.50859744421 0.269800396052 0. 0.173323615768 0.225395739418 0. 0.0520477021147 0. 0.284281705356 0.0953344886278 0.0515911206625 0. 0.234186592483 0.0289777763915 0. 0.161158840873 0.796843962108 0. 0.115827793356 0. 0.0987136739611 0.00029047619079 0.0112748855466 0.0121835662905 1.77155307137 0.0169763500914 0. 0.18823403339 3.31343536517 0. 0.101946039966 0.368466135555 -0.105733514394 0.55778792064 0. 0.0456698894765 0. 0.152841815427 0.0976274621557 0.114331444121 0.138690469977 2.07292580293 0. 0.0995490839043 0. 0.11553472201 0.00936734365735 0. 0.0639926611674 0.0711496517083 0. 0.072945462527 0.0165240972727 0.0563383181792 0.0301863217865 0.072033684696 0.0895041669733 0.234873522908 0. 0. 0.00334416438512 0.0658256490442 0. 0.0201119425472 0.0142221784569 0.796802944169 0.00644729862263 0. 0. 0.969675795578 0. 0.259312270938 16.7988341937 -0.123747011131 0.148762152389 0.448086643454 0.341823632575 0.34476022895 0.110877804612 0.468103639003 0.0517409316386 0. 0.472120665461 6.98729985985 0.569550979079 0.129146686061 0.0224600289171 0.282942379039 0.0547809756015 0.0529083010131 0.126121884865 0.464817592539 0.0563535784111 0.157848239294 0.0690716512742 0.284621038424 0. 1.26223251509 0. 0.425919459795 0. 0.021314959391 0.040206047527 0.10390150134 0. 0.474503890347 0.253280616196 1.80381788864 0.35821099567 0.457002815235 0.154061170371 4.27766696355 0.386090358293 47.9325619303 19.6808295645 -0.0940392483601 0.156428897336 0. 0.555747149715 0.265719451989 0.0591439377268 0. 0.388837541416 0. 0.092604306386 0.707672059766 4.16244419308 0. 0. 0.017844959855 0.191326971468 0.0214867140775 0.038793811958 0.0231011617586 0.178575314934 0.0264742042909 0.0665555390941 0.00974038240155 0.233148293816 0. 0. 0.312691113373 0.796448296354 0.0276668298469 0. 0.00576986511196 0.161257921724 0.0740679232858 0.0435058827918 0.0146785759452 0.935073559881 0.130985969118 0.150459907519 0.104142974561 2.2937251156 25.9167566891 27.9672543534 30.3671736585 -0.434058116582 0.0243009357809 0.0664865836138 0.0549805741932 1.85695152847 0.145837441361 0.119526026661 0.451736279288 0.93810077143 0.0667330549159 0. 0.0784036993055 9.77530236961 0.436725089765 0.58316203681 0.977490399744 0.341726863473 0.0390561119246 0.0380593521652 0.0286543721396 0.781823693643 0.00218133774376 0.0685003177396 0. 0.271085249245 0.0104602785429 0. 0. 3.47120842402 0. 0. 2.30786650813 1.50791862083 0.0483963919454 0.0300621606704 0.0735252786412 5.61717661886 0. 0.634793867133 0.742661472684 1.55918666263 0. 0.841314002074 0. -0.0113667677619 0.139097021802 0.0266279055959 0.0649110059928 0.271165225002 0.356374200249 0.462447049335 0.0812554110799 0. 0.261906579666 0.214962406813 0.150876194512 0. 4.85246662164 0.112885739127 0.128479081658 0.00382441531228 0.0963471511583 0.0288968160516 0.0380575513004 0. 0.460646796364 0. 0.0526747725656 0. 0.0635182874082 0.0624795281108 0.0496585258215 0.249922297538 0.880126512364 0.104923430442 0.0475178691005 0.0469942044593 0.377726315 0.02396015719 0.0058029211923 0.400818155317 1.88399437755 0.0249683518635 0.276514482787 0.0333431132158 0.479895695338 0.0844193920514 0.0624254941258 21.7592101953 -0.0331799427383 0. 0.0666993209566 0. 0.0659147301184 0.256960995461 0.286462654957 0.0701466885296 0. 0.0107854883592 0.295165736711 0. 1.21447464954 0.180018476203 1.01556150887 0.426925008475 0.0425154209715 0.0198069960443 0.0949639914014 0.00626698048332 0.10953938333 0. 0.300853421045 0. 0. 0. 0.0831189682586 0.00455574777414 0.229147001649 0.243060751563 0.659201322877 0.00153006753369 0.0140756082878 0.0077442567221 0.264077928925 0.00835488167252 0.342760335106 0. 1.80433636682 0. 0. 0. 1.1713441614 0. 31.8153346162 13.500934857 -0.0753651521978 0.0829572682127 0.0469876926104 0.213057044827 0.276108755483 0. 0.205795926871 2.07448463232 0.414603494325 0.108654113555 0. 0.42829121982 0.438401644702 0.326753757929 0.233179693471 7.21268221952 0.0721202274211 0.0136132175223 0.0214700972484 0.181444564043 0.0226930454947 0.0998250535633 0. 1.02344251681 0.27821255631 0.0066081187679 0. 0.0411768797912 0. 0.18792017758 0.056173201874 2.58754316069 0.240544111649 0.0391893694734 0.0120639862744 0.591089276474 0.41302815344 0.0800084271644 0.145503183728 5.00734758378 0.188951138852 0.0153168225304 0.00275019000738 1.24518227851 30.5503637373 34.0462233841 18.6930893112 -3.5612805718 0.185576667155 0. 0.261882000557 0.552498356896 0. 0. 0.0454188913343 2.18033142306 0. 0.913055260815 0.148167561548 0.979499033508 0. 0.0276967036387 0.0462666186648 6.87550522201 0.409269139199 0. 0.385739048816 1.2307998883 0. 0.175887843684 0.0906161829493 0.735716867884 0. 0.600993186416 0. 0.729833033914 0. 0. 0.026483433212 2.74504384982 0.155811527469 0. 0.123461266078 0.427731161393 0.0289604446028 0. 0.0303196385124 0.493373112815 0. 0.222411828762 0. 0.699369865327 0. 0.00201358602267 0.0716169942232 -0.104325456084 0.463481189267 0. 0. 0.0326564812186 0.0193838763331 0.0364109108089 0.0460004723167 0. 0.098968148224 0. 0.0447017063462 0. 0. 0.0257930407901 0.263414933857 0.206483480307 1.24027101417 0.00160980668212 0.258419493927 0.0376900584074 0.045732253611 0. 0.0414234180165 0.064309867278 0.0667778675875 0.0394817700222 0.0782429690108 0.0462470882557 0.145607151232 0. 0.124089860161 0.120025598718 0.113313102447 0. 0.0293429859405 0. 0.0944873791495 0. 0.0538686904815 0.237650500843 0. 0.145663879182 0.0422859300375 0.0328957650127 0.0011783331156 0.0268609220906 0.109848171138 0.708962533642 -0.0440826539721 0.183543317224 1.31985453104 0.29760797105 0.0134450303614 0.0627229514106 0.31279883249 0.0806111169421 0. 0.157442294141 0.297999910948 0.109689823 0. 0.282760962173 0.218720526434 0.0560052611502 0.251959973649 0.420273990731 3.41918753696 0.491882578276 0.0896406707367 0.186494631066 0.439708062254 0.197947369192 0. 0.497223431254 1.2424461357 0.258879085594 0. 0.00808306260146 0.0470148067102 0.17542811997 0.0509391703359 0.148001904375 1.04860067906 0.194814679614 0.115927749447 0. 0.449370327984 0.0200324395713 0. 0.0892899979766 1.23078140878 0.079658732789 0. 0.0477979550569 0.168444216083 0.0449592501719 352.932298864 0.757542891626 -0.0260133112348 0. 0.0533392790958 0.709830630177 0. 0.0772589390514 0. 0.102456250928 0.164849778116 0.0404640512768 0.190001520841 0.135220074865 0.314847205215 0.153220567324 0.0365803390517 0. 0.060206598525 0.364682449198 0.133569747889 1.93244338701 0. 0.0246104772359 0.0254103916945 0.227563058626 0.0076539393152 0.0631550795105 0.0293457012601 0.108828143742 0.0226945449551 0.0322923760681 0.0514989763176 0.297520720886 0. 0.0872796679636 0.0728170451125 0.210120628582 0.0723105238391 0. 0.187833239399 0.0353299664323 0. 0.176256670958 0. 0.0721598798001 0.0450225348449 0.13074927379 0. 0.0585416392465 1.78059816087 39.161107698 1.08904133074 -0.32285906089 0.0859967474225 0.0561149741506 0.0997333958055 6.22297209977 0.0880669876225 0.726694491183 1.01646558779 1.08531977553 0.28612993001 0. 0.315673439399 0.410167922953 0.131920417886 0.104283886065 0. 0.778552681658 0.0466109104441 0.0770193625443 0.0954793310376 5.88489430467 0. 0.189290015679 1.20033163478 1.04257180512 0.0240800875658 0. 0. 0. 0.258693504552 0. 0. 0.410407385613 0.0417471510459 0.0229055164516 0.0633805100821 6.20291445659 0.268643999351 1.00503843064 0.172686305629 0.447784867539 0. 0.134286796325 0.220374931404 0.988209249538 0.132976168404 0. 0.323609598337 4.25915133684 0.0849966076834 0.374585594363 0.00669084346932 -0.0592120190495 0.317137404498 0.00996511224837 0.024970726587 0.184469819546 2.22580329794 0. 0.361810497613 0. 0.982607661126 0.136268953756 0.2043280624 0.45640423584 0. 0.0106817429255 0.0328444321006 0.0648093172502 0.237096986804 0.0178648037634 0.0197756543926 0.0919299997176 1.2554947586 0.164755867238 0.454088869701 0. 0.112459471987 0.0808505600423 0.0371170702525 0.169759857654 0.2913277705 0. 0.237002712084 0.0475003073893 0.184783472255 0.0192972493559 0.00777830381048 0.314901795686 2.11204235155 0.159218972699 0.385608776687 0.0617656827024 0.219401023947 0.0421932203634 0.0692095788129 0.0936204368 0. 0.21065062495 0. 0.146933837691 0.28561463973 0. 0.0412013552127 21.1669501142 -0.0214242844445 0. 0.0890509476222 0.106347387581 0.50477863564 0. 3.09784136779 0.0459525854663 0. 0.165204710987 0.445843862583 0.278213722528 0. 0.210736910449 0.177706552924 0.0380595760919 0.058570696183 0.0201420132449 0.258429258273 0.0560705901873 0.0251972854114 0.140893674403 1.42610603808 0. 0. 0. 0.317799605587 0.0506989312525 0.255831368443 0. 0.0806293001956 0.0168824151148 0.00475962470686 0. 0.0971995733402 0.0437031245498 0.500973292004 0.0774839884335 2.90438537811 0.202071520986 0.0937165711889 0.0216420775447 0.46085520615 0. 0. 0.386212730776 0. 0.0439111871227 0. 0.00142019617832 1.72372488346 0.00353564686792 39.2916179068 18.2449713723 -0.12772333616 0.202937477234 0.0456262887699 0.384240827481 0.750471298595 0.566716666735 0.329482300209 7.9730276104 0.348733256117 0.416616268506 0. 1.60604961709 0.153626160452 0. 0.051816532713 0.517553659832 0.191648788308 0.0783717598123 0.0620273916294 0.517147043007 0.757054829915 0.271320901834 0.0610169937309 7.83805440567 0.26049598552 0.0116099054579 0. 0.271192109703 0. 0.269401620363 0. 0.869217204478 0.173886539068 0.101559401417 0.0513360463705 0.25313978055 0.814021622311 0.542152688427 0.661009268928 6.26229632635 0.0789158873422 0.140136062493 0.459696135584 0.449218526527 0.242718586153 0. 0.036411591094 1.15509068397 0.3893585454 0.0424108621429 0.560890848122 1.09144238728 32.8955493322 38.4940460748 24.077551687 -0.892146421339 0.105792977881 0. 0.203727471191 0.937054097698 0. 0.11392298206 0.0306223345718 9.42292304392 0.368889170803 1.66077364659 0.579325085445 0.114146365789 0.149157964404 0.0775871861269 0.0452777917467 1.87236487125 0.253819545628 0.136018977537 0.389932585883 1.67509605282 0.0552503571781 0. 0.161064385475 15.4813846104 0. 0.20972813964 0. 0.675574459504 0. 0. 0. 0.942992935462 0.141984025502 0.0271301662091 0.0830153582675 0.959015469118 0. 0.279990642381 0. 5.26272896639 0. 1.3089471879 0. 0.932609036265 0.0129723246839 0.0293439782823 0.0631589397541 280.629762483 0.33921123514 61.6326568199 0.574254177642 6.51206780811 0. 0.154805300534 0.571105398762 -0.0543459569035 0. 0. 0.175082894371 0.0300029311488 0.152289336153 0.0213642624993 0.0474803694279 0.272378780882 1.11185426229 0.195192906777 0. 0. 0.0422434128828 0.0236417440157 0.153894931667 0. 0.159478557231 0.0581249296853 0.0888637596587 0.00774711463909 0.0797019570098 0.0220358018891 0. 0. 0.788772412095 0. 0. 0.0125193864137 0.157865057283 0. 0.053199968005 0. 0.103059554852 0.0214087156837 0. 0.036253294775 0.171112602984 0.0185506897953 0.0201440173115 0.180508780553 0.379647848599 0.165082219653 0. 0.0387162959041 0.17589011491 0.0166076794048 0.0888466997722 0.278144013414 0.516232169639 0.134276520095 0.0356284139123 0.110707261879 0.765365154596 0.0484784571802 0.105517140489 1.956996971 -0.0426453273696 0.0191205668943 0.0368964641593 0.0195993734266 0.020426687841 0.0071332799582 0.052440437308 0.0188225003564 0.137720655499 0.050220433979 0.791577703309 0.0569744636126 0.0490397005783 0.0154243449821 0.0854117057841 0.0247958613472 0.0837332655223 0.0474247246812 0.120026567666 0.0690972261089 0.0520473599944 0. 0.0770543128608 0.0275746063381 0.105528767172 0. 1.05765165507 0. 0.0503584622369 0.00540933675393 0.0512677354683 0.0567514547181 0.0241550573068 0.00713138366743 0.0322524761285 0.00510242031931 0.0275438433454 0.00454715835838 0.0660427342198 0.010682243118 0.066443063198 0. 1.06220346525 0. 0.0369033385963 0.0104664832187 0.053823143186 0.0247144334391 0.396443415435 0.162886463316 2.81533142291 0.303786834202 0.122329738726 0.0197654206404 0.301045311419 0.0927439142057 4.07574873867 0.297231398254 -0. 0.387694492842 0.0566264290759 0. 0.0420389430627 0.0372263203947 0.0284009571392 0.391280067504 0. 0. 0. 2.62120940939 0.235208821229 0.174126629446 0.0377333685393 0. 0.266507634665 0.140780997735 0. 0.274461791044 0.024251685869 0.0123437067252 0. 0.42174418179 0.386142599092 0. 0.280878402933 2.26656277487 0.0668300289241 0.00484107193822 0.0120421621438 0.467512964536 0.140861595319 0. 0. 0.152886951063 0.0726618429342 0.00881337066215 0.0765283799663 0.323564236667 0. 0.104293437079 0.0656777320123 1.27568533433 0.0936900727309 0.114534588299 0.0388409803721 0.261207870269 0.539598476857 0.057248937284 0.709959826108 1.31873341905 0.149748324813 0.0137692137083 0.021682240931 2.67377221412 3.34744003832 63.6215057037 0.552099970733 -0.262658101564 0.0330856130484 0.0318435467419 0.06434557919 0.956294914676 0. 0.0362010379979 0.210563484821 0.649823236136 0. 0. 0.178067726788 6.14046266775 0.484508818038 0.969822459383 0.0908273537571 0.569261086804 0.0475523632477 0. 0.0356114691876 1.12898507341 0.0473037858179 0. 0. 0.60621623873 0.00374427661168 0. 0. 49.6159095859 4.68022066218 5.91403524205 12.128423537 0.343023643831 0.0170291972708 0. 0.0286948987936 1.10355826045 0. 0. 0.247628287953 0.256927506886 0.00389918558072 0.0386987944657 0.0462994870786 4.38167122112 0.749142928044 0.326128125834 0.155704509341 6.93877030376 0.243950655216 0.795264519656 0.219296014971 6.28903338562 0.253404687172 0.350852805934 0.514188082347 7.10336662893 0.17185837391 0.250117723726 0.310340196655 -0.0836251079889 0. 0. 0.0759521765583 0.025061096046 0.128763746911 0.0365471490099 0. 0.0513270168229 0.115390559489 0.0136726811189 0. 0.494123395556 0.738187904377 0.113320681627 0. 0. 0.172946985827 0.0634101240401 0.0303155000782 0. 0.113804414616 0.0536675968956 0. 0. 0.0934146779956 0. 0. 0.157608968678 1.11946201469 0.163383148328 0. 0. 0.0151230114653 0.0171489957776 0.0145945353819 0.015584347954 0.11246152727 0.0672202658176 0. 0.102939183862 0. 0.0860115508942 0. 0.0968596103594 0.564102323427 0.0442859710728 0. 0.114886652857 1.58908101447 0.0640408949033 0.904737091043 0.0464952209978 0.55079298779 0.0350352055003 0. 0.223792473206 0.138240250676 0.128815431027 0.47979472309 1.00317623422 -0.0291577441272 0.00710949998472 0.0678309421565 0.0296178528991 0.0382507639617 0. 0.440552472665 0. 0. 0. 0.41775879454 0.0882600115553 0.481363126311 0.40262892409 2.18167671879 0.22263115552 0.0849711406145 0. 0.121560618927 0.0125624650954 0. 0.0428371422818 0.191018400085 0.137560451816 0. 0. 0.250171892144 0.0477011893207 9.6100077808 4.83686618095 20.5612112307 6.14952831179 0.0434614128121 0.00814219912045 0.0536473772114 0.00722447169821 0.0567220784066 0.0346109731334 0.477257172205 0. 0.0159230494094 0.00672775637493 0.312424461243 0. 0.926206563236 0.170008698136 1.00901362295 0.595253476155 0. 0.0829218608049 1.88426764212 0.0861787526896 0.826858434307 0. 1.08578916825 0.406345336454 0.693518216334 0.0723512495772 0.686787071396 0.139318568235 37.7467182911 0.407872757386 -0. 0.118017675903 0.0516491740649 0. 0.0245749501147 0. 0. 0.515743121688 0.00349160199675 0. 0.0461156753177 0.227277037273 0. 0. 0.195669278198 1.81813346514 0.222473192805 0.0396850438219 0. 0.267936923992 0.111696900826 0. 0. 0.551653259568 0.081951854164 0. 0.082737441961 0.133720495134 0.299280716335 0. 0. 3.68142435956 0.070474856968 0.0253494371084 0. 0.0186977483264 0.0484115177612 0. 0. 0.364949634323 0. 0.0637057162944 0. 0.118085161486 0.136351224149 0. 0.0098593477854 1.37279032042 0.347644700635 1.0187663532 0.267201375923 2.77745201989 0.207254836317 0. 0. 2.06876811139 0.505268712448 0.346609972923 0.303669059181 0.251430422297 3.04304016233 34.0403102714 1.13479757826 - -0.0181562543195 0.0237541470812 0.0374678167352 0.0229356112767 0.0128689037304 0.0198976366858 0.0146655632375 0.00919594319685 0.00472893318106 0.0211913632303 0.0055799304347 0.0110186011298 0.011298864648 0.0212572494848 0.0236085461411 0.0174040193786 0.0162290051584 0.0148443207067 0.0353528716219 0.0119611294267 0.0135951768286 0.0180305546134 0.0153945069058 0.0065457378099 0.0078695600931 0.0191529378739 0.0083646520671 0.0103291428757 0.00819577204868 0.0151009637038 0.0395263872133 0.00821847799094 0.0207915459753 0.0230931017409 0.0422829154308 0.0282726539789 0.0135792875468 0.0329056051667 0.0141017924951 0.0139740807157 0.0140824034252 0.0275383935595 0.00496476036542 0.0118834390088 0.00615824907675 0.0144300896903 0.0275466491572 0.0105317037816 0.000922468535899 0.0174195794121 0.000696348080875 0.01351829124 0.0078555121632 0.0176405660316 0.016049381888 0.00653336051055 0.000634022586315 0.0136299552106 0.0103827981635 0.0061971613548 0.00498147886533 0.021300710268 0.0173922639928 0.014968849752 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT - diff --git a/PhyloCSF_Parameters/21mosquitoes_noncoding.ECM b/PhyloCSF_Parameters/21mosquitoes_noncoding.ECM deleted file mode 100644 index 6b40287..0000000 --- a/PhyloCSF_Parameters/21mosquitoes_noncoding.ECM +++ /dev/null @@ -1,72 +0,0 @@ -2.60522165174 -5.52510067718 3.46892355586 -2.06752205896 4.87084817478 2.21791845944 -2.3195381658 0.29942855373 0.528228212208 0.26648971101 -0.330068073364 4.34832138922 0.432834075405 0.566200533823 4.59841842144 -0.552416252538 0.261795105 3.90539440681 0.215698594141 8.6764671226 4.28639980545 -0.295548791599 0.827336939107 0.393001102173 2.30234170923 3.81729458011 9.33029881664 4.31982049419 -5.82573631847 0.801834999525 1.86182286498 0.602393752325 3.81311102277 0.474788400945 0.721304810831 0.329054451704 -0.595892512437 9.69926539657 0.842946055917 0.971814913776 0.399337020469 5.15799117581 0.236792300614 0.73713375116 5.37263336106 -1.05273301983 0.621797096011 10.3561262134 0.615594998571 0.720352431384 0.636012240368 4.08598201643 0.288342417197 12.6654887488 4.68843038831 -0.511007461668 1.27482190234 0.770931708347 5.14006094873 0.263064404428 0.72057905066 0.31199670561 4.78418938995 4.77782550368 8.79650954363 4.02459238797 -2.45614751139 0.368323546282 0.896011440009 0.345330822663 6.38445607882 0.812447241133 1.22688836396 0.89846227661 3.86123785872 0.054624957844 0.807672411047 0.284218649159 -0.297071771517 3.3301080317 0.294244712813 0.594387565738 0.630325090791 8.22791956827 0.60941585104 1.39405066498 0.518559738627 3.74891441167 0.432486622264 0.886834747439 3.57278649553 -0.491952797003 0.211319243882 3.22926300477 0.288114933896 1.46193024122 0.664041941702 8.73877116939 0.711829787348 0.610050659555 0.26177882384 3.52009446056 0.282194809626 6.51970381022 2.46888502102 -0.270311769619 0.53701253113 0.253466034556 2.07899632569 0.389073083667 1.18867330633 0.366846269651 5.2275473054 0.266988648959 0.45562665342 0.293347630878 2.23924111386 2.99584349371 5.01115562509 2.53862842844 -2.54429183679 0.208897902088 0.690631250814 0.202027264705 0.244791690551 0. 0.102010744231 0.068623129321 0.718867473979 0.0861791543005 0.200678256294 0.0277198677359 0.358710455289 0.0198590262246 0.0727513233457 0.0181667907683 -0.205741251989 3.54878426463 0.282535784093 0.442820226573 0.0371097332821 0.472702213865 0.00924159247056 0.0270547897495 0.217166271741 0.809157527615 0.0731064332526 0.167555106759 0.0823809711156 0.233703673635 0.0507150524041 0.0118325287932 2.79594212608 -0.454462784752 0.221619695452 3.94980098948 0.192503544533 0.20057130093 0.110679640482 0.366954674621 0. 0.294065885262 0.0422692166612 1.19442307203 0.136885521587 0. 0.00705222137801 0.38732889744 0.0336198621798 7.61431848979 4.1790760497 -0.250017930855 0.600751819008 0.2532882811 2.48072248044 0. 0.096910416293 0.033071836568 0.3330380543 0.106896588224 0.221471925649 0.184154952423 0.71515124614 0.0787027589041 0.197544782653 0.00291609470126 0.293131845465 2.57577732798 6.94208324896 3.27585074853 -0.267538861181 0.0782973620584 0.140990405947 0.0415135512486 3.26788735517 0.391466887355 0.584485074743 0.223924105786 0.53967272806 0.030939550127 0.104490034188 0.0907393878631 0.706815630064 0.118344611019 0.181283524607 0.00908489560399 3.65214779623 0.43161700393 0.963510202506 0.268388623877 -0.122528796445 0.403492967439 0. 0.0753976110614 0.345763756346 7.95722267283 0.351981375839 0.660662480024 0. 0.519980399021 0.311961640455 0.087688748179 0. 0.665982021083 0.153361405173 0.157150510133 0.289733588913 4.91280159829 0.597746315167 0.783123601521 6.85421562286 -0.157896529141 0.125849840503 0.258837222819 0.0262407555021 0.546585213019 0.250136220871 6.1023022464 0.27858435627 0.0965962927904 0.0837203126736 0.41309497354 0.0651975505063 0.167610924662 0.0863019690749 0.523540972714 0.0356231133228 0.524246028168 0.427565464426 5.77089638668 0.309151292801 14.7964854058 6.03102821436 -0.170436883784 0.101171673737 0. 0.235477601463 0.290761451767 0.986145223945 0.298849243214 4.18240167889 0.0838301866341 0.217688815126 0. 0.367784454716 0. 0.171407551321 0.172665624586 0.622087066397 0.206350807788 0.679113628723 0.477771364745 3.59103421041 5.56204335797 17.2297122913 6.90886230132 -0.637707469457 0.0980845253209 0. 0.0386222159964 0.23291610923 0. 0.133387182059 0.140114698057 6.19099261505 0.286769228317 0.917424235416 0.222350439907 0.196014430766 0.0438704080348 0.171320870319 0.029495951056 8.61610724776 0.740338142792 1.897591966 0.504461228772 3.89883392169 0.303737900124 0.940750518231 0.582602259878 -0.0552030861191 0.406515753038 0.126757954568 0.17902632355 0.0429018761926 0.167792025667 0.088308826142 0. 0.397029203581 4.18595899237 0.361569523204 0.629291039745 0.012095057946 0.218555477593 0.0338811067771 0. 0.714975070526 9.88809944498 0.73947683568 1.01131929346 0.212139146705 4.47739869358 0.282032128892 0.788958556228 5.0147010624 -0.142317397722 0. 0.858132236596 0.0524028347981 0.0845413370276 0.223285798859 0.477504820704 0.0313574645896 0.741621629651 0.381515213112 6.79910727345 0.185605422378 0. 0. 0.307194239723 0.0334611209093 1.51778663185 0.633300960636 12.5139215776 0.52321566535 0.907058407988 0.803636621863 5.54890362758 0.353466300082 11.6791489514 5.62326450239 -0.0632604351817 0.293940871922 0.120172031706 0.408175611648 0. 0.168880218778 0. 0.226461793393 0.424688374337 0.644519008495 0.35940974446 4.21139730687 0.0533289483047 0.179151278901 0.0389341139928 0.233983621214 0.450540732963 1.44704264599 0.891610313991 8.79731335796 0.453587541817 0.501626596963 0.419745943993 4.04719461146 5.37510573152 11.5732278696 5.93235816792 -0.271934817808 0.0220389805083 0.360919166698 0.0306140044835 0.752318321992 0.463319481404 0.0237920653271 0.0472648305889 0.410951022594 0. 0.206617433612 0.0490180837447 4.19715565416 0.331859055831 0.636355522299 0.327688640142 3.84097030894 0.240503800507 0.665107401131 0.398453372736 9.89885147868 0.797924695707 1.41658091675 0.962105284807 4.14390656934 0.185723871788 0.927757405015 0.447505455533 -0.0441422651003 0.351697700152 0.0540161434958 0.0395732774663 0.203771372951 0.550631712994 0.174017431879 0.41203269941 0. 0.58734824068 0.119062840479 0.144323912746 0.232310518672 4.00520653295 0.346972105194 0.468054735393 0.25509398801 5.26566329901 0.623159418873 0.565609802428 0.854434133855 14.9117484413 0.845802974661 1.85608265587 0.403055949032 6.4442609397 0.519341640143 0.848589689817 5.39834773416 -0.0732180070149 0.0968521775348 0.228828756215 0.0184219094418 0.135688516825 0.0237881831167 0.859989660933 0.163967324751 0.0963793084962 0.050979981086 0.468537052022 0.0523032717653 0.495209908214 0.192641952809 3.0982481819 0.17865921222 0.416996695586 0.345414736546 5.03705465074 0.330159736313 1.67298903994 0.841108082877 11.9450323105 1.20722675626 0.740920305434 0.26598753344 5.3213295419 0.35148359416 11.7501313957 4.96184490401 -0.0221615561397 0. 0.18053780639 0.232847292427 0.0886419985582 0.311519768132 0.0782740903323 0.768657876222 0.20478676049 0.104330422709 0.0149957938401 0.355174837782 0.401325655323 0.669743397933 0.240594251687 2.21617894499 0.239479204102 0.463301114039 0.257639362336 3.21848934944 0.614917578254 1.24161518748 0.753701089267 10.3962486969 0.4724551404 0.72561003943 0.346683864076 3.8853095069 4.48167836817 11.5738315211 3.84920008886 -6.46152443068 0.688877807506 0.907244785869 0.467331091131 0.611857479133 0.38000697963 0.274957472129 0.0417115243384 1.78039895393 0.0931120924274 0.92558963629 0.11139615157 0.719672704195 0.108813780714 0.14630642316 0.108187658319 3.08393052516 0.224878585989 0.620023085921 0.308954907803 0.492547578464 0.174234124077 0.0130567187595 0. 0.675106424614 0. 0.254520863205 0.206575237598 0.501861233193 0.157443454569 0.0158713688637 0.0253774110209 -0.383814344165 6.97508651301 0.535744016959 0.869608553356 0.125634803092 1.1992165745 0.0482168945747 0.166215809035 0.385867165096 1.79183536119 0.134729159035 0.42852869417 0.0405646931802 0.896198342106 0.110650667529 0.062369015921 0.167364953657 3.41846809715 0.263196922934 0.481586151241 0.062064983602 0.31960756476 0.056698891866 0.0686419515445 0.163067764246 0.637468886748 0.0931119682843 0.152959353192 0.103874145219 0.320755915959 0.0585407497123 0.159114390453 3.3705044899 -1.05022340326 0.581026804078 11.2240678679 0.470465861776 0.317218721951 0.0630525248766 0.778161858589 0.181788766574 0.277449520997 0.361212044249 2.08515796396 0.43619236315 0.452696901317 0.173696696033 0.642502390054 0.0404014311909 0.682778351182 0.544672566316 5.21922208324 0.355151721135 0.107162523901 0.062248643198 0.663306402484 0.19162270899 0.522764714146 0.0335688758657 0.782763482094 0.163106673887 0. 0.0465122608892 0.585116516325 0.0171956340661 9.69575537066 5.40056188954 -0.463555302185 1.36885645104 0.629145708589 5.01894573147 0.116251331227 0.0907081671292 0.202939025922 0.905680697885 0.304403966397 0.432168130854 0.187380395451 1.35467307484 0.114572366551 0.0821882529413 0.176377339242 0.592215505168 0.305818323259 0.543871427782 0.216286614077 2.53109375099 0. 0.153558117059 0. 0.542581004971 0.20674612679 0.192504536483 0.0298525823301 0.547588985676 0.0805929436176 0.128518226387 0.0298694150466 0.255215461869 3.37416853428 8.46230911018 4.07152778919 -0.480383982717 0.113564278539 0.255623640736 0.00307653945662 7.39516897953 0.599690149253 1.27957922996 0.551895856538 0.710140444653 0.11711866548 0.203456778477 0.0768765888675 1.03022447997 0.13889393181 0.360875415287 0.143429116955 0.192790074292 0.0229978012169 0.0474128199143 0. 4.07431891567 0.348455094593 0.615092758097 0.2789288752 0.231998468985 0.16665458539 0.0999114485727 0. 0.545458431919 0.140425511194 0.252964601793 0.0641235109003 3.45150022822 0.25341181581 0.85537272809 0.336373802126 -0.0498994970469 0.659298255503 0.120756811598 0.110625856911 0.499397078742 13.156694884 0.527902627276 1.17450655751 0.0979999890977 0.783058133349 0. 0.234245741379 0.242028577174 1.27297503647 0.198144716023 0.226456646017 0.0392688783335 0.310112026688 0. 0.0478714335742 0.362254930416 5.85652628067 0.393384006798 0.85767141986 0.189282416135 0.204461461925 0. 0.249713282975 0.063213200208 0.772616833904 0.0880407062257 0.0621511474181 0.267377413205 4.93887836005 0.75208565002 0.499218431241 3.95581023001 -0.178490254361 0.113243779052 0.680601416525 0.0123851259926 1.07307674091 0.663960519495 11.4793867882 0.595067811349 0.255354019327 0.112138018559 0.72108127423 0. 0.2947402588 0.171527002844 1.04678252153 0.166942144533 0.0207482608192 0.0515545866334 0.294103848407 0.00675470149663 0.722558600771 0.21081306386 5.61878406624 0.353707057708 0.143153986138 0.0295066441118 0.27082080531 0.036527617573 0.392923461837 0.0543021739285 0.73796041319 0.111898158653 0.607469043142 0.42658669437 6.48078550527 0.214897870972 8.25817958502 3.64643404483 -0. 0.208975293263 0.113922477378 0.454907336945 0.527947416158 1.52290075472 0.499491662628 8.81867782892 0.162144537939 0.176899300708 0.339150496892 0.68155736895 0.243904893911 0.392613238257 0.235077576555 0.989929641162 0.0598904480749 0.0274939063586 0.0573185360404 0.220558213277 0.421217145809 0.469155144997 0.277763898137 4.77918871671 0. 0.0794382166745 0.130631183539 0.276353468502 0.158423765967 0.375150759131 0.0250784177391 0.818554705267 0.423651854092 0.932897423151 0.511556304679 3.77771578835 3.94974067907 10.060749705 4.3142715615 -1.06919091118 0.176544118626 0.62815843859 0.106929919545 0.625172320518 0.0983476708752 0.321057017741 0.0707726923527 13.0461448409 0.740214098892 0.5323200039 0.662033161825 0.555671637344 0.167882921301 0.254232048068 0.100907764286 0.612709770406 0.242146767217 0.324412275851 0.0715175841763 0.541526056137 0. 0.0203467517845 0.128916507747 4.65809384137 0.181788404383 1.09871502383 0.370878527838 0.517539462064 0.00597018697316 0.027004886244 0.130423699596 9.71419503953 0.996475979239 2.30362027852 0.771326354775 3.68110740354 0.574069449478 0.667747864717 0.357518830067 -0.124255890974 1.29327498652 0.049216033785 0.222982127914 0.0604731034924 0.80299117925 0.336520079351 0.239465907053 0.668765775192 10.0008088688 0.89905029628 1.10329562756 0.0812623827644 0.521666447963 0.020478509012 0.0788716826363 0.0723017837057 0.627028740646 0.0793409847722 0.183569879309 0. 0.535168096864 0. 0.154780680418 0.339970756151 3.70808312049 0.271651366993 0.458888099002 0.0631968307521 0.60855138889 0.000969590450287 0.129408342384 0.74578001827 10.9642335764 0.809321015463 1.26043846525 0.443541303106 6.32079872143 0.187046545446 0.779603904702 5.78656154224 -0.430633667495 0.216900752581 1.22423556589 0.1379606532 0.423782004361 0. 0.465596630589 0.125839128325 1.57018052588 0.499595707407 17.1424388709 0.630510821719 0.0770546407886 0.184781829392 0.80194232831 0.0778331486629 0.272675568284 0.154344824097 0.816164640218 0.181261351779 0. 0.289203423792 0.724311118449 0.430547822512 0.640397034316 0.185400847809 6.06769299227 0.336957380147 0. 0.0785717850552 0.563809365013 0. 0.879107248925 0.570402654692 15.1934005002 0.692558665128 0.543186719362 0.656469474346 4.55015113356 0.455496393966 14.8406602979 5.87378021279 -0.10782961655 0.397922832562 0.303043906275 1.15134235508 0.204418853685 0.371359365018 0.0922161117302 0.671905577877 0.407876429368 1.49131224744 1.22316074924 9.31364010052 0.0659344552593 0.144574201112 0.0925735408299 0.582475702388 0.0363355228639 0.297656428736 0.138440193879 0.659881107176 0.131631371164 0.0386775112254 0.149568084225 0.15703864353 0.245809837971 0.604325605926 0.462539132915 4.32018874731 0. 0.241384207368 0.00943776558503 0.474622377065 0.930923295825 1.57505991892 0.448160445025 8.27984902319 0.212526985917 0.662027832874 0.271951734254 5.3932152289 7.01796079889 13.2819260064 7.73152824174 -0.785114366281 0. 0.190582516962 0.0437245001644 1.60902617329 0.267703675237 0.172723544963 0.203174364247 0.24840311051 0.23889140142 0.287781434575 0.029901601348 8.72032227161 0.809949936009 1.27012921147 0.646006066362 0.263858017466 0.0911580000312 0. 0.0649890857122 0.588978777883 0.0593159278304 0.11311914885 0.127673720151 0.547537065571 0.00890813618702 0. 0.0160219806526 5.36614341439 0.321823878762 0.433766701507 0.153232412137 3.70023837835 0.451404912321 0.667859184893 0.381159496482 7.15133975759 0.765693663643 1.16326409239 0.756193823975 3.97556787065 0.0739449366022 1.30928853238 0.487292257318 -0.0932330048649 0.626458702051 0.147020840639 0.0783894286927 0.261572302761 1.54108436263 0.0203356376929 0.435931519232 0.163874623407 0.857984858575 0.215844705736 0.132020661072 0.581596595914 8.440142681 0.489582070011 0.887531645778 0.0330134663461 0.273150370312 0.142226319085 0.0929907118425 0.046271815886 0.616275281387 0.029319930779 0.139365079455 0. 0.44593197596 0.16281235461 0.131885848282 0.137662554377 5.38384064088 0.231910649926 0.405129195554 0.249998695284 4.60624374682 0.259025590052 0.940729844945 0.70354790234 10.809106611 0.673222830015 1.76599423259 0.383056109368 4.94461024512 0.324289399806 1.27641294791 3.64226215594 -0.115671087631 0.11099052262 0.523966729459 0.00825619242947 0.355096190579 0.273626760734 1.42924086577 0.190326900145 0.383735854706 0. 0.652083379392 0.0276221627974 1.28837929594 0.522186746577 6.74328786096 0.446545887313 0.109097648858 0.0210803305946 0.363099787521 0.0189067390323 0.207581570135 0.160645760092 0.651889079029 0.075801742214 0. 0.0473877911129 0.468659407859 0. 0.462535958607 0.518887856133 4.02344182321 0.297666753421 0.682490917891 0.251494236206 5.17276559213 0.229920577423 1.30998499607 0.620950341384 9.80097842168 0.792641443266 0.716049028897 0.340371268778 4.75383838917 0.398584556613 10.8895201843 3.39222524377 -0.0848119993015 0.0497111753355 0. 0.529676147046 0.218063169303 0.393785170806 0.389534896176 1.37035309167 0.181035586425 0.20545759066 0. 0.856323451482 0.631963013807 1.3992801786 0.563353589371 4.87278695277 0.0211020424287 0.0819252907359 0.0456965121717 0.197177035324 0.051473249901 0.188027970631 0.0844195663027 0.611932893809 0.0856434000193 0.161610141343 0.0593737882724 0.270441938039 0.169490119886 0.559077869937 0.245904264031 3.55100653969 0.328551756953 0.604424375658 0.392278042947 3.38035008941 0.520756692006 1.35443032822 0.371276014057 9.72265927134 0.398852401405 0.681732161833 0.397171209847 4.22304365899 4.28169336076 7.01100597142 3.51268072128 -2.2963661213 0.163164534263 0.572357770823 0.268914073677 0.329726654283 0. 0. 0. 0.618819652738 0.0340760214334 0.15660069592 0.137629051393 0.464863762542 0.0482339350431 0.0765141331328 0.0223618722052 4.93641399381 0.53919507183 0.778870379206 0.469274391055 0.529410506384 0.0102089226755 0.22936863473 0.00911296317807 0.951615777102 0.152092158452 0.195633518988 0.299143403733 0.792403150648 0.136536824369 0.292380158659 0.0634072465286 2.67929976566 0.111090266371 0.397993600546 0.273477085143 0.20004454144 0. 0. 0. 0.772323580557 0.0460467490792 0.274422295287 0.180438769889 0.345031512095 0.1169411809 0. 0.0862887154545 -0.36221886721 4.43749633365 0.198705602053 0.648323746956 0.068704432249 0.279665861526 0.00260402382336 0.141985679692 0.0423421376083 0.801368750052 0.223824905685 0.277391236847 0.0381087967915 0.497983733464 0.0469589556908 0.0268327207866 0.551348074861 10.1600786946 0.532862806093 1.2972973744 0. 1.35996071209 0. 0.457780412711 0.390328433347 1.35639448115 0.0821727427381 0.153319290359 0.407256454251 0.513142352844 0.0111661994826 0.336157828438 0.527409566821 3.84832736431 0.239717899947 0.829973779517 0.0644161274506 0.182748240199 0.0127517474922 0.174565348311 0.013411761878 0.849321327846 0.114319422746 0.116665223506 0.0177312509882 0.353509116466 0.108648716676 0.0492162804168 3.55997377287 -0.662844734956 0.24718672961 4.44643944812 0.312155165897 0.125249804856 0. 0.452865252824 0.0902557562959 0.780092420005 0. 1.08300931948 0.13064833238 0. 0.151981557649 0.403639021805 0.0102513824782 1.33684469853 0.5338563919 10.3812633396 0.691151745857 0.216592999189 0. 0.988823139793 0.297160088089 0.590577033043 0.412386887601 1.4165299385 0.0504868122996 0.308776833086 0. 0.765724055981 0.289704632468 0.598650479144 0.0352777339578 5.83174099423 0.37437356017 0.130108430271 0.114499334124 0.176488935715 0. 0. 0.281216744974 0.678643505586 0.216726769023 0.437232408654 0.0169010207316 0.193734873381 0.107114237976 7.62089842807 5.82215745173 -0.39718927436 0.582256314986 0.447372089267 3.00510556006 0.00523208328632 0.192717126765 0.0504732351332 0.271183148591 0.0739618424566 0.297135925765 0. 0.857837202389 0.0136678015112 0.112114970511 0.065541380167 0.354750352898 0.584297791039 1.24696119807 0.528300740757 6.53236720694 0.101472510413 0.110976638701 0. 0.70469406721 0.143001511783 0.292934968547 0.217703115206 1.18711697484 0.00759432390077 0.575520856236 0. 0.860908450835 0.326804098134 0.652075620805 0.265602198793 3.54052358699 0.0529274692445 0. 0. 0.13065909266 0.0921045261971 0.222944690332 0. 0.904397126722 0.0339390870035 0.0493798526259 0.077727243165 0.350455381219 3.06691219618 9.43091121002 4.23747456331 -0.266754024104 0.00650093716495 0.12800911926 0.0772980128718 2.86683009967 0.234582115115 0.445501850035 0.157126406069 0.290399172749 0.107595239865 0.108077202261 0.161561897413 0.699113848226 0.191697057858 0.162509316102 0. 0.607692951274 0.0469956221946 0.198918977485 0.0922159160776 7.58433037129 0.368490961564 1.08674774904 0.496812861248 0.666102043238 0.0990191396224 0.0920136908503 0.0821908436717 1.49081558785 0.154597741226 0.174755637165 0.146478461101 0.269216683997 0. 0.253567617568 0. 2.98327563942 0.233736190464 0.351757273558 0.139263081868 0.239430381403 0.0208928742124 0.222252319178 0.0175789101065 0.810861806823 0.279608431283 0.179458188958 0.195866758858 2.6854820791 0.398053984532 0.89809834227 0.247935202602 -0. 0.350679119366 0.171770055102 0.104925151245 0.27569187295 6.94829024374 0.334803148398 0.67706013313 0.193350480379 0.412581822479 0.0992653935902 0. 0.10635427699 0.699016591819 0.0539186926384 0.138446373546 0.153056250509 0.713312843099 0.0600509965939 0.255963010535 0.977892604151 14.4889648601 0.9706502979 0.881312161472 0.0346182115187 0.64545890404 0.134577713879 0.290715313336 0. 2.39103151387 0.273437271363 0.464611330894 0.246713626684 0.40332369024 0. 0.145163680564 0.372829638364 5.88638743233 0.226345198689 0.660313641705 0.190871514078 0.468824543611 0. 0.342786925459 0.0289876816848 0.926564298096 0.264713948349 0.168913634851 0.247713670257 4.30894205465 0.435130299606 0.538207204466 4.09158908846 -0.0852410654989 0.0511030057169 0.509274844394 0.0373529090687 0.702993747187 0.420627472897 5.42647743174 0.131536971718 0.0544918473889 0.0128070613042 0.524612151038 0.126370441821 0.153615064327 0.18902932533 0.51889155516 0.0343168562204 0.177500342967 0. 0.829123397045 0.142488350733 1.72654391503 0.629020310446 11.7406994673 0.890649274227 0.0675687379755 0.11742638392 1.01918916916 0.169065502496 0.563238316532 0.404080301794 1.757981046 0.033475292508 0.116203786627 0. 0.327480025776 0.0230249387485 0.594810129652 0.230254744366 5.0646899971 0.418798741428 0.104334665716 0.104697825563 0.407467483724 0.0406246231031 0.348189622419 0.21390374221 0.705834513063 0.0642328453938 0.553054947903 0.513442901514 4.26222018466 0.208573091283 10.5015585013 4.79812930239 -0.016450712606 0.216977814459 0.196903475283 0.251042590329 0.381360395441 0.413738227705 0.369887142101 4.88259977716 0.188049445316 0.176146965588 0.0503173213445 0.269668758345 0.0782349657847 0.280488056823 0.120251545162 0.618000796657 0.126134853645 0.401182869233 0.114756316467 0.597468154008 0.532005117974 1.72633341664 0.896161496941 12.3577660392 0.126652444404 0.183007805123 0.0120862345708 0.810724156403 0.546614503908 0.381149400912 0.262332528854 1.85559847553 0. 0.149062776866 0.0200114447219 0.530378592208 0.310737212864 0.615825997783 0.409391933973 5.39308092496 0.200657743084 0.0952515324537 0. 0.521862066811 0.0957681689554 0.441655874781 0.173274569629 0.711991153156 0.264993223104 0.150780925398 0.398721418433 3.85456065949 4.25450384849 13.2346289613 6.0736547061 -0.440603456097 0.175073392063 0.119622864329 0. 0.241873704132 0.0710770145015 0.0666045777945 0.13396754322 4.24467760612 0.219451207928 0.47068741368 0.159446593493 0.26107084768 0. 0.101681207607 0.0920335638825 1.24654760408 0.189595106863 0.221227691285 0.169635541932 0.565777108883 0.24512236772 0.122082481977 0.106034887959 10.4509269008 0.388387008742 1.12670684035 0.421873919179 0.887638019557 0.230073415723 0.215867259065 0.141579391234 0.747688670763 0.322956986932 0.151769782551 0.145090356887 0.19983239471 0. 0.138068910759 0.162894030212 4.12944027014 0.222269703418 0.334749332402 0.304982463476 0.380209684032 0. 0.0599817853084 0. 5.64715544394 0.843531318989 1.49518330985 0.696491513928 2.82691991286 0.272897891241 0.647969513561 0.270271138196 -0.0368326690502 0.516163584717 0.0402954019228 0.182113461448 0.0267329337356 0.295453650877 0. 0.0391106979068 0.346195590601 3.90722002563 0.251453752135 0.499977068872 0.0438768001794 0.3121885514 0. 0.0101561918638 0.194163815105 1.35154136626 0.256764960023 0.351956461653 0.170903537116 0.571102158636 0.106497372506 0.146134689188 0.650963876986 8.25974889116 0.620138351612 1.28022944042 0.122665881254 0.902940935388 0.0514628555172 0.223518006413 0.0584356644606 0.677203763896 0.159679451097 0.12007911109 0.00334815605962 0.3959196116 0.174551188289 0.159757167432 0.400908679613 3.8883577563 0.339738184481 0.655622431939 0.0665622505526 0.301088437109 0.0532895087776 0.074214780687 0.467362675757 7.53716823196 0.459313777385 0.972487425198 0.169797309845 3.67327701095 0.226350163374 0.743267916615 2.90494533079 -0.171217381999 0.0497713256843 0.703690916737 0.00377987735703 0.0210415170442 0.0860663292958 0.467325777053 0.128714715206 0.496303416213 0.423708568916 5.52927750422 0.209280636062 0.0873057422167 0. 0.259365039118 0.0275367980795 0.383471027046 0.204822857403 1.80740883282 0.200378182483 0.40275582395 0. 0.892186378848 0.0663342198387 1.69920321307 0.698565335305 14.5160708517 0.633401751827 0.234001345722 0.147947342925 0.935226991803 0.0778740557829 0.250771561241 0.0176325172834 0.747036852503 0.101064900471 0.139891600514 0.0267744784649 0.156853529895 0. 1.03113066727 0.393691514117 6.82845384705 0.361457674159 0. 0.0227540771818 0.432779186274 0.121581588911 1.00417952833 0.528467331925 10.1998063449 0.70292632121 0.575173027014 0.53026533446 3.85919571034 0.583793843694 7.55826014247 3.99957544825 -0.11046481743 0.259409163754 0.0640200209963 0.387824432047 0. 0.116530780141 0. 0.269206680089 0.396274595634 0.501678979087 0.285561984975 3.75701797435 0.0203002997396 0.117638129845 0. 0.276900338114 0.209721834182 0.425937609857 0.160289713534 1.42478289884 0.0133090770313 0.356482366509 0.0707080376994 0.809766978853 0.717499678142 1.05863963611 0.545701151656 8.66185832183 0.108602644392 0.230637865059 0.207292284638 0.538602837775 0.105996038363 0.180389920988 0.186551695414 0.654473921306 0.0307507719021 0.155170777697 0.0354792755932 0.326333864235 0.281965140344 0.534045303356 0.36860222882 4.52696158832 0.0512746128742 0.109908902216 0.031024119875 0.337401611895 0.399978877574 1.62914608647 0.776194566993 6.37590575281 0.26209124539 0.628104114236 0.229319936808 3.77378987738 2.82365702231 7.35426366874 3.24606543855 -0.28348427334 0.0699109092497 0.0115243665938 0.0247539692896 0.417015450631 0.135875392068 0.268295082193 0.145629497336 0.260780495373 0. 0. 0. 3.10401749226 0.233910519211 0.50550031745 0.274249624795 0.502928793045 0. 0.30256369977 0.102945787798 0.992034505912 0.241353238048 0.198457172634 0.154684893909 0.573358343749 0. 0.227077915261 0. 7.45434830156 0.424948012815 0.712630951997 0.524185596935 0.361367267025 0.0744190424464 0.112792427081 0.0734282242981 0.484091834767 0.111218952303 0.150743797934 0.0021339917222 0.293650150546 0. 0.02116599467 0. 3.38903656196 0.112898399837 0.478710281107 0.129217440647 3.21303018321 0.333544983719 0.784623002124 0.447344524196 5.70524160401 0.749006476972 0.94290384194 0.635394355901 2.6809463432 0.190350416362 0.506824958659 0.311522768636 -0.0441271017621 0.295578059389 0.00538296576352 0.110839307911 0.0967261383251 0.879962963336 0.239929977946 0.130401327035 0. 0.340950951096 0. 0.137440936288 0.346025987669 3.47636446237 0.278642779927 0.470025718811 0.112692964798 0.619099122427 0.00242780561576 0.173907015881 0.201742176005 0.999189599873 0.219477527941 0.921815929995 0.131841137033 0.676395318803 0. 0.194240135011 0.609370026677 9.57208990388 0.584905018757 0.898643131352 0.0236332695617 0.208932252302 0.217701165002 0.178589346395 0.0707708189865 0.75565077833 0. 0.0793080592395 0.179063482307 0.379112828132 0.176743685886 0.103537317554 0.461838184221 3.38109025265 0.227764370549 0.711382935742 0.33354958253 4.06165867022 0.524877361639 0.658211390383 0.735233306573 9.7497109579 0.731821772009 1.73956580152 0.265634075375 3.47770284375 0.463685252076 0.662645060954 2.65607159046 -0.0683387462584 0.0219629130994 0.277538132256 0.0218956105837 0.206201631706 0.0684822381157 0.407023501116 0.0451269026509 0.123393342911 0.072966956579 0.247768523847 0.0483266332068 0.606740463055 0.29820535935 2.6061321606 0.175109875588 0.144201033078 0.0824589690667 0.503437283862 0.0753138053082 0.392349366718 0.255603880722 1.52451708358 0.172409143922 0.189011576962 0.0325607363443 0.588467389971 0.0933720092444 1.2780171571 0.690762189525 7.24187169913 0.644942406325 0.0762203715741 0.045675693536 0.286183717598 0.0152119119626 0.180745081545 0.0659332293219 0.690175236215 0.126163675168 0.128302974079 0. 0.318741829473 0.0326199410537 0.498619723618 0.187967114517 2.82346513173 0.227608501656 0.505109007998 0.258054431799 3.92125357864 0.364902097321 1.24245726327 0.602397752765 8.63586700945 0.759728453173 0.583845430492 0.20994437703 3.64889395544 0.242635624424 4.90403632008 3.05311621448 -0.0306716260713 0.0814321197009 0.0263314010054 0.272678801329 0.106013680564 0.129532610405 0.0907157735716 0.532493488287 0.0109148306893 0. 0.162164771732 0.265180903915 0.392021613007 0.447741723488 0.282872330359 2.08107153488 0.0784322946977 0.148287907702 0.0731834628584 0.480938701331 0.194862987879 0.41943849415 0.136885175806 1.07543696247 0.0733045890116 0.170090519611 0.152154070687 0.575338518819 0.651042513614 0.990533484602 0.402752307023 5.51178277187 0.0423383577472 0.114394597746 0.0322564050447 0.290883488614 0.0176772594012 0.130997979349 0.0554591676 0.600771271188 0. 0.0290669346423 0.130598018554 0.373034762049 0.33093489787 0.412308156247 0.201480408382 2.63346193838 0.288284729936 0.743880049931 0.285467677785 2.4778577813 0.413816264532 1.08713768724 0.625062767287 5.87760116803 0.261761111281 0.472862376536 0.281657222631 2.33927651605 2.25924727523 6.49703836519 2.52893187835 - -0.0436588705204 0.0180416592111 0.0172705049816 0.0313059619256 0.0204318574391 0.00866565654901 0.00855826696922 0.0141519128344 0.0142075650725 0.0143506931474 0.00948176289506 0.0144385885967 0.0225118414231 0.0129557312092 0.0174966181456 0.0312026568728 0.0239028750731 0.014100885263 0.0142807205131 0.0174958592717 0.0150062262476 0.00953963818715 0.00766268420971 0.00948917307515 0.0109028479501 0.00974640899548 0.00766468852951 0.00853983079827 0.00982133662971 0.0113346471791 0.0146598494319 0.0173023151885 0.0185232762774 0.00942946755785 0.0112331321758 0.0129178678673 0.0182808830371 0.0124702528141 0.00976065350432 0.0142632664142 0.0110575600113 0.0125490239213 0.00953313419174 0.00870953731425 0.0110807056641 0.00941450435082 0.014224693302 0.0178827153121 0.0237376950165 0.0107759910236 0.00965035342006 0.0224624342706 0.015863351958 0.0110733401237 0.0109487196432 0.0142092703067 0.0157160768607 0.0182943776 0.015043406603 0.0204114839078 0.0240554444316 0.0186483208344 0.0239797623875 0.0436191635614 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT - diff --git a/PhyloCSF_Parameters/23flies.nh b/PhyloCSF_Parameters/23flies.nh deleted file mode 100644 index 31aa0bf..0000000 --- a/PhyloCSF_Parameters/23flies.nh +++ /dev/null @@ -1,67 +0,0 @@ -( - ( - ( - ( - ( - ( - ( - ( - ( - ( - ( - ( - ( - dmel:0.0542029, - ( - dsim:0.0213103, - dsec:0.0227973 - ):0.0242621 - ):0.0585014, - ( - dyak:0.0889658, - dere:0.0771526 - ):0.0254381 - ):0.181996, - ( - dbia:0.126739, - dsuz:0.0934222 - ):0.0964756 - ):0.0125386, - ( - dana:0.132676, - dbip:0.134892 - ):0.531515 - ):0.00264138, - deug:0.318569 - ):0.0369765, - dele:0.207426 - ):0.0025605, - dkik:0.485329 - ):0.00243957, - dtak:0.226746 - ):0.0143511, - drho:0.195624 - ):0.0495906, - dfic:0.257704 - ):0.290027, - ( - ( - dpse:0.0138526, - dper:0.014979 - ):0.00969914, - dmir:0.0172853 - ):0.398344 - ):0.150107, - dwil:0.550935 - ):0.0418275, - ( - ( - ( - dvir:0.242786, - dmoj:0.321598 - ):0.090819, - dalb:0.436249 - ):0.0143777, - dgri:0.318782 - ):0.162991 -); \ No newline at end of file diff --git a/PhyloCSF_Parameters/23flies_coding.ECM b/PhyloCSF_Parameters/23flies_coding.ECM deleted file mode 100644 index cecefde..0000000 --- a/PhyloCSF_Parameters/23flies_coding.ECM +++ /dev/null @@ -1,71 +0,0 @@ -0.704683 -21.246849 0.244381 -1.285623 24.077005 0.379462 -1.686611 0.202683 0.058649 0.202431 -0.082680 1.070070 0.000000 0.054512 17.776808 -0.022382 0.018864 0.493817 0.109334 33.264571 12.649106 -0.296153 0.284082 0.091160 1.987226 28.513525 28.550711 20.106160 -10.110351 0.203943 0.678176 0.704075 2.296469 0.170185 0.005570 0.403661 -0.250353 3.401392 0.072390 0.339075 0.312478 2.535100 0.079470 0.720947 1.718855 -1.957925 0.112645 6.051152 0.559190 0.182778 0.166356 1.106757 0.205481 81.876527 1.176596 -0.430880 0.326925 0.155502 4.087453 0.340486 0.238443 0.091285 4.708209 1.821642 33.026231 0.853084 -0.824682 0.000000 0.050266 0.143753 2.686747 0.222009 0.000000 0.170604 1.175220 0.000000 0.066678 0.188612 -0.038299 0.343243 0.000000 0.005077 0.110613 0.702038 0.136417 0.042543 0.072594 0.404052 0.077817 0.043019 16.344290 -0.110354 0.043260 0.226320 0.082963 0.321872 0.020644 1.037156 0.178174 0.206265 0.047891 0.734665 0.080387 2.288823 0.415881 -0.057554 0.064736 0.036226 0.500428 0.000000 0.033774 0.028629 2.361795 0.096649 0.082891 0.182564 0.481770 26.209477 26.031989 0.948770 -2.592045 0.315567 0.032405 0.267518 0.438032 0.065081 0.072433 0.125092 1.084512 0.001026 0.524214 0.331504 0.231756 0.012267 0.076370 0.022302 -0.129204 0.982385 0.068509 0.286913 0.016097 0.151188 0.000000 0.104314 0.253764 0.097968 0.214733 0.359898 0.000000 0.058085 0.023245 0.048257 1.600227 -0.047628 0.073308 0.650338 0.218750 0.073551 0.009380 0.204879 0.038744 0.000000 0.101242 0.271272 0.000000 0.018086 0.012080 0.130037 0.014327 24.074715 0.919928 -0.285461 0.364317 0.112988 1.623951 0.070481 0.006170 0.115755 0.183985 0.000000 0.343260 0.000000 0.000000 0.111756 0.021344 0.041850 0.065750 2.932725 42.733986 1.508892 -0.270938 0.039912 0.013938 0.032013 2.780905 0.058375 0.000000 0.000000 0.183091 0.010489 0.144223 0.058332 0.230893 0.031971 0.059047 0.005021 2.536950 0.087468 0.198532 0.169817 -0.019126 0.104872 0.006262 0.035012 0.036140 0.657644 0.080323 0.000000 0.052889 0.122373 0.056399 0.052429 0.053126 0.058255 0.004767 0.021207 0.055629 0.495392 0.000000 0.018111 18.674069 -0.006133 0.000000 0.090480 0.033084 0.000000 0.068378 1.038125 0.000000 0.000000 0.025462 0.010633 0.000000 0.000000 0.017659 0.100707 0.014347 0.153132 0.057720 0.931194 0.042816 34.894165 15.319585 -0.103278 0.064757 0.027371 0.212007 0.103688 0.000000 0.000000 4.012458 0.215859 0.051146 0.000000 0.258130 0.069157 0.026748 0.042132 0.290166 0.285958 0.037932 0.100554 1.567318 33.455540 39.586962 22.985732 -0.670331 0.230360 0.179345 0.000000 0.000000 0.014076 0.048084 0.149552 40.665320 0.000000 5.399983 0.426864 0.046003 0.035322 0.020282 0.000000 2.929298 0.000000 0.146174 0.549349 0.794139 0.013745 0.046290 0.042499 -0.107106 0.000000 0.000000 0.240088 0.000000 0.016538 0.016239 0.000000 3.654832 0.571052 4.775858 0.000000 0.016161 0.002643 0.000000 0.030126 0.481656 1.321280 0.000000 0.000000 0.036754 0.228096 0.000000 0.034038 22.455047 -0.217591 0.243264 0.479832 0.000000 0.065015 0.039285 0.016562 0.000000 3.020358 0.000000 44.235882 0.399701 0.005605 0.027004 0.054798 0.000000 0.000000 0.016626 1.930574 0.556805 0.005920 0.023351 0.602760 0.081580 57.679880 22.449621 -0.095245 0.203775 0.030416 0.000000 0.099590 0.000000 0.000000 0.088770 6.398701 0.000000 5.249641 1.040400 0.024524 0.014474 0.001228 0.026026 0.009788 0.000000 0.226711 2.449416 0.024233 0.005492 0.001568 1.018571 40.770596 43.442597 28.753059 -0.194598 0.014181 0.014679 0.017517 0.464018 0.000000 0.000000 0.094073 0.248226 0.000488 0.024767 0.029802 3.372305 0.144326 0.581090 0.267394 1.807368 0.072072 0.125911 0.157946 1.987202 0.000000 0.000000 0.269774 0.721419 0.011610 0.169076 0.040987 -0.041530 0.063324 0.000000 0.011465 0.000000 0.181868 0.000000 0.000000 0.058036 0.068771 0.061094 0.022512 0.384783 1.736442 0.132669 0.023532 0.011758 0.648055 0.066903 0.042106 0.006409 0.601218 0.000000 0.006766 0.093949 0.306244 0.061756 0.028850 20.388500 -0.000000 0.000000 0.057012 0.000050 0.000000 0.000000 0.128166 0.000000 0.000000 0.007620 0.079417 0.000000 0.287108 0.033420 1.034159 0.205855 0.196980 0.025359 0.383712 0.011921 0.015469 0.000000 0.414758 0.000000 0.006948 0.014377 0.330523 0.000000 25.600805 11.352211 -0.087719 0.037648 0.014926 0.151283 0.108849 0.031347 0.000000 0.583867 0.129665 0.033842 0.067070 0.149390 0.368587 0.256987 0.373825 3.469940 0.298492 0.090341 0.099415 1.508596 0.181871 0.044089 0.000000 2.939743 0.092710 0.067523 0.102786 0.980654 32.453450 46.488367 14.452792 -2.220475 0.206816 0.000000 0.306768 0.424399 0.059495 0.046092 0.168806 0.917116 0.045883 0.262000 0.237490 0.131218 0.000000 0.041658 0.219744 2.273189 0.020382 0.068293 0.226478 0.237688 0.028164 0.033532 0.091481 0.000000 0.163597 0.000000 0.000000 0.118703 0.000000 0.098005 0.010956 -0.134573 0.945698 0.045787 0.239222 0.046365 0.128494 0.019130 0.072626 0.121273 0.282269 0.112181 0.108509 0.000000 0.050305 0.008301 0.032545 0.086338 0.138431 0.068381 0.241153 0.023043 0.061316 0.009558 0.035812 0.000000 0.059719 0.000000 0.007459 0.000264 0.027863 0.000000 0.014933 2.104670 -0.000000 0.062002 0.389224 0.134380 0.061847 0.001571 0.142788 0.040878 0.000000 0.067368 0.214914 0.024713 0.050105 0.051619 0.054850 0.000000 0.009271 0.067315 0.695552 0.034531 0.032598 0.006761 0.076182 0.022477 0.090016 0.000000 0.200545 0.050623 0.016092 0.019950 0.000000 0.029435 19.494910 1.170712 -0.192727 0.128593 0.070927 1.485716 0.050393 0.024840 0.038926 0.260893 0.056113 0.080932 0.025865 0.334860 0.059904 0.006229 0.011429 0.043097 0.149364 0.135828 0.082484 0.262390 0.031524 0.019769 0.014847 0.125841 0.060782 0.000000 0.049055 0.071553 0.010314 0.001004 0.000000 0.064772 2.933105 22.652339 1.384367 -0.469875 0.107525 0.051468 0.098070 9.194789 0.080476 0.066506 0.264016 0.657393 0.087269 0.013012 0.130337 0.744951 0.000000 0.165162 0.054878 0.437168 0.031482 0.085032 0.023888 3.571811 0.114918 0.089254 0.279537 0.163468 0.051393 0.000000 0.000000 0.326801 0.073170 0.006912 0.000000 1.603015 0.118923 0.132484 0.107812 -0.019292 0.175173 0.013241 0.100593 0.000000 1.603038 0.046060 0.059925 0.031717 0.355865 0.117265 0.083129 0.000000 0.243049 0.029300 0.000000 0.033522 0.021505 0.016014 0.069034 0.000342 0.782419 0.085492 0.045462 0.000000 0.006461 0.045161 0.024729 0.000000 0.139720 0.005215 0.026429 0.095703 0.317319 0.039260 0.029366 12.576617 -0.091539 0.120620 0.155170 0.002362 0.000000 0.135595 4.055080 0.238262 0.000000 0.069614 0.278643 0.023336 0.363518 0.000000 0.326058 0.000000 0.149248 0.086708 0.217166 0.000000 0.073249 0.140854 1.699912 0.218157 0.000000 0.027685 0.108983 0.058702 0.032554 0.000000 0.133389 0.029813 0.233478 0.103428 0.690950 0.039666 31.441594 9.948192 -0.063615 0.110006 0.045285 0.330163 0.361179 0.000000 0.000000 5.789920 0.178264 0.112170 0.000000 0.625745 0.000000 0.000000 0.082603 0.531462 0.031583 0.040361 0.042601 0.086254 0.297269 0.000000 0.000000 3.559143 0.125367 0.018479 0.000000 0.035706 0.174922 0.000000 0.000000 0.531992 0.232086 0.081087 0.086226 0.623109 22.274226 21.166886 16.358880 -0.233107 0.000000 0.070302 0.444077 0.342175 0.138937 0.000000 0.181981 2.742144 0.067924 0.000000 0.316865 0.239106 0.000000 0.031947 0.055378 0.155724 0.000000 0.049867 0.465401 0.154256 0.036162 0.003766 0.123528 0.676685 0.010137 0.000000 0.000000 0.082238 0.005285 0.002813 0.024818 1.330657 0.000000 0.012196 0.203719 3.204597 0.000000 0.370033 0.216610 -0.062751 0.633127 0.000000 0.000000 0.089182 0.095239 0.132365 0.021210 0.340553 2.258760 0.000000 0.047059 0.000000 0.132867 0.007246 0.000000 0.046733 0.264003 0.001925 0.000000 0.038797 0.065982 0.031012 0.015676 0.193117 0.214336 0.000000 0.000000 0.000136 0.044270 0.005193 0.002390 0.080784 0.740933 0.000000 0.000000 0.000000 1.090606 0.000000 0.131509 16.355966 -0.177147 0.000000 0.372676 0.463084 0.347318 0.147341 0.358777 0.096225 0.000000 0.332847 4.828983 0.555991 0.229884 0.000000 0.227954 0.059194 0.148002 0.000000 0.352444 0.383594 0.135507 0.090852 0.230341 0.000000 0.245232 0.000000 0.986063 0.000000 0.041554 0.017631 0.076875 0.049689 0.516505 0.205064 1.725241 0.379256 0.208024 0.091212 4.640254 0.455890 48.461943 21.940299 -0.137940 0.146398 0.000000 0.545248 0.000000 0.063170 0.067905 0.469713 0.000000 0.113267 0.789388 3.945789 0.000260 0.000000 0.019907 0.107056 0.092126 0.073370 0.000000 0.089538 0.032421 0.023650 0.020328 0.293293 0.000000 0.000000 0.234129 1.084429 0.001631 0.008024 0.000000 0.107047 0.129782 0.066626 0.025694 0.896088 0.397240 0.046041 0.000000 2.574020 23.330898 29.938406 30.377789 -0.484279 0.022572 0.033412 0.079042 1.757453 0.122791 0.143024 0.355543 0.544421 0.049494 0.118079 0.104815 10.484896 0.322883 0.543932 0.974207 0.296487 0.025782 0.050101 0.057919 0.680284 0.056120 0.025735 0.045656 0.175262 0.017153 0.000000 0.000000 3.328981 0.000000 0.000000 1.662731 1.384547 0.055413 0.068152 0.089770 5.647599 0.000000 0.532778 0.732707 1.282864 0.000000 0.581676 0.100075 -0.042215 0.123904 0.001643 0.063633 0.097200 0.673142 0.018895 0.210397 0.077771 0.218275 0.067555 0.112123 0.836738 4.381956 0.079997 0.272743 0.037956 0.062051 0.000732 0.046146 0.033691 0.166194 0.047069 0.058309 0.007090 0.034249 0.022080 0.010480 0.193181 1.197265 0.049026 0.224340 0.067297 0.297595 0.005332 0.038379 0.383849 1.946621 0.275556 0.289375 0.123584 0.441522 0.148201 0.035246 21.262573 -0.000000 0.011278 0.061097 0.000000 0.123920 0.000000 0.465062 0.035154 0.011947 0.020248 0.152795 0.005040 0.669656 0.278413 0.981454 0.255805 0.025804 0.009769 0.084479 0.006607 0.029813 0.011802 0.138968 0.041149 0.003847 0.000000 0.052776 0.000000 0.142640 0.091682 0.637297 0.000000 0.022770 0.018267 0.249278 0.000042 0.269390 0.003167 1.786243 0.000000 0.000000 0.010239 1.090026 0.000000 32.810401 13.606975 -0.100789 0.052347 0.021978 0.252944 0.245654 0.141640 0.000000 1.708761 0.135939 0.091693 0.079072 0.338624 0.875229 0.153260 0.219435 7.372884 0.077527 0.028807 0.013221 0.131361 0.120042 0.017497 0.000000 0.697589 0.005673 0.005004 0.003311 0.098324 0.000000 0.224434 0.006010 2.528101 0.259394 0.034249 0.021170 0.515197 0.692663 0.063161 0.060058 4.904895 0.168292 0.000000 0.198919 1.100055 30.347230 35.111427 17.921575 -2.859059 0.134689 0.000000 0.259700 0.436002 0.000000 0.000000 0.052899 1.662989 0.045373 0.727256 0.057128 0.463000 0.000000 0.032161 0.063939 4.519148 0.270807 0.000000 0.401340 0.752023 0.000000 0.002277 0.140723 0.897880 0.000000 0.368486 0.000000 0.498935 0.000000 0.000000 0.061340 1.908136 0.106462 0.000000 0.165930 0.388644 0.000000 0.000000 0.004034 0.357271 0.017497 0.262317 0.010912 0.512636 0.042889 0.000000 0.071997 -0.058731 0.190380 0.007881 0.070698 0.009489 0.054984 0.000000 0.028056 0.006290 0.054618 0.000000 0.043591 0.000000 0.070675 0.014004 0.003798 0.098959 0.888731 0.023085 0.397500 0.014320 0.032681 0.000000 0.015270 0.052803 0.016365 0.056956 0.069776 0.027075 0.135569 0.000000 0.054656 0.000000 0.000000 0.037560 0.112678 0.014675 0.007542 0.033942 0.019395 0.000000 0.132405 0.000000 0.018492 0.021457 0.061452 0.009759 0.026933 0.534376 -0.292409 0.135199 0.761955 0.144129 0.089295 0.002520 0.188467 0.062967 0.000000 0.043743 0.150133 0.095202 0.072349 0.069024 0.117114 0.038547 0.370670 0.281397 1.981203 0.327188 0.173247 0.000000 0.352243 0.141961 0.006541 0.241639 0.652460 0.169076 0.046313 0.000000 0.066860 0.105993 0.189375 0.130901 0.591624 0.119817 0.080836 0.000000 0.246418 0.025046 0.022972 0.012897 0.770402 0.057972 0.085206 0.000000 0.103121 0.035498 347.458068 0.372023 -0.063294 0.130152 0.040262 0.472048 0.021568 0.007626 0.034463 0.128569 0.120281 0.050118 0.099176 0.122073 0.064992 0.000000 0.035590 0.169451 0.156755 0.527105 0.075861 1.863747 0.007656 0.009861 0.014984 0.190019 0.000000 0.086588 0.000000 0.107535 0.036482 0.000000 0.080036 0.334040 0.174902 0.220447 0.000000 0.090832 0.003732 0.034539 0.000000 0.060005 0.236962 0.000000 0.177069 0.071601 0.050255 0.044863 0.006514 0.154126 1.525730 42.329209 1.047081 -0.369397 0.074624 0.024092 0.078207 6.681391 0.168156 0.581769 1.190500 0.454593 0.234727 0.026094 0.221380 0.512749 0.056937 0.095297 0.000000 0.649482 0.040726 0.089689 0.102655 5.326834 0.000000 0.287479 1.296893 0.320151 0.020388 0.000000 0.000000 0.000000 0.353876 0.000000 0.000000 0.315342 0.056518 0.043658 0.053422 6.166184 0.314975 0.827853 0.316700 0.331875 0.048140 0.402466 0.070427 0.936756 0.000000 0.000000 0.351024 2.906935 0.053119 0.350418 0.060454 -0.028373 0.220302 0.005778 0.049372 0.261660 2.020079 0.098951 0.106332 0.042055 0.736011 0.074320 0.183924 0.021895 0.123166 0.008584 0.034243 0.052249 0.149697 0.010620 0.032827 0.082245 1.374991 0.015789 0.389454 0.000577 0.050391 0.037388 0.015066 0.128749 0.095160 0.000000 0.118050 0.044102 0.108573 0.009504 0.021825 0.370284 1.945901 0.220449 0.292645 0.084001 0.166172 0.069029 0.045738 0.041522 0.210436 0.007611 0.000000 0.124620 0.220369 0.005267 0.020198 18.950349 -0.008318 0.016298 0.077147 0.055879 0.494118 0.150502 3.024822 0.000000 0.000000 0.120866 0.154335 0.155165 0.002249 0.011156 0.147259 0.062931 0.094414 0.013077 0.179421 0.041454 0.170670 0.000000 1.485354 0.000000 0.000000 0.007951 0.125300 0.014506 0.232574 0.000000 0.088074 0.104030 0.038831 0.012324 0.066711 0.023157 0.497341 0.133397 2.898036 0.195153 0.014152 0.064431 0.301537 0.016176 0.007430 0.070364 0.106274 0.000000 0.000000 0.000000 0.938944 0.016739 38.933632 16.731807 -0.130055 0.148689 0.034097 0.398366 0.651783 0.348774 0.286709 8.459715 0.285617 0.380305 0.000000 1.217497 0.121462 0.037780 0.057141 0.337459 0.145853 0.089394 0.055501 0.380714 0.664995 0.379499 0.035124 7.126025 0.064679 0.018897 0.020877 0.253161 0.000000 0.179264 0.000000 0.619382 0.131765 0.072252 0.041487 0.228965 0.645519 0.501063 0.642293 6.085236 0.134379 0.045373 0.263552 0.527250 0.055180 0.039711 0.000000 0.849429 0.545823 0.030315 0.353142 0.970124 33.768017 38.728493 23.190402 -0.727363 0.109400 0.024683 0.098209 0.542926 0.000000 0.068441 0.057398 5.338506 0.242049 0.713601 0.373930 0.246841 0.036450 0.075766 0.093416 1.312131 0.221806 0.089761 0.186343 0.930333 0.000000 0.073225 0.139443 6.391422 0.000000 0.276197 0.000000 0.380180 0.000000 0.000000 0.075234 0.594581 0.106641 0.021648 0.086134 0.495116 0.000000 0.048479 0.010205 2.238835 0.000000 0.694438 0.149376 0.547589 0.000000 0.044953 0.049102 307.938100 0.238698 65.024561 0.461351 3.484450 0.000000 0.189228 0.444197 -0.000000 0.000000 0.005646 0.229902 0.023799 0.129363 0.022142 0.037768 0.114464 1.016550 0.110671 0.000000 0.016143 0.084965 0.011166 0.003837 0.007202 0.101959 0.015510 0.054105 0.011181 0.057794 0.008794 0.001388 0.001336 0.497595 0.000000 0.000000 0.015620 0.119917 0.000000 0.028796 0.000000 0.068854 0.004663 0.000000 0.031677 0.120479 0.036966 0.015746 0.052443 0.391626 0.114670 0.000000 0.034366 0.177083 0.012189 0.031733 0.212685 0.386708 0.118160 0.062207 0.128217 0.635647 0.039912 0.157119 1.242350 -0.033079 0.013743 0.023916 0.016385 0.022602 0.002116 0.038342 0.013321 0.122782 0.033580 0.644959 0.040582 0.045594 0.008429 0.069618 0.021172 0.067860 0.030530 0.074203 0.047872 0.034391 0.000000 0.054546 0.019230 0.106788 0.000000 0.739273 0.015430 0.054382 0.000000 0.036286 0.049613 0.022855 0.005969 0.021506 0.004436 0.026344 0.001445 0.047273 0.008809 0.040623 0.003882 0.745195 0.009885 0.034086 0.006438 0.044876 0.021321 0.397382 0.107600 1.928691 0.280394 0.103566 0.009490 0.250330 0.074413 2.862718 0.265466 -0.111417 0.467798 0.000000 0.000000 0.057461 0.031412 0.011231 0.338564 0.079952 0.000000 0.000000 2.438078 0.025277 0.000000 0.031744 0.191138 0.138381 0.075509 0.000000 0.230760 0.022280 0.003378 0.000000 0.287789 0.202719 0.000000 0.136991 1.427628 0.042769 0.013625 0.022037 0.361738 0.097921 0.000000 0.000000 0.147320 0.065418 0.022429 0.000000 0.305805 0.020906 0.016408 0.131390 1.097096 0.071178 0.055718 0.019322 0.354879 0.599622 0.075679 0.390486 1.187259 0.119489 0.043329 0.026499 2.334275 2.443146 67.971059 0.517326 -0.491329 0.033871 0.000000 0.057351 1.230314 0.000000 0.000000 0.335732 0.258455 0.011126 0.114284 0.098918 6.628141 0.418389 0.885928 0.278607 0.068902 0.041204 0.184731 0.053825 1.069373 0.002543 0.000000 0.146038 0.319851 0.000000 0.000000 0.087855 51.867318 4.002421 3.730938 11.967459 0.000130 0.009880 0.122766 0.044492 0.924246 0.000000 0.034304 0.321394 0.216424 0.005500 0.165891 0.012531 4.932338 0.493719 0.309700 0.299789 5.966049 0.282593 0.450167 0.162242 5.984462 0.270723 0.284164 0.639894 4.485779 0.144482 0.253797 0.274695 -0.000000 0.019356 0.016798 0.021995 0.000000 0.069745 0.016072 0.017431 0.000000 0.031154 0.035254 0.010345 0.070605 0.328560 0.082723 0.103825 0.006839 0.077265 0.008479 0.096511 0.003727 0.081266 0.025795 0.000000 0.003408 0.040081 0.029227 0.004186 0.102272 0.978333 0.225794 0.015924 0.251781 0.000000 0.000000 0.012760 0.013899 0.053653 0.025722 0.000953 0.000000 0.062419 0.000000 0.000000 0.052251 0.410263 0.018820 0.000000 0.038666 1.730986 0.046872 0.557497 0.040784 0.419973 0.039164 0.000000 0.111893 0.278697 0.089269 0.057809 0.716509 -0.101984 0.002697 0.040867 0.024331 0.044287 0.016535 0.306444 0.008147 0.039780 0.003442 0.073740 0.031667 0.623710 0.234408 2.262342 0.227478 0.000000 0.000000 0.192142 0.031680 0.061057 0.000000 0.169427 0.076306 0.034997 0.000000 0.144713 0.045551 9.171523 4.940184 21.212916 4.852324 0.000000 0.000845 0.089633 0.010326 0.160730 0.037983 0.303564 0.000000 0.005803 0.009027 0.233859 0.027310 0.873936 0.000000 1.160209 0.449760 0.076063 0.097200 1.100709 0.023047 0.846809 0.000000 0.879353 0.458354 0.374045 0.065264 0.647484 0.104813 42.531854 0.272450 -0.122962 0.036196 0.000000 0.056697 0.073584 0.005514 0.000000 0.235927 0.075866 0.019073 0.000000 0.071920 0.161836 0.118851 0.163445 0.866550 0.079848 0.110451 0.007895 0.155610 0.065113 0.000301 0.000000 0.355667 0.035350 0.011198 0.000000 0.105067 0.356677 0.136367 0.000000 3.304619 0.000000 0.044129 0.170136 0.029021 0.043727 0.015468 0.000000 0.172355 0.070593 0.000000 0.093994 0.082345 0.189117 0.020373 0.023266 1.005651 0.375382 0.551574 0.177836 3.735614 0.216399 0.005424 0.000000 1.602872 0.288834 0.068437 0.291196 0.879621 3.707395 37.967642 1.416108 - -0.017705 0.025102 0.038323 0.021820 0.011736 0.021070 0.014321 0.010200 0.005516 0.020228 0.006702 0.012128 0.010150 0.022067 0.023461 0.017042 0.016296 0.015657 0.035566 0.010788 0.014202 0.017815 0.015752 0.007369 0.008745 0.017101 0.008331 0.008579 0.008684 0.013803 0.037665 0.009446 0.022330 0.023558 0.041574 0.027731 0.012963 0.032064 0.013706 0.014380 0.017590 0.024788 0.004681 0.012785 0.006619 0.013421 0.027337 0.011342 0.000849 0.018348 0.000712 0.011525 0.008305 0.019496 0.016278 0.007339 0.000540 0.013259 0.009921 0.005825 0.004952 0.021466 0.016774 0.014173 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT diff --git a/PhyloCSF_Parameters/23flies_noncoding.ECM b/PhyloCSF_Parameters/23flies_noncoding.ECM deleted file mode 100644 index 113490e..0000000 --- a/PhyloCSF_Parameters/23flies_noncoding.ECM +++ /dev/null @@ -1,71 +0,0 @@ -2.601764 -5.371564 3.543195 -2.228525 4.751887 2.144120 -2.259368 0.446709 0.528969 0.305919 -0.425539 4.203755 0.315885 0.472428 4.294746 -0.539515 0.087689 3.683795 0.204184 8.409182 3.794250 -0.300953 0.724468 0.360016 2.232992 3.839126 8.919614 3.859389 -5.608456 0.723982 1.815124 0.562503 3.551939 0.453143 0.680907 0.395174 -0.519681 9.969147 0.722491 0.874669 0.297591 5.360563 0.200132 0.698375 5.361866 -1.038558 0.540463 10.533255 0.554739 0.736603 0.309096 3.939220 0.384434 12.203109 5.007271 -0.569012 1.349498 0.778173 4.833659 0.259741 0.721588 0.452134 4.812171 4.809548 8.754198 3.919616 -2.475545 0.407883 0.920713 0.450421 6.018192 0.731251 1.055057 1.016812 3.559324 0.201102 0.572845 0.227164 -0.332400 3.315542 0.272940 0.538351 0.508442 6.994964 0.481002 1.251291 0.371448 3.543863 0.330819 0.620549 2.999636 -0.465798 0.212207 3.019417 0.315170 1.291523 0.475720 8.356594 0.495020 0.629332 0.256428 3.307970 0.396199 6.091033 2.294281 -0.395290 0.530621 0.300509 2.159400 0.444752 0.989907 0.299532 4.833089 0.301792 0.384792 0.274214 2.233042 2.952070 4.567582 2.371345 -2.537838 0.265364 0.619250 0.228247 0.333262 0.019182 0.028284 0.048082 0.761782 0.147941 0.237332 0.101637 0.405712 0.064682 0.136610 0.038210 -0.180853 3.395579 0.240751 0.420291 0.000000 0.550213 0.116313 0.000000 0.255209 0.686030 0.030800 0.309738 0.084052 0.205627 0.125073 0.059029 2.835389 -0.418163 0.257527 3.796286 0.212701 0.250088 0.051044 0.288369 0.032087 0.355297 0.083461 1.251203 0.080906 0.000000 0.052421 0.302709 0.032390 7.520830 4.533323 -0.323260 0.625461 0.200982 2.375716 0.038590 0.145281 0.000000 0.397393 0.138558 0.287319 0.229586 0.518443 0.089044 0.161537 0.051860 0.316217 2.598327 6.720047 3.203515 -0.298643 0.144420 0.090080 0.030805 3.143189 0.419743 0.686280 0.257317 0.549064 0.027381 0.014863 0.089086 0.633826 0.038900 0.249634 0.061265 3.570739 0.538877 1.126035 0.246850 -0.150898 0.327010 0.000000 0.077290 0.435934 7.715268 0.252689 0.618272 0.000000 0.568054 0.339822 0.096548 0.000000 0.644953 0.191054 0.184063 0.269722 5.001129 0.592423 0.822916 6.905759 -0.166798 0.105621 0.238045 0.000000 0.376857 0.411835 5.824799 0.161156 0.055213 0.015132 0.157083 0.161035 0.250717 0.022639 0.482721 0.047397 0.502488 0.548443 5.350243 0.208878 15.760407 6.222900 -0.156969 0.105274 0.000000 0.274437 0.457231 1.041763 0.123402 3.910557 0.036560 0.156766 0.078551 0.393534 0.000000 0.274165 0.235918 0.555029 0.203042 0.545134 0.467007 3.294009 5.388919 19.523039 6.551734 -0.619827 0.008405 0.000000 0.026078 0.200716 0.180761 0.137833 0.090334 5.478498 0.332423 0.801353 0.236696 0.256294 0.039021 0.168804 0.009535 8.846311 0.663707 1.813567 0.468653 3.768640 0.364336 0.679333 0.531909 -0.030355 0.363879 0.093984 0.159208 0.072346 0.133369 0.000000 0.000000 0.194957 4.201457 0.314183 0.496070 0.004906 0.210483 0.000000 0.081339 0.597165 10.436439 0.887898 0.915306 0.023824 4.709414 0.376669 0.818878 4.849630 -0.081763 0.021776 0.845303 0.049470 0.159582 0.033683 0.408199 0.162264 0.741804 0.277220 6.558430 0.160911 0.000000 0.073730 0.208241 0.000000 1.305791 0.552696 13.862535 0.479726 0.726611 0.623501 5.502429 0.141505 12.161083 6.169591 -0.089828 0.179816 0.202436 0.298585 0.063021 0.301649 0.000000 0.448382 0.107339 0.493931 0.125674 3.865954 0.081707 0.192678 0.000000 0.205618 0.322922 1.335129 0.843032 8.353419 0.460001 0.480086 0.416980 3.940683 5.115753 11.949063 5.823031 -0.376337 0.017277 0.351610 0.084528 0.795067 0.254141 0.269713 0.178817 0.348072 0.000000 0.421144 0.054545 3.768430 0.369239 0.556171 0.374934 3.468226 0.240114 0.710215 0.389895 9.449287 1.059654 1.588288 1.112749 3.280203 0.119310 1.020226 0.396886 -0.026712 0.334533 0.152899 0.068203 0.126086 0.521896 0.285383 0.449907 0.058720 0.483207 0.296040 0.108356 0.197247 3.635456 0.240431 0.433202 0.228583 5.503828 0.592082 0.540483 0.921313 16.880444 0.749070 1.828049 0.365739 6.589636 0.573144 0.758322 5.226270 -0.133797 0.023152 0.293286 0.032464 0.155817 0.122195 0.846251 0.079564 0.013570 0.073967 0.467264 0.028818 0.501867 0.197761 3.206049 0.211305 0.527745 0.322195 5.486183 0.304329 1.700719 0.891706 13.835580 1.249022 0.564950 0.467363 5.345337 0.289211 10.098627 5.577783 -0.000176 0.121670 0.268158 0.301608 0.075802 0.416462 0.207420 0.772697 0.221044 0.025585 0.000000 0.364748 0.541893 0.555350 0.208302 2.142846 0.262543 0.483365 0.296216 3.011180 0.700939 1.208349 0.831779 10.503339 0.438770 0.604402 0.240417 3.691809 4.135103 12.330823 3.796772 -6.611485 0.649387 1.056040 0.500083 0.706847 0.065476 0.051755 0.149975 1.728769 0.197157 1.005486 0.181808 0.631623 0.205861 0.210231 0.147443 3.098716 0.301548 0.554122 0.263890 0.507405 0.169642 0.006798 0.000000 0.610121 0.000000 0.279869 0.188102 0.475964 0.106994 0.019875 0.000000 -0.415143 6.799075 0.419090 0.691917 0.174198 1.002565 0.195976 0.481467 0.347364 1.679722 0.185943 0.246229 0.034017 0.536292 0.000000 0.115921 0.157467 2.942636 0.218084 0.521503 0.000000 0.502702 0.000000 0.187815 0.156793 0.623639 0.149539 0.000000 0.123432 0.515201 0.129910 0.119820 2.955831 -1.025821 0.533429 12.322458 0.432603 0.341524 0.228573 0.762858 0.111933 0.383740 0.447694 1.816522 0.466690 0.575339 0.079632 0.530693 0.069011 0.612797 0.460474 5.575999 0.238608 0.076378 0.067289 0.568361 0.300319 0.318170 0.120105 0.738358 0.278907 0.000000 0.000000 0.597858 0.144006 9.086880 5.224291 -0.450964 1.101401 0.553875 4.568749 0.141115 0.342361 0.194934 0.615139 0.369330 0.422756 0.273304 1.259092 0.183814 0.170317 0.169329 0.537619 0.209342 0.451539 0.197240 2.285531 0.019773 0.149005 0.076151 0.331914 0.170005 0.107837 0.018809 0.481246 0.087187 0.082929 0.054869 0.272052 3.148738 7.167925 3.637783 -0.465640 0.068101 0.277043 0.083582 7.582138 0.550515 1.357393 0.436401 0.730666 0.180385 0.187217 0.120669 0.915349 0.187823 0.426599 0.136359 0.232855 0.116062 0.000000 0.000000 4.416962 0.278988 0.638519 0.143258 0.251600 0.182628 0.044545 0.000000 0.468944 0.176863 0.270775 0.061454 3.264091 0.247321 0.821773 0.229908 -0.035466 0.646976 0.135296 0.047784 0.530250 13.673219 0.617684 1.078816 0.147630 0.940462 0.112286 0.121187 0.281210 0.954679 0.112468 0.234466 0.000000 0.279482 0.061965 0.069113 0.386477 6.447309 0.375529 0.835813 0.112045 0.252097 0.022056 0.273154 0.178765 0.752277 0.092479 0.193351 0.414566 4.764226 0.480976 0.603083 4.062558 -0.095979 0.149978 0.603155 0.082649 1.082918 0.454140 11.941643 0.499631 0.261288 0.114020 0.825272 0.000000 0.277972 0.104824 0.908298 0.162585 0.000000 0.051826 0.462169 0.000000 0.674227 0.286072 6.169792 0.312947 0.069275 0.128378 0.380077 0.000000 0.413247 0.120746 0.894357 0.090301 0.640244 0.369630 6.581180 0.203613 8.726236 3.685595 -0.077156 0.313010 0.027292 0.386508 0.526307 1.241210 0.499045 8.741992 0.169379 0.122133 0.159614 0.709891 0.253673 0.423451 0.293366 0.874117 0.062160 0.048808 0.072648 0.239746 0.350734 0.460539 0.272908 4.997475 0.022032 0.121911 0.019492 0.195206 0.142674 0.459924 0.083387 0.718093 0.289053 0.719384 0.481258 3.537789 4.064001 11.017069 4.188293 -1.076127 0.265404 0.465049 0.137081 0.539963 0.156196 0.135150 0.103502 13.430271 0.582730 1.138367 0.597763 0.566578 0.190008 0.374294 0.079201 0.609867 0.389308 0.304154 0.051893 0.571627 0.000000 0.229765 0.003016 4.551240 0.074387 1.027400 0.172478 0.224739 0.030170 0.000000 0.234570 10.155599 0.771612 2.623992 0.694069 3.601918 0.490717 0.747230 0.476901 -0.156884 1.235087 0.193290 0.232039 0.075719 1.024212 0.278858 0.114512 0.540461 11.016911 0.834320 1.081525 0.025680 0.606111 0.074592 0.045898 0.064851 0.640352 0.090033 0.115144 0.006349 0.392555 0.031757 0.116298 0.316063 3.687805 0.372391 0.620580 0.052731 0.479054 0.062138 0.140789 0.609534 11.753022 0.759866 0.957306 0.355935 7.316049 0.248728 0.940240 5.689819 -0.522198 0.254479 1.199653 0.185293 0.394990 0.185667 0.479915 0.109370 1.621623 0.462885 19.575018 0.605486 0.054925 0.148097 0.815098 0.076164 0.290931 0.153021 0.894128 0.195593 0.000000 0.256035 0.611042 0.360177 0.666899 0.285130 6.217471 0.250806 0.018460 0.062926 0.595156 0.000000 0.981781 0.554080 16.899756 0.642442 0.540401 0.406559 4.711341 0.554389 15.091587 6.442054 -0.173494 0.401790 0.435215 0.991164 0.094521 0.000000 0.295235 0.720753 0.449916 1.272335 1.053914 8.932368 0.234371 0.348855 0.155685 0.472388 0.054565 0.312400 0.125422 0.493248 0.158014 0.196232 0.029566 0.293040 0.234852 0.452256 0.418576 3.812129 0.066599 0.231259 0.046371 0.323169 0.895056 1.410351 0.495426 7.024087 0.317954 1.021352 0.149826 5.391906 6.227780 13.709101 7.749267 -0.853776 0.044229 0.360815 0.103119 1.603678 0.445582 0.267440 0.326604 0.153674 0.060092 0.721206 0.259240 8.208100 0.746590 1.207732 0.690180 0.290566 0.022551 0.108170 0.096963 0.545196 0.115187 0.000000 0.361166 0.514650 0.044496 0.000000 0.000000 5.625716 0.191011 0.501467 0.185422 3.504580 0.352445 0.409781 0.512891 7.315077 0.716469 1.134478 0.925868 3.689554 0.361277 1.325239 0.047692 -0.005487 0.470064 0.128175 0.111230 0.199433 1.406214 0.000000 0.247649 0.202561 0.730440 0.188152 0.460706 0.584902 7.175388 0.522271 0.691185 0.043219 0.388635 0.133604 0.000000 0.145190 0.552231 0.145715 0.187300 0.000000 0.360258 0.000000 0.206983 0.182787 5.223962 0.217647 0.425020 0.265980 5.176814 0.518345 0.543111 0.560152 11.758804 0.634359 1.691027 0.448878 4.761480 0.495490 0.993264 3.206563 -0.136975 0.186709 0.478224 0.059781 0.487610 0.331209 1.327943 0.331577 0.374182 0.034796 0.536180 0.000000 1.170161 0.443854 6.686821 0.424422 0.167999 0.000000 0.330142 0.133627 0.201446 0.158244 0.553848 0.023400 0.109193 0.033778 0.549391 0.118313 0.453725 0.454081 4.522434 0.235607 0.605810 0.416895 5.517017 0.199498 1.215568 0.640599 10.445044 0.686735 0.721257 0.274042 5.009584 0.533602 9.876693 2.935051 -0.178316 0.075301 0.122401 0.530359 0.141678 0.406224 0.181390 1.339669 0.203777 0.316394 0.108137 0.727697 0.573415 1.104183 0.642300 4.749388 0.094225 0.184601 0.019942 0.210711 0.092785 0.252538 0.029726 0.538076 0.050348 0.159703 0.099774 0.084542 0.247592 0.532108 0.260429 3.551170 0.325130 0.455521 0.332409 3.322482 0.634289 1.229934 0.360066 9.967450 0.287033 0.651555 0.331618 4.216152 4.069400 6.804351 3.379383 -2.475841 0.310433 0.631872 0.359105 0.358896 0.001176 0.031718 0.042795 0.645646 0.082260 0.167501 0.172331 0.567244 0.054305 0.175336 0.117180 4.726855 0.379925 0.772357 0.366767 0.559374 0.070985 0.183265 0.050180 0.712362 0.348194 0.189306 0.443699 0.911353 0.229171 0.328185 0.197628 2.527485 0.182446 0.346001 0.343805 0.265084 0.000000 0.040819 0.000000 0.642922 0.163816 0.182220 0.207681 0.404642 0.170075 0.000000 0.024553 -0.467183 4.069269 0.198474 0.688881 0.073166 0.022970 0.000403 0.269012 0.020373 0.944348 0.330450 0.312406 0.000000 0.519477 0.098676 0.101300 0.532887 9.860917 0.504782 1.215923 0.000000 1.334416 0.000000 0.709365 0.542846 1.129542 0.000000 0.274510 0.473217 0.418468 0.102600 0.357130 0.462404 3.210854 0.197268 0.751442 0.090844 0.375616 0.050091 0.058417 0.000000 0.700537 0.121769 0.446433 0.303567 0.341734 0.017067 0.046468 3.284045 -0.767942 0.255276 4.125593 0.373608 0.143074 0.057616 0.407827 0.050396 0.494385 0.144263 1.124658 0.175846 0.127435 0.090233 0.394920 0.081724 1.101286 0.452228 10.106357 0.558821 0.097143 0.003582 1.020170 0.438022 0.516214 0.416602 1.544490 0.273957 0.478723 0.000000 0.714934 0.349008 0.549864 0.173705 5.237141 0.372293 0.188142 0.062490 0.111336 0.000000 0.000000 0.180037 1.066639 0.257235 0.447464 0.116632 0.235056 0.028104 7.113417 5.597014 -0.473112 0.578220 0.544089 2.951036 0.027721 0.242602 0.081942 0.218979 0.267939 0.251698 0.000000 1.012319 0.167001 0.185923 0.091123 0.450424 0.544232 1.158001 0.499127 6.099253 0.135862 0.047611 0.000000 0.574312 0.202936 0.281335 0.247911 1.056986 0.120597 0.569310 0.000137 0.927174 0.301344 0.582254 0.191682 3.003401 0.081737 0.022475 0.010857 0.212390 0.163801 0.284411 0.000000 0.727635 0.000000 0.028621 0.077194 0.406960 3.156958 8.208296 3.774758 -0.309661 0.049007 0.133385 0.091362 2.755696 0.302741 0.312715 0.173483 0.308585 0.099407 0.179866 0.022343 0.653558 0.165648 0.235040 0.053440 0.586031 0.013153 0.203553 0.179613 7.588948 0.439620 0.963759 0.560670 0.547479 0.069668 0.135861 0.069560 1.431799 0.121765 0.083360 0.133101 0.286516 0.000000 0.201802 0.000000 2.850572 0.217626 0.255306 0.234034 0.294456 0.041952 0.267161 0.012711 0.795716 0.224302 0.277029 0.210832 2.387409 0.472709 0.874536 0.361853 -0.029261 0.287987 0.237502 0.079464 0.285453 6.205070 0.169673 0.611736 0.159718 0.477366 0.004748 0.097031 0.173503 0.692083 0.042684 0.136517 0.240863 0.721124 0.000000 0.375262 1.049409 15.096871 1.010045 1.140460 0.000000 0.744953 0.241932 0.130242 0.000000 2.613270 0.300906 0.466220 0.111303 0.453737 0.027777 0.187780 0.383153 5.695618 0.076418 0.574590 0.139786 0.484303 0.000000 0.165394 0.000000 0.772638 0.403996 0.263550 0.188979 3.693512 0.209611 0.565563 3.562260 -0.097211 0.051183 0.441628 0.008171 0.513421 0.235820 5.117930 0.235499 0.070306 0.031957 0.521432 0.082371 0.197312 0.172738 0.475343 0.026569 0.193239 0.098269 0.559770 0.177330 1.560608 0.661727 12.152351 0.795908 0.106566 0.071232 0.682414 0.141641 0.497342 0.312506 1.819394 0.000000 0.133686 0.000000 0.366764 0.043015 0.626554 0.317121 4.856776 0.337778 0.000000 0.107514 0.369197 0.178869 0.558013 0.149704 0.649928 0.008353 0.391040 0.524673 3.280242 0.249585 10.295043 4.555461 -0.020045 0.205435 0.217245 0.301692 0.426481 0.478619 0.103046 4.800339 0.155993 0.160516 0.043241 0.397869 0.268960 0.363964 0.134832 0.563882 0.206984 0.375368 0.012559 0.630731 0.568268 1.608418 0.744192 12.175507 0.074512 0.257717 0.054367 0.681996 0.492646 0.384357 0.353597 1.815422 0.101884 0.204837 0.057981 0.370971 0.293241 0.532753 0.197967 5.366890 0.155427 0.152522 0.000000 0.443356 0.019514 0.346667 0.260514 0.720482 0.312306 0.152334 0.352924 3.555941 3.923479 13.411564 5.467898 -0.452256 0.206865 0.133409 0.053800 0.309607 0.013382 0.068926 0.024207 3.922763 0.231168 0.559275 0.176878 0.358375 0.000000 0.177712 0.092559 1.220271 0.281882 0.084022 0.231489 0.483739 0.265890 0.136849 0.176715 10.288818 0.257275 0.960286 0.314541 0.872735 0.200592 0.202326 0.131606 0.733168 0.228237 0.118611 0.164725 0.195676 0.043394 0.070039 0.096837 3.560857 0.215779 0.437414 0.309641 0.474794 0.000000 0.017567 0.044485 5.427917 0.797076 1.424635 0.652427 2.447342 0.293912 0.545920 0.307262 -0.044245 0.619117 0.053195 0.141686 0.014937 0.319049 0.000000 0.119072 0.298004 4.056319 0.149644 0.455791 0.080113 0.220718 0.000000 0.084651 0.230774 1.245942 0.270442 0.396449 0.195181 0.543332 0.053672 0.185784 0.625666 8.727710 0.630593 1.349462 0.173700 0.825699 0.000000 0.272748 0.137963 0.557985 0.170833 0.179833 0.000000 0.346076 0.170917 0.168602 0.385726 4.067515 0.280119 0.562507 0.091162 0.271720 0.125340 0.066231 0.332908 7.325217 0.478010 0.921739 0.198779 3.601640 0.253466 0.732345 2.845043 -0.178881 0.093322 0.699548 0.062185 0.081196 0.155751 0.462067 0.087997 0.565895 0.345463 5.396309 0.263785 0.139528 0.018192 0.243818 0.030588 0.371072 0.202450 1.698770 0.248557 0.310900 0.000000 0.726337 0.011974 1.553810 0.675185 15.773670 0.684844 0.098120 0.078217 1.123305 0.084511 0.274645 0.146030 0.925165 0.035489 0.194232 0.001406 0.019483 0.028565 1.050409 0.390054 6.907826 0.417634 0.000000 0.000000 0.541805 0.145072 1.010631 0.544363 9.463188 0.632776 0.481165 0.577055 3.772050 0.550469 7.592797 4.413703 -0.160193 0.151178 0.076731 0.442325 0.000000 0.097576 0.063933 0.270416 0.425640 0.525532 0.449104 3.827531 0.031662 0.142824 0.027593 0.306584 0.192121 0.472240 0.158885 1.310323 0.079608 0.395180 0.151512 0.736482 0.519828 1.073672 0.382793 8.412434 0.154417 0.336653 0.246102 0.526592 0.081189 0.210083 0.135201 0.510685 0.004573 0.084876 0.081531 0.298596 0.285357 0.522613 0.438062 4.298715 0.076127 0.156612 0.000000 0.443800 0.554995 1.594286 0.784444 6.013321 0.306408 0.542734 0.198707 3.550842 2.758071 7.598315 3.146937 -0.412435 0.015231 0.187409 0.120300 0.567347 0.210729 0.440478 0.181399 0.317807 0.000000 0.050741 0.057232 3.160728 0.334488 0.354212 0.360271 0.508498 0.011257 0.330649 0.156356 1.013338 0.189070 0.183363 0.165266 0.389625 0.034616 0.181013 0.025816 7.108493 0.349994 0.774400 0.622327 0.336767 0.175377 0.229579 0.045691 0.323095 0.159209 0.338763 0.069403 0.193390 0.000000 0.075213 0.006311 3.286063 0.198551 0.399383 0.306299 3.516208 0.408732 0.913046 0.572741 5.429028 0.644483 0.714877 0.648722 2.384371 0.250045 0.558689 0.372519 -0.098069 0.332712 0.000000 0.144720 0.083426 0.887236 0.186255 0.180659 0.095963 0.281346 0.000000 0.157633 0.296128 3.149026 0.264908 0.501043 0.164447 0.606566 0.020498 0.211121 0.275024 0.977583 0.279703 1.001596 0.140037 0.640242 0.000000 0.047092 0.551324 9.096144 0.554377 1.054314 0.000000 0.263226 0.109142 0.207882 0.134602 0.611970 0.000000 0.201130 0.101080 0.420257 0.178073 0.054108 0.482487 2.953057 0.297405 0.644937 0.334328 3.490527 0.490048 0.634879 0.732207 10.150242 0.610477 1.733431 0.287374 3.267094 0.507470 0.705478 2.527529 -0.116809 0.095621 0.266191 0.036779 0.189954 0.055923 0.322421 0.099934 0.206787 0.063055 0.205228 0.044019 0.542407 0.212310 2.599162 0.229251 0.148294 0.162361 0.525809 0.141745 0.368773 0.289755 1.307732 0.237778 0.193107 0.000000 0.506109 0.032377 1.106088 0.610683 7.513910 0.620563 0.165645 0.045802 0.224782 0.067127 0.232263 0.066361 0.600482 0.150483 0.239247 0.000000 0.264738 0.019006 0.529099 0.152228 2.834036 0.263711 0.508716 0.289136 3.462465 0.403499 1.219309 0.608277 8.844769 0.760817 0.587408 0.236371 3.570274 0.330510 4.727667 3.096371 -0.048239 0.176725 0.003618 0.395369 0.158604 0.171050 0.089168 0.569434 0.020305 0.082772 0.150083 0.298184 0.474740 0.451725 0.324546 2.228059 0.116178 0.135524 0.134483 0.467172 0.179658 0.524966 0.084806 1.039384 0.093799 0.095190 0.169115 0.539303 0.766168 1.022562 0.417858 5.372551 0.095812 0.005762 0.028258 0.331755 0.046415 0.156690 0.029201 0.519322 0.032630 0.033342 0.149510 0.430416 0.464808 0.413177 0.180027 2.604676 0.413948 0.857642 0.373916 2.474743 0.451283 1.077532 0.618891 5.603282 0.310993 0.464848 0.299034 2.260628 2.476569 6.611571 2.538459 - -0.043674 0.017847 0.017784 0.031140 0.019247 0.009435 0.008616 0.014681 0.014523 0.013609 0.009686 0.014671 0.023828 0.013718 0.017289 0.031140 0.022797 0.013406 0.013476 0.017287 0.015125 0.009514 0.007840 0.009700 0.011412 0.009188 0.007837 0.008615 0.010497 0.010951 0.013480 0.017787 0.019404 0.009325 0.010950 0.013715 0.016772 0.011612 0.009187 0.013612 0.011624 0.011611 0.009512 0.009416 0.011590 0.009325 0.013406 0.017844 0.024548 0.011593 0.010498 0.023830 0.015826 0.011627 0.011414 0.014532 0.015830 0.016777 0.015127 0.019247 0.024553 0.019413 0.022809 0.043672 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT diff --git a/PhyloCSF_Parameters/49birds.nh b/PhyloCSF_Parameters/49birds.nh deleted file mode 100644 index 86e15d2..0000000 --- a/PhyloCSF_Parameters/49birds.nh +++ /dev/null @@ -1,145 +0,0 @@ -( - ( - ( - white_throated_tinamou:0.14713848271634652, - ostrich:0.0669049215898666 - ):0.0456207, - ( - ( - mallard:0.10028745513816674, - ( - red_junglefowl:0.03905575798189643, - turkey:0.04493722486181307 - ):0.11314680730786908 - ):0.039436008777786025, - ( - ( - ( - american_flamingo:0.031174620859996834, - great_crested_grebe:0.058417896636777364 - ):0.01296753085832649, - ( - rock_pigeon:0.09633671022177494, - ( - yellow_throated_sandgrouse:0.07165064326126222, - brown_mesite:0.08712456250758675 - ):0.002719488343977022 - ):0.001410999566142196 - ):0.0009273225223553452, - ( - ( - ( - ( - red_crested_turaco:0.07078577990315871, - houbara_bustard:0.0731475442885532 - ):0.0014445948503099305, - common_cuckoo:0.11149034290960456 - ):0.0010580846929490806, - ( - ( - chimney_swift:0.09078444347276869, - annas_hummingbird:0.11256371899621678 - ):0.020355877022882312, - chuck_wills_widow:0.06966131682334 - ):0.0037924287513986035 - ):0.0011276894283190548, - ( - ( - hoatzin:0.07556944687975468, - ( - killdeer:0.06016638160099794, - grey_crowned_crane:0.05705645035504941 - ):0.0015091427770182256 - ):0.0009224455197761668, - ( - ( - ( - white_tailed_tropicbird:0.059061515479716734, - sunbittern:0.09470289401860604 - ):0.0031780841974596956, - ( - red_throated_loon:0.04446615576907132, - ( - ( - cormorant:0.06390072121783605, - ( - ( - little_egret:0.0561921453883497, - dalmatian_pelican:0.04165214732285272 - ):0.001331123705788551, - crested_ibis:0.03983191693545154 - ):0.0009704851624009051 - ):0.0016067246418978304, - ( - ( - adelie_penguin:0.013529809074939583, - emperor_penguin:0.010909750342265476 - ):0.02141598523903805, - northern_fulmar:0.034160583031281784 - ):0.0011916471746770939 - ):0.0018991936576422622 - ):0.002086441791048191 - ):0.0011932377882976901, - ( - ( - ( - turkey_vulture:0.030069867646272997, - ( - white_tailed_eagle:0.0011420478190177913, - bald_eagle:0.0010021438096430545 - ):0.042651569203343 - ):0.001976623642640992, - ( - barn_owl:0.06754049962740655, - ( - ( - cuckoo_roller:0.0669564258176255, - ( - ( - rhinoceros_hornbill:0.09978173141421996, - ( - downy_woodpecker:0.14337011012642253, - carmine_bee_eater:0.10295692038068512 - ):0.003899638626102539 - ):0.0025293333293138287, - bar_tailed_trogon:0.10483156204618177 - ):0.0012225438504183434 - ):0.0013579825674525498, - speckled_mousebird:0.12047156157154118 - ):0.0006216626324594806 - ):0.0005988663497087942 - ):0.000803038200607886, - ( - red_legged_seriema:0.05500194156181956, - ( - peregrine_falcon:0.07623456175620913, - ( - ( - ( - ( - ( - medium_ground_finch:0.03719930529721754, - zebra_finch:0.041967682103530725 - ):0.024465779960146403, - american_crow:0.03847367084047499 - ):0.04403125726463492, - golden_collared_manakin:0.0693007102024994 - ):0.009023297418129851, - rifleman:0.08356784367257653 - ):0.03887899266813369, - ( - kea:0.04202072919051133, - budgerigar:0.058486107104773866 - ):0.052799582285419054 - ):0.0021026337964740738 - ):0.0012887706973270813 - ):0.0015010215404783966 - ):0.004147680965927658 - ):0.0011153877017478781 - ):0.0010103618732958555 - ):0.0010719451106151227 - ):0.0319547592447372 - ):0.0456207 - ):0.055951154, - green_anole:0.297064 -); \ No newline at end of file diff --git a/PhyloCSF_Parameters/49birds_coding.ECM b/PhyloCSF_Parameters/49birds_coding.ECM deleted file mode 100644 index f894011..0000000 --- a/PhyloCSF_Parameters/49birds_coding.ECM +++ /dev/null @@ -1,72 +0,0 @@ -0.771493279396 -14.5180982851 0.547433994462 -0.829799770357 31.1892114825 0.7020007509 -1.2357249048 0.0591436724948 0.143021129459 0.0723670336788 -0.0491379655094 1.68015082454 0.0198294354489 0.039540785463 10.4536837099 -0.0705620171551 0.0966709944264 1.69743422922 0.142387839362 91.937054195 27.5243026465 -0.0429527042192 0.105163194816 0.0172649210373 2.25040676661 10.8921310832 29.7216988175 32.0319353336 -7.4338524426 0.17080527673 0.354723692547 0.186750900063 1.57462078709 0.053744234112 0.0267286337571 0.0670392311205 -0.15475952294 7.04751773186 0.133727701692 0.272371840933 0.0995168546074 2.91545126347 0.241247972617 0.30307911252 1.14819950914 -0.523684400979 0.193336177917 7.27785844907 0.248082744588 0.28292064082 0.0737402201706 2.22444630107 0.0911973524823 39.1328554206 1.20406413448 -0.173018086183 0.206353768518 0.171683630752 10.768130388 0.0919414494248 0.0323218254172 0.205978125948 4.34740100489 1.16358434945 33.6941468224 1.7233728365 -0.72844506036 0.0408900267574 0.0984268008214 0.0606490247723 6.27625068709 0.108522818556 0.732902667282 0.156984045956 1.27333682927 0.0371320946863 0.190371215329 0.0649658426497 -0.0107338084319 0.332629598166 0.0135926658879 0.022093725551 0. 2.18866127674 0.143671679617 0.121521316476 0.0119565599453 0.549500917257 0.0356995023641 0.0243544304587 12.7843674905 -0.0520823421344 0.0350655628839 0.405289748819 0.067795684311 1.27336050355 0.160287788944 6.57922720905 0.299427412867 0.0786854813099 0.0488940935773 0.960805451861 0.0665927661081 5.34516996652 0.736796631636 -0.0216049508162 0.0160718839072 0.0223163001706 0.605907271879 0.0245681166778 0.0205049564898 0.158269973844 3.87244486996 0.0304252144396 0.0317223740088 0.0589426989831 0.873730975438 9.99938453006 25.8255751638 1.22569015347 -2.18663674868 0.111696040966 0.0634197481102 0.154784667253 0.211944334747 0.0142851196137 0.0249872010961 0.0178329430869 0.632866998477 0.0456544602052 0.155643358185 0.0852409113534 0.114188793132 0.00538347477404 0.0172684858959 0.00982443430665 -0.0806194749382 1.82202603689 0.0700874839516 0.139029576933 0.0180592441769 0.131956497224 0.0167764425897 0.0204819995985 0.0337369858375 0.495354204564 0.0430768582 0.0598964584571 0.00958027358921 0.0336402412939 0.0100876385187 0. 2.33982994684 -0.0813812527058 0.072537901315 0.967025850778 0.0745340778643 0.0311639252932 0.00984056819269 0.180306689601 0.00854548443289 0.0545028256988 0.042940471875 0.398138428286 0.0395461759513 0.0155719958588 0.00453736963474 0.0574916836341 0.00557974117017 23.6795913232 1.61299074838 -0.0890303815424 0.0309711104056 0.075284329732 2.72022205635 0.0173828570078 0.00889347376972 0.0250244061361 0.189896560082 0.0470550538246 0.0369691647928 0.0517741235211 0.814461875725 0.0113513697564 7.49810654027e-05 0.0161305091349 0.0857488913528 2.52155138217 51.8301587085 1.73431675231 -0.0831502869336 0.00623291475441 0.0140485960681 0.00222815351908 1.85271487285 0.0142595343747 0. 0.0240393018298 0.100035548941 0.00744094731676 0.0208705373804 0.00714801356087 0.202643068745 0.00840395811706 0.0485674719118 0. 2.58108992655 0.0610588913053 0.288098926224 0.0640178651307 -0.0121507251646 0.0924520030781 0.00836826924209 0.0186151696838 0.0836537312744 1.54107027962 0.0440270652618 0.131930258067 0.00717636251265 0.120684206891 0.0125595231276 0.0212153052835 0.000324249078674 0.075269096427 0.0148448619927 0.0162954435488 0.135980978245 1.38509214833 0.0582990476554 0.097001138788 10.3565106085 -0.0327561377247 0.0194019854761 0.151645046369 0.0216308024113 0.16219698802 0.0736088846667 3.56703356477 0.0906683018246 0.0211444376486 0.0293098893392 0.213048465069 0.030853222824 0.105229675827 0.0117895396449 0.238615514744 0.00758025850283 0.383949439837 0.217940094945 3.42317049457 0.151800096828 80.196430788 26.5641853165 -0.00712174354816 0.00723985090453 0.00595505344662 0.0975294587912 0.0438607458733 0.0573004108171 0. 2.03540765518 0.0049271871924 0.0089011742123 0.00755042591788 0.131884297209 0.0101448079456 0.00832642054426 0.0156458916585 0.109023373526 0.0378815314904 0.0463207771448 0.0165605454301 1.6138138067 9.1542408524 28.6750081769 21.9548306605 -0.342652952354 0. 0.00831817472204 0.0019578776316 0.0256561801987 0.00396518185496 0. 0.00828598360004 24.819368396 0. 0.692289530387 0.00221688308001 0.0423207748289 0. 0.00421964524011 0.0102462249253 9.72150853477 0.287135700558 0.111035024588 0.161520784401 0.987246541018 0.0268612351287 0.14984953371 0.0013382555295 -0.0274952800589 0.239907400328 0.130619934855 0.0199908101654 0.00651256013327 0.0940574219685 0.0188049255523 0.0154651516836 0.731121345902 1.44205827826 1.47351708949 0.0159273184405 0. 0.0478071542405 0.00524987299297 0. 0.337092192699 7.2223642138 0.298762023217 0. 0.0197476073108 0.971106449371 0.23665637847 0.000783759865199 22.6147561126 -0.126747246284 0.00525348090503 0.431201251443 0.00871397252545 0.00260008330902 0.00505104531015 0.154413324232 0. 1.38751553761 0.0069785180879 24.2115845119 0. 0.0154314907887 0. 0.026146215906 0.00674642096354 0.249262272475 0.264254321875 5.15802336393 0.282622534951 0.100276942636 0.0464677107833 2.8678028547 0.0103939496336 58.2624766604 19.1638370992 -0.0407572307445 0.0541760472627 0.0408884489312 0.594154801521 0.00637997251286 0.0198824741158 0.0398930112025 0.199496998649 0.131755897653 0.18449888875 0.326574404736 2.81319866554 0.014151320102 0.0153460674176 0.00990532258908 0.0946255220831 0.573596562106 0.632515608499 0.283840725565 16.0063596615 0.075905929081 0.0826477869133 0.145510045956 1.80628209641 29.347029641 79.0811920949 24.1343195351 -0.0670321669475 0.000563067043618 0.00709263218583 0.0160730475881 0.397475218922 0.0108774166451 0.0224531700364 0.0117432492443 0.110217799898 0.00741770540948 0.0106037107321 0.00421212203971 6.34377872097 0. 0.30644392794 0.0507575748744 1.9736613358 0.0556021195246 0.102283849299 0.0480436043823 4.00887120044 0.0417641609514 0.653798644135 0.0359958557139 1.53421130077 0.0163428855889 0.117515458291 0.0242819224677 -0.00643748166518 0.0295649828891 0.000637970407505 0.019754645672 0.0030508665228 0.178930335275 0. 0.00883618689765 0.0253554586766 0.0635021784113 0.0114766272275 0.0282686114778 0.159188805299 2.05296843661 0.0831033972167 0.158454009429 0.0790863053832 0.843181005219 0.0366298173461 0.107941366273 0.0245725600104 1.92780227841 0.103817357813 0.139569513175 0.0230997188178 0.954192866331 0.0226992195858 0.144293124685 11.6702094631 -0. 0.000741264056699 0.0321762732716 0.00876551202277 0.0409627203061 0.0066341456828 0.289776596366 0.0104730362024 0.00188148859201 0.00415933999863 0.0531027228242 0.00397499828712 0.277347255409 0.081204120774 1.47530308516 0.0831617109488 0.0348369494271 0.0330910542007 0.514722517892 0.0315293996595 0.448937601962 0.0560895061976 3.50959324007 0.0672410028933 0.000363858402076 0.0325302162526 0.698509928297 0.0222160316559 31.3936914479 7.82675950727 -0.0103057326894 0.0209560410928 0. 0.0432390313139 0. 0.000598674783837 0. 0.331194702356 0.0159021216996 0.0263734927337 0.0229446661305 0.0793998208566 0.0655491795789 0.0771818086854 0.0755945133111 2.56835350509 0.0801848672594 0.0780599264085 0.0459870926371 1.38822655563 0.0245587112418 0.105445060089 0.157688337733 2.56327777985 0.00606283188176 0.0292401665627 0.0516866860149 1.68499310101 9.08011950879 26.1164046404 6.89513673659 -1.52942036217 0.0973183013281 0.0388353247448 0.117166119514 0.201990514263 0.015333596402 0.0128796043445 0.0124927834828 0.391532889031 0.0313292278453 0.0213395537798 0.046335054843 0.111001960231 0.00549068726692 0.0162640654866 0.00404973027084 1.6718235251 0.0500267310822 0.0517100980774 0.0537247281374 0.0619851968551 0.00546186911396 0.00987533716152 0.00386417990485 0.0791417803087 0.0355024148452 0. 0.0324557541248 0.0530512896758 0.0027411404153 0.003400456723 0.00422901561025 -0.0827672478108 2.45968541101 0.0634654669355 0.173632559347 0.0131604282059 0.164795491269 0.0131791154447 0.0351360772548 0.0335412538099 0.474036367211 0.03667071173 0.0671758266016 0.0124420599637 0.0313192578121 0.00897011881742 0.0123210571936 0.0862780006103 0.62622938248 0.0460793037594 0.0418612404259 0.00488689931062 0.0558122415879 0.0175672823754 0.00628262205823 0.00715550696459 0.0910460725338 0.00443029935197 0.0287613924571 0.00313419211364 0.0319575833704 0.00226776365132 0. 1.70115845114 -0.0522505604502 0.0898926251941 1.06240549924 0.112920569564 0.0463514147993 0.0149556757989 0.290216053777 0.0126916204037 0.0444314578346 0.0425138927353 0.346736063384 0.0532746125015 0.0239887410771 0.00428625042153 0.0806840702641 0.00726198943985 0.0617898168537 0.0606229656609 0.929748659037 0.0607814405512 0.0130660362186 0.00815276835162 0.144015583909 0.00475002529722 0.0297003498473 0. 0.132271963252 0.0101996218813 0.00843968014492 0.00444182503798 0.0259434869283 0.00418488182163 13.9895365789 1.74259584965 -0.069879625366 0.0502569650608 0.0601726449853 3.10841773214 0.0194174772813 0.00880592559668 0.026064139331 0.183837737792 0.0384232333402 0.0386598563856 0.028491177004 0.66561597344 0.0178802430678 0.0106144479446 0.010721316501 0.0584953860606 0.0488555874011 0.0240956518334 0.0447701807091 0.81606944054 0.00601727190495 0.00644546124483 0.00707166378557 0.0505635979412 0. 0.00103456844645 0.00427279006237 0.187146494621 0.00269164053833 0. 0.00100987468273 0.047653345948 1.4140884143 23.7236399779 1.55601401505 -0.181158453397 0.0260123477086 0.0397790253368 0.0100844740285 8.86889734423 0.0461483266391 0. 0.107929568028 0.256807798045 0.0320388886734 0.0695661905816 0.0188244726856 0.942228107881 0. 0.280430428925 0. 0.177260190745 0.0103616000988 0.0309089068449 0.00733443583341 2.08534651761 0.0619419333752 0.0385046664547 0.040395753471 0.063159608537 0.00541444268653 0.00590389620526 0.00982289064588 0.298133346746 0.00680478222793 0.0432921772456 0.00757149486997 1.03013073458 0.0486682637201 0.188686676483 0.0246949247744 -0.0122577305366 0.191980971044 0.0161067868229 0.0275695037423 0.14003002796 5.91146468912 0.134860570052 0.387425224734 0.0209047479093 0.400275840087 0.021321233877 0.0329212682449 0.00736037530406 0.286707031154 0.0674343529579 0.0311016087688 0.01510330413 0.0812436776202 0.00951252481602 0.0089036753564 0.0500637131568 1.53342839158 0.129298933272 0.11420040671 0.00657888694428 0.0901221706124 0.00747913674455 0.0199622847226 0.0126688373082 0.175994119126 0.0118295798482 0.00036469247377 0.0486596453358 0.628137800632 0.0473421611494 0.0308176979667 8.69450787125 -0.0555064568149 0.0480629442424 0.276262166032 0.0331518765262 0.562775127606 0.281398177498 15.7085436131 0.333136469932 0.0406317413376 0.107810107191 0.523491550083 0.0915018349276 0.234333738224 0.0552067621755 1.18046200077 0.0590812702434 0.043050916247 0.0231734472692 0.204509977331 0.0233882916335 0. 0.16346581468 6.09067753677 0.0888615500043 0.0279377722441 0.0701278427092 0.269656981301 0.0300336306608 0.0285534734776 0.0334291528371 0.323865691396 0.0205253370633 0.126702292889 0.134698271566 1.9279992831 0.0830503615842 68.895319709 18.1269451688 -0.0105930094914 0.0197467947894 0.00672572148301 0.219652037737 0.0569481631527 0.192199885757 0.0770026769259 8.2030334245 0.00992272063324 0.0406733489963 0.0200757655693 0.465563570471 0.00648442428788 0.0322131056713 0.0652316603109 0.434810615786 0.00266089608895 0.00461778904828 0.00596362923912 0.0916196214411 0.0124266748599 0.0905298871638 0.0352078645817 1.75296746263 0. 0.011915518628 0.0064691624691 0.117966135277 0. 0. 0.00641417426938 0.263264203083 0.0294620633383 0.0517569597285 0.0297106128632 0.775854199415 9.25329006582 21.8046714515 21.0184122059 -0.254177076964 0.0466163962153 0.013775505342 0.0165752917716 0.2541994313 0. 0.0234895802647 0. 3.51441514201 0.0628800416072 0.126836526076 0.113077846139 0.202105100057 0.00982962599455 0.00967118786199 0.0052933427804 0.301915015348 0.0209447385129 0.0262482055616 0.021515034263 0.0805828810913 0.00282008757285 0.0242510782787 0. 0.874922102518 0.0133118469457 0.0278638597687 0.0256982967577 0.0830735772627 0.0140431178472 0.00152631760016 0.00512338828271 2.14076248522 0.109913868096 0.127066667315 0.0860586763677 1.85126960484 0.0189655004627 0.22577819126 0.02214203147 -0.0187961223364 0.536260801381 0.0187201885281 0.0570722129956 0. 0.249122534002 0.0247618945167 0.0347282919429 0.119844529013 5.89713390113 0.135529295696 0.37862421452 0. 0.0716822297298 0.0139552063489 0.0090504051125 0.0143990351069 0.218599982006 0.0201367961938 0.0288787666884 0. 0.0953004938169 0.0184742524512 0.0163365894936 0.0148614517249 0.91696743349 0.010473158236 0.102230161422 0.00781085519074 0.0411893350182 0.00772386312203 7.845967971e-05 0.0513084582793 1.83647544751 0.0711026312034 0.0484847347439 0.0136165169786 1.40745470677 0.258157562514 0.135820730719 8.13762983681 -0.0328636713303 0.0187769783312 0.235179486576 0.0733364272614 0.0926161334728 0.00838022497616 0.408607171412 0.0113896740303 0.230797267043 0.166509619107 4.62098300244 0.355598938915 0.0707469720138 0.00499944094366 0.1819732433 0.0220544026913 0.0721575489303 0.0276836910024 0.222982276164 0.0331777831189 0.0244250690124 0.00613550182328 0.289795200046 0.00732929200673 0.0844588490175 0.0304535572718 1.0957917311 0.0567580546743 0.0173063494738 0.00490556988502 0.0661130308739 0.0183619577456 0.0948448651991 0.101343657162 1.83229308595 0.0912091468367 0.433113687149 0.0715023194908 4.13594806656 0.0258080154165 30.5908569921 10.0811942943 -0.0243094808513 0.0577216517943 0.0200297769648 0.877392683846 0.00616672142884 0.0133710129811 0.0101473425531 0.425742741255 0.141560490571 0.443900074406 0.191187943803 9.36899545687 0. 0.018888775476 0.0149073518673 0.13913130704 0.0462748737881 0.0379647006055 0.0137169525908 0.459494094526 0. 0.0190014624053 0.00446871333479 0.110939295873 0. 0.0330973044641 0.020129035622 1.80187002398 0. 0.00776890685305 0.000484586777783 0.0693812551183 0.0801448777091 0.218228314494 0.10116895754 3.17665838205 0.0223213571149 0.107982033724 0.190590547393 2.20919088952 7.91138478576 34.3882055135 12.7244322854 -0.15434282613 0.00935208126288 0.0151733883381 0.013729475622 1.71785898184 0.0271358624608 0.146655133895 0.0177553776853 0.30178866371 0.0182577297541 0.0375645028041 0.0274235268157 26.8094991811 0. 0.612478351302 0. 0.142234190974 0.0114076697294 0.011520354398 0.0142505051056 0.280313823039 0.00876817134547 0.0630840357167 0.0103192072714 0.0826066155485 0.0047477806076 0.00469973766013 0.00628193768667 4.58278302533 0.0291050999455 0.0296673134073 0.0479828667289 0.725647477002 0.0270877926263 0.0588757234687 0.0273951850099 6.40325605509 0.0438568294629 0.732225073977 0.00651736008295 1.44810954129 0.0184942984015 0.172245324759 0.0349897269167 -0.00969533647635 0.0999488616985 0.0052454488918 0.0131800710292 0.0337929099917 1.0749439893 0.0326869238681 0.111456192054 0.0264268584625 0.224134039428 0.0199444908588 0.0290530701962 0.562736693539 10.7237952641 0.118229726105 0.506770835596 0.0102800806728 0.0606173209593 0.00751054512132 0.0133113286074 0.0105443090872 0.183782605146 0.0204709347631 0.0276985652596 0.00129705656982 0.0754620175889 0. 0.025804891967 0.030298070793 2.03508410924 0.0447055642363 0.132059900606 0.0301183881127 0.37615525312 0.015908228653 0.0213106603965 0.0431287073534 3.93391823581 0.275853026894 0.265254577006 0. 0.929017326538 0.0360346586025 0.121805115134 12.2774917757 -0.00781203656183 0.00305032194564 0.0716340021864 0.00950419017431 0.290444381626 0.0363585294956 1.48832591097 0.0531160643028 0.00529187417067 0.0181792465187 0.1898146219 0.0202367292531 1.25814605694 0.340506545072 3.55342590032 0.340626708068 0.00543938441184 0.00876335637772 0.0465035840453 0.00925919109869 0.0557620647879 0.0126977754034 0.284454447223 0.0133494203904 0. 0.00517806534409 0.0414239861961 0.0147777238638 0.0411492373521 0.0355017967194 1.07082122249 0.0287025328326 0.0124956170788 0.0109304744587 0.34347636804 0.0163556298762 1.02652889428 0.14159544335 6.96484884785 0.145598748684 0.0100539151045 0.00261004468069 1.03235017399 0.0320664273316 34.9286691378 8.23239114357 -0.0114083420209 0.0199984874197 0.00840313920552 0.139176400973 0.0135290119007 0.0655614948349 0.0271933719352 1.45516931 0.0142193129151 0.0186767358189 0.0235742444493 0.348139821213 0.292921217267 0.0772705614775 0.146955588856 13.0029095601 0.0128252811737 0.0160174998411 0.00344783997877 0.0854516604554 0. 0.0306215484952 0.00135298295599 0.197945344879 0.00398803702332 0. 0.0112408821513 0.130903293586 0.0345087851993 0.0350951206775 0.024019772453 2.51762209502 0.0236558879595 0.033012214447 0.0321554878851 0.53405164739 0.0272060510773 0.175337751612 0.294680297433 5.21552771342 0.0246904606628 0.0948001199036 0.0427269667822 1.71316918042 10.4885072326 28.6013786797 8.76793221684 -2.77594356032 0.0993047870626 0.258987813235 0.196747240033 0.159727053992 0.0201599544009 0.0456494718309 0.014416684875 0.453919642655 0.0552728098673 0.176877082092 0.105471229855 0.386772302504 0.00718586592846 0.0321231644917 0.025169217975 6.78299214328 0.375237957265 0.480908376528 0.294621559134 0.387630790093 0.0702904544528 0.169324529386 0.0583382719292 0.390108022986 0.150928696164 0.18405706465 0.0963763242996 0.894999246158 0.0063632664085 0.0562162829768 0.0486748216443 2.62332950228 0.20035925212 0.35459689191 0.134554657987 0.228256251997 0.0429382995137 0.0430277011087 0. 0.499835267232 0.0872802166146 0. 0.00901740735283 0.289857331321 0.0270375266701 0.04838186141 0.0374696887996 -0.0121894520849 0.410790063033 0.011133598533 0.00165056619402 0.0051843131731 0.0431018327577 0.00539237299706 0.0150623598867 0.0170708870198 0.0840406186667 0. 0.0242935664732 0.0080513219032 0.0398494896751 0.00545725560213 0. 0.0790745463878 3.2078145507 0.0532472065717 0.010043455522 0.00635188554487 0.0880596706435 0.013721224767 0.00651922284968 0.025457891714 0.304325536564 0.00707279853229 0.0675357009414 0.0172192049667 0.106767001377 0.00573203678181 0.0136987547062 0.013655212029 0.297543754748 0.0119723251101 0.00318746283208 0.00162010996025 0.0299444434255 0.0108699938489 0.0166143146908 0.00169048351502 0.0635594253576 0.00467473667675 0.0232766714606 0.00173091362045 0.0456155333578 0.00257003829396 0.00549671428511 3.59183812996 -0.0128603903345 0.155272434481 2.90473676882 0.0921884295404 0.018003235893 0.0088919464121 0.332278027108 0.029517979277 0.0950845378976 0.0814115848686 1.02293237377 0.0782302611672 0.124932670117 0.0147696168081 0.209777697594 0.0191860423374 1.17481497084 0.422005627993 7.16881310532 0.519389046385 0.138828982528 0.0537440354805 1.18848446499 0.053710043866 0.258890930878 0.191467019998 2.4094721595 0.233810974308 0.141415434357 0.0802249814486 0.478853644692 0.0570549680101 0.186570124039 0.158525054764 3.30106333889 0.127155955145 0.070267211767 0. 0.703384400913 0.0418228555285 0. 0. 0.981935304195 0.0968146005396 0.0783266440087 0.00763974452017 0.23785171402 0.0201171111811 507.765111884 2.44158816723 -0.0298412769399 0.0122551089064 0.0159708172401 0.662041901317 0.00734282838376 0.0100875430507 0.00631171792731 0.0627729308325 0.00317881402807 0.0217712378384 0.0380502109864 0.181154195019 0.0147807967765 0.000693398311567 0.0108043597623 0.083547251776 0.124351036848 0.181987183493 0.0659530747008 4.28844853026 0.00751655604012 0.0154663468996 0.00513218639619 0.101949747019 0. 0.00997028720563 0.0172390346722 0.836591636433 0.0182342555086 0.019835677565 0.0069782151758 0.16156444993 0.022796908347 0.0389716219568 0.0269186753463 0.441801768503 0.00596547916974 0.014701676295 0.00739562555348 0.0342721533618 0.00495950613705 0.0217814491004 0.00623597741371 0.141948440236 0.0124771328796 0.0118889570172 0.00259482001219 0.0781727135773 2.98967538063 49.2839591139 3.316675155 -0.0722278190998 0.00500866092764 0.0173192942569 0.023154035384 3.4470883287 0.0171508279517 0.0554954011444 0.091309482244 0.0662760011389 0.00829980119382 0.022354058005 0.0338946495945 0.235314951058 0. 0.0763098378531 0.0332331474469 0.286505793562 0.01505939157 0.0464968416988 0.0254099705532 6.29714726079 0.0976069040919 0.476439604983 0.0361553588411 0.122280514014 0. 0.040880462884 0.0107976740267 0.516163749196 0.011360889129 0.0121972794524 0.0203193196188 0.0695019404399 0.00472048511553 0.0113007052678 0.0118761160785 4.26073713503 0.0861649940812 0.310162417427 0.051843758979 0.103507527036 0. 0.0457793711362 0. 0.430028495412 0. 0.0801999766326 0.0205470075237 2.81788640408 0.00323540880644 0.44167841641 0.0268487689328 -0.0109315724616 0.144616714606 0.00821707597789 0.000456726857907 0.0764913882054 2.45357074876 0.0661435744316 0.176744922702 0.00819456481366 0.266597495417 0.0182759357264 0.00846119421793 0.0313617134389 0.0966495049223 0.0162790413192 0.00163711843708 0.0369439154618 0.234872736279 0.0123576787921 0.0265123221939 0.036042397569 4.81163765756 0.150265642397 0.164785582551 0. 0.180317458513 0.00458491922496 0.0367902105118 0. 0.389255850299 0.00174760112765 0. 0.00257753728933 0.0635580300716 0.0084535343221 0.00282624864339 0.0447019415675 2.88017138187 0.289532320254 0.123735336689 0.00324188461583 0.118078308966 0.0100812848724 0.0198277053741 0.0116340464762 0.243292793662 0.0120482062486 0.0176763288885 0.263693820924 0.709176626674 0.248550219855 0.0328825526141 12.6242878278 -0.0135254471713 0.0224138900757 0.096798546819 0.0154444374282 0.469113896116 0.22743490158 7.79328364964 0.213279371798 0.0161344840406 0.0784909371759 0.179648483473 0.0628751158954 0.0423341383387 0.00630178455457 0.312339853289 0.0234883695029 0.0322889750944 0.0291162192912 0.247846604119 0.0201655279496 0.0518907117023 0.0661747311717 12.1031163415 0.0342292472337 0.0670292507246 0.0263262931891 0.406923875717 0.00490776541097 0. 0.0160598832211 0.353791691237 0.026544047596 0.0118193968718 0.00791022068661 0.109843293866 0.0158225402976 0.333300299142 0.31958909408 12.0613669426 0.0616488096615 0.0107388318896 0.0148583295769 0.233395457926 0.0229189251464 0.0725987489501 0.0224009938245 0.366753524194 0.0033444418443 0.435154262392 0. 5.18531608176 0.0337930801197 103.370411838 30.2187145757 -0.00889801311401 0.014314272414 0.00733263507062 0.139923321215 0.0599475336812 0.151241438878 0.0626266723432 3.26792392121 0.0168047793112 0.0355345341123 0.00841349152452 0.279741113857 0.0269058261891 0.0203136714086 0.0172489856388 0.100526472268 0.00951741783187 0.0365100909268 0.0188076923165 0.311852144931 0.0234901851248 0.406481108084 0.118585605774 5.59567167405 0. 0.0209633844747 0.0017276477389 0.386993411551 0.0356811825554 0.00753007889328 0.0256322285828 0.467310381695 0.00386274806443 0.01299145289 0.00713480561887 0.0563915408293 0.0270058369068 0.251044072283 0.255733515669 3.20974363638 0.00242786317209 0.0191998396281 0.0137316622378 0.150868053414 0.0179523093513 0.0494934567133 0.0152084857496 0.22043068467 0.265435129553 0.0233293793875 0.240040834453 1.01421579934 10.035477583 28.3055731705 29.0099153961 -0.161412798087 0.00424480446191 0. 0. 0.0906916476566 0.00563968805371 0.0321857317281 0.00625169793881 2.32459802666 0.18028353771 0.402169481502 0.146021735821 0.180738849749 0.0152470119891 0.0594309552204 0. 1.59918269474 0.0878914404839 0.151488329592 0.0644464394055 0.433227437698 0.0415119312985 0.134563380307 0.0308938272344 12.8269080058 0.586851670675 1.37028858456 0.768958451975 0.504903662999 0.0401830542296 0.179516483383 0.0260615738593 0.320069615284 0.0514874328311 0.0730906239858 0.0500704875043 0.126989204283 0.0185452770624 0.120931812654 0.0233211166859 2.57821698158 0.137637074862 0.52477780815 0.185823198291 0.14069243508 0.0436555868557 0.0759002609233 0.0304916977712 351.484733517 0.0751625144229 26.381564856 0.10755263699 1.62508488908 0.117164738243 0.443351098266 0.125852859682 -0.00540817019885 0.109532143682 0.00466186168276 0.0119570850765 0.0158619374367 0.0807774228921 0.0133696167272 0.00519688621966 0.029392784273 1.27871496477 0.063722905148 0.04128067384 0.00632884583531 0.0453137431349 0.00843806244594 0.0123184356638 0.0549166610956 0.828580129577 0.0498266614372 0.0502292974892 0.0199171150784 0.185872475093 0.0251441786984 0.010719019886 0.089127529091 3.4296456957 0.103967035845 0.239907865574 0.00468334570237 0.206251061571 0.0138674587778 0.0283270941681 0.00773883894314 0.0717966354105 0.0039461417809 0.00130873744795 0.00796058746493 0.112416234141 0.0258843362023 0.0102273571283 0.0143618403641 1.09404680854 0.0371145501871 0.0742827896751 0.00597837009967 0.0989926626628 0.00732532644804 0.0141200991997 0.297694270758 1.90815280778 0.448236037837 0.0662766472026 0.0370265810511 1.47916590967 0.115943259122 0.102962006329 2.53689270085 -0.0102444412948 0.00509286785591 0.0526826133572 0.00865174390146 0.0167207453137 0.0078067338281 0.0680018616885 0.00652270728479 0.0529708932914 0.0317393901905 0.953237491747 0.0460080390141 0.0202225963419 0.00647460880487 0.0627457859646 0.00621514632303 0.0849084781118 0.0605758785434 0.430500146762 0.0760617630848 0.0368909715192 0.0130987377349 0.289812358407 0.0111800529475 0.15870666689 0.105782269501 3.01587355888 0.129715864077 0.0292980098652 0.0140236078572 0.161233068931 0.013554679652 0.00638065202681 0.00383023188484 0.0462524279848 0.00467115363075 0.0143634062062 0.00687250339689 0.106692653386 0.00553305812419 0.0427454939109 0.0298804720595 0.989563854742 0.0360911542865 0.0145669991601 0.00652825936214 0.0693258497758 0.00506439035447 0. 0.0616959880557 9.95680242469 0.105688196253 0.162332902184 0.0468444399235 1.27307344663 0.0459595842087 8.27606578348 0.715389857412 -0.00789939435885 0.01212501017 0.00773363835482 0.175301373497 0. 0.0143690209499 0.00126452851364 0.132117818087 0.0582018868707 0.0711103982248 0.0578686515489 1.756951756 0.00998972583202 0.0120449704688 0.0114545328219 0.0634532707085 0.0744891940437 0.0686263990691 0.0484135563166 1.44153871334 0.00450888748208 0.0272210780702 0.0240257116739 0.208900041641 0.0398056574747 0. 0.113109727358 5.32058987453 0.0150482576711 0.0314730538069 0.0119754249663 0.256988726401 0.00098902044467 0.0131515986558 0.0105575625281 0.10786533181 0.00903471281231 0.0072515426398 0.0277375045236 0.110148076992 0.0208083242687 0.0755742185728 0.0905113037895 1.71936164198 0.00966856631646 0.0179622299535 0.0146245333127 0.12178135613 0.294662757949 0.0974744910442 0.572307858294 3.67660894718 0.0571583781106 0.0395596260121 0.107882138908 2.20567784646 1.91713540938 48.0143648972 0.853169465851 -0.0531643487552 0.00046790400605 0.000838453691686 0.01812896729 0.208420547857 0.0343787330744 0. 0.0231920471902 0.043685055595 0.00732004830476 0. 0. 4.11106061846 0.048722096716 0.146088640727 0.0560625049253 0.0474926500595 0.00475721733224 0.00484972824452 0. 0.197182079712 0.0457824201776 0. 0. 0.058950641239 0.0289413524406 0.0136873269902 0.0229852647113 41.3472328531 1.0528307594 1.29285877772 0.306280922598 0.0345768065397 0.00451575537032 0.00714407574213 0.00383630480052 0.231578282487 0.027634098434 0.0463528990383 0. 0.0637039348201 0.0184746799941 0.00875762872995 0. 4.32985621739 0.117782272716 0.022019255005 0.0681679785543 3.64445607755 0.0592877548457 0.525086277223 0.0756449030113 4.56261330482 0.110131050888 0.0439052051569 0.0797889683874 2.06518561996 0.0666683510558 0.0762726044496 0.0517838499854 -0.0055199762485 0.0334289719786 0.00390763608714 0.00102384267646 0. 0.106196580492 0.00818508580281 0.0136642809574 0.00357284653328 0.0457468056207 0.00694679633975 0. 0.0911050824201 0.599678869518 0.0489300439061 0.0108088282083 0.0105832559291 0.145765335695 0.00690974052474 0.0114920430125 0.0175529106988 0.175936238339 0.0413270786918 0.00872752794066 0.00466216314537 0.0913950125537 0.00860719686636 0.0243677507458 0.0585882757321 2.80334749919 0.0872701701452 0.111401177662 0.00200006153919 0.0217250647562 0.00433905371471 0. 0. 0.110447906903 0.0173404257969 0.00995287043434 0.00388615508611 0.0438806416399 0.00902124309974 0.00312743519908 0.0425164571122 0.955534749424 0.0288747192586 0.0248716875581 0.206472713399 1.77357320853 0.123522093577 0.193297452822 0.0928470465172 1.53245881476 0.111006305099 0.117335749811 0.105553436644 0.742828630094 0.0622235265575 0.0423426485008 1.43526430491 -0.00783695049608 0.0250727545388 0.0365535857915 0. 0.104520783638 0.0175266123984 0.423097003684 0.0372719485901 0. 0.00118601758413 0.0980061451082 0.0165691637301 0.398423196665 0.0736727127086 1.87900199944 0.0923264680767 0.0174427982474 0. 0.0558435587249 0.0325636812093 0.0600891313087 0. 0.53367919355 0.0668040000349 0. 0.0149063765247 0.118853989326 0.0549025463859 2.14712512855 0.312763441889 20.1875336549 0.347860470677 0.0066552531376 0.00307323366926 0.0412644723982 0.00610625387445 0.0831499855006 0.0075476627928 0.537235020729 0.0317779628223 0. 0.0021195066801 0.103937315422 0.0444811941521 0.209725175735 0.0477753255181 1.65952099137 0.0698039587929 0.0802054038476 0.0387196706916 2.78319794878 0.061028317299 1.47838527252 0.204511470784 7.10912954036 0.256877041263 0.549142746907 0.0751592976177 1.26735185125 0.109280267489 34.4959393706 1.05085922221 -0.00746472259056 0.00204899373295 0.00581141364371 0.0491987450047 0.0279931733762 0. 0.0187164230282 0.139287436956 0.00599351063267 0. 0.00799680673582 0.0650958058285 0.0344787803875 0.0123348960029 0.0622609147898 0.851318265478 0.0137965285149 0.0171589122973 0.00792908114731 0.177351717033 0.0066528572533 0.0210605579391 0.0315464539473 0.18248378446 0.00953680519322 0.00890950686499 0.00910725738233 0.174716153118 0.0532132015906 0.106932799171 0.0628787450617 3.22751790841 0.00644393995935 0.002174043541 0.00377513820975 0.0273030924407 0.0338199259892 0.00125051939221 0.0390614305644 0.10632141054 0.00310445049144 0.00717703221063 0.00848650791657 0.0783047449268 0.0456723888635 0.0516488993956 0.0415544937568 1.15249307403 0.265892650003 0.126252301003 0.188030143058 2.21350162545 0.0711131598547 0.0498530038432 0.14039933692 1.62206226821 0.0927215536591 0.0268076213023 0.0997798597602 0.992253660267 1.28408120875 24.4950942036 1.65934183601 - -0.0255410031621 0.0196994410272 0.0329436805941 0.0171683371063 0.0149396985614 0.0183708104275 0.00645076614979 0.0131771277358 0.0119329780996 0.019404291813 0.0110661479582 0.0126066351598 0.00767281125434 0.0211476929741 0.0217199500715 0.0162144992548 0.0125788049362 0.0153824193819 0.0351900543795 0.0107925691178 0.016594963679 0.0192878934182 0.0069342750228 0.0174443586684 0.00639363526807 0.00974852461103 0.0111678900222 0.00443298791246 0.00723674640067 0.0193993823623 0.0394721937175 0.0134712866574 0.0308697977783 0.0261955025614 0.0398854098195 0.0222118074114 0.0157269211794 0.0271424443752 0.00716582944527 0.018409347815 0.015995194452 0.0210047367317 0.0151538538426 0.00983855721495 0.00727530179348 0.0147630423609 0.0279360948926 0.0111035450087 0.000586877417582 0.0155362448361 0.000536216447671 0.0120197877511 0.0121507344448 0.0176708896065 0.00473584340384 0.0155784373036 0.0010210997268 0.0121177246907 0.0119605502469 0.0104896896194 0.00812470878645 0.0202026177119 0.0134871493447 0.0175201850745 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT - diff --git a/PhyloCSF_Parameters/49birds_noncoding.ECM b/PhyloCSF_Parameters/49birds_noncoding.ECM deleted file mode 100644 index 2e3e718..0000000 --- a/PhyloCSF_Parameters/49birds_noncoding.ECM +++ /dev/null @@ -1,72 +0,0 @@ -2.78592743423 -6.58600444004 3.19341169223 -1.63519457982 12.1399355041 2.45567860959 -2.43476285124 0.137196047767 0.462787891603 0.0687994720539 -0.0828676812999 4.64297827314 0.0583439047427 0.114333277922 4.54770228198 -0.569910594763 0.269905137878 10.0658717921 0.227536068622 36.0992488386 10.3039899411 -0.0485017841297 0.412819154555 0.0211222634573 2.74491138612 2.97356015436 14.4767642696 13.8730044691 -4.91172089731 0.155166943916 0.607308551579 0.0926673262207 2.93090865811 0.0568018331327 0.563736806771 0.0419502454502 -0.110594870229 14.1973016288 0.227814935065 0.348821740023 0.0698012930426 4.35673029912 0.320289189969 0.205259373689 3.19849897319 -0.200634258787 0.0561388860069 9.29335938844 0.0929695932917 0.395913544434 0.0764056737434 8.35592589299 0.0734485882052 10.2333897454 3.31735868963 -0.13798910766 1.0340072599 0.318823468155 10.7213291459 0.0794339571607 0.150236344311 0.308812958798 4.11390908902 2.34629268324 13.7678588818 3.75348569698 -1.61163899145 0.0903822534676 0.0978724405796 0.103846672592 13.0480744395 0.227582308607 2.33026717206 0.158960500271 2.75288101677 0.0415967285977 0.155011835538 0.0774147142431 -0.0539412039354 2.7175215174 0.0197134073579 0.160319614896 0.188046082887 17.3910431275 0.852712504949 0.990756643627 0.0714613184066 4.0085387173 0.0637586828172 0.239230657001 3.72498943433 -0.115504297981 0.0554316110801 2.62956148456 0.108596913546 3.44821535373 0.624122455894 46.1826203189 0.819390424217 0.144340307998 0.0767389836681 3.45253752203 0.0918946223283 11.0581166867 2.78890551354 -0.0686425149198 0.126358582519 0.0353234891621 1.62786654769 0.112834294186 0.366312347819 0.910925474064 10.8159929664 0.0420270072454 0.121652373835 0.041021549888 2.70393912639 1.97744280002 8.57968016608 3.32159829656 -2.7544269435 0.0893651329767 0.147541427462 0.045588254393 0.13118461025 3.18524470568e-05 0.00511362108266 0.00177951014407 0.415950418678 0.00274376193493 0.00295069255731 0. 0.0490110518677 0.0109095971916 0. 0. -0.0792482672501 3.8269663053 0.0600975342331 0.169229443099 0.0235434410828 0.20555593481 0.0187169473997 0.027489303549 0.00704240140764 0.842055408475 0.0204804845935 0.00228597224206 0.011244526864 0.0757896416031 0. 0. 3.49147912066 -0.140350659206 0.0519225842332 2.88395589756 0.0273793218983 0.0160717268365 0.00476194914635 0.256665151464 0.000945031287224 0.0457491179596 0.0221450577789 0.598936842192 0.0157356154024 0.000732141038617 0. 0.0653627423271 0.0024299228541 10.7164632866 3.57233983814 -0.0420703782816 0.245254684763 0.0661881569729 3.31052265197 0.00921779748141 0. 0.0187176169492 0.0941345819645 0.00889233349389 0. 0.00988308290204 0.825507301736 0.0116464934505 0.0265891275072 0.0121580600248 0.105930373584 2.27706263405 16.0355075221 2.99806680412 -0.0835624220006 0.00882220161046 0. 0. 3.08974563007 0.122047945762 0.580194800746 0.0527490707359 0.0735023766671 0.00433095387463 0.0343457304593 0.00511087269641 0.0846597799348 0. 0.0288920646816 0.00160328304007 3.89374822857 0.145724186109 0.859411475778 0.0977710846653 -0.0154152275448 0.104820298736 0. 0.0105463060181 0.115102782565 5.17009625533 0.237854650192 0.172608828294 0.00557693962982 0.118368017498 0.00724878346524 0. 0. 0.182319021431 0. 0. 0.138898774156 5.03284649814 0.138658093089 0.165678358789 4.79323321106 -0.00482910140346 0. 0.20777458312 0. 0.532995768631 0.254053586795 16.2610321 0.173403286842 0. 0. 0.157481114874 0. 0. 0. 0.394080739918 0. 0.69328323564 0.320689384456 9.88649042287 0.167025974959 34.8139406207 10.1133870094 -0. 0.00961312458577 0.00777720146138 0.0421416632552 0.0668430982448 0.316055827456 0.310161085324 3.80578081572 0. 0. 0.00286341134589 0.0655755234675 0. 0. 0.0111015655273 0.0940823246107 0.0501235340082 0.388529007176 0.100853422779 3.47803826662 3.01358288946 13.5549050105 9.5786073322 -0.468309814243 0. 0.00422239547645 0. 0.26830641753 0.00846178333649 0.154305577789 0. 11.2231238988 0.279262732154 0.668330937867 0.193652679992 0.219677620446 7.2077574577e-05 0.00604055276834 0. 33.2452989031 0.811222421625 2.55659342609 0.452160447674 7.64549509172 0.263216471122 4.7802784332 0.143871982185 -0.000860877233951 0.834462206337 0. 0. 0.00360228322614 0.414239512028 0.197936924501 0.00823935352163 0.11774285457 11.2493424316 0.201884259842 0.497799451235 0. 0.266084682123 0. 0. 0.266110848103 34.7258580282 0.547536957554 1.46118924155 0.160338489022 9.08023328703 2.77572496514 0.635232621196 20.7884238597 -0.00982618500386 0. 0.591865235112 0. 0. 0.00218531337504 1.27017090395 0. 0.339648545761 0.16161338633 9.56757283704 0.183239415868 0. 0. 0.190549769126 0. 0.939489900239 0.401541837309 30.6896731945 0.378631582678 0.49544403824 0.338076522141 40.5444710727 0.154867530415 51.5670070065 18.1748961464 -0. 0.00305450479455 0.0135564060988 0.917987071428 0.0121496291976 0.00940515686116 0.119119559264 0.323445066476 0.137627082052 0.973331878132 0.317403241123 13.7268039631 0. 0.00385237606388 0.0129442098625 0.2243721539 0.436381800076 4.66762939214 0.890960051922 46.0687746218 0.159821879484 0.606560651364 1.3124413836 8.44478548018 12.4665171004 49.6206423643 16.2525872954 -0.0480997542122 0. 0.0120069171917 0.00705871640247 0.365898539349 0.00331565177772 0.00828798187583 0.0190617177772 0.0566983820258 0.00206195136388 0. 0.000851243591405 4.13290256325 0.0778480013042 0.257064930071 0.0532942502359 2.58623674767 0.0627896589555 0.130295452685 0.0607415410117 12.6708354607 0.127040124001 2.19987609742 0.174617163404 12.8946521218 0.0747252598411 0.446429410446 0.0977030126566 -0.00562265261444 0.0764307547465 0. 0. 0.0063414974605 0.380861788353 0.00753424639752 0.0220559286448 0.00980976134525 0.101156083167 0. 0.0138619086514 0.072833456771 3.75912497016 0.0471465843163 0.106431837705 0.0803441627835 3.285182125 0.0552749886049 0.164538257304 0.2503607233 12.1799982117 0.873441856704 0.770053907325 0.397759952713 10.5237799774 0.22377862705 0.742945113248 4.04528522945 -0. 0. 0.0539015946056 0.00278364992127 0.0377957707833 0.0135963635668 0.89440013158 0.0147550321805 0. 0.000295662566089 0.101859214026 0.000945192222413 0.107777801947 0.0455856315413 2.95431984048 0.0299580499308 0.0692407005928 0.0777213018462 2.8342950611 0.0597295499215 3.20392772547 0.525791072418 30.2914067842 0.591091345872 0.778259117844 0.196799800294 9.7436291249 0.250287033284 14.0153836355 3.34075289278 -0.0029775553938 0.000481714381558 0.00995582674459 0.0354561987446 0. 0.00988402515618 0.00175895315694 0.319479264747 0. 0. 0.00856538884321 0.0181925584499 0.038841902373 0.144236561331 0.0680763995227 2.45864879147 0.0532891365325 0.207694885915 0.0544091024245 2.62133140043 0.124628865738 0.386482949994 0.605612447182 9.29643383867 0.193490205147 0.508707708341 0.224730774419 9.95732384776 2.2284772758 9.79481604528 2.83331650296 -6.56858255082 0.157040779976 0.412175038103 0.0941892466145 0.22602139234 0. 0. 0.000432028561943 0.578215659146 0. 0.0122850462384 0.0100014809361 0.11167679813 0.00640756227736 0. 0.00161147255275 2.46904674823 0.0456773806562 0.15229360324 0.0314539380676 0.0534554009708 0. 0. 0.00927397630364 0.447179203281 0. 0. 0. 0.0367299291555 0. 0. 0.00903617543561 -0.154254426169 12.0194888817 0.188385564082 0.404976306527 0.0330397145777 0.450121271064 0.0489176001655 0.0370399636967 0.05094694887 0.990991883141 0.0180840722072 0.00384380211183 0. 0.169457512386 0.00819708281146 0.00870799638103 0.0573145148162 3.61306377769 0.0855272437255 0.154782328737 0.00748232676517 0.0881927464735 0.0049964336753 0.012854379142 0.0301713814632 0.72400213014 0.00648062632878 0.0198374976478 0. 0.0571707574935 0. 0.00247035561626 4.34813916207 -0.227788108235 0.0799299082191 9.79896923451 0.103053796284 0. 0. 0.78255650198 0.015579837746 0.128340355924 0.046279605209 0.779068029741 0.0225234611853 0.00602103326625 0.00493313737968 0.161693747513 0. 0.0772646124819 0.0784651311818 3.39842393239 0.0430785142297 0.00319153334055 0.0200545515437 0.226232620884 0. 0.0820883049329 0.0265643135942 0.866371736819 0.0183432125543 0. 0.0250462788848 0.0482691177232 0. 10.1583124061 4.45404934624 -0.107881419785 0.624537506527 0.143524792543 8.57913984856 0. 0. 0. 0.243607905648 0.0376568369585 0. 0.0123913692603 0.977051019802 0.0286899775315 0.0401590208837 0.0222659759274 0.159355783736 0.0382060716859 0.180359387973 0.0471829513688 2.82761809762 0.00499074984672 0.00488669031459 0. 0.053752763036 0.00691320221159 0. 0. 0.829310276526 0.00323386746488 0.00593988613076 0. 0.021522244845 2.40542589088 19.5417991861 3.75671940857 -0.12834113079 0.000631024810323 0. 0.00370534372453 12.9755000578 0.249546857178 2.2428079352 0.16858926865 0.167087689576 0.02383686429 0.0439490546363 0. 0.655221811919 0. 0.0906015436812 0. 0.0942550375717 0.0144616778276 0.0351737751326 0.0112630245205 3.31439870246 0.0682789714328 0.43347001132 0.0516315018829 0.281101289081 0. 0.00916726942431 0. 0.230196247012 0. 0.0403187341028 0. 3.34331662861 0.0971515456628 0.781046975592 0.0872172134872 -0.00147272373388 0.231637836881 0.00034595435521 0. 0.239177344728 19.0321903198 0.682121242987 0.58023907979 0. 0.362869697142 0.00491708358301 0. 0. 0.711707470265 0. 0. 0. 0.117504471461 0.0121911148736 0. 0.111229457943 4.4199412059 0.306313105926 0.250843260075 0.0151977356619 0.530844103954 0.0200689115308 0.0183915886966 0. 0.240685558284 0.00716322812369 0.0025539038592 0.0720097295311 5.06653931434 0.0792452953844 0.173890272432 5.19879437497 -0.00584157821457 0.00981900567978 0.501161696619 0. 1.70123466465 0.457547343541 50.4645366614 0.516148327511 0. 0.0476676401932 0.633934534495 0.0154289667092 0. 0. 1.41536414927 0. 0. 0. 0.204730338169 0. 0.317299779043 0.262826758155 18.4505803511 0.196113664614 0.541248280455 0.708760121856 2.67512354266 0.181899268955 0. 0.0231037960197 0.546155668327 0.000709150651529 0.690762503945 0.31210703086 10.5525498701 0.251830847873 35.1062120167 9.24273876406 -0. 0. 0. 0.121219395501 0.173500127538 0.732707640921 0.967955772341 13.9456042856 0.0142592910443 0.0661696110665 0. 0.204245055816 0. 0. 0. 0.335284741585 0.00120828759341 0.000770045425943 0. 0.0762604530737 0.0474049343197 0.13927094387 0.17189083881 3.32796677053 0.00836207794708 0.0417538220573 0. 0.302116718197 0.0100602962328 0.0446388722815 0.0203652287305 0.233869284809 0.0606199672857 0.338796931585 0.101822437413 4.01419582769 3.59460760499 14.1246349223 11.2167674822 -0.305915296181 0.00387290678178 0.0283900521037 0.000168284862403 0.103145819992 0.00682213703837 0. 0.0069105622856 10.8506353065 0.143162318594 0.606240184459 0.101575092269 0.174857843309 0. 0. 0. 0.379874892195 0.0135188840515 0.0283892888726 0. 0.0866224362335 0.00680603807226 0.00423745111466 0.00363287262812 9.81027429037 0.148538407691 0.484853262019 0.110578511 0.0796243853214 0. 0. 0.00845303045711 10.3935417311 0.412884043486 0.946160277011 0.227669238572 3.3309009611 0.119274560321 0.88047907047 0.0227475613468 -0. 0.464728116785 0.00308746578916 0. 0. 0.199886815768 0.0125122178155 0. 0.180705625194 14.0947925672 0.252641224242 0.547186742156 0.00366396625264 0.171718229624 0. 0. 0.00256090204409 0.636746675067 0.00960274978496 0. 0. 0.146270560184 0.017249053838 0.000316098567487 0.285378211168 9.24014013085 0.305949089687 0.718193549725 0.00312219292709 0.0773155035163 0.00955123407451 0.00198881136206 0.144809836717 19.3056982127 0.243438772992 0.717540645624 0.151265661762 4.92211351063 0.504292174964 0.361202903197 4.49006892216 -0.087451981084 0.00842338129519 0.392290124716 0.00139847334073 0.027044155128 0.0139774661244 0.638507439152 0. 0.556961222423 0.13882239836 13.5150909923 0.166561693382 0. 0.000756205239141 0.188613940486 0.0144571766857 0. 0.0167131216833 0.532700702004 0. 0.0320969284915 0.02326036368 0.33353910299 0.0105399567991 0.600959423559 0.261734253996 10.1713107581 0.238032618109 0. 0.0199740705072 0.139539542607 0. 0.57217221198 0.216745519905 12.1940990023 0.178514589947 0.592929555019 0.137803794033 9.00742699427 0.129076334826 15.0682981859 4.38093295403 -0.00986884400482 0. 0.00714910857349 0.367847444687 0.0166385250797 0. 0.0210436940204 0.155361065995 0.170480142873 0.717744368709 0.312410321473 14.2913544055 0. 0. 0. 0.120387628276 0.000292448770617 0.0183996746206 0.0118009941572 0.612374176547 0. 0.00880187636181 0. 0.0810806480573 0.211302552782 0.467407092312 0.246211628106 10.2837358385 0.000671732121191 0. 0.00544000385484 0.0566344860084 0.152106508386 1.52277218051 0.373232827818 17.3834665486 0.088560075074 0.196177361201 0.380258104422 4.36085934855 3.18437134081 18.8510841125 5.14520276184 -0.140188964873 0. 0.0151920530983 0.0153098032383 1.21840798939 0.0200771021955 0.013828583721 0. 0.298711554809 0.013282000644 0. 0.0167204186218 17.9923373684 0.232696535903 0.984057841766 0.142431651545 0.0594158796265 0. 0. 0.0137989912116 0.12040947048 0. 0. 0. 0.311981750261 0. 0. 0.0153840209357 5.10599693577 0.060058085426 0.192867675621 0.0439372706467 2.29950758326 0.107264463125 0.122983893731 0.0764090093826 14.9222894425 0.206524497422 2.86780466508 0.159494635211 3.80306505617 0.0334445588107 0.325190963647 0.151947105188 -0. 0.207669384822 0.00189721251573 0.00553485636554 0. 1.52235490048 0.0214143749539 0. 0.0145960413034 0.32793862831 0.00705339082687 0.0457414280331 0.268825669828 19.5855144187 0.172589090786 0.409132980287 0.00554476834153 0.1076229582 0. 0.00240622379516 0.00804850693051 0.206710892449 0.00818525905021 0.0258785461201 0.000760289922815 0.311325590969 0.0118866698369 0.0359508735092 0.0658382096549 4.45507109341 0.0857620092788 0.184552789051 0.0797894222264 3.9481700794 0.0581303052042 0.16676938791 0.269272847366 19.2295897427 0.73594417452 0.978955856639 0.125122027026 5.05506631457 0.0973955577781 0.428928296452 4.82612419107 -0. 0.0187625080249 0.20621297091 0. 0.215475351118 0.00846225603838 4.56136559967 0.013451185552 0. 0. 0.397015828795 0.0315660915039 0.710900933484 0.189198512858 15.8999065484 0.160971621735 0.00628354924211 0.0161321594066 0.0723294391078 0. 0.0117968393571 0.0236982978919 0.433978791462 0.0143668477172 0.00817272892114 0. 0.316429262812 0.0198151164693 0.153450120451 0.0773647680014 3.50455393025 0.0618333636644 0.166520883576 0.0976239406896 3.24864400372 0.0837585483462 4.31483949393 0.648545185882 34.2984034321 0.819405183509 0.266907960006 0.122705495208 4.9548758249 0.199588957896 16.6777618142 3.57079368656 -0.0124471120403 0.0272087327615 0.00155187404069 0.125233490839 0. 0. 0.00895158073499 1.06491980832 0. 0. 0.00715827430729 0.414147587417 0.180211554628 0.623836427105 0.241870122255 12.2059095361 0.00658301673438 0.0125565086887 0. 0.058709761226 0. 0.0151374969764 0. 0.0571779694018 0. 0. 0. 0.285486228445 0.0388450921219 0.0813947228349 0.0513523513133 3.2140738289 0.0593540209486 0.20347229722 0.0794482293815 2.69456850247 0.178836946955 0.472832758926 0.844501463372 14.1545062979 0.111742476081 0.237178456371 0.101985554242 4.60324813954 2.89376135367 11.9743180489 3.79180138166 -1.85192230366 0.0693790157141 0.106402926385 0.0608024713276 0.0436329895839 0.00107179024991 0. 0.00390362798834 0.0808916951667 0. 0.00433532953897 0.00866563775885 0.115681448961 0.00244887631965 0.0122927075949 0.00307380568859 8.32999782753 0.126029974553 0.460073198431 0.120793949772 0.115673876081 0.00271733825314 0. 0.0047754974823 1.70598507161 0. 0. 0. 0.178363763058 0. 0. 0. 3.00967295837 0.0788741164722 0.103306012195 0.0385900978126 0.0418440750087 0.000122216607141 0. 0. 0.136527075723 0. 0.00566931440696 0.00251708868497 0.105111201226 0.00419097275684 0. 0.00485924133915 -0.0549154541207 3.03224643496 0.0428847156108 0.133703532383 0.0202336985508 0.140949578231 0.00900894226931 0.0250639669303 0.0048425257738 0.128268392937 0. 0.0115912491402 0. 0.0827492946191 0.0160830178931 0.0111482505672 0.24141129768 17.0668338244 0.206414807432 1.00003095748 0. 0.311079374201 0. 0. 0.0145169454496 3.04001941638 0. 0. 0.0331464951668 0.127673716292 0. 0.00965378489659 0.0589629693926 4.9678210571 0.0571303284523 0.248965454673 0. 0.0493384833039 0. 0.00239893485768 0. 0.230692698695 0. 0. 0.0422766872909 0.0920739167052 0. 0.00133058864128 4.29048773271 -0.101517404125 0.0343491447041 2.27313430775 0.0554319415663 0.0210799624769 0. 0.0821407508018 0. 0.0329140841083 0.0175891419447 0.184042580709 0.0134375573067 0.0238409003486 0.0035029716646 0.0557026739775 0.0110516944291 0.449722568316 0.159306400865 14.0744663646 0.253068276327 0.0121885022963 0. 0.46176793784 0. 0. 0. 2.26889710649 0.0224957316916 0.0300941303173 0. 0.127312288213 0.0124284578828 0.147104057547 0.0639672848033 4.10550614777 0.0825088546667 0. 0.00813367565483 0.0729990890482 0.00689730236854 0.00599463654984 0.00116099561615 0.127372168082 0. 0.0374612069485 0. 0.0641437950891 0. 8.9067174944 5.26727004749 -0.0634587178075 0.164446070886 0.0389132563161 1.99737117863 0.00282180434061 0. 0. 0.0774665806316 0.00868272364467 0. 0. 0.14300480576 0.0283602289446 0.023588473164 0.0105163231084 0.108103678501 0.14614846102 0.666021762766 0.113838834063 11.0648283984 0.00197426866049 0. 0. 0.151913570895 0. 0. 0. 2.32294437496 0.0235773309743 0.00278112713673 0. 0.0949326087762 0.0380151845809 0.268793047678 0.0730886004517 3.71246743415 0.00918507483228 0. 0. 0.046609892172 0.000579927622744 0. 0. 0.246691875092 0. 0. 0.0121177322723 0.0858990441967 2.11327446775 18.4850191794 4.13292946501 -0.0454886898633 0. 0.00608734618322 0.0016151106611 1.98767482394 0.0527684920215 0.210535924194 0.0536827040618 0.0420252303951 0.00588687958894 0. 0.00066928368527 0.154395852194 0.0186920369151 0.0166574139067 0.00359586340379 0.217447880351 0.0227868287022 0.0421451566115 0.0208986894064 9.79650280147 0.141230586854 0.926171845582 0.120065761888 0.483172002247 0. 0. 0.00519099356137 0.715526565594 0.0222416221031 0.134580169449 0.00972160824641 0.0897851212753 0.00130881885851 0.0166280705267 0.00142630838426 3.27162515516 0.0628333601292 0.197931476966 0.048359439559 0.0588224129141 0.00505944834557 0.00615546676895 0.00148701250206 0.266009222204 0.0152178532484 0.0375628245831 0.0051968742038 3.10505375421 0.0921325112832 0.494869259187 0.057954196026 -0. 0.10375058827 0.00895116015077 0. 0.0488589220103 3.23100578316 0.102852989537 0.0992758415717 0.00335181630037 0.0273009328923 0.00169258214181 0.0021720572221 0. 0.232980339437 0.00106980475086 0.00264157628508 0. 0.26583153922 0.000454703033684 0. 0.257433667291 15.0764556279 0.475982048683 0.612573787407 0.00127451046421 0.854042044641 0.010430565389 0. 0.00892929688638 0.951084070718 0.0305638428038 0.0291998661887 0.0103191984664 0.128858289569 0. 0. 0.065182747413 4.50215646981 0.141527513151 0.149054910944 0.00381937078567 0.113453281622 0.001544157525 0.0163706083748 0.00216907007472 0.425752972949 0.015172048448 0. 0.090884506002 3.94010288909 0.0822907479248 0.143448913247 3.94613664994 -0. 0. 0.17631552808 0. 0.541360468027 0.191544494061 12.9177085683 0.19141559287 0. 0.0077944473201 0.150455878283 0.00425317702852 0. 0.0157869881978 0.441933004077 0. 0. 0.0027451427081 0.813018154846 0.00629319249643 1.82975513433 0.614583853488 51.1610794325 0.680185321452 0.680808083455 0.482636692887 4.63806009414 0.190710087212 0.0255917056117 0.0788586973079 2.51305147376 0.0223075594435 0.00821325826844 0.0118380563154 0.387025791712 0. 0.731484041325 0.285688609037 20.8451309518 0.274016052876 0.00281011791009 0.00386208802479 0.271546419145 0.00882315670346 0.00814020975936 0.0353938170827 0.810935235854 0. 0.719888232788 0.317147489876 13.0266914958 0.209522978429 42.3850162604 9.79461368788 -0.0087248402762 0. 0. 0.0388028267706 0.0544601295802 0.167312785248 0.128592356538 2.38092749378 0. 0.0136994402801 0.00208139452493 0.0426199782934 0.00783642738883 0.0384048442744 0.00683574723219 0.0935666624087 0. 0. 0. 0.143036392756 0.145858915325 0.559774631266 0.33719131026 10.2273191348 0. 0.0102269689265 0. 0.517426541896 0.0328635291206 0.129812799345 0.0471040742776 0.610397195218 0.000429440743348 0.011649854694 0.00926334868987 0.0765859221309 0.0363917814826 0.183338074344 0.124125168139 3.20750017235 0.00108884405549 0. 0.00709815195924 0.0494190173154 0.00181848086765 0.0479824177173 0.0093094534245 0.152251675425 0.0411876400152 0.292750010335 0.0548809377424 2.76386105945 2.22257855879 10.8628930542 11.1413927804 -0.0760250538715 0.00700421836525 0.00866648194089 0.00435986152497 0.0540827397947 0. 0.00391636097676 0. 2.23283740478 0.0477354909763 0.119722467157 0.0512077291182 0.0582828087579 1.84450841094e-05 0.0212705156613 0.00347637118437 2.3444294707 0.0387767742541 0.13871448845 0.0161289290258 0.404228283439 0.00670727864772 0. 0. 42.6257611554 0.196792049636 0.929369177618 0.221868715408 0.489384967201 0.0168388452585 0.0398846300782 0.00512133729322 0.141547888798 0.01482634149 0.0254244831056 0.0210919924281 0.052656552978 0.0045449028405 0. 0.00716446340832 3.97333759429 0.0632861016144 0.142570150692 0.0496143346137 0.0894119344944 0.00143211187454 0.0202383137864 0. 7.73808578168 0.269236099363 0.714173337151 0.148482271426 2.27460367338 0.0612555216636 0.506093630745 0.0397805658951 -0.00335948534388 0.166811362037 0. 0. 0.00163245648269 0.0869115764053 0.00145131831787 0. 0.0366620864637 3.60332218814 0.0569434943281 0.162544597515 0.0101552271511 0.0862933628427 0.00997209836899 0.00614153543388 0.0143543479853 4.36503411421 0.0404557851182 0.0829539975305 0.0279204536382 0.591301367783 0.00185763764181 0.0353923010908 0.707502598715 35.0815245817 0.426555047875 2.24727598232 0. 0.78485920919 0.0292031839397 0. 0.00180239766365 0.267951329933 0. 0. 0.022120304753 0.153353668133 0.000864485448678 0.0247743262171 0.0575696359221 5.18508259902 0.0736462414271 0.260305286917 0. 0.0968691355895 0.0138850315085 0. 0.138838219983 15.4052198753 0.211229746893 0.59906033101 0.0515508895799 3.32129727819 0.27694555062 0.169235739566 3.26958964513 -0.00315205571841 0. 0.119858587196 0. 0.00965168066826 0.0035616261757 0.172854630017 0.0111622195472 0.148179057638 0.0410147698761 3.03403380457 0.0541614715481 0.000563097911286 0.00489601991308 0.0940862857026 0. 0.0217924575442 0.0129881466992 3.25778010704 0.028965386855 0.140292613723 0.0293657555445 0.484832092218 0.0345007483117 1.88077579645 0.325730094754 34.7467555829 0.561059668728 0.0149027296968 0.004157980621 0.846966791909 0. 0.00260535739846 0.00911471818673 0.243798651713 0.00180356314893 0.0271269185037 0. 0.165004321262 0. 0.256825819514 0.106302800681 4.81357755061 0.126885076615 0. 0.00848265494272 0.154125731765 0.00945871747585 0.250541358334 0.119835918567 12.7448935237 0.0835390299321 0.403266783084 0.0841562495728 7.56357418722 0.074228113326 9.80967504055 3.27871254942 -0.0103556018408 0. 0.0011816109884 0.113633952737 0.0118785975884 0.0125379387686 0.0104722121626 0.0788538391735 0.0533571273803 0.168525336551 0.0621319164848 2.95416541639 0.00242580625115 0.00146091373886 0.0100088353982 0.0663269954569 0.025369860271 0.22434540866 0.0343720715155 3.46956439231 0.0131447148201 0.0215679445196 0. 0.405073060412 0.556475593543 1.67817531836 0.545977564286 35.7061721804 0.0116939219962 0. 0.0183565441501 0.460092201302 0.00074238992399 0. 0.00579123310552 0.191431140758 0.00108942651377 0. 0.00297715155179 0.0726203290199 0.0534914770371 0.244946229554 0.115786843235 4.52310415665 0.0183960883988 0.0315494387759 0.0220921785763 0.138487740821 0.1498026314 1.20488541655 0.374457402337 13.0091599938 0.0516036232577 0.0991638339044 0.272220445341 2.92620666289 1.97016748469 12.8367518412 3.06689854949 -0.125733907422 0.00436972047946 0. 0.00353647416495 0.154469830792 0.00266701849446 0. 0.00747470692383 0.0428772107152 0. 0.00651486169726 0.0038758756817 2.12423784206 0.0396390768058 0.119676126216 0.0613113344595 0.0934530446047 0.00100486685685 0. 0.0099634245887 0.255867138922 0.00432278305936 0. 0.0033608119693 0.709920584226 0. 0. 0. 8.76488154869 0.108747954622 0.443139983406 0.108862992226 0.0592114869062 0.0021774332275 0. 0.00310486942886 0.146282632535 0. 0. 0. 0.0932659832328 0. 0.00226265698012 0.000437508156089 4.17379919929 0.0813437704349 0.132209517747 0.0702854009238 2.40862742376 0.105698824568 0.178043076253 0.112608616225 7.73500464643 0.139203650826 1.69519019403 0.0810436611991 3.09662064828 0.0385681117838 0.111269521996 0.0489347359831 -0. 0.0609872263047 0.00933842716192 0.000948328196705 0.00374889004249 0.15253027804 0. 0.00952953880298 0. 0.0572009319937 0.00837445788167 0. 0.039770266434 2.41207882465 0.0293270824384 0.0921186610183 0.0023267112147 0.166351748457 0. 0. 0.00216144889003 0.575616954777 0. 0.0148745203406 0.0015650455934 0.679423704369 0. 0.00801061566315 0.145315119018 10.0943879764 0.149402556355 0.412657654327 0.0098602040256 0.0757051733271 0. 0.00455281594064 0. 0.147595745939 0. 0. 0.0110837912317 0.0745131511445 0. 0. 0.0561028712269 4.3424873055 0.0450383438033 0.159410591003 0.0585146883274 2.37207001639 0.0359509499726 0.111435198427 0.139595758963 10.3724187684 0.454590596885 0.57005580893 0.0887282266365 3.33992114556 0.0553897405699 0.22588766036 2.97958638551 -0.00884501661763 0.00822019802007 0.0567978754604 0.00153576505523 0.0229617810989 0. 0.413469077511 0. 0. 0.00113601739474 0.044920740573 0. 0.149636695726 0.0400778032714 2.29007985767 0.0437062887372 0.00940439830966 0.00173005848216 0.0763644279553 0.00198872511095 0.0318057542977 0. 0.959001128734 0.00686764151641 0. 0. 0.69893106591 0.00227248143697 0.431545896385 0.0834627522463 10.4903910182 0.146065626468 0.000137938557632 0.00373652129917 0.0823752461755 0.00739167528714 0.0129600361132 0.00022436885351 0.262261843382 0.00530115881603 0. 0. 0.140415389848 0. 0.238536586546 0.0597236814982 3.45822422879 0.0896154132005 0.0942643358202 0.0515910631369 2.61062231714 0.0494450785923 2.33496905686 0.373558427272 32.9662411021 0.412373005557 0.212265840597 0.0992654681453 3.89618387928 0.130112261982 8.22472527244 2.42902491323 -0.0340591581891 0.012593100295 0.00323337401409 0.0685872694336 0.0105214233326 0.0112649491742 0. 0.139366554692 0.00843066624747 0. 0. 0.04777707531 0.0625981591408 0.106881090187 0.0405634111512 1.64631472157 0.00949918338782 0. 0.000604291454891 0.114526662756 0.00372564611188 0.0921689564017 0.00746205552917 0.200492727878 0. 0.000282518921569 0.00466192088992 0.57052517656 0.101107481918 0.229025687261 0.137716530929 6.54507791785 0. 0. 0.00460225123511 0.0532545275311 0.00269316586069 0. 0. 0.107055482973 0. 0.000186005327605 0.0156408180693 0.0835639144202 0.0562034194714 0.152712853513 0.0782557471793 2.78045654664 0.124962081181 0.143982562493 0.0473902723691 1.60216771614 0.0746132290942 0.308205816866 0.464655090752 4.89934528676 0.0455440791486 0.127170079697 0.0816795449481 2.41190068084 1.8126811407 6.5182404037 2.72920933193 - -0.0357983654718 0.0146634321466 0.0209916853044 0.0241608300459 0.0196605104347 0.0113786862615 0.0029009138093 0.0163015785126 0.0225609755057 0.0145991965297 0.0181825729424 0.0164781957079 0.0186856678405 0.0130405682814 0.0179309987722 0.0240968720195 0.0181775551111 0.0146957289426 0.0210180199751 0.0178777837456 0.0179375335248 0.014026410045 0.00304930001685 0.0181980546371 0.00237235102112 0.00247910724881 0.00304553476624 0.00292174613484 0.0129216428963 0.016886060241 0.0212194293029 0.021001239545 0.0207025677211 0.0101079314077 0.0168739180256 0.0130368421188 0.0145312058205 0.0117191223335 0.00248094305692 0.0145761834505 0.0160538354021 0.0117605522361 0.0140380390381 0.0114567437712 0.0112780796487 0.0101486396189 0.0148519084459 0.0147005486842 0.0206773071958 0.0111337585868 0.012890738691 0.0187059909187 0.0197741432688 0.0160489156219 0.00237751747496 0.0226108300737 0.0197730187728 0.0145713864549 0.0179588059761 0.0198394530312 0.0208205335746 0.0208303362555 0.0183984258157 0.0360132307673 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT - diff --git a/PhyloCSF_Parameters/58mammals.nh b/PhyloCSF_Parameters/58mammals.nh deleted file mode 100644 index d3e6676..0000000 --- a/PhyloCSF_Parameters/58mammals.nh +++ /dev/null @@ -1,172 +0,0 @@ -( - ( - ( - ( - ( - ( - ( - ( - ( - ( - ( - Human:0.00655, - Chimp:0.00684 - ):0.00422, - Gorilla:0.008964 - ):0.009693, - Orangutan:0.01894 - ):0.003471, - Gibbon:0.02227 - ):0.01204, - ( - ( - ( - Rhesus:0.004991, - Crab_eating_macaque:0.004991 - ):0.003, - Baboon:0.008042 - ):0.01061, - Green_monkey:0.027 - ):0.025 - ):0.02183, - ( - Marmoset:0.03, - Squirrel_monkey:0.01035 - ):0.01965 - ):0.07261, - Bushbaby:0.13992 - ):0.013494, - Chinese_tree_shrew:0.174937 - ):0.002, - ( - ( - ( - Squirrel:0.125468, - ( - Lesser_Egyptian_jerboa:0.1, - ( - ( - Prairie_vole:0.08, - ( - Chinese_hamster:0.04, - Golden_hamster:0.04 - ):0.04 - ):0.06, - ( - Mouse:0.084509, - Rat:0.091589 - ):0.047773 - ):0.06015 - ):0.1 - ):0.022992, - ( - Naked_mole_rat:0.1, - ( - Guinea_pig:0.065629, - ( - Chinchilla:0.06, - Brush_tailed_rat:0.1 - ):0.06 - ):0.05 - ):0.06015 - ):0.025746, - ( - Rabbit:0.114227, - Pika:0.201069 - ):0.101463 - ):0.015313 - ):0.020593, - ( - ( - ( - Pig:0.12, - ( - ( - Alpaca:0.047275, - Wild_bactrian_camel:0.04 - ):0.04, - ( - ( - Dolphin:0.034688, - Killer_whale:0.039688 - ):0.03, - ( - Tibetan_antelope:0.1, - ( - Cow:0.1, - ( - Sheep:0.05, - Domestic_goat:0.05 - ):0.05 - ):0.01 - ):0.013592 - ):0.025153 - ):0.020335 - ):0.02, - ( - ( - ( - Horse:0.059397, - White_rhinoceros:0.025 - ):0.05, - ( - Cat:0.098612, - ( - Dog:0.052458, - ( - Ferret:0.05, - ( - Panda:0.02, - ( - Pacific_walrus:0.02, - Weddell_seal:0.02 - ):0.02 - ):0.03 - ):0.03 - ):0.02 - ):0.049845 - ):0.006219, - ( - ( - Black_flying_fox:0.05, - Megabat:0.063399 - ):0.05, - ( - Big_brown_bat:0.02, - ( - Davids_myotis:0.04, - Microbat:0.04254 - ):0.05 - ):0.06 - ):0.033706 - ):0.004508 - ):0.011671, - ( - Hedgehog:0.221785, - ( - Shrew:0.169562, - Star_nosed_mole:0.1 - ):0.1 - ):0.056393 - ):0.021227 - ):0.023664, - ( - ( - ( - ( - ( - Elephant:0.002242, - Cape_elephant_shrew:0.05 - ):0.04699, - Manatee:0.1 - ):0.049697, - ( - Cape_golden_mole:0.03, - Tenrec:0.235936 - ):0.01 - ):0.03, - Aardvark:0.03 - ):0.02, - Armadillo:0.169809 - ):0.006717 -); \ No newline at end of file diff --git a/PhyloCSF_Parameters/58mammals_coding.ECM b/PhyloCSF_Parameters/58mammals_coding.ECM deleted file mode 100644 index f894011..0000000 --- a/PhyloCSF_Parameters/58mammals_coding.ECM +++ /dev/null @@ -1,72 +0,0 @@ -0.771493279396 -14.5180982851 0.547433994462 -0.829799770357 31.1892114825 0.7020007509 -1.2357249048 0.0591436724948 0.143021129459 0.0723670336788 -0.0491379655094 1.68015082454 0.0198294354489 0.039540785463 10.4536837099 -0.0705620171551 0.0966709944264 1.69743422922 0.142387839362 91.937054195 27.5243026465 -0.0429527042192 0.105163194816 0.0172649210373 2.25040676661 10.8921310832 29.7216988175 32.0319353336 -7.4338524426 0.17080527673 0.354723692547 0.186750900063 1.57462078709 0.053744234112 0.0267286337571 0.0670392311205 -0.15475952294 7.04751773186 0.133727701692 0.272371840933 0.0995168546074 2.91545126347 0.241247972617 0.30307911252 1.14819950914 -0.523684400979 0.193336177917 7.27785844907 0.248082744588 0.28292064082 0.0737402201706 2.22444630107 0.0911973524823 39.1328554206 1.20406413448 -0.173018086183 0.206353768518 0.171683630752 10.768130388 0.0919414494248 0.0323218254172 0.205978125948 4.34740100489 1.16358434945 33.6941468224 1.7233728365 -0.72844506036 0.0408900267574 0.0984268008214 0.0606490247723 6.27625068709 0.108522818556 0.732902667282 0.156984045956 1.27333682927 0.0371320946863 0.190371215329 0.0649658426497 -0.0107338084319 0.332629598166 0.0135926658879 0.022093725551 0. 2.18866127674 0.143671679617 0.121521316476 0.0119565599453 0.549500917257 0.0356995023641 0.0243544304587 12.7843674905 -0.0520823421344 0.0350655628839 0.405289748819 0.067795684311 1.27336050355 0.160287788944 6.57922720905 0.299427412867 0.0786854813099 0.0488940935773 0.960805451861 0.0665927661081 5.34516996652 0.736796631636 -0.0216049508162 0.0160718839072 0.0223163001706 0.605907271879 0.0245681166778 0.0205049564898 0.158269973844 3.87244486996 0.0304252144396 0.0317223740088 0.0589426989831 0.873730975438 9.99938453006 25.8255751638 1.22569015347 -2.18663674868 0.111696040966 0.0634197481102 0.154784667253 0.211944334747 0.0142851196137 0.0249872010961 0.0178329430869 0.632866998477 0.0456544602052 0.155643358185 0.0852409113534 0.114188793132 0.00538347477404 0.0172684858959 0.00982443430665 -0.0806194749382 1.82202603689 0.0700874839516 0.139029576933 0.0180592441769 0.131956497224 0.0167764425897 0.0204819995985 0.0337369858375 0.495354204564 0.0430768582 0.0598964584571 0.00958027358921 0.0336402412939 0.0100876385187 0. 2.33982994684 -0.0813812527058 0.072537901315 0.967025850778 0.0745340778643 0.0311639252932 0.00984056819269 0.180306689601 0.00854548443289 0.0545028256988 0.042940471875 0.398138428286 0.0395461759513 0.0155719958588 0.00453736963474 0.0574916836341 0.00557974117017 23.6795913232 1.61299074838 -0.0890303815424 0.0309711104056 0.075284329732 2.72022205635 0.0173828570078 0.00889347376972 0.0250244061361 0.189896560082 0.0470550538246 0.0369691647928 0.0517741235211 0.814461875725 0.0113513697564 7.49810654027e-05 0.0161305091349 0.0857488913528 2.52155138217 51.8301587085 1.73431675231 -0.0831502869336 0.00623291475441 0.0140485960681 0.00222815351908 1.85271487285 0.0142595343747 0. 0.0240393018298 0.100035548941 0.00744094731676 0.0208705373804 0.00714801356087 0.202643068745 0.00840395811706 0.0485674719118 0. 2.58108992655 0.0610588913053 0.288098926224 0.0640178651307 -0.0121507251646 0.0924520030781 0.00836826924209 0.0186151696838 0.0836537312744 1.54107027962 0.0440270652618 0.131930258067 0.00717636251265 0.120684206891 0.0125595231276 0.0212153052835 0.000324249078674 0.075269096427 0.0148448619927 0.0162954435488 0.135980978245 1.38509214833 0.0582990476554 0.097001138788 10.3565106085 -0.0327561377247 0.0194019854761 0.151645046369 0.0216308024113 0.16219698802 0.0736088846667 3.56703356477 0.0906683018246 0.0211444376486 0.0293098893392 0.213048465069 0.030853222824 0.105229675827 0.0117895396449 0.238615514744 0.00758025850283 0.383949439837 0.217940094945 3.42317049457 0.151800096828 80.196430788 26.5641853165 -0.00712174354816 0.00723985090453 0.00595505344662 0.0975294587912 0.0438607458733 0.0573004108171 0. 2.03540765518 0.0049271871924 0.0089011742123 0.00755042591788 0.131884297209 0.0101448079456 0.00832642054426 0.0156458916585 0.109023373526 0.0378815314904 0.0463207771448 0.0165605454301 1.6138138067 9.1542408524 28.6750081769 21.9548306605 -0.342652952354 0. 0.00831817472204 0.0019578776316 0.0256561801987 0.00396518185496 0. 0.00828598360004 24.819368396 0. 0.692289530387 0.00221688308001 0.0423207748289 0. 0.00421964524011 0.0102462249253 9.72150853477 0.287135700558 0.111035024588 0.161520784401 0.987246541018 0.0268612351287 0.14984953371 0.0013382555295 -0.0274952800589 0.239907400328 0.130619934855 0.0199908101654 0.00651256013327 0.0940574219685 0.0188049255523 0.0154651516836 0.731121345902 1.44205827826 1.47351708949 0.0159273184405 0. 0.0478071542405 0.00524987299297 0. 0.337092192699 7.2223642138 0.298762023217 0. 0.0197476073108 0.971106449371 0.23665637847 0.000783759865199 22.6147561126 -0.126747246284 0.00525348090503 0.431201251443 0.00871397252545 0.00260008330902 0.00505104531015 0.154413324232 0. 1.38751553761 0.0069785180879 24.2115845119 0. 0.0154314907887 0. 0.026146215906 0.00674642096354 0.249262272475 0.264254321875 5.15802336393 0.282622534951 0.100276942636 0.0464677107833 2.8678028547 0.0103939496336 58.2624766604 19.1638370992 -0.0407572307445 0.0541760472627 0.0408884489312 0.594154801521 0.00637997251286 0.0198824741158 0.0398930112025 0.199496998649 0.131755897653 0.18449888875 0.326574404736 2.81319866554 0.014151320102 0.0153460674176 0.00990532258908 0.0946255220831 0.573596562106 0.632515608499 0.283840725565 16.0063596615 0.075905929081 0.0826477869133 0.145510045956 1.80628209641 29.347029641 79.0811920949 24.1343195351 -0.0670321669475 0.000563067043618 0.00709263218583 0.0160730475881 0.397475218922 0.0108774166451 0.0224531700364 0.0117432492443 0.110217799898 0.00741770540948 0.0106037107321 0.00421212203971 6.34377872097 0. 0.30644392794 0.0507575748744 1.9736613358 0.0556021195246 0.102283849299 0.0480436043823 4.00887120044 0.0417641609514 0.653798644135 0.0359958557139 1.53421130077 0.0163428855889 0.117515458291 0.0242819224677 -0.00643748166518 0.0295649828891 0.000637970407505 0.019754645672 0.0030508665228 0.178930335275 0. 0.00883618689765 0.0253554586766 0.0635021784113 0.0114766272275 0.0282686114778 0.159188805299 2.05296843661 0.0831033972167 0.158454009429 0.0790863053832 0.843181005219 0.0366298173461 0.107941366273 0.0245725600104 1.92780227841 0.103817357813 0.139569513175 0.0230997188178 0.954192866331 0.0226992195858 0.144293124685 11.6702094631 -0. 0.000741264056699 0.0321762732716 0.00876551202277 0.0409627203061 0.0066341456828 0.289776596366 0.0104730362024 0.00188148859201 0.00415933999863 0.0531027228242 0.00397499828712 0.277347255409 0.081204120774 1.47530308516 0.0831617109488 0.0348369494271 0.0330910542007 0.514722517892 0.0315293996595 0.448937601962 0.0560895061976 3.50959324007 0.0672410028933 0.000363858402076 0.0325302162526 0.698509928297 0.0222160316559 31.3936914479 7.82675950727 -0.0103057326894 0.0209560410928 0. 0.0432390313139 0. 0.000598674783837 0. 0.331194702356 0.0159021216996 0.0263734927337 0.0229446661305 0.0793998208566 0.0655491795789 0.0771818086854 0.0755945133111 2.56835350509 0.0801848672594 0.0780599264085 0.0459870926371 1.38822655563 0.0245587112418 0.105445060089 0.157688337733 2.56327777985 0.00606283188176 0.0292401665627 0.0516866860149 1.68499310101 9.08011950879 26.1164046404 6.89513673659 -1.52942036217 0.0973183013281 0.0388353247448 0.117166119514 0.201990514263 0.015333596402 0.0128796043445 0.0124927834828 0.391532889031 0.0313292278453 0.0213395537798 0.046335054843 0.111001960231 0.00549068726692 0.0162640654866 0.00404973027084 1.6718235251 0.0500267310822 0.0517100980774 0.0537247281374 0.0619851968551 0.00546186911396 0.00987533716152 0.00386417990485 0.0791417803087 0.0355024148452 0. 0.0324557541248 0.0530512896758 0.0027411404153 0.003400456723 0.00422901561025 -0.0827672478108 2.45968541101 0.0634654669355 0.173632559347 0.0131604282059 0.164795491269 0.0131791154447 0.0351360772548 0.0335412538099 0.474036367211 0.03667071173 0.0671758266016 0.0124420599637 0.0313192578121 0.00897011881742 0.0123210571936 0.0862780006103 0.62622938248 0.0460793037594 0.0418612404259 0.00488689931062 0.0558122415879 0.0175672823754 0.00628262205823 0.00715550696459 0.0910460725338 0.00443029935197 0.0287613924571 0.00313419211364 0.0319575833704 0.00226776365132 0. 1.70115845114 -0.0522505604502 0.0898926251941 1.06240549924 0.112920569564 0.0463514147993 0.0149556757989 0.290216053777 0.0126916204037 0.0444314578346 0.0425138927353 0.346736063384 0.0532746125015 0.0239887410771 0.00428625042153 0.0806840702641 0.00726198943985 0.0617898168537 0.0606229656609 0.929748659037 0.0607814405512 0.0130660362186 0.00815276835162 0.144015583909 0.00475002529722 0.0297003498473 0. 0.132271963252 0.0101996218813 0.00843968014492 0.00444182503798 0.0259434869283 0.00418488182163 13.9895365789 1.74259584965 -0.069879625366 0.0502569650608 0.0601726449853 3.10841773214 0.0194174772813 0.00880592559668 0.026064139331 0.183837737792 0.0384232333402 0.0386598563856 0.028491177004 0.66561597344 0.0178802430678 0.0106144479446 0.010721316501 0.0584953860606 0.0488555874011 0.0240956518334 0.0447701807091 0.81606944054 0.00601727190495 0.00644546124483 0.00707166378557 0.0505635979412 0. 0.00103456844645 0.00427279006237 0.187146494621 0.00269164053833 0. 0.00100987468273 0.047653345948 1.4140884143 23.7236399779 1.55601401505 -0.181158453397 0.0260123477086 0.0397790253368 0.0100844740285 8.86889734423 0.0461483266391 0. 0.107929568028 0.256807798045 0.0320388886734 0.0695661905816 0.0188244726856 0.942228107881 0. 0.280430428925 0. 0.177260190745 0.0103616000988 0.0309089068449 0.00733443583341 2.08534651761 0.0619419333752 0.0385046664547 0.040395753471 0.063159608537 0.00541444268653 0.00590389620526 0.00982289064588 0.298133346746 0.00680478222793 0.0432921772456 0.00757149486997 1.03013073458 0.0486682637201 0.188686676483 0.0246949247744 -0.0122577305366 0.191980971044 0.0161067868229 0.0275695037423 0.14003002796 5.91146468912 0.134860570052 0.387425224734 0.0209047479093 0.400275840087 0.021321233877 0.0329212682449 0.00736037530406 0.286707031154 0.0674343529579 0.0311016087688 0.01510330413 0.0812436776202 0.00951252481602 0.0089036753564 0.0500637131568 1.53342839158 0.129298933272 0.11420040671 0.00657888694428 0.0901221706124 0.00747913674455 0.0199622847226 0.0126688373082 0.175994119126 0.0118295798482 0.00036469247377 0.0486596453358 0.628137800632 0.0473421611494 0.0308176979667 8.69450787125 -0.0555064568149 0.0480629442424 0.276262166032 0.0331518765262 0.562775127606 0.281398177498 15.7085436131 0.333136469932 0.0406317413376 0.107810107191 0.523491550083 0.0915018349276 0.234333738224 0.0552067621755 1.18046200077 0.0590812702434 0.043050916247 0.0231734472692 0.204509977331 0.0233882916335 0. 0.16346581468 6.09067753677 0.0888615500043 0.0279377722441 0.0701278427092 0.269656981301 0.0300336306608 0.0285534734776 0.0334291528371 0.323865691396 0.0205253370633 0.126702292889 0.134698271566 1.9279992831 0.0830503615842 68.895319709 18.1269451688 -0.0105930094914 0.0197467947894 0.00672572148301 0.219652037737 0.0569481631527 0.192199885757 0.0770026769259 8.2030334245 0.00992272063324 0.0406733489963 0.0200757655693 0.465563570471 0.00648442428788 0.0322131056713 0.0652316603109 0.434810615786 0.00266089608895 0.00461778904828 0.00596362923912 0.0916196214411 0.0124266748599 0.0905298871638 0.0352078645817 1.75296746263 0. 0.011915518628 0.0064691624691 0.117966135277 0. 0. 0.00641417426938 0.263264203083 0.0294620633383 0.0517569597285 0.0297106128632 0.775854199415 9.25329006582 21.8046714515 21.0184122059 -0.254177076964 0.0466163962153 0.013775505342 0.0165752917716 0.2541994313 0. 0.0234895802647 0. 3.51441514201 0.0628800416072 0.126836526076 0.113077846139 0.202105100057 0.00982962599455 0.00967118786199 0.0052933427804 0.301915015348 0.0209447385129 0.0262482055616 0.021515034263 0.0805828810913 0.00282008757285 0.0242510782787 0. 0.874922102518 0.0133118469457 0.0278638597687 0.0256982967577 0.0830735772627 0.0140431178472 0.00152631760016 0.00512338828271 2.14076248522 0.109913868096 0.127066667315 0.0860586763677 1.85126960484 0.0189655004627 0.22577819126 0.02214203147 -0.0187961223364 0.536260801381 0.0187201885281 0.0570722129956 0. 0.249122534002 0.0247618945167 0.0347282919429 0.119844529013 5.89713390113 0.135529295696 0.37862421452 0. 0.0716822297298 0.0139552063489 0.0090504051125 0.0143990351069 0.218599982006 0.0201367961938 0.0288787666884 0. 0.0953004938169 0.0184742524512 0.0163365894936 0.0148614517249 0.91696743349 0.010473158236 0.102230161422 0.00781085519074 0.0411893350182 0.00772386312203 7.845967971e-05 0.0513084582793 1.83647544751 0.0711026312034 0.0484847347439 0.0136165169786 1.40745470677 0.258157562514 0.135820730719 8.13762983681 -0.0328636713303 0.0187769783312 0.235179486576 0.0733364272614 0.0926161334728 0.00838022497616 0.408607171412 0.0113896740303 0.230797267043 0.166509619107 4.62098300244 0.355598938915 0.0707469720138 0.00499944094366 0.1819732433 0.0220544026913 0.0721575489303 0.0276836910024 0.222982276164 0.0331777831189 0.0244250690124 0.00613550182328 0.289795200046 0.00732929200673 0.0844588490175 0.0304535572718 1.0957917311 0.0567580546743 0.0173063494738 0.00490556988502 0.0661130308739 0.0183619577456 0.0948448651991 0.101343657162 1.83229308595 0.0912091468367 0.433113687149 0.0715023194908 4.13594806656 0.0258080154165 30.5908569921 10.0811942943 -0.0243094808513 0.0577216517943 0.0200297769648 0.877392683846 0.00616672142884 0.0133710129811 0.0101473425531 0.425742741255 0.141560490571 0.443900074406 0.191187943803 9.36899545687 0. 0.018888775476 0.0149073518673 0.13913130704 0.0462748737881 0.0379647006055 0.0137169525908 0.459494094526 0. 0.0190014624053 0.00446871333479 0.110939295873 0. 0.0330973044641 0.020129035622 1.80187002398 0. 0.00776890685305 0.000484586777783 0.0693812551183 0.0801448777091 0.218228314494 0.10116895754 3.17665838205 0.0223213571149 0.107982033724 0.190590547393 2.20919088952 7.91138478576 34.3882055135 12.7244322854 -0.15434282613 0.00935208126288 0.0151733883381 0.013729475622 1.71785898184 0.0271358624608 0.146655133895 0.0177553776853 0.30178866371 0.0182577297541 0.0375645028041 0.0274235268157 26.8094991811 0. 0.612478351302 0. 0.142234190974 0.0114076697294 0.011520354398 0.0142505051056 0.280313823039 0.00876817134547 0.0630840357167 0.0103192072714 0.0826066155485 0.0047477806076 0.00469973766013 0.00628193768667 4.58278302533 0.0291050999455 0.0296673134073 0.0479828667289 0.725647477002 0.0270877926263 0.0588757234687 0.0273951850099 6.40325605509 0.0438568294629 0.732225073977 0.00651736008295 1.44810954129 0.0184942984015 0.172245324759 0.0349897269167 -0.00969533647635 0.0999488616985 0.0052454488918 0.0131800710292 0.0337929099917 1.0749439893 0.0326869238681 0.111456192054 0.0264268584625 0.224134039428 0.0199444908588 0.0290530701962 0.562736693539 10.7237952641 0.118229726105 0.506770835596 0.0102800806728 0.0606173209593 0.00751054512132 0.0133113286074 0.0105443090872 0.183782605146 0.0204709347631 0.0276985652596 0.00129705656982 0.0754620175889 0. 0.025804891967 0.030298070793 2.03508410924 0.0447055642363 0.132059900606 0.0301183881127 0.37615525312 0.015908228653 0.0213106603965 0.0431287073534 3.93391823581 0.275853026894 0.265254577006 0. 0.929017326538 0.0360346586025 0.121805115134 12.2774917757 -0.00781203656183 0.00305032194564 0.0716340021864 0.00950419017431 0.290444381626 0.0363585294956 1.48832591097 0.0531160643028 0.00529187417067 0.0181792465187 0.1898146219 0.0202367292531 1.25814605694 0.340506545072 3.55342590032 0.340626708068 0.00543938441184 0.00876335637772 0.0465035840453 0.00925919109869 0.0557620647879 0.0126977754034 0.284454447223 0.0133494203904 0. 0.00517806534409 0.0414239861961 0.0147777238638 0.0411492373521 0.0355017967194 1.07082122249 0.0287025328326 0.0124956170788 0.0109304744587 0.34347636804 0.0163556298762 1.02652889428 0.14159544335 6.96484884785 0.145598748684 0.0100539151045 0.00261004468069 1.03235017399 0.0320664273316 34.9286691378 8.23239114357 -0.0114083420209 0.0199984874197 0.00840313920552 0.139176400973 0.0135290119007 0.0655614948349 0.0271933719352 1.45516931 0.0142193129151 0.0186767358189 0.0235742444493 0.348139821213 0.292921217267 0.0772705614775 0.146955588856 13.0029095601 0.0128252811737 0.0160174998411 0.00344783997877 0.0854516604554 0. 0.0306215484952 0.00135298295599 0.197945344879 0.00398803702332 0. 0.0112408821513 0.130903293586 0.0345087851993 0.0350951206775 0.024019772453 2.51762209502 0.0236558879595 0.033012214447 0.0321554878851 0.53405164739 0.0272060510773 0.175337751612 0.294680297433 5.21552771342 0.0246904606628 0.0948001199036 0.0427269667822 1.71316918042 10.4885072326 28.6013786797 8.76793221684 -2.77594356032 0.0993047870626 0.258987813235 0.196747240033 0.159727053992 0.0201599544009 0.0456494718309 0.014416684875 0.453919642655 0.0552728098673 0.176877082092 0.105471229855 0.386772302504 0.00718586592846 0.0321231644917 0.025169217975 6.78299214328 0.375237957265 0.480908376528 0.294621559134 0.387630790093 0.0702904544528 0.169324529386 0.0583382719292 0.390108022986 0.150928696164 0.18405706465 0.0963763242996 0.894999246158 0.0063632664085 0.0562162829768 0.0486748216443 2.62332950228 0.20035925212 0.35459689191 0.134554657987 0.228256251997 0.0429382995137 0.0430277011087 0. 0.499835267232 0.0872802166146 0. 0.00901740735283 0.289857331321 0.0270375266701 0.04838186141 0.0374696887996 -0.0121894520849 0.410790063033 0.011133598533 0.00165056619402 0.0051843131731 0.0431018327577 0.00539237299706 0.0150623598867 0.0170708870198 0.0840406186667 0. 0.0242935664732 0.0080513219032 0.0398494896751 0.00545725560213 0. 0.0790745463878 3.2078145507 0.0532472065717 0.010043455522 0.00635188554487 0.0880596706435 0.013721224767 0.00651922284968 0.025457891714 0.304325536564 0.00707279853229 0.0675357009414 0.0172192049667 0.106767001377 0.00573203678181 0.0136987547062 0.013655212029 0.297543754748 0.0119723251101 0.00318746283208 0.00162010996025 0.0299444434255 0.0108699938489 0.0166143146908 0.00169048351502 0.0635594253576 0.00467473667675 0.0232766714606 0.00173091362045 0.0456155333578 0.00257003829396 0.00549671428511 3.59183812996 -0.0128603903345 0.155272434481 2.90473676882 0.0921884295404 0.018003235893 0.0088919464121 0.332278027108 0.029517979277 0.0950845378976 0.0814115848686 1.02293237377 0.0782302611672 0.124932670117 0.0147696168081 0.209777697594 0.0191860423374 1.17481497084 0.422005627993 7.16881310532 0.519389046385 0.138828982528 0.0537440354805 1.18848446499 0.053710043866 0.258890930878 0.191467019998 2.4094721595 0.233810974308 0.141415434357 0.0802249814486 0.478853644692 0.0570549680101 0.186570124039 0.158525054764 3.30106333889 0.127155955145 0.070267211767 0. 0.703384400913 0.0418228555285 0. 0. 0.981935304195 0.0968146005396 0.0783266440087 0.00763974452017 0.23785171402 0.0201171111811 507.765111884 2.44158816723 -0.0298412769399 0.0122551089064 0.0159708172401 0.662041901317 0.00734282838376 0.0100875430507 0.00631171792731 0.0627729308325 0.00317881402807 0.0217712378384 0.0380502109864 0.181154195019 0.0147807967765 0.000693398311567 0.0108043597623 0.083547251776 0.124351036848 0.181987183493 0.0659530747008 4.28844853026 0.00751655604012 0.0154663468996 0.00513218639619 0.101949747019 0. 0.00997028720563 0.0172390346722 0.836591636433 0.0182342555086 0.019835677565 0.0069782151758 0.16156444993 0.022796908347 0.0389716219568 0.0269186753463 0.441801768503 0.00596547916974 0.014701676295 0.00739562555348 0.0342721533618 0.00495950613705 0.0217814491004 0.00623597741371 0.141948440236 0.0124771328796 0.0118889570172 0.00259482001219 0.0781727135773 2.98967538063 49.2839591139 3.316675155 -0.0722278190998 0.00500866092764 0.0173192942569 0.023154035384 3.4470883287 0.0171508279517 0.0554954011444 0.091309482244 0.0662760011389 0.00829980119382 0.022354058005 0.0338946495945 0.235314951058 0. 0.0763098378531 0.0332331474469 0.286505793562 0.01505939157 0.0464968416988 0.0254099705532 6.29714726079 0.0976069040919 0.476439604983 0.0361553588411 0.122280514014 0. 0.040880462884 0.0107976740267 0.516163749196 0.011360889129 0.0121972794524 0.0203193196188 0.0695019404399 0.00472048511553 0.0113007052678 0.0118761160785 4.26073713503 0.0861649940812 0.310162417427 0.051843758979 0.103507527036 0. 0.0457793711362 0. 0.430028495412 0. 0.0801999766326 0.0205470075237 2.81788640408 0.00323540880644 0.44167841641 0.0268487689328 -0.0109315724616 0.144616714606 0.00821707597789 0.000456726857907 0.0764913882054 2.45357074876 0.0661435744316 0.176744922702 0.00819456481366 0.266597495417 0.0182759357264 0.00846119421793 0.0313617134389 0.0966495049223 0.0162790413192 0.00163711843708 0.0369439154618 0.234872736279 0.0123576787921 0.0265123221939 0.036042397569 4.81163765756 0.150265642397 0.164785582551 0. 0.180317458513 0.00458491922496 0.0367902105118 0. 0.389255850299 0.00174760112765 0. 0.00257753728933 0.0635580300716 0.0084535343221 0.00282624864339 0.0447019415675 2.88017138187 0.289532320254 0.123735336689 0.00324188461583 0.118078308966 0.0100812848724 0.0198277053741 0.0116340464762 0.243292793662 0.0120482062486 0.0176763288885 0.263693820924 0.709176626674 0.248550219855 0.0328825526141 12.6242878278 -0.0135254471713 0.0224138900757 0.096798546819 0.0154444374282 0.469113896116 0.22743490158 7.79328364964 0.213279371798 0.0161344840406 0.0784909371759 0.179648483473 0.0628751158954 0.0423341383387 0.00630178455457 0.312339853289 0.0234883695029 0.0322889750944 0.0291162192912 0.247846604119 0.0201655279496 0.0518907117023 0.0661747311717 12.1031163415 0.0342292472337 0.0670292507246 0.0263262931891 0.406923875717 0.00490776541097 0. 0.0160598832211 0.353791691237 0.026544047596 0.0118193968718 0.00791022068661 0.109843293866 0.0158225402976 0.333300299142 0.31958909408 12.0613669426 0.0616488096615 0.0107388318896 0.0148583295769 0.233395457926 0.0229189251464 0.0725987489501 0.0224009938245 0.366753524194 0.0033444418443 0.435154262392 0. 5.18531608176 0.0337930801197 103.370411838 30.2187145757 -0.00889801311401 0.014314272414 0.00733263507062 0.139923321215 0.0599475336812 0.151241438878 0.0626266723432 3.26792392121 0.0168047793112 0.0355345341123 0.00841349152452 0.279741113857 0.0269058261891 0.0203136714086 0.0172489856388 0.100526472268 0.00951741783187 0.0365100909268 0.0188076923165 0.311852144931 0.0234901851248 0.406481108084 0.118585605774 5.59567167405 0. 0.0209633844747 0.0017276477389 0.386993411551 0.0356811825554 0.00753007889328 0.0256322285828 0.467310381695 0.00386274806443 0.01299145289 0.00713480561887 0.0563915408293 0.0270058369068 0.251044072283 0.255733515669 3.20974363638 0.00242786317209 0.0191998396281 0.0137316622378 0.150868053414 0.0179523093513 0.0494934567133 0.0152084857496 0.22043068467 0.265435129553 0.0233293793875 0.240040834453 1.01421579934 10.035477583 28.3055731705 29.0099153961 -0.161412798087 0.00424480446191 0. 0. 0.0906916476566 0.00563968805371 0.0321857317281 0.00625169793881 2.32459802666 0.18028353771 0.402169481502 0.146021735821 0.180738849749 0.0152470119891 0.0594309552204 0. 1.59918269474 0.0878914404839 0.151488329592 0.0644464394055 0.433227437698 0.0415119312985 0.134563380307 0.0308938272344 12.8269080058 0.586851670675 1.37028858456 0.768958451975 0.504903662999 0.0401830542296 0.179516483383 0.0260615738593 0.320069615284 0.0514874328311 0.0730906239858 0.0500704875043 0.126989204283 0.0185452770624 0.120931812654 0.0233211166859 2.57821698158 0.137637074862 0.52477780815 0.185823198291 0.14069243508 0.0436555868557 0.0759002609233 0.0304916977712 351.484733517 0.0751625144229 26.381564856 0.10755263699 1.62508488908 0.117164738243 0.443351098266 0.125852859682 -0.00540817019885 0.109532143682 0.00466186168276 0.0119570850765 0.0158619374367 0.0807774228921 0.0133696167272 0.00519688621966 0.029392784273 1.27871496477 0.063722905148 0.04128067384 0.00632884583531 0.0453137431349 0.00843806244594 0.0123184356638 0.0549166610956 0.828580129577 0.0498266614372 0.0502292974892 0.0199171150784 0.185872475093 0.0251441786984 0.010719019886 0.089127529091 3.4296456957 0.103967035845 0.239907865574 0.00468334570237 0.206251061571 0.0138674587778 0.0283270941681 0.00773883894314 0.0717966354105 0.0039461417809 0.00130873744795 0.00796058746493 0.112416234141 0.0258843362023 0.0102273571283 0.0143618403641 1.09404680854 0.0371145501871 0.0742827896751 0.00597837009967 0.0989926626628 0.00732532644804 0.0141200991997 0.297694270758 1.90815280778 0.448236037837 0.0662766472026 0.0370265810511 1.47916590967 0.115943259122 0.102962006329 2.53689270085 -0.0102444412948 0.00509286785591 0.0526826133572 0.00865174390146 0.0167207453137 0.0078067338281 0.0680018616885 0.00652270728479 0.0529708932914 0.0317393901905 0.953237491747 0.0460080390141 0.0202225963419 0.00647460880487 0.0627457859646 0.00621514632303 0.0849084781118 0.0605758785434 0.430500146762 0.0760617630848 0.0368909715192 0.0130987377349 0.289812358407 0.0111800529475 0.15870666689 0.105782269501 3.01587355888 0.129715864077 0.0292980098652 0.0140236078572 0.161233068931 0.013554679652 0.00638065202681 0.00383023188484 0.0462524279848 0.00467115363075 0.0143634062062 0.00687250339689 0.106692653386 0.00553305812419 0.0427454939109 0.0298804720595 0.989563854742 0.0360911542865 0.0145669991601 0.00652825936214 0.0693258497758 0.00506439035447 0. 0.0616959880557 9.95680242469 0.105688196253 0.162332902184 0.0468444399235 1.27307344663 0.0459595842087 8.27606578348 0.715389857412 -0.00789939435885 0.01212501017 0.00773363835482 0.175301373497 0. 0.0143690209499 0.00126452851364 0.132117818087 0.0582018868707 0.0711103982248 0.0578686515489 1.756951756 0.00998972583202 0.0120449704688 0.0114545328219 0.0634532707085 0.0744891940437 0.0686263990691 0.0484135563166 1.44153871334 0.00450888748208 0.0272210780702 0.0240257116739 0.208900041641 0.0398056574747 0. 0.113109727358 5.32058987453 0.0150482576711 0.0314730538069 0.0119754249663 0.256988726401 0.00098902044467 0.0131515986558 0.0105575625281 0.10786533181 0.00903471281231 0.0072515426398 0.0277375045236 0.110148076992 0.0208083242687 0.0755742185728 0.0905113037895 1.71936164198 0.00966856631646 0.0179622299535 0.0146245333127 0.12178135613 0.294662757949 0.0974744910442 0.572307858294 3.67660894718 0.0571583781106 0.0395596260121 0.107882138908 2.20567784646 1.91713540938 48.0143648972 0.853169465851 -0.0531643487552 0.00046790400605 0.000838453691686 0.01812896729 0.208420547857 0.0343787330744 0. 0.0231920471902 0.043685055595 0.00732004830476 0. 0. 4.11106061846 0.048722096716 0.146088640727 0.0560625049253 0.0474926500595 0.00475721733224 0.00484972824452 0. 0.197182079712 0.0457824201776 0. 0. 0.058950641239 0.0289413524406 0.0136873269902 0.0229852647113 41.3472328531 1.0528307594 1.29285877772 0.306280922598 0.0345768065397 0.00451575537032 0.00714407574213 0.00383630480052 0.231578282487 0.027634098434 0.0463528990383 0. 0.0637039348201 0.0184746799941 0.00875762872995 0. 4.32985621739 0.117782272716 0.022019255005 0.0681679785543 3.64445607755 0.0592877548457 0.525086277223 0.0756449030113 4.56261330482 0.110131050888 0.0439052051569 0.0797889683874 2.06518561996 0.0666683510558 0.0762726044496 0.0517838499854 -0.0055199762485 0.0334289719786 0.00390763608714 0.00102384267646 0. 0.106196580492 0.00818508580281 0.0136642809574 0.00357284653328 0.0457468056207 0.00694679633975 0. 0.0911050824201 0.599678869518 0.0489300439061 0.0108088282083 0.0105832559291 0.145765335695 0.00690974052474 0.0114920430125 0.0175529106988 0.175936238339 0.0413270786918 0.00872752794066 0.00466216314537 0.0913950125537 0.00860719686636 0.0243677507458 0.0585882757321 2.80334749919 0.0872701701452 0.111401177662 0.00200006153919 0.0217250647562 0.00433905371471 0. 0. 0.110447906903 0.0173404257969 0.00995287043434 0.00388615508611 0.0438806416399 0.00902124309974 0.00312743519908 0.0425164571122 0.955534749424 0.0288747192586 0.0248716875581 0.206472713399 1.77357320853 0.123522093577 0.193297452822 0.0928470465172 1.53245881476 0.111006305099 0.117335749811 0.105553436644 0.742828630094 0.0622235265575 0.0423426485008 1.43526430491 -0.00783695049608 0.0250727545388 0.0365535857915 0. 0.104520783638 0.0175266123984 0.423097003684 0.0372719485901 0. 0.00118601758413 0.0980061451082 0.0165691637301 0.398423196665 0.0736727127086 1.87900199944 0.0923264680767 0.0174427982474 0. 0.0558435587249 0.0325636812093 0.0600891313087 0. 0.53367919355 0.0668040000349 0. 0.0149063765247 0.118853989326 0.0549025463859 2.14712512855 0.312763441889 20.1875336549 0.347860470677 0.0066552531376 0.00307323366926 0.0412644723982 0.00610625387445 0.0831499855006 0.0075476627928 0.537235020729 0.0317779628223 0. 0.0021195066801 0.103937315422 0.0444811941521 0.209725175735 0.0477753255181 1.65952099137 0.0698039587929 0.0802054038476 0.0387196706916 2.78319794878 0.061028317299 1.47838527252 0.204511470784 7.10912954036 0.256877041263 0.549142746907 0.0751592976177 1.26735185125 0.109280267489 34.4959393706 1.05085922221 -0.00746472259056 0.00204899373295 0.00581141364371 0.0491987450047 0.0279931733762 0. 0.0187164230282 0.139287436956 0.00599351063267 0. 0.00799680673582 0.0650958058285 0.0344787803875 0.0123348960029 0.0622609147898 0.851318265478 0.0137965285149 0.0171589122973 0.00792908114731 0.177351717033 0.0066528572533 0.0210605579391 0.0315464539473 0.18248378446 0.00953680519322 0.00890950686499 0.00910725738233 0.174716153118 0.0532132015906 0.106932799171 0.0628787450617 3.22751790841 0.00644393995935 0.002174043541 0.00377513820975 0.0273030924407 0.0338199259892 0.00125051939221 0.0390614305644 0.10632141054 0.00310445049144 0.00717703221063 0.00848650791657 0.0783047449268 0.0456723888635 0.0516488993956 0.0415544937568 1.15249307403 0.265892650003 0.126252301003 0.188030143058 2.21350162545 0.0711131598547 0.0498530038432 0.14039933692 1.62206226821 0.0927215536591 0.0268076213023 0.0997798597602 0.992253660267 1.28408120875 24.4950942036 1.65934183601 - -0.0255410031621 0.0196994410272 0.0329436805941 0.0171683371063 0.0149396985614 0.0183708104275 0.00645076614979 0.0131771277358 0.0119329780996 0.019404291813 0.0110661479582 0.0126066351598 0.00767281125434 0.0211476929741 0.0217199500715 0.0162144992548 0.0125788049362 0.0153824193819 0.0351900543795 0.0107925691178 0.016594963679 0.0192878934182 0.0069342750228 0.0174443586684 0.00639363526807 0.00974852461103 0.0111678900222 0.00443298791246 0.00723674640067 0.0193993823623 0.0394721937175 0.0134712866574 0.0308697977783 0.0261955025614 0.0398854098195 0.0222118074114 0.0157269211794 0.0271424443752 0.00716582944527 0.018409347815 0.015995194452 0.0210047367317 0.0151538538426 0.00983855721495 0.00727530179348 0.0147630423609 0.0279360948926 0.0111035450087 0.000586877417582 0.0155362448361 0.000536216447671 0.0120197877511 0.0121507344448 0.0176708896065 0.00473584340384 0.0155784373036 0.0010210997268 0.0121177246907 0.0119605502469 0.0104896896194 0.00812470878645 0.0202026177119 0.0134871493447 0.0175201850745 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT - diff --git a/PhyloCSF_Parameters/58mammals_noncoding.ECM b/PhyloCSF_Parameters/58mammals_noncoding.ECM deleted file mode 100644 index 2e3e718..0000000 --- a/PhyloCSF_Parameters/58mammals_noncoding.ECM +++ /dev/null @@ -1,72 +0,0 @@ -2.78592743423 -6.58600444004 3.19341169223 -1.63519457982 12.1399355041 2.45567860959 -2.43476285124 0.137196047767 0.462787891603 0.0687994720539 -0.0828676812999 4.64297827314 0.0583439047427 0.114333277922 4.54770228198 -0.569910594763 0.269905137878 10.0658717921 0.227536068622 36.0992488386 10.3039899411 -0.0485017841297 0.412819154555 0.0211222634573 2.74491138612 2.97356015436 14.4767642696 13.8730044691 -4.91172089731 0.155166943916 0.607308551579 0.0926673262207 2.93090865811 0.0568018331327 0.563736806771 0.0419502454502 -0.110594870229 14.1973016288 0.227814935065 0.348821740023 0.0698012930426 4.35673029912 0.320289189969 0.205259373689 3.19849897319 -0.200634258787 0.0561388860069 9.29335938844 0.0929695932917 0.395913544434 0.0764056737434 8.35592589299 0.0734485882052 10.2333897454 3.31735868963 -0.13798910766 1.0340072599 0.318823468155 10.7213291459 0.0794339571607 0.150236344311 0.308812958798 4.11390908902 2.34629268324 13.7678588818 3.75348569698 -1.61163899145 0.0903822534676 0.0978724405796 0.103846672592 13.0480744395 0.227582308607 2.33026717206 0.158960500271 2.75288101677 0.0415967285977 0.155011835538 0.0774147142431 -0.0539412039354 2.7175215174 0.0197134073579 0.160319614896 0.188046082887 17.3910431275 0.852712504949 0.990756643627 0.0714613184066 4.0085387173 0.0637586828172 0.239230657001 3.72498943433 -0.115504297981 0.0554316110801 2.62956148456 0.108596913546 3.44821535373 0.624122455894 46.1826203189 0.819390424217 0.144340307998 0.0767389836681 3.45253752203 0.0918946223283 11.0581166867 2.78890551354 -0.0686425149198 0.126358582519 0.0353234891621 1.62786654769 0.112834294186 0.366312347819 0.910925474064 10.8159929664 0.0420270072454 0.121652373835 0.041021549888 2.70393912639 1.97744280002 8.57968016608 3.32159829656 -2.7544269435 0.0893651329767 0.147541427462 0.045588254393 0.13118461025 3.18524470568e-05 0.00511362108266 0.00177951014407 0.415950418678 0.00274376193493 0.00295069255731 0. 0.0490110518677 0.0109095971916 0. 0. -0.0792482672501 3.8269663053 0.0600975342331 0.169229443099 0.0235434410828 0.20555593481 0.0187169473997 0.027489303549 0.00704240140764 0.842055408475 0.0204804845935 0.00228597224206 0.011244526864 0.0757896416031 0. 0. 3.49147912066 -0.140350659206 0.0519225842332 2.88395589756 0.0273793218983 0.0160717268365 0.00476194914635 0.256665151464 0.000945031287224 0.0457491179596 0.0221450577789 0.598936842192 0.0157356154024 0.000732141038617 0. 0.0653627423271 0.0024299228541 10.7164632866 3.57233983814 -0.0420703782816 0.245254684763 0.0661881569729 3.31052265197 0.00921779748141 0. 0.0187176169492 0.0941345819645 0.00889233349389 0. 0.00988308290204 0.825507301736 0.0116464934505 0.0265891275072 0.0121580600248 0.105930373584 2.27706263405 16.0355075221 2.99806680412 -0.0835624220006 0.00882220161046 0. 0. 3.08974563007 0.122047945762 0.580194800746 0.0527490707359 0.0735023766671 0.00433095387463 0.0343457304593 0.00511087269641 0.0846597799348 0. 0.0288920646816 0.00160328304007 3.89374822857 0.145724186109 0.859411475778 0.0977710846653 -0.0154152275448 0.104820298736 0. 0.0105463060181 0.115102782565 5.17009625533 0.237854650192 0.172608828294 0.00557693962982 0.118368017498 0.00724878346524 0. 0. 0.182319021431 0. 0. 0.138898774156 5.03284649814 0.138658093089 0.165678358789 4.79323321106 -0.00482910140346 0. 0.20777458312 0. 0.532995768631 0.254053586795 16.2610321 0.173403286842 0. 0. 0.157481114874 0. 0. 0. 0.394080739918 0. 0.69328323564 0.320689384456 9.88649042287 0.167025974959 34.8139406207 10.1133870094 -0. 0.00961312458577 0.00777720146138 0.0421416632552 0.0668430982448 0.316055827456 0.310161085324 3.80578081572 0. 0. 0.00286341134589 0.0655755234675 0. 0. 0.0111015655273 0.0940823246107 0.0501235340082 0.388529007176 0.100853422779 3.47803826662 3.01358288946 13.5549050105 9.5786073322 -0.468309814243 0. 0.00422239547645 0. 0.26830641753 0.00846178333649 0.154305577789 0. 11.2231238988 0.279262732154 0.668330937867 0.193652679992 0.219677620446 7.2077574577e-05 0.00604055276834 0. 33.2452989031 0.811222421625 2.55659342609 0.452160447674 7.64549509172 0.263216471122 4.7802784332 0.143871982185 -0.000860877233951 0.834462206337 0. 0. 0.00360228322614 0.414239512028 0.197936924501 0.00823935352163 0.11774285457 11.2493424316 0.201884259842 0.497799451235 0. 0.266084682123 0. 0. 0.266110848103 34.7258580282 0.547536957554 1.46118924155 0.160338489022 9.08023328703 2.77572496514 0.635232621196 20.7884238597 -0.00982618500386 0. 0.591865235112 0. 0. 0.00218531337504 1.27017090395 0. 0.339648545761 0.16161338633 9.56757283704 0.183239415868 0. 0. 0.190549769126 0. 0.939489900239 0.401541837309 30.6896731945 0.378631582678 0.49544403824 0.338076522141 40.5444710727 0.154867530415 51.5670070065 18.1748961464 -0. 0.00305450479455 0.0135564060988 0.917987071428 0.0121496291976 0.00940515686116 0.119119559264 0.323445066476 0.137627082052 0.973331878132 0.317403241123 13.7268039631 0. 0.00385237606388 0.0129442098625 0.2243721539 0.436381800076 4.66762939214 0.890960051922 46.0687746218 0.159821879484 0.606560651364 1.3124413836 8.44478548018 12.4665171004 49.6206423643 16.2525872954 -0.0480997542122 0. 0.0120069171917 0.00705871640247 0.365898539349 0.00331565177772 0.00828798187583 0.0190617177772 0.0566983820258 0.00206195136388 0. 0.000851243591405 4.13290256325 0.0778480013042 0.257064930071 0.0532942502359 2.58623674767 0.0627896589555 0.130295452685 0.0607415410117 12.6708354607 0.127040124001 2.19987609742 0.174617163404 12.8946521218 0.0747252598411 0.446429410446 0.0977030126566 -0.00562265261444 0.0764307547465 0. 0. 0.0063414974605 0.380861788353 0.00753424639752 0.0220559286448 0.00980976134525 0.101156083167 0. 0.0138619086514 0.072833456771 3.75912497016 0.0471465843163 0.106431837705 0.0803441627835 3.285182125 0.0552749886049 0.164538257304 0.2503607233 12.1799982117 0.873441856704 0.770053907325 0.397759952713 10.5237799774 0.22377862705 0.742945113248 4.04528522945 -0. 0. 0.0539015946056 0.00278364992127 0.0377957707833 0.0135963635668 0.89440013158 0.0147550321805 0. 0.000295662566089 0.101859214026 0.000945192222413 0.107777801947 0.0455856315413 2.95431984048 0.0299580499308 0.0692407005928 0.0777213018462 2.8342950611 0.0597295499215 3.20392772547 0.525791072418 30.2914067842 0.591091345872 0.778259117844 0.196799800294 9.7436291249 0.250287033284 14.0153836355 3.34075289278 -0.0029775553938 0.000481714381558 0.00995582674459 0.0354561987446 0. 0.00988402515618 0.00175895315694 0.319479264747 0. 0. 0.00856538884321 0.0181925584499 0.038841902373 0.144236561331 0.0680763995227 2.45864879147 0.0532891365325 0.207694885915 0.0544091024245 2.62133140043 0.124628865738 0.386482949994 0.605612447182 9.29643383867 0.193490205147 0.508707708341 0.224730774419 9.95732384776 2.2284772758 9.79481604528 2.83331650296 -6.56858255082 0.157040779976 0.412175038103 0.0941892466145 0.22602139234 0. 0. 0.000432028561943 0.578215659146 0. 0.0122850462384 0.0100014809361 0.11167679813 0.00640756227736 0. 0.00161147255275 2.46904674823 0.0456773806562 0.15229360324 0.0314539380676 0.0534554009708 0. 0. 0.00927397630364 0.447179203281 0. 0. 0. 0.0367299291555 0. 0. 0.00903617543561 -0.154254426169 12.0194888817 0.188385564082 0.404976306527 0.0330397145777 0.450121271064 0.0489176001655 0.0370399636967 0.05094694887 0.990991883141 0.0180840722072 0.00384380211183 0. 0.169457512386 0.00819708281146 0.00870799638103 0.0573145148162 3.61306377769 0.0855272437255 0.154782328737 0.00748232676517 0.0881927464735 0.0049964336753 0.012854379142 0.0301713814632 0.72400213014 0.00648062632878 0.0198374976478 0. 0.0571707574935 0. 0.00247035561626 4.34813916207 -0.227788108235 0.0799299082191 9.79896923451 0.103053796284 0. 0. 0.78255650198 0.015579837746 0.128340355924 0.046279605209 0.779068029741 0.0225234611853 0.00602103326625 0.00493313737968 0.161693747513 0. 0.0772646124819 0.0784651311818 3.39842393239 0.0430785142297 0.00319153334055 0.0200545515437 0.226232620884 0. 0.0820883049329 0.0265643135942 0.866371736819 0.0183432125543 0. 0.0250462788848 0.0482691177232 0. 10.1583124061 4.45404934624 -0.107881419785 0.624537506527 0.143524792543 8.57913984856 0. 0. 0. 0.243607905648 0.0376568369585 0. 0.0123913692603 0.977051019802 0.0286899775315 0.0401590208837 0.0222659759274 0.159355783736 0.0382060716859 0.180359387973 0.0471829513688 2.82761809762 0.00499074984672 0.00488669031459 0. 0.053752763036 0.00691320221159 0. 0. 0.829310276526 0.00323386746488 0.00593988613076 0. 0.021522244845 2.40542589088 19.5417991861 3.75671940857 -0.12834113079 0.000631024810323 0. 0.00370534372453 12.9755000578 0.249546857178 2.2428079352 0.16858926865 0.167087689576 0.02383686429 0.0439490546363 0. 0.655221811919 0. 0.0906015436812 0. 0.0942550375717 0.0144616778276 0.0351737751326 0.0112630245205 3.31439870246 0.0682789714328 0.43347001132 0.0516315018829 0.281101289081 0. 0.00916726942431 0. 0.230196247012 0. 0.0403187341028 0. 3.34331662861 0.0971515456628 0.781046975592 0.0872172134872 -0.00147272373388 0.231637836881 0.00034595435521 0. 0.239177344728 19.0321903198 0.682121242987 0.58023907979 0. 0.362869697142 0.00491708358301 0. 0. 0.711707470265 0. 0. 0. 0.117504471461 0.0121911148736 0. 0.111229457943 4.4199412059 0.306313105926 0.250843260075 0.0151977356619 0.530844103954 0.0200689115308 0.0183915886966 0. 0.240685558284 0.00716322812369 0.0025539038592 0.0720097295311 5.06653931434 0.0792452953844 0.173890272432 5.19879437497 -0.00584157821457 0.00981900567978 0.501161696619 0. 1.70123466465 0.457547343541 50.4645366614 0.516148327511 0. 0.0476676401932 0.633934534495 0.0154289667092 0. 0. 1.41536414927 0. 0. 0. 0.204730338169 0. 0.317299779043 0.262826758155 18.4505803511 0.196113664614 0.541248280455 0.708760121856 2.67512354266 0.181899268955 0. 0.0231037960197 0.546155668327 0.000709150651529 0.690762503945 0.31210703086 10.5525498701 0.251830847873 35.1062120167 9.24273876406 -0. 0. 0. 0.121219395501 0.173500127538 0.732707640921 0.967955772341 13.9456042856 0.0142592910443 0.0661696110665 0. 0.204245055816 0. 0. 0. 0.335284741585 0.00120828759341 0.000770045425943 0. 0.0762604530737 0.0474049343197 0.13927094387 0.17189083881 3.32796677053 0.00836207794708 0.0417538220573 0. 0.302116718197 0.0100602962328 0.0446388722815 0.0203652287305 0.233869284809 0.0606199672857 0.338796931585 0.101822437413 4.01419582769 3.59460760499 14.1246349223 11.2167674822 -0.305915296181 0.00387290678178 0.0283900521037 0.000168284862403 0.103145819992 0.00682213703837 0. 0.0069105622856 10.8506353065 0.143162318594 0.606240184459 0.101575092269 0.174857843309 0. 0. 0. 0.379874892195 0.0135188840515 0.0283892888726 0. 0.0866224362335 0.00680603807226 0.00423745111466 0.00363287262812 9.81027429037 0.148538407691 0.484853262019 0.110578511 0.0796243853214 0. 0. 0.00845303045711 10.3935417311 0.412884043486 0.946160277011 0.227669238572 3.3309009611 0.119274560321 0.88047907047 0.0227475613468 -0. 0.464728116785 0.00308746578916 0. 0. 0.199886815768 0.0125122178155 0. 0.180705625194 14.0947925672 0.252641224242 0.547186742156 0.00366396625264 0.171718229624 0. 0. 0.00256090204409 0.636746675067 0.00960274978496 0. 0. 0.146270560184 0.017249053838 0.000316098567487 0.285378211168 9.24014013085 0.305949089687 0.718193549725 0.00312219292709 0.0773155035163 0.00955123407451 0.00198881136206 0.144809836717 19.3056982127 0.243438772992 0.717540645624 0.151265661762 4.92211351063 0.504292174964 0.361202903197 4.49006892216 -0.087451981084 0.00842338129519 0.392290124716 0.00139847334073 0.027044155128 0.0139774661244 0.638507439152 0. 0.556961222423 0.13882239836 13.5150909923 0.166561693382 0. 0.000756205239141 0.188613940486 0.0144571766857 0. 0.0167131216833 0.532700702004 0. 0.0320969284915 0.02326036368 0.33353910299 0.0105399567991 0.600959423559 0.261734253996 10.1713107581 0.238032618109 0. 0.0199740705072 0.139539542607 0. 0.57217221198 0.216745519905 12.1940990023 0.178514589947 0.592929555019 0.137803794033 9.00742699427 0.129076334826 15.0682981859 4.38093295403 -0.00986884400482 0. 0.00714910857349 0.367847444687 0.0166385250797 0. 0.0210436940204 0.155361065995 0.170480142873 0.717744368709 0.312410321473 14.2913544055 0. 0. 0. 0.120387628276 0.000292448770617 0.0183996746206 0.0118009941572 0.612374176547 0. 0.00880187636181 0. 0.0810806480573 0.211302552782 0.467407092312 0.246211628106 10.2837358385 0.000671732121191 0. 0.00544000385484 0.0566344860084 0.152106508386 1.52277218051 0.373232827818 17.3834665486 0.088560075074 0.196177361201 0.380258104422 4.36085934855 3.18437134081 18.8510841125 5.14520276184 -0.140188964873 0. 0.0151920530983 0.0153098032383 1.21840798939 0.0200771021955 0.013828583721 0. 0.298711554809 0.013282000644 0. 0.0167204186218 17.9923373684 0.232696535903 0.984057841766 0.142431651545 0.0594158796265 0. 0. 0.0137989912116 0.12040947048 0. 0. 0. 0.311981750261 0. 0. 0.0153840209357 5.10599693577 0.060058085426 0.192867675621 0.0439372706467 2.29950758326 0.107264463125 0.122983893731 0.0764090093826 14.9222894425 0.206524497422 2.86780466508 0.159494635211 3.80306505617 0.0334445588107 0.325190963647 0.151947105188 -0. 0.207669384822 0.00189721251573 0.00553485636554 0. 1.52235490048 0.0214143749539 0. 0.0145960413034 0.32793862831 0.00705339082687 0.0457414280331 0.268825669828 19.5855144187 0.172589090786 0.409132980287 0.00554476834153 0.1076229582 0. 0.00240622379516 0.00804850693051 0.206710892449 0.00818525905021 0.0258785461201 0.000760289922815 0.311325590969 0.0118866698369 0.0359508735092 0.0658382096549 4.45507109341 0.0857620092788 0.184552789051 0.0797894222264 3.9481700794 0.0581303052042 0.16676938791 0.269272847366 19.2295897427 0.73594417452 0.978955856639 0.125122027026 5.05506631457 0.0973955577781 0.428928296452 4.82612419107 -0. 0.0187625080249 0.20621297091 0. 0.215475351118 0.00846225603838 4.56136559967 0.013451185552 0. 0. 0.397015828795 0.0315660915039 0.710900933484 0.189198512858 15.8999065484 0.160971621735 0.00628354924211 0.0161321594066 0.0723294391078 0. 0.0117968393571 0.0236982978919 0.433978791462 0.0143668477172 0.00817272892114 0. 0.316429262812 0.0198151164693 0.153450120451 0.0773647680014 3.50455393025 0.0618333636644 0.166520883576 0.0976239406896 3.24864400372 0.0837585483462 4.31483949393 0.648545185882 34.2984034321 0.819405183509 0.266907960006 0.122705495208 4.9548758249 0.199588957896 16.6777618142 3.57079368656 -0.0124471120403 0.0272087327615 0.00155187404069 0.125233490839 0. 0. 0.00895158073499 1.06491980832 0. 0. 0.00715827430729 0.414147587417 0.180211554628 0.623836427105 0.241870122255 12.2059095361 0.00658301673438 0.0125565086887 0. 0.058709761226 0. 0.0151374969764 0. 0.0571779694018 0. 0. 0. 0.285486228445 0.0388450921219 0.0813947228349 0.0513523513133 3.2140738289 0.0593540209486 0.20347229722 0.0794482293815 2.69456850247 0.178836946955 0.472832758926 0.844501463372 14.1545062979 0.111742476081 0.237178456371 0.101985554242 4.60324813954 2.89376135367 11.9743180489 3.79180138166 -1.85192230366 0.0693790157141 0.106402926385 0.0608024713276 0.0436329895839 0.00107179024991 0. 0.00390362798834 0.0808916951667 0. 0.00433532953897 0.00866563775885 0.115681448961 0.00244887631965 0.0122927075949 0.00307380568859 8.32999782753 0.126029974553 0.460073198431 0.120793949772 0.115673876081 0.00271733825314 0. 0.0047754974823 1.70598507161 0. 0. 0. 0.178363763058 0. 0. 0. 3.00967295837 0.0788741164722 0.103306012195 0.0385900978126 0.0418440750087 0.000122216607141 0. 0. 0.136527075723 0. 0.00566931440696 0.00251708868497 0.105111201226 0.00419097275684 0. 0.00485924133915 -0.0549154541207 3.03224643496 0.0428847156108 0.133703532383 0.0202336985508 0.140949578231 0.00900894226931 0.0250639669303 0.0048425257738 0.128268392937 0. 0.0115912491402 0. 0.0827492946191 0.0160830178931 0.0111482505672 0.24141129768 17.0668338244 0.206414807432 1.00003095748 0. 0.311079374201 0. 0. 0.0145169454496 3.04001941638 0. 0. 0.0331464951668 0.127673716292 0. 0.00965378489659 0.0589629693926 4.9678210571 0.0571303284523 0.248965454673 0. 0.0493384833039 0. 0.00239893485768 0. 0.230692698695 0. 0. 0.0422766872909 0.0920739167052 0. 0.00133058864128 4.29048773271 -0.101517404125 0.0343491447041 2.27313430775 0.0554319415663 0.0210799624769 0. 0.0821407508018 0. 0.0329140841083 0.0175891419447 0.184042580709 0.0134375573067 0.0238409003486 0.0035029716646 0.0557026739775 0.0110516944291 0.449722568316 0.159306400865 14.0744663646 0.253068276327 0.0121885022963 0. 0.46176793784 0. 0. 0. 2.26889710649 0.0224957316916 0.0300941303173 0. 0.127312288213 0.0124284578828 0.147104057547 0.0639672848033 4.10550614777 0.0825088546667 0. 0.00813367565483 0.0729990890482 0.00689730236854 0.00599463654984 0.00116099561615 0.127372168082 0. 0.0374612069485 0. 0.0641437950891 0. 8.9067174944 5.26727004749 -0.0634587178075 0.164446070886 0.0389132563161 1.99737117863 0.00282180434061 0. 0. 0.0774665806316 0.00868272364467 0. 0. 0.14300480576 0.0283602289446 0.023588473164 0.0105163231084 0.108103678501 0.14614846102 0.666021762766 0.113838834063 11.0648283984 0.00197426866049 0. 0. 0.151913570895 0. 0. 0. 2.32294437496 0.0235773309743 0.00278112713673 0. 0.0949326087762 0.0380151845809 0.268793047678 0.0730886004517 3.71246743415 0.00918507483228 0. 0. 0.046609892172 0.000579927622744 0. 0. 0.246691875092 0. 0. 0.0121177322723 0.0858990441967 2.11327446775 18.4850191794 4.13292946501 -0.0454886898633 0. 0.00608734618322 0.0016151106611 1.98767482394 0.0527684920215 0.210535924194 0.0536827040618 0.0420252303951 0.00588687958894 0. 0.00066928368527 0.154395852194 0.0186920369151 0.0166574139067 0.00359586340379 0.217447880351 0.0227868287022 0.0421451566115 0.0208986894064 9.79650280147 0.141230586854 0.926171845582 0.120065761888 0.483172002247 0. 0. 0.00519099356137 0.715526565594 0.0222416221031 0.134580169449 0.00972160824641 0.0897851212753 0.00130881885851 0.0166280705267 0.00142630838426 3.27162515516 0.0628333601292 0.197931476966 0.048359439559 0.0588224129141 0.00505944834557 0.00615546676895 0.00148701250206 0.266009222204 0.0152178532484 0.0375628245831 0.0051968742038 3.10505375421 0.0921325112832 0.494869259187 0.057954196026 -0. 0.10375058827 0.00895116015077 0. 0.0488589220103 3.23100578316 0.102852989537 0.0992758415717 0.00335181630037 0.0273009328923 0.00169258214181 0.0021720572221 0. 0.232980339437 0.00106980475086 0.00264157628508 0. 0.26583153922 0.000454703033684 0. 0.257433667291 15.0764556279 0.475982048683 0.612573787407 0.00127451046421 0.854042044641 0.010430565389 0. 0.00892929688638 0.951084070718 0.0305638428038 0.0291998661887 0.0103191984664 0.128858289569 0. 0. 0.065182747413 4.50215646981 0.141527513151 0.149054910944 0.00381937078567 0.113453281622 0.001544157525 0.0163706083748 0.00216907007472 0.425752972949 0.015172048448 0. 0.090884506002 3.94010288909 0.0822907479248 0.143448913247 3.94613664994 -0. 0. 0.17631552808 0. 0.541360468027 0.191544494061 12.9177085683 0.19141559287 0. 0.0077944473201 0.150455878283 0.00425317702852 0. 0.0157869881978 0.441933004077 0. 0. 0.0027451427081 0.813018154846 0.00629319249643 1.82975513433 0.614583853488 51.1610794325 0.680185321452 0.680808083455 0.482636692887 4.63806009414 0.190710087212 0.0255917056117 0.0788586973079 2.51305147376 0.0223075594435 0.00821325826844 0.0118380563154 0.387025791712 0. 0.731484041325 0.285688609037 20.8451309518 0.274016052876 0.00281011791009 0.00386208802479 0.271546419145 0.00882315670346 0.00814020975936 0.0353938170827 0.810935235854 0. 0.719888232788 0.317147489876 13.0266914958 0.209522978429 42.3850162604 9.79461368788 -0.0087248402762 0. 0. 0.0388028267706 0.0544601295802 0.167312785248 0.128592356538 2.38092749378 0. 0.0136994402801 0.00208139452493 0.0426199782934 0.00783642738883 0.0384048442744 0.00683574723219 0.0935666624087 0. 0. 0. 0.143036392756 0.145858915325 0.559774631266 0.33719131026 10.2273191348 0. 0.0102269689265 0. 0.517426541896 0.0328635291206 0.129812799345 0.0471040742776 0.610397195218 0.000429440743348 0.011649854694 0.00926334868987 0.0765859221309 0.0363917814826 0.183338074344 0.124125168139 3.20750017235 0.00108884405549 0. 0.00709815195924 0.0494190173154 0.00181848086765 0.0479824177173 0.0093094534245 0.152251675425 0.0411876400152 0.292750010335 0.0548809377424 2.76386105945 2.22257855879 10.8628930542 11.1413927804 -0.0760250538715 0.00700421836525 0.00866648194089 0.00435986152497 0.0540827397947 0. 0.00391636097676 0. 2.23283740478 0.0477354909763 0.119722467157 0.0512077291182 0.0582828087579 1.84450841094e-05 0.0212705156613 0.00347637118437 2.3444294707 0.0387767742541 0.13871448845 0.0161289290258 0.404228283439 0.00670727864772 0. 0. 42.6257611554 0.196792049636 0.929369177618 0.221868715408 0.489384967201 0.0168388452585 0.0398846300782 0.00512133729322 0.141547888798 0.01482634149 0.0254244831056 0.0210919924281 0.052656552978 0.0045449028405 0. 0.00716446340832 3.97333759429 0.0632861016144 0.142570150692 0.0496143346137 0.0894119344944 0.00143211187454 0.0202383137864 0. 7.73808578168 0.269236099363 0.714173337151 0.148482271426 2.27460367338 0.0612555216636 0.506093630745 0.0397805658951 -0.00335948534388 0.166811362037 0. 0. 0.00163245648269 0.0869115764053 0.00145131831787 0. 0.0366620864637 3.60332218814 0.0569434943281 0.162544597515 0.0101552271511 0.0862933628427 0.00997209836899 0.00614153543388 0.0143543479853 4.36503411421 0.0404557851182 0.0829539975305 0.0279204536382 0.591301367783 0.00185763764181 0.0353923010908 0.707502598715 35.0815245817 0.426555047875 2.24727598232 0. 0.78485920919 0.0292031839397 0. 0.00180239766365 0.267951329933 0. 0. 0.022120304753 0.153353668133 0.000864485448678 0.0247743262171 0.0575696359221 5.18508259902 0.0736462414271 0.260305286917 0. 0.0968691355895 0.0138850315085 0. 0.138838219983 15.4052198753 0.211229746893 0.59906033101 0.0515508895799 3.32129727819 0.27694555062 0.169235739566 3.26958964513 -0.00315205571841 0. 0.119858587196 0. 0.00965168066826 0.0035616261757 0.172854630017 0.0111622195472 0.148179057638 0.0410147698761 3.03403380457 0.0541614715481 0.000563097911286 0.00489601991308 0.0940862857026 0. 0.0217924575442 0.0129881466992 3.25778010704 0.028965386855 0.140292613723 0.0293657555445 0.484832092218 0.0345007483117 1.88077579645 0.325730094754 34.7467555829 0.561059668728 0.0149027296968 0.004157980621 0.846966791909 0. 0.00260535739846 0.00911471818673 0.243798651713 0.00180356314893 0.0271269185037 0. 0.165004321262 0. 0.256825819514 0.106302800681 4.81357755061 0.126885076615 0. 0.00848265494272 0.154125731765 0.00945871747585 0.250541358334 0.119835918567 12.7448935237 0.0835390299321 0.403266783084 0.0841562495728 7.56357418722 0.074228113326 9.80967504055 3.27871254942 -0.0103556018408 0. 0.0011816109884 0.113633952737 0.0118785975884 0.0125379387686 0.0104722121626 0.0788538391735 0.0533571273803 0.168525336551 0.0621319164848 2.95416541639 0.00242580625115 0.00146091373886 0.0100088353982 0.0663269954569 0.025369860271 0.22434540866 0.0343720715155 3.46956439231 0.0131447148201 0.0215679445196 0. 0.405073060412 0.556475593543 1.67817531836 0.545977564286 35.7061721804 0.0116939219962 0. 0.0183565441501 0.460092201302 0.00074238992399 0. 0.00579123310552 0.191431140758 0.00108942651377 0. 0.00297715155179 0.0726203290199 0.0534914770371 0.244946229554 0.115786843235 4.52310415665 0.0183960883988 0.0315494387759 0.0220921785763 0.138487740821 0.1498026314 1.20488541655 0.374457402337 13.0091599938 0.0516036232577 0.0991638339044 0.272220445341 2.92620666289 1.97016748469 12.8367518412 3.06689854949 -0.125733907422 0.00436972047946 0. 0.00353647416495 0.154469830792 0.00266701849446 0. 0.00747470692383 0.0428772107152 0. 0.00651486169726 0.0038758756817 2.12423784206 0.0396390768058 0.119676126216 0.0613113344595 0.0934530446047 0.00100486685685 0. 0.0099634245887 0.255867138922 0.00432278305936 0. 0.0033608119693 0.709920584226 0. 0. 0. 8.76488154869 0.108747954622 0.443139983406 0.108862992226 0.0592114869062 0.0021774332275 0. 0.00310486942886 0.146282632535 0. 0. 0. 0.0932659832328 0. 0.00226265698012 0.000437508156089 4.17379919929 0.0813437704349 0.132209517747 0.0702854009238 2.40862742376 0.105698824568 0.178043076253 0.112608616225 7.73500464643 0.139203650826 1.69519019403 0.0810436611991 3.09662064828 0.0385681117838 0.111269521996 0.0489347359831 -0. 0.0609872263047 0.00933842716192 0.000948328196705 0.00374889004249 0.15253027804 0. 0.00952953880298 0. 0.0572009319937 0.00837445788167 0. 0.039770266434 2.41207882465 0.0293270824384 0.0921186610183 0.0023267112147 0.166351748457 0. 0. 0.00216144889003 0.575616954777 0. 0.0148745203406 0.0015650455934 0.679423704369 0. 0.00801061566315 0.145315119018 10.0943879764 0.149402556355 0.412657654327 0.0098602040256 0.0757051733271 0. 0.00455281594064 0. 0.147595745939 0. 0. 0.0110837912317 0.0745131511445 0. 0. 0.0561028712269 4.3424873055 0.0450383438033 0.159410591003 0.0585146883274 2.37207001639 0.0359509499726 0.111435198427 0.139595758963 10.3724187684 0.454590596885 0.57005580893 0.0887282266365 3.33992114556 0.0553897405699 0.22588766036 2.97958638551 -0.00884501661763 0.00822019802007 0.0567978754604 0.00153576505523 0.0229617810989 0. 0.413469077511 0. 0. 0.00113601739474 0.044920740573 0. 0.149636695726 0.0400778032714 2.29007985767 0.0437062887372 0.00940439830966 0.00173005848216 0.0763644279553 0.00198872511095 0.0318057542977 0. 0.959001128734 0.00686764151641 0. 0. 0.69893106591 0.00227248143697 0.431545896385 0.0834627522463 10.4903910182 0.146065626468 0.000137938557632 0.00373652129917 0.0823752461755 0.00739167528714 0.0129600361132 0.00022436885351 0.262261843382 0.00530115881603 0. 0. 0.140415389848 0. 0.238536586546 0.0597236814982 3.45822422879 0.0896154132005 0.0942643358202 0.0515910631369 2.61062231714 0.0494450785923 2.33496905686 0.373558427272 32.9662411021 0.412373005557 0.212265840597 0.0992654681453 3.89618387928 0.130112261982 8.22472527244 2.42902491323 -0.0340591581891 0.012593100295 0.00323337401409 0.0685872694336 0.0105214233326 0.0112649491742 0. 0.139366554692 0.00843066624747 0. 0. 0.04777707531 0.0625981591408 0.106881090187 0.0405634111512 1.64631472157 0.00949918338782 0. 0.000604291454891 0.114526662756 0.00372564611188 0.0921689564017 0.00746205552917 0.200492727878 0. 0.000282518921569 0.00466192088992 0.57052517656 0.101107481918 0.229025687261 0.137716530929 6.54507791785 0. 0. 0.00460225123511 0.0532545275311 0.00269316586069 0. 0. 0.107055482973 0. 0.000186005327605 0.0156408180693 0.0835639144202 0.0562034194714 0.152712853513 0.0782557471793 2.78045654664 0.124962081181 0.143982562493 0.0473902723691 1.60216771614 0.0746132290942 0.308205816866 0.464655090752 4.89934528676 0.0455440791486 0.127170079697 0.0816795449481 2.41190068084 1.8126811407 6.5182404037 2.72920933193 - -0.0357983654718 0.0146634321466 0.0209916853044 0.0241608300459 0.0196605104347 0.0113786862615 0.0029009138093 0.0163015785126 0.0225609755057 0.0145991965297 0.0181825729424 0.0164781957079 0.0186856678405 0.0130405682814 0.0179309987722 0.0240968720195 0.0181775551111 0.0146957289426 0.0210180199751 0.0178777837456 0.0179375335248 0.014026410045 0.00304930001685 0.0181980546371 0.00237235102112 0.00247910724881 0.00304553476624 0.00292174613484 0.0129216428963 0.016886060241 0.0212194293029 0.021001239545 0.0207025677211 0.0101079314077 0.0168739180256 0.0130368421188 0.0145312058205 0.0117191223335 0.00248094305692 0.0145761834505 0.0160538354021 0.0117605522361 0.0140380390381 0.0114567437712 0.0112780796487 0.0101486396189 0.0148519084459 0.0147005486842 0.0206773071958 0.0111337585868 0.012890738691 0.0187059909187 0.0197741432688 0.0160489156219 0.00237751747496 0.0226108300737 0.0197730187728 0.0145713864549 0.0179588059761 0.0198394530312 0.0208205335746 0.0208303362555 0.0183984258157 0.0360132307673 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT - diff --git a/PhyloCSF_Parameters/7yeast.nh b/PhyloCSF_Parameters/7yeast.nh deleted file mode 100644 index 8dda6a9..0000000 --- a/PhyloCSF_Parameters/7yeast.nh +++ /dev/null @@ -1 +0,0 @@ -((((((Scer:.0836,Spar:.0617):.0432,Smik:.1154):.0165,Skud:.1731):.0275,Sbay:.1594):.0770,Scas:.1099):.0550,Sklu:.2034); diff --git a/PhyloCSF_Parameters/7yeast_coding.ECM b/PhyloCSF_Parameters/7yeast_coding.ECM deleted file mode 100644 index adaa933..0000000 --- a/PhyloCSF_Parameters/7yeast_coding.ECM +++ /dev/null @@ -1,71 +0,0 @@ -0.581210 -15.563110 0.478004 -0.632709 21.431688 0.529454 -0.749020 0.077211 0.197225 0.159506 -0.095275 1.032016 0.010836 0.389958 15.753929 -0.134920 0.099137 1.110098 0.146316 49.318435 21.193136 -0.093855 0.266767 0.000000 0.915935 15.814609 32.905174 15.876484 -2.687463 0.062497 0.556006 0.147354 0.612457 0.000000 0.000000 0.021614 -0.409508 5.014965 0.399427 1.883728 0.428255 3.005682 0.000000 1.242239 0.517978 -1.739711 0.418899 5.309414 0.122260 0.072084 0.161638 1.648589 0.000000 40.487998 1.275128 -0.257829 0.843298 0.212030 3.434994 0.000000 0.875068 0.313143 2.308739 0.331741 46.143335 0.863468 -0.308499 0.034663 0.222327 0.000000 1.647203 0.530892 0.391866 0.522821 0.277582 0.000000 0.306026 0.000000 -0.008095 0.697456 0.022813 0.000000 0.191011 1.071397 0.000000 0.411128 0.000000 0.549492 0.082179 0.111141 11.541455 -0.104394 0.083716 0.272127 0.088265 0.432972 0.000000 2.943965 0.000000 0.054686 0.145827 0.492993 0.139564 3.147210 0.459307 -0.047091 0.000000 0.000000 0.464352 0.007182 0.380534 0.247606 0.766087 0.011549 0.100558 0.000000 0.370674 11.003782 27.760545 0.568313 -0.910273 0.334042 0.301939 0.133802 0.187701 0.000000 0.114210 0.134237 0.000000 0.153931 0.814700 0.110467 0.060661 0.000000 0.099956 0.073124 -0.262213 1.650487 0.352155 0.268885 0.080474 0.184282 0.000000 0.053395 0.000000 0.846812 0.655845 0.000000 0.000252 0.000000 0.059180 0.236031 0.855325 -0.486331 0.000000 1.122447 0.487166 0.117094 0.260023 0.338839 0.000000 0.698496 0.226905 0.000000 0.181440 0.120316 0.178966 0.134563 0.000000 32.534553 2.495203 -0.286895 0.148017 0.255525 1.196662 0.045141 0.052327 0.120422 0.130288 0.000000 0.000000 0.000000 0.482767 0.000000 0.209644 0.031002 0.000000 1.046003 58.410734 0.961689 -0.066199 0.016481 0.044313 0.000000 0.728036 0.072765 0.000000 0.024678 0.046264 0.007519 0.063470 0.000000 0.000000 0.103493 0.077039 0.081201 0.738042 0.028871 0.191031 0.000000 -0.040067 0.206127 0.015669 0.000000 0.180330 0.583841 0.077471 0.279440 0.000000 0.000000 0.068522 0.490914 0.601179 0.462959 0.000000 0.000000 0.067797 1.040454 0.031001 0.251090 20.159234 -0.052950 0.000000 0.060574 0.061778 0.000000 0.000000 2.194430 0.178304 0.077773 0.000000 0.000000 0.011175 0.000000 0.000000 0.138892 0.125348 0.147478 0.025787 1.829750 0.075639 46.887092 39.633304 -0.022091 0.000000 0.033558 0.132681 0.097633 0.262964 0.051213 0.455749 0.000000 0.408639 0.000000 0.058674 0.556299 0.000000 0.000000 0.152429 0.000039 0.230734 0.095356 0.741125 22.763060 49.492507 18.490177 -0.944127 0.000000 0.843122 0.552476 0.047695 1.070144 0.000000 0.000000 17.187125 0.757537 1.015590 0.000000 0.258196 0.000000 0.105490 0.085306 7.314215 0.000000 0.000000 0.732925 1.291685 0.623259 0.000000 0.579306 -0.229394 1.915409 0.789940 0.000000 0.135078 0.727031 0.003531 0.000000 5.794902 3.482350 1.218529 0.310979 0.039164 0.000000 0.053583 0.441751 0.591085 14.418730 0.859429 0.466483 0.057566 2.640641 0.002621 0.037862 20.618005 -1.517375 0.797452 0.000000 0.000000 0.000000 0.000000 0.752398 1.551200 2.248566 0.000000 44.061056 0.899375 0.152647 0.451626 0.029082 0.000000 0.000000 0.051836 17.017765 0.514944 0.000000 0.000000 7.166142 0.431489 150.361161 55.270133 -0.009896 0.000000 0.000000 0.639135 0.000562 0.000000 0.000000 0.141571 4.984891 0.000000 5.396914 0.829176 0.000000 0.149664 0.004566 0.000000 0.103796 0.000000 0.066265 4.116663 0.000000 0.000000 0.000000 0.690723 20.304468 98.868462 26.296639 -0.076185 0.000000 0.000000 0.286589 0.224284 0.060457 0.021870 0.000000 0.039925 0.000000 0.000000 0.162746 1.568783 0.417423 0.739826 0.137057 0.410596 0.000000 0.518875 0.234408 1.110975 0.000000 0.000000 0.439714 1.081426 0.806999 0.523769 0.000000 -0.000000 0.000000 0.067671 0.249910 0.555469 0.000000 0.000000 0.231677 0.000000 0.525589 0.297108 0.091708 1.736653 4.899255 0.412733 0.000000 0.000000 1.510406 0.717409 0.428116 1.475873 2.332245 0.000000 0.000000 0.000000 4.634631 0.442689 0.004883 12.733571 -0.059779 0.000000 0.042869 0.533397 0.183715 0.072118 0.274229 0.000000 0.000000 0.000000 0.161290 0.291983 1.034426 0.722227 1.564296 0.000000 0.000000 0.000000 2.225157 0.160754 0.523704 0.000000 0.837382 1.178229 0.000000 2.758903 2.687397 0.000000 34.614559 15.129294 -0.049996 0.317931 0.000000 0.000000 0.356306 0.000000 0.486823 0.000000 0.000000 0.306962 0.000000 0.300807 1.827523 0.000000 0.213560 2.509984 0.250805 0.405624 0.000000 0.713324 0.385827 0.000000 2.337610 0.290645 0.690732 0.000000 0.058561 1.456656 11.227375 39.457012 12.904200 -0.987910 0.207730 0.000000 0.271599 0.277918 0.164910 0.067738 0.000000 0.114197 0.213350 0.000000 0.249641 0.124566 0.146009 0.012716 0.000000 1.249151 0.462433 0.000000 0.000000 0.119174 0.083300 0.032816 0.000000 0.449821 0.291481 0.000000 0.052229 0.018576 0.061246 0.030042 0.000000 -0.155840 3.158621 0.140173 0.000000 0.009189 0.518859 0.113705 0.000000 0.000000 1.806903 0.010675 0.000000 0.007381 0.081087 0.009648 0.000000 0.404504 1.063950 0.000000 0.000000 0.000000 0.539935 0.305632 0.000000 0.216981 0.000000 0.000000 0.116171 0.216011 0.600828 0.788736 0.000000 1.292750 -0.000000 0.336075 1.441360 0.303222 0.162858 0.000000 0.448497 0.228369 0.000000 0.374496 0.641901 0.133087 0.109522 0.000000 0.103542 0.208657 0.000000 0.000000 3.747700 0.547344 0.050998 0.000000 0.252905 0.118388 0.000000 0.000000 0.892253 0.153856 0.111432 0.000000 0.019578 0.040944 20.688427 2.273031 -0.119965 0.000000 0.102133 2.261594 0.056324 0.000000 0.037167 0.311712 0.000000 0.000000 0.000000 0.853791 0.002873 0.007741 0.024273 0.049773 0.104988 0.000000 0.425768 0.487591 0.035713 0.000000 0.000000 0.184667 0.000000 0.407509 0.206089 0.000000 0.000000 0.000000 0.000000 0.263377 1.133080 23.651072 1.384351 -0.221583 0.106956 0.100740 0.083688 4.006297 0.407657 0.000000 0.449088 0.194676 0.096544 0.060718 0.000000 0.521904 0.027122 0.325806 0.000000 0.218561 0.000000 0.108089 0.000000 0.903898 0.324377 0.000000 0.318105 0.000000 0.000809 0.000000 0.049001 0.171605 1.054405 0.023873 0.337838 0.624720 0.018192 0.224498 0.038672 -0.000000 0.107133 0.132738 0.220992 0.090073 3.924319 0.178088 0.000000 0.098026 1.165314 0.000000 0.195615 0.014375 0.031834 0.018956 0.423232 0.000000 0.239858 0.148558 0.000000 0.298245 0.307821 0.000000 0.560624 0.000000 0.043917 1.143561 0.042065 0.660493 0.000000 1.175586 1.225266 0.098629 0.572943 0.000000 0.055702 16.830036 -0.125299 0.090062 0.290758 0.100231 0.000000 0.475077 8.873984 0.389810 0.006809 0.000000 0.591616 0.298536 0.449019 0.000000 0.814238 0.060188 0.090764 0.015783 0.288974 0.000000 0.000000 0.294032 3.462958 0.167758 0.000000 0.000000 1.087950 0.072984 0.034194 0.000000 0.335123 0.838866 0.129048 0.102170 1.427760 0.097373 54.926871 23.740868 -0.079728 0.193276 0.015683 0.183531 0.106547 0.000000 0.065435 2.317427 0.000000 0.245919 0.176927 0.809508 0.000000 0.465597 0.023674 0.160960 0.076264 0.000000 0.000000 0.106577 0.040440 0.540362 0.465913 0.338494 0.481099 0.223491 0.000000 0.030650 0.000000 2.319882 0.000000 0.000000 0.000000 0.069241 0.132037 0.388986 16.496601 33.395296 14.732489 -0.480661 0.303715 0.083047 0.196624 0.488275 0.000000 0.000000 0.824541 1.550415 0.000000 0.000000 0.000000 0.000000 0.355596 0.082294 0.000000 0.283191 0.096306 0.000000 0.005266 0.000000 0.376161 0.000000 0.407138 1.999530 0.482876 0.000000 0.000000 0.031756 0.138489 0.003763 0.000000 1.945803 0.005497 0.623839 0.180562 1.791773 0.626305 0.000000 0.000000 -0.017167 0.000000 0.190885 1.152310 0.012930 0.864321 0.100982 0.000000 0.421233 7.881538 0.000000 0.559986 0.037409 0.000000 0.019720 0.216379 0.000000 1.000745 0.016604 0.000000 0.290029 0.000000 0.000000 0.517306 0.652268 0.410752 0.000000 0.482156 0.008488 0.546516 0.315243 0.000000 0.000000 1.764232 0.458357 0.610885 0.219036 2.282234 0.347131 0.000000 21.233897 -0.095359 0.448136 0.390840 0.000000 0.000000 1.688249 0.985432 0.000000 0.000000 0.000000 3.532209 0.000000 0.000000 0.000000 0.153060 0.285654 0.000000 0.000000 0.431492 0.183953 0.000000 0.770997 0.225006 0.208561 0.000000 0.020922 3.887695 0.000000 0.014578 0.000000 0.029792 0.130489 0.310164 0.222473 2.579923 0.000000 0.006457 0.000000 3.987643 0.765572 58.548571 19.497275 -0.027388 0.310643 0.000000 0.095622 0.060460 0.000000 0.006577 0.203578 0.000000 0.000000 0.240123 2.403076 0.188588 0.071722 0.000000 0.000000 0.000000 0.000000 0.000000 0.175975 0.121440 0.041025 0.389425 0.000000 0.000000 0.376751 0.165425 0.218142 0.000000 0.000000 0.000000 0.071363 0.000000 0.204550 0.000000 0.580710 0.129068 0.000000 0.039864 0.729593 14.539872 31.246112 20.652534 -0.207410 0.000000 0.033833 0.141152 1.797225 0.358117 0.429069 0.000000 0.273201 0.154393 0.000000 0.000000 8.600236 0.827320 0.758821 0.292609 0.165898 0.062135 0.000000 0.000000 0.000000 0.175716 0.000000 0.573440 0.070858 0.000000 0.124088 0.000000 1.680901 1.547508 0.323719 0.621556 0.516150 0.000000 0.076676 0.014377 4.021073 0.000000 0.000000 0.303957 0.142697 0.171286 0.909555 0.000000 -0.000000 0.593534 0.108717 0.000000 0.000000 1.297648 0.000000 0.313229 0.000000 0.800027 0.000000 0.000000 0.541970 5.837924 0.000000 1.181059 0.000000 0.000000 0.254773 0.192650 0.000000 0.000000 1.170849 0.000000 0.159523 0.000000 0.000000 0.246581 0.884189 2.232994 1.683233 0.000000 0.214697 0.229985 0.000000 0.108241 0.214938 2.331261 0.096801 0.207652 0.000000 0.240941 0.412811 0.009712 14.297408 -0.090486 0.165946 0.068338 0.000000 0.792196 0.000000 2.444380 0.000000 0.000000 0.000000 0.423463 0.070000 2.438833 0.000000 2.577749 0.568614 0.022860 0.000000 0.204827 0.016758 0.000000 0.596930 0.327958 0.214064 0.010888 0.111986 0.000000 0.000000 0.069180 0.293073 1.723185 1.120367 0.088987 0.000000 0.697477 0.000000 0.000000 0.285306 6.784114 0.000000 0.547546 0.000000 0.000000 0.036953 40.639291 21.481324 -0.034290 0.000000 0.013382 0.307393 0.000000 0.292293 0.000000 0.969271 0.000000 0.000000 0.031346 0.442067 0.483278 1.356857 0.000000 4.146653 0.066357 0.199970 0.000000 0.000000 0.378033 0.000000 0.000000 0.000000 0.000000 0.545784 0.127831 0.000000 0.000000 0.000000 0.000000 1.214617 0.000000 0.110261 0.331540 0.177800 0.175719 0.228170 0.237924 1.373525 0.185112 0.088704 0.000000 0.102844 14.663966 33.108782 16.892095 -0.886628 0.646899 0.515932 0.247176 0.083186 0.000000 0.000000 0.000000 0.063306 0.554063 0.000000 0.003250 0.650818 0.349594 0.027112 0.000000 6.981227 0.000000 0.000000 0.137770 0.766745 0.000000 0.000000 0.000000 5.302647 0.000000 0.029797 0.000000 0.000000 0.057130 0.000000 0.015138 1.441951 0.303182 0.000000 0.000000 0.239458 0.210965 0.163587 0.000000 0.606056 0.211722 0.097119 0.000000 0.489901 0.397413 0.236327 0.000000 -0.084336 0.498741 0.000000 0.000000 0.034532 0.120610 0.021158 0.034849 0.015844 0.379120 0.000000 0.000000 0.051024 0.000000 0.031396 0.059221 0.084293 3.513888 0.152216 0.000000 0.000000 0.061043 0.040112 0.000000 0.000000 1.410304 0.129854 0.000000 0.000000 0.028949 0.001850 0.214896 0.001822 0.336081 0.072220 0.000000 0.043623 0.059941 0.032237 0.045128 0.000000 0.210611 0.000000 0.000000 0.013692 0.000000 0.057039 0.078064 0.587740 -0.960921 0.250810 0.474287 0.692960 0.000000 0.000000 0.034693 0.000000 0.000000 0.172164 1.269599 0.548721 0.200360 0.000000 0.111537 0.230672 0.000000 0.965801 14.234842 0.140443 0.000000 0.000000 1.841766 0.000000 2.459291 1.785422 10.091001 0.000000 1.583833 0.000000 1.218662 0.000000 0.000000 0.000000 2.888922 0.138947 0.161138 0.000000 0.276271 0.136482 0.499417 0.000000 0.699368 0.000000 0.500526 0.000000 0.329900 0.186302 486.412169 2.684468 -0.000000 0.000000 0.034368 0.492827 0.025758 0.018903 0.055829 0.093677 0.000000 0.000000 0.040647 0.238821 0.003243 0.071543 0.032339 0.039721 0.109106 0.000000 0.116193 2.380201 0.000000 0.047225 0.000000 0.059261 0.273288 0.000000 0.034783 0.446094 0.356646 0.247371 0.052196 0.000000 0.041847 0.000000 0.002442 0.244748 0.027902 0.066161 0.058467 0.040985 0.044615 0.000000 0.045401 0.060115 0.043970 0.103019 0.024720 0.015502 2.245816 37.140983 1.783312 -0.174660 0.105661 0.120582 0.150751 2.654171 0.316747 0.239080 0.220325 0.030904 0.557200 0.000000 0.226196 0.000000 0.116552 0.162299 0.000000 0.245453 0.088307 0.191545 0.031558 3.285822 0.000000 0.000000 0.055485 1.232935 0.297499 0.000000 0.000000 0.724705 0.488099 0.381352 0.647326 0.138114 0.000000 0.102226 0.071339 2.546651 0.148625 0.456219 0.299769 0.000000 0.272685 0.000000 0.158932 0.120549 0.232446 0.000000 0.239668 2.633689 0.000000 0.838252 0.102140 -0.076290 0.222235 0.091728 0.126827 0.435155 2.568649 0.112151 0.216897 0.000000 0.922295 0.247360 1.059574 0.196550 0.000000 0.027697 0.204131 0.000000 0.065786 0.279558 0.234001 0.143670 6.273089 0.000000 0.000000 0.000000 0.180281 0.000000 0.143620 0.000000 4.435553 0.000000 0.000000 0.075017 0.480922 0.000000 0.000000 0.503215 4.046132 0.234913 0.000000 0.396891 0.000000 0.387623 0.194181 0.527405 0.000000 0.039654 0.220256 0.229124 0.420790 0.000000 0.014856 12.802339 -0.112591 0.170737 0.152960 0.118820 0.409862 0.023975 4.040695 0.434860 0.000000 0.137047 0.210743 0.563215 0.000000 0.000000 0.280330 0.111136 0.076451 0.042725 0.328045 0.139056 0.000000 0.203348 8.116849 0.000000 0.000000 0.000000 2.227129 0.000000 0.000000 0.728749 0.000000 0.844170 0.087893 0.165974 0.176141 0.000000 0.654636 0.540798 4.066529 0.016221 0.000000 0.000000 0.240944 0.206063 0.000000 0.306564 0.039927 0.134277 0.412406 0.104584 3.983463 0.000000 42.416576 19.141427 -0.075938 0.161257 0.080334 0.179790 0.221106 0.308403 0.449379 1.633883 0.032948 1.017172 0.000000 0.879498 0.304811 0.212739 0.000000 0.000000 0.088776 0.352034 0.000000 0.200678 0.000000 0.000000 0.930661 3.330835 0.000000 0.284515 0.000000 0.186103 0.478359 0.000000 1.095536 0.593863 0.016012 0.000000 0.106686 0.234584 0.486522 0.000000 0.586732 2.194112 0.208192 0.648705 0.175287 0.000000 0.067774 0.263861 0.353851 0.000000 0.032511 0.005846 0.303390 0.421322 13.025586 29.255618 13.712447 -0.423497 0.150552 0.000000 0.361415 0.000000 0.000000 0.000000 0.000000 1.671338 0.662016 1.770083 0.747868 0.478512 0.000000 0.121256 0.159343 0.000000 0.006066 4.940797 0.000000 0.594209 0.000000 1.341997 0.046355 13.055068 2.249021 2.828416 1.182330 1.540525 0.427894 0.759690 0.000000 0.216479 0.000000 0.982736 0.000000 0.452749 0.000000 0.191647 0.028696 3.153440 0.002316 1.034944 0.120343 0.247372 0.000000 0.000000 0.353709 423.207339 0.558197 209.336485 0.000000 3.322661 0.224165 1.624617 0.668449 -0.167846 0.593887 0.000000 0.000000 0.033474 0.379160 0.111165 0.000000 0.000000 2.734169 0.414991 0.264326 0.081819 0.626054 0.040304 0.000000 0.046298 0.000000 0.221687 0.810484 0.000000 0.194011 0.218109 0.082335 0.193604 7.605495 0.000000 0.000000 0.000000 0.025548 0.000000 0.587455 0.000000 0.433385 0.889536 0.000000 0.198213 0.440281 0.046882 0.086429 0.000000 1.155222 0.348591 0.065344 0.000000 0.817450 0.208139 0.000000 0.000000 2.954758 1.420488 0.000000 0.202105 1.914725 0.429550 0.273775 6.909055 -0.015444 0.000965 0.029316 0.002769 0.026030 0.017431 0.058191 0.004839 0.000000 0.041495 0.216275 0.016229 0.048090 0.021558 0.059608 0.015619 0.004252 0.085617 0.099629 0.025858 0.017249 0.008373 0.072950 0.000000 0.118416 0.050120 3.265562 0.000000 0.043810 0.081384 0.135791 0.003276 0.000900 0.007199 0.027115 0.008059 0.022075 0.003495 0.073267 0.000000 0.046231 0.011252 0.409717 0.000000 0.041895 0.004284 0.048473 0.009314 0.000000 0.180511 3.575284 0.193517 0.058504 0.000000 0.423116 0.000000 7.963153 0.516820 -0.000000 0.000000 0.077798 0.272073 0.058593 0.001869 0.085667 0.175545 0.000000 0.000000 0.000000 1.126982 0.000000 0.000000 0.045010 0.251098 0.090385 0.658032 0.000000 0.000000 0.025499 0.066118 0.000000 0.121227 0.063344 0.000000 0.361418 1.744951 0.161152 0.545267 0.188062 0.086206 0.219463 0.000000 0.000000 0.172792 0.110211 0.116180 0.165967 0.286618 0.185170 0.184486 0.000000 0.319763 0.170665 0.000000 0.034537 0.363201 0.330882 0.000000 0.000000 1.537824 0.079165 0.126285 0.054285 0.958372 4.001877 98.188238 0.241872 -0.057473 0.262884 0.005060 0.000000 0.085291 0.031113 0.000000 0.130545 0.039827 0.124990 0.051355 0.000000 1.143533 0.000000 0.560616 0.438764 0.181176 0.000000 0.000000 0.021100 0.000000 1.297757 0.851549 0.000000 0.301899 0.000000 0.000000 0.346638 29.700775 7.007735 10.452363 5.270753 0.000000 0.000000 0.108007 0.235866 0.079923 0.000000 0.000000 0.327583 0.059397 0.000000 0.033672 0.046509 0.978196 0.000000 0.175446 0.511700 1.202017 0.000000 0.905227 0.218817 1.207795 1.004379 0.139326 0.000000 1.949425 0.162242 0.064332 0.107138 -0.000000 0.000000 0.077123 0.105725 0.000000 0.228748 0.004437 0.000000 0.051380 0.000000 0.000000 0.046525 0.000000 0.693290 0.140976 0.000000 0.165638 0.000000 0.000000 0.213329 0.000000 0.448879 0.179594 0.037935 0.213165 0.000000 0.000000 0.159334 1.148017 5.554200 0.667162 0.000000 0.000000 0.000000 0.020986 0.103900 0.000000 0.528857 0.057361 0.000000 0.028700 0.072115 0.044128 0.051650 0.000000 1.043061 0.027150 0.000000 1.266404 1.181732 0.000000 0.972926 0.000000 1.059611 0.000000 0.050903 0.000000 0.436223 0.153078 0.183917 0.677572 -0.000000 0.136851 0.071342 0.000000 0.000000 0.110783 0.136471 0.081232 0.033349 0.130757 0.000000 0.000000 0.528313 0.070096 1.137683 0.070841 0.085511 0.266065 0.000000 0.000000 0.000000 0.000000 0.000000 0.066063 0.072512 0.116559 0.229946 0.000000 6.158381 5.774936 25.210182 7.048552 0.043426 0.057664 0.000000 0.000000 0.000000 0.000000 0.056143 0.163533 0.020904 0.076903 0.051841 0.000000 0.000000 0.000000 0.826724 0.231042 0.977674 0.367270 0.260490 0.000000 0.000000 0.127730 1.868945 0.022373 0.159692 0.269767 0.254645 0.034510 19.970821 0.000000 -0.052141 0.102223 0.000000 0.000000 0.001868 0.000000 0.010455 0.155385 0.016960 0.075331 0.061180 0.000000 0.155947 0.000000 0.174958 0.499488 0.000000 0.299579 0.335970 0.000000 0.037930 0.000000 0.000000 0.296135 0.000000 0.487602 0.211727 0.000000 0.000000 0.000000 0.000000 3.126326 0.004730 0.166950 0.000000 0.000000 0.030902 0.000000 0.000000 0.237758 0.033598 0.062251 0.024403 0.052678 0.122858 0.000000 0.044946 0.582508 0.000000 1.033681 1.250157 1.407673 0.000000 0.000000 0.036481 0.736912 0.997027 0.382341 0.145731 0.278208 0.221501 27.533240 1.044282 - -0.042558 0.024513 0.030138 0.036293 0.017995 0.012479 0.008171 0.020108 0.020893 0.010055 0.009439 0.014649 0.018597 0.016947 0.020770 0.030135 0.026648 0.007776 0.012271 0.013887 0.017633 0.006954 0.005409 0.013514 0.003213 0.002707 0.001910 0.006327 0.013506 0.005776 0.010752 0.012711 0.045143 0.020107 0.019335 0.037538 0.016269 0.012098 0.006217 0.020106 0.011230 0.009807 0.006088 0.022349 0.012260 0.011228 0.010804 0.021456 0.001050 0.014490 0.000519 0.019166 0.019118 0.014150 0.008827 0.023470 0.000684 0.005011 0.010397 0.008147 0.026476 0.018304 0.026556 0.026866 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT diff --git a/PhyloCSF_Parameters/7yeast_noncoding.ECM b/PhyloCSF_Parameters/7yeast_noncoding.ECM deleted file mode 100644 index 742619b..0000000 --- a/PhyloCSF_Parameters/7yeast_noncoding.ECM +++ /dev/null @@ -1,71 +0,0 @@ -2.324407 -5.962122 3.040942 -2.256750 8.559818 2.532988 -2.208606 0.338020 0.569290 0.223004 -0.194704 3.381941 0.361955 0.548933 4.271863 -0.458150 0.292858 3.323939 0.164416 12.506413 4.242540 -0.169551 0.717897 0.259557 2.615209 3.866647 12.050782 3.559946 -5.973296 0.649046 2.021627 0.561768 3.049419 0.355052 0.681852 0.174647 -0.461336 11.709968 0.635177 1.265431 0.247099 4.311997 0.257091 0.719617 3.036520 -0.982077 0.637142 10.269136 0.470801 0.457233 0.205056 3.944384 0.180281 11.505158 3.394517 -0.386140 1.860537 0.686900 8.797010 0.218806 0.720942 0.159702 3.906770 2.873188 11.782237 2.868772 -1.687118 0.141238 0.363387 0.215444 7.441212 0.379155 1.419727 0.413761 2.274873 0.190507 0.417736 0.133822 -0.299153 2.811613 0.158702 0.440753 0.603727 12.776732 0.642330 2.120747 0.225787 3.042437 0.205748 0.650356 2.050079 -0.391130 0.122774 2.861442 0.204874 1.996865 0.505968 13.289501 0.556748 0.710216 0.207778 3.556385 0.311511 6.473629 2.343011 -0.181757 0.418659 0.169061 3.211784 0.381006 1.249844 0.516703 8.797010 0.169081 0.440641 0.161571 2.615209 2.245018 7.961551 2.513706 -2.151990 0.134365 0.491035 0.207198 0.344995 0.020501 0.088779 0.000000 0.569979 0.094390 0.177883 0.070105 0.201108 0.004930 0.019463 0.026898 -0.190323 3.825897 0.264889 0.387180 0.000000 0.447622 0.000267 0.073626 0.055905 0.644423 0.053499 0.145995 0.010824 0.180006 0.016375 0.032724 3.329486 -0.448221 0.309883 3.067708 0.154420 0.103292 0.000000 0.268859 0.000880 0.235131 0.000000 0.675979 0.093081 0.000000 0.021493 0.238278 0.000000 12.730795 4.707491 -0.127873 0.432397 0.204286 2.513706 0.008358 0.046201 0.000000 0.311511 0.017107 0.205212 0.056293 0.556748 0.000000 0.035734 0.000000 0.204874 3.147806 13.310792 3.312749 -0.181568 0.002177 0.064850 0.000000 2.953057 0.215776 0.562076 0.253099 0.476138 0.000000 0.000000 0.000000 0.459821 0.107577 0.065128 0.015793 3.806558 0.330231 1.027034 0.486971 -0.046002 0.181727 0.025544 0.010971 0.214639 4.726145 0.188341 0.618189 0.028326 0.335803 0.104064 0.000000 0.055231 0.662613 0.052215 0.118075 0.266652 3.812014 0.266344 0.939899 4.925549 -0.079769 0.051154 0.201256 0.000000 0.497431 0.153531 3.103795 0.151780 0.000000 0.014474 0.174257 0.000000 0.153935 0.000000 0.506560 0.056497 0.632818 0.186783 4.713201 0.087262 16.287053 5.562184 -0.000000 0.000000 0.000000 0.161571 0.158046 0.726461 0.271934 2.868772 0.302376 0.032063 0.344330 0.180281 0.000000 0.115267 0.056293 0.470801 0.239875 0.636928 0.308562 3.556385 5.411464 13.293379 3.884500 -0.438502 0.010521 0.019381 0.000000 0.181355 0.000000 0.082372 0.018379 3.799372 0.219070 0.461596 0.098140 0.093033 0.000000 0.036558 0.031271 11.889462 0.643402 2.490261 1.168067 3.705557 0.154285 0.712664 0.026706 -0.086976 0.560662 0.013895 0.106465 0.015927 0.216114 0.000000 0.028597 0.223984 3.783832 0.194473 0.485357 0.000000 0.132853 0.037948 0.000000 0.628055 14.640486 0.901107 1.565545 0.398095 3.384437 0.229982 0.629663 2.897752 -0.153908 0.023634 0.512032 0.056497 0.146588 0.000000 0.404211 0.000000 0.507959 0.167209 3.884500 0.151780 0.000000 0.000000 0.087262 0.000000 1.265981 0.732359 15.722741 0.506560 0.374262 0.352749 7.995371 0.174257 12.608393 4.796047 -0.028599 0.081084 0.093894 0.516703 0.042617 0.000000 0.066557 0.159702 0.345823 0.574329 0.271934 3.559946 0.000000 0.056190 0.000000 0.164416 0.497133 2.416779 0.666037 13.289501 0.169248 0.672368 0.404211 3.944384 4.231405 14.011435 3.103795 -0.170195 0.000000 0.004770 0.001044 0.527406 0.069575 0.000000 0.061904 0.250662 0.000000 0.005784 0.000000 2.519033 0.206246 0.506508 0.121568 3.504833 0.232716 0.560706 0.208361 12.362144 0.645175 1.145372 0.544169 3.272380 0.203660 0.624662 0.221225 -0.015586 0.263770 0.000193 0.021390 0.067747 0.710565 0.103890 0.159402 0.000000 0.423672 0.000000 0.120499 0.184056 3.319312 0.237641 0.492826 0.270518 4.623787 0.513097 0.597353 1.069439 15.615980 0.542086 2.448074 0.398072 3.737469 0.152753 0.772862 3.002685 -0.025803 0.000000 0.318242 0.000000 0.150496 0.065861 0.666037 0.093081 0.152673 0.000000 0.308562 0.000880 0.358873 0.276039 3.312749 0.154420 0.444014 0.183456 8.257091 0.238278 2.837205 0.498558 15.722741 0.675979 1.111261 0.277676 4.713201 0.268859 13.849203 4.453129 -0.000000 0.068988 0.017976 0.169061 0.036191 0.070118 0.093894 0.686900 0.000000 0.000000 0.000000 0.259557 0.199837 0.478074 0.204286 2.532988 0.234932 0.491223 0.318242 2.861442 0.442068 1.437359 0.512032 10.269136 0.215597 0.678751 0.201256 3.323939 2.920270 9.876393 3.067708 -6.066180 0.545878 1.250639 0.410996 0.538680 0.011173 0.125129 0.022686 1.888143 0.107031 0.477734 0.101776 0.472466 0.000000 0.138775 0.023892 2.727391 0.142361 0.501729 0.144271 0.285770 0.038141 0.114032 0.000000 0.660296 0.002575 0.128851 0.050622 0.099986 0.070559 0.000000 0.008867 -0.468203 11.765145 0.517703 1.149969 0.043004 0.714212 0.000000 0.142267 0.216362 2.870469 0.178801 0.393730 0.004871 0.930034 0.034381 0.099841 0.294193 3.944502 0.201500 0.533914 0.003802 0.250199 0.049017 0.061995 0.000000 0.816188 0.126163 0.114579 0.000000 0.432236 0.000000 0.000000 3.325879 -1.092821 0.611306 9.876393 0.492826 0.134467 0.108471 0.772862 0.120499 0.459028 0.163502 2.448074 0.159402 0.180545 0.042462 0.597353 0.021390 0.567990 0.235266 4.453129 0.237641 0.000000 0.088322 0.152753 0.000000 0.155879 0.015089 0.542086 0.103890 0.001578 0.107236 0.513097 0.000193 11.058420 4.596102 -0.344283 1.196335 0.478074 7.961551 0.033517 0.106160 0.056190 0.650356 0.220343 0.413226 0.115267 2.120747 0.000000 0.125243 0.035734 0.440753 0.164928 0.471084 0.276039 2.343011 0.018960 0.000000 0.000000 0.205748 0.000000 0.230805 0.000000 0.642330 0.022480 0.042462 0.021493 0.158702 2.759894 14.822309 3.319312 -0.514815 0.062248 0.120075 0.007875 11.581393 0.583265 1.923544 0.682361 0.603673 0.000000 0.222957 0.018508 1.213080 0.366791 0.318448 0.143685 0.325010 0.016418 0.042760 0.000000 3.761923 0.100322 0.986593 0.175640 0.184398 0.037337 0.042107 0.071044 0.607281 0.000000 0.241647 0.019144 2.750504 0.528912 0.744032 0.163718 -0.014902 0.717449 0.097225 0.191490 0.630737 17.119583 0.762597 1.792175 0.018091 1.005233 0.000000 0.180473 0.195637 1.854669 0.146478 0.297353 0.004545 0.201857 0.000000 0.019515 0.347305 4.815561 0.000000 0.617947 0.079491 0.389772 0.000000 0.016985 0.000000 0.783456 0.000000 0.165714 0.222612 3.545221 0.268690 0.445661 4.912857 -0.094498 0.000000 0.678751 0.000000 1.454000 0.537272 14.011435 0.485357 0.093574 0.061815 0.629663 0.028597 0.040994 0.230805 1.565545 0.106465 0.000000 0.009403 0.277676 0.037948 0.557911 0.141818 4.796047 0.194473 0.000000 0.039214 0.229982 0.000000 0.081275 0.015089 0.901107 0.013895 0.561364 0.189587 3.737469 0.132853 14.559531 4.409233 -0.069707 0.148494 0.000000 0.440641 0.646167 2.099605 0.574329 11.782237 0.027776 0.290184 0.032063 0.719617 0.050361 0.413226 0.205212 1.265431 0.000000 0.068010 0.000000 0.207778 0.237402 0.760630 0.167209 3.394517 0.031612 0.061815 0.014474 0.257091 0.107389 0.163502 0.000000 0.635177 0.277160 0.853104 0.423672 3.042437 5.386236 14.630832 3.783832 -1.069311 0.000000 0.316129 0.095453 0.424773 0.088287 0.103428 0.025947 11.354807 0.760572 2.075004 0.434427 0.328215 0.000000 0.100618 0.014867 0.424424 0.050598 0.156398 0.007582 0.144511 0.000000 0.000000 0.029353 3.681274 0.234045 1.032541 0.103750 0.263771 0.000000 0.008329 0.475651 9.699932 0.949413 2.590234 0.666111 3.114821 0.336870 0.790763 0.066661 -0.084409 1.463345 0.165714 0.297353 0.082861 1.058255 0.016985 0.180473 0.395159 14.630832 0.617947 1.792175 0.053084 0.445661 0.019515 0.191490 0.035867 0.627362 0.000000 0.146478 0.000000 0.324910 0.000000 0.000000 0.269245 4.409233 0.000000 0.762597 0.000000 0.268690 0.000000 0.097225 0.644754 16.902753 0.783456 1.854669 0.328968 4.428067 0.389772 1.005233 3.847067 -0.293672 0.095694 1.437359 0.118075 0.197102 0.000000 0.672368 0.000000 1.343693 0.760630 13.293379 0.618189 0.062743 0.000000 0.939899 0.010971 0.194953 0.172995 0.498558 0.052215 0.000000 0.167039 0.352749 0.104064 0.616539 0.141818 5.562184 0.188341 0.000000 0.088322 0.266344 0.025544 1.334178 0.603882 15.615980 0.662613 0.639705 0.324910 3.384437 0.335803 14.454682 4.815561 -0.085002 0.477770 0.070118 1.249844 0.000000 0.306148 0.000000 0.720942 1.098018 2.099605 0.726461 12.050782 0.000000 0.106160 0.046201 0.548933 0.000000 0.142205 0.065861 0.505968 0.000000 0.000000 0.000000 0.205056 0.170265 0.537272 0.153531 4.242540 0.027300 0.108471 0.000000 0.361955 0.589166 2.483203 0.710565 12.776732 0.197608 1.058255 0.216114 4.311997 4.268825 17.119583 4.726145 -0.433922 0.003863 0.091103 0.024584 1.761890 0.131150 0.717644 0.118446 0.560620 0.015130 0.100109 0.045358 8.008245 0.470856 1.419918 0.418982 0.167154 0.000000 0.043497 0.022479 0.610887 0.136082 0.140137 0.030274 0.276852 0.031150 0.000000 0.000000 3.551489 0.192400 0.615431 0.144818 2.401197 0.187603 0.554096 0.444879 10.636410 0.653142 1.726857 0.636154 2.472373 0.155034 0.632402 0.276836 -0.030716 0.468415 0.000000 0.099841 0.220392 2.483203 0.114579 0.393730 0.096474 0.853104 0.061995 0.142267 0.360878 14.822309 0.533914 1.149969 0.029624 0.122648 0.000000 0.034381 0.000000 0.603882 0.126163 0.178801 0.000000 0.189587 0.049017 0.000000 0.337383 4.596102 0.201500 0.517703 0.144571 5.499667 0.432236 0.930034 0.925138 16.902753 0.816188 2.870469 0.313563 3.545221 0.250199 0.714212 3.026253 -0.071532 0.038107 0.491223 0.032724 0.313495 0.142205 2.416779 0.145995 0.101294 0.068010 0.636928 0.073626 1.248076 0.471084 13.310792 0.387180 0.008855 0.038103 0.183456 0.016375 0.116443 0.172995 0.732359 0.053499 0.021628 0.009403 0.186783 0.000267 0.574404 0.235266 4.707491 0.264889 0.512042 0.122648 4.623787 0.180006 2.777846 0.627362 14.640486 0.644423 0.707086 0.201857 3.812014 0.447622 12.383165 3.944502 -0.028382 0.162046 0.068988 0.418659 0.078765 0.477770 0.081084 1.860537 0.097296 0.148494 0.000000 0.717897 0.385668 1.196335 0.432397 8.559818 0.000000 0.038107 0.000000 0.122774 0.000000 0.095694 0.023634 0.637142 0.000000 0.000000 0.051154 0.292858 0.201824 0.611306 0.309883 3.040942 0.222689 0.468415 0.263770 2.811613 0.559221 1.463345 0.560662 11.709968 0.257598 0.717449 0.181727 3.381941 3.269345 11.765145 3.825897 -2.089064 0.233093 0.478814 0.269245 0.195050 0.000000 0.047544 0.000000 0.432400 0.034146 0.086453 0.013423 0.194587 0.025218 0.013976 0.000000 8.134336 0.553060 1.353221 0.390192 0.536449 0.097213 0.061899 0.064969 1.364475 0.064845 0.188713 0.155485 0.393981 0.000000 0.110918 0.006106 2.281797 0.166841 0.635614 0.206970 0.206045 0.006253 0.000000 0.000000 0.512882 0.013184 0.102436 0.018054 0.185537 0.047379 0.005868 0.000000 -0.228275 3.269345 0.144818 0.418982 0.026173 0.276836 0.000000 0.045358 0.000000 0.636154 0.030274 0.118446 0.000000 0.444879 0.022479 0.024584 0.598557 12.383165 0.615431 1.419918 0.031183 0.632402 0.000000 0.100109 0.129967 1.726857 0.140137 0.717644 0.060396 0.554096 0.043497 0.091103 0.183731 3.026253 0.192400 0.470856 0.033775 0.155034 0.031150 0.015130 0.032331 0.653142 0.136082 0.131150 0.000000 0.187603 0.000000 0.003863 2.740877 -0.319599 0.201824 2.920270 0.121568 0.000000 0.027300 0.221225 0.000000 0.097230 0.107389 0.544169 0.061904 0.017887 0.022480 0.208361 0.001044 1.698169 0.574404 13.849203 0.506508 0.087418 0.000000 0.624662 0.005784 0.634432 0.081275 1.145372 0.000000 0.204326 0.001578 0.560706 0.004770 0.435176 0.337383 3.002685 0.206246 0.010500 0.000000 0.203660 0.000000 0.077766 0.000000 0.645175 0.069575 0.060396 0.000000 0.232716 0.000000 8.940934 3.551489 -0.163865 0.385668 0.199837 2.245018 0.000000 0.000000 0.000000 0.133822 0.037364 0.050361 0.000000 0.413761 0.000000 0.000000 0.000000 0.215444 0.359474 1.248076 0.358873 6.473629 0.029346 0.062743 0.000000 0.417736 0.031728 0.040994 0.153935 1.419727 0.017887 0.180545 0.000000 0.363387 0.168738 0.360878 0.184056 2.050079 0.000000 0.053084 0.000000 0.190507 0.000000 0.195637 0.055231 0.379155 0.000000 0.004871 0.010824 0.141238 2.549084 8.008245 2.519033 -0.217496 0.012716 0.012216 0.000000 2.997394 0.157543 0.543970 0.152524 0.282436 0.000000 0.000000 0.004911 0.370348 0.045159 0.102552 0.003404 0.871800 0.064755 0.083848 0.010846 12.587816 0.692645 1.639998 0.490214 0.625169 0.013799 0.092718 0.000000 1.899125 0.281827 0.543734 0.156916 0.182961 0.000000 0.070560 0.000000 3.103071 0.264927 0.480320 0.167141 0.183069 0.000000 0.003234 0.023419 0.637527 0.089945 0.100345 0.033439 2.133385 0.298441 0.548139 0.184395 -0.000000 0.257598 0.475651 0.014867 0.290482 4.268825 0.103750 0.434427 0.000000 0.066661 0.029353 0.025947 0.000000 0.666111 0.007582 0.095453 0.000000 0.707086 0.008329 0.100618 0.628368 14.454682 1.032541 2.075004 0.056886 0.790763 0.000000 0.103428 0.077766 2.590234 0.156398 0.316129 0.000000 0.313563 0.000000 0.000000 0.420242 3.847067 0.234045 0.760572 0.057675 0.336870 0.000000 0.088287 0.032331 0.949413 0.050598 0.000000 0.144212 2.472373 0.263771 0.328215 3.253683 -0.000000 0.000000 0.215597 0.031271 0.392144 0.170265 4.231405 0.098140 0.000000 0.031612 0.026706 0.018379 0.031728 0.000000 1.168067 0.000000 0.070551 0.021628 1.111261 0.036558 2.040859 0.616539 12.608393 0.461596 0.256677 0.000000 0.712664 0.082372 0.634432 0.155879 2.490261 0.019381 0.024351 0.000000 0.398072 0.000000 0.429724 0.269245 2.897752 0.219070 0.056886 0.079491 0.154285 0.000000 0.129967 0.000000 0.643402 0.010521 0.524203 0.276852 3.272380 0.093033 13.578799 3.681274 -0.005796 0.097296 0.000000 0.169081 0.171488 1.098018 0.345823 2.873188 0.038277 0.027776 0.302376 0.174647 0.037364 0.220343 0.017107 0.561768 0.025642 0.101294 0.152673 0.710216 0.497041 1.343693 0.507959 11.505158 0.000000 0.093574 0.000000 0.681852 0.097230 0.459028 0.235131 2.021627 0.000000 0.096474 0.000000 0.225787 0.248102 0.395159 0.223984 3.036520 0.000000 0.018091 0.028326 0.355052 0.000000 0.216362 0.055905 0.649046 0.154919 0.560620 0.250662 2.274873 3.246394 11.354807 3.799372 -0.419797 0.033439 0.156916 0.003404 0.101743 0.023419 0.000000 0.004911 3.246394 0.167141 0.490214 0.152524 0.184395 0.000000 0.010846 0.000000 1.754706 0.100345 0.543734 0.102552 0.597093 0.003234 0.092718 0.000000 13.578799 0.480320 1.639998 0.543970 0.548139 0.070560 0.083848 0.012216 0.647307 0.089945 0.281827 0.045159 0.180010 0.000000 0.013799 0.000000 3.253683 0.264927 0.692645 0.157543 0.298441 0.000000 0.064755 0.012716 7.777208 0.637527 1.899125 0.370348 2.663792 0.183069 0.625169 0.282436 -0.052225 0.559221 0.019144 0.143685 0.001785 0.197608 0.071044 0.018508 0.248102 5.386236 0.175640 0.682361 0.000000 0.163718 0.000000 0.007875 0.205316 2.777846 0.241647 0.318448 0.031147 0.639705 0.042107 0.222957 0.429724 14.559531 0.986593 1.923544 0.010500 0.744032 0.042760 0.120075 0.085855 0.925138 0.000000 0.366791 0.116327 0.328968 0.037337 0.000000 0.420242 4.912857 0.100322 0.583265 0.033775 0.528912 0.016418 0.062248 0.510721 10.636410 0.607281 1.213080 0.180010 3.114821 0.184398 0.603673 3.103071 -0.097865 0.000000 0.442068 0.015793 0.000000 0.000000 0.169248 0.000000 0.497041 0.237402 5.411464 0.253099 0.029346 0.018960 0.486971 0.000000 0.407388 0.116443 2.837205 0.065128 0.208501 0.000000 0.374262 0.000000 2.040859 0.557911 16.287053 0.562076 0.087418 0.000000 1.027034 0.064850 0.081318 0.000000 1.069439 0.107577 0.031147 0.000000 0.398095 0.000000 0.628368 0.347305 4.925549 0.215776 0.031183 0.003802 0.330231 0.002177 1.234860 0.610887 12.362144 0.459821 0.597093 0.144511 3.705557 0.476138 12.587816 3.761923 -0.026685 0.078765 0.036191 0.381006 0.030430 0.000000 0.042617 0.218806 0.171488 0.646167 0.158046 3.866647 0.000000 0.033517 0.008358 0.223004 0.083765 0.313495 0.150496 1.996865 0.000000 0.197102 0.146588 0.457233 0.392144 1.454000 0.497431 12.506413 0.000000 0.134467 0.103292 0.569290 0.035870 0.220392 0.067747 0.603727 0.001785 0.082861 0.015927 0.247099 0.290482 0.630737 0.214639 4.271863 0.026173 0.043004 0.000000 0.338020 0.460213 1.761890 0.527406 7.441212 0.101743 0.424773 0.181355 3.049419 2.997394 11.581393 2.953057 -0.168521 0.000000 0.006106 0.000000 0.460213 0.018054 0.155485 0.013423 0.154919 0.000000 0.064969 0.000000 2.549084 0.206970 0.390192 0.269245 0.416540 0.005868 0.110918 0.013976 1.234860 0.102436 0.188713 0.086453 0.524203 0.000000 0.061899 0.047544 8.940934 0.635614 1.353221 0.478814 0.230860 0.047379 0.000000 0.025218 0.510721 0.013184 0.064845 0.034146 0.144212 0.006253 0.097213 0.000000 2.740877 0.166841 0.553060 0.233093 2.995600 0.185537 0.393981 0.194587 7.777208 0.512882 1.364475 0.432400 2.133385 0.206045 0.536449 0.195050 -0.000000 0.222689 0.008867 0.023892 0.035870 0.589166 0.050622 0.101776 0.000000 0.277160 0.000000 0.022686 0.168738 2.759894 0.144271 0.410996 0.062013 0.512042 0.000000 0.138775 0.081318 1.334178 0.128851 0.477734 0.024351 0.561364 0.114032 0.125129 0.435176 11.058420 0.501729 1.250639 0.075276 0.144571 0.070559 0.000000 0.085855 0.644754 0.002575 0.107031 0.000000 0.222612 0.038141 0.011173 0.183731 3.325879 0.142361 0.545878 0.230860 2.401197 0.099986 0.472466 0.647307 9.699932 0.660296 1.888143 0.182961 2.750504 0.285770 0.538680 2.281797 -0.048050 0.000000 0.234932 0.026898 0.083765 0.000000 0.497133 0.070105 0.025642 0.000000 0.239875 0.000000 0.359474 0.164928 3.147806 0.207198 0.168057 0.008855 0.444014 0.019463 0.407388 0.194953 1.265981 0.177883 0.070551 0.000000 0.632818 0.088779 1.698169 0.567990 12.730795 0.491035 0.062013 0.029624 0.270518 0.004930 0.205316 0.035867 0.628055 0.094390 0.000000 0.004545 0.266652 0.020501 0.598557 0.294193 3.329486 0.134365 0.416540 0.167154 3.504833 0.201108 1.754706 0.424424 11.889462 0.569979 0.871800 0.325010 3.806558 0.344995 8.134336 2.727391 -0.017579 0.028382 0.000000 0.181757 0.026685 0.085002 0.028599 0.386140 0.005796 0.069707 0.000000 0.169551 0.163865 0.344283 0.127873 2.256750 0.048050 0.071532 0.025803 0.391130 0.097865 0.293672 0.153908 0.982077 0.000000 0.094498 0.079769 0.458150 0.319599 1.092821 0.448221 5.962122 0.000000 0.030716 0.015586 0.299153 0.052225 0.084409 0.086976 0.461336 0.000000 0.014902 0.046002 0.194704 0.228275 0.468203 0.190323 2.324407 0.168521 0.433922 0.170195 1.687118 0.419797 1.069311 0.438502 5.973296 0.217496 0.514815 0.181568 2.208606 2.089064 6.066180 2.151990 - -0.050652 0.017255 0.021160 0.032474 0.018026 0.008973 0.008527 0.015506 0.018850 0.010325 0.010458 0.015506 0.035649 0.014782 0.017158 0.032474 0.019614 0.010055 0.009977 0.017158 0.010003 0.006173 0.005336 0.010458 0.008072 0.006082 0.005336 0.008527 0.014070 0.009981 0.009977 0.021160 0.022403 0.007536 0.009981 0.014782 0.011453 0.006492 0.006082 0.010325 0.010352 0.006492 0.006173 0.008973 0.016223 0.007536 0.010055 0.017255 0.028967 0.016223 0.014070 0.035649 0.017417 0.010352 0.008072 0.018850 0.017417 0.011453 0.010003 0.018026 0.028967 0.022403 0.019614 0.050652 - - -AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT -CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT -GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT -TTA TTC TTG TTT diff --git a/README b/README index c4b8af9..431286b 100644 --- a/README +++ b/README @@ -1,56 +1,65 @@ - +---------------------------------------------------------------------+ - | ____ __ __ ___________ ______ | - | / __ \/ /_ __ __/ /____ / ____/ ___// ____/ | - | / /_/ / __ \/ / / / // __ \/ / \__ \/ /_ | - | / ____/ / / / /_/ / // /_/ / /___ ___/ / __/ | - | /_/ /_/ /_/\__, /_/ \____/\____//____/_/ | - | /____/ | - | | - | http://compbio.mit.edu/PhyloCSF | - +---------------------------------------------------------------------+ ++---------------------------------------------------------------------+ +| ____ __ __ ___________ ______ | +| / __ \/ /_ __ __/ /____ / ____/ ___// ____/ | +| / /_/ / __ \/ / / / // __ \/ / \__ \/ /_ | +| / ____/ / / / /_/ / // /_/ / /___ ___/ / __/ | +| /_/ /_/ /_/\__, /_/ \____/\____//____/_/ | +| /____/ | +| | +| http://compbio.mit.edu/PhyloCSF | ++---------------------------------------------------------------------+ -SOURCE DISTRIBUTION +BINARY DISTRIBUTION -Please see our web site for more information about PhyloCSF and how to use it. -PhyloCSF is written in OCaml. This source distribution is divided into a -library, CamlPaml, containing generic infrastructure for phylogenetic rate -models, and a program implementing the PhyloCSF-specific models and driver -program. With additional development, the CamlPaml library will eventually be -released as a separate entity, but for now it is just part of this -distribution. +Please see our web site for instructions on how to use this software. +This distribution includes 32-bit and 64-bit Linux executables packaged +using CDE (http://www.stanford.edu/~pgbovine/cde.html), as well as the +29mammals and 12flies parameter files. PhyloCSF should be started using +the ./PhyloCSF script, which will extract and run the executable from +the appropriate CDE package for your achitecture. -Here are the steps to build the source: +PGP signatures for the CDE packages by the maintainer (Mike Lin + int - val of_index : int -> t - val compare : t -> t -> int - -module DNA = struct - type t = char - - let dim = 4 - - let compare = compare - - let is = function - | 'A' | 'a' - | 'C' | 'c' - | 'G' | 'g' - | 'T' | 't' -> true - | _ -> false - - let index = function - | 'A' | 'a' -> 0 - | 'C' | 'c' -> 1 - | 'G' | 'g' -> 2 - | 'T' | 't' -> 3 - | _ as nuc -> invalid_arg (sprintf "unrecognized nucleotide %c" nuc) - - let of_index = function - | 0 -> 'A' - | 1 -> 'C' - | 2 -> 'G' - | 3 -> 'T' - | _ -> invalid_arg "CamlPaml.Code.DNA.of_index" - - let comp = function - | 'A' -> 'T' - | 'G' -> 'C' - | 'C' -> 'G' - | 'T' -> 'A' - | 'a' -> 't' - | 'g' -> 'c' - | 'c' -> 'g' - | 't' -> 'a' - | 'N' -> 'N' - | 'n' -> 'n' - | '-' -> '-' - | _ as nuc -> invalid_arg (sprintf "unrecognized nucleotide %c" nuc) - - let revcomp s = - let l = String.length s - let s' = String.create l - for i = 0 to l-1 do - s'.[l-i-1] <- comp s.[i] - s' - -let ord a = - let t = Hashtbl.create 16 - Array.iteri (fun i x -> Hashtbl.add t x i) a - fun x -> Hashtbl.find t x - -module AA = struct - type t = char - let dim = 20 - let compare = compare - - let aa2twenty = [| - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - - -1; 0;-1; 1; 2; 3; 4; 5; 6; 7;-1; 8; 9;10;11;-1; - 12;13;14;15;16;-1;17;18;-1;19;-1;-1;-1;-1;-1;-1; - - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1; - -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1 |] - - - let twenty2aa = ord aa2twenty - - let is c = - let ci = Char.code c - ci <= (Array.length aa2twenty) && aa2twenty.(ci) >= 0 - - let index c = aa2twenty.(Char.code c) - - let of_index ci = Char.chr (twenty2aa ci) - - let blosum62_matrix = [| - 4; 0;-2;-1; -2; 0;-2;-1; -1;-1;-1;-2; -1;-1;-1;-1; 0; 0;-3;-2; - 0; 9;-3;-4; -2;-3;-3;-1; -3;-1;-1;-3; -3;-3;-3;-1; -1;-1;-2;-2; - -2;-3; 6; 2; -3;-1;-1;-3; -1;-4;-3; 1; -1; 0;-2; 0; -1;-3;-4;-3; - -1;-4; 2; 5; -3;-2; 0;-3; 1;-3;-2; 0; -1; 2; 0; 0; -1;-2;-3;-2; - - -2;-2;-3;-3; 6;-3;-1; 0; -3; 0; 0;-3; -4;-3;-3;-2; -2;-1; 1; 3; - 0;-3;-1;-2; -3; 6;-2;-4; -2;-4;-3; 0; -2;-2;-2; 0; -2;-3;-2;-3; - -2;-3;-1; 0; -1;-2; 8;-3; -1;-3;-2; 1; -2; 0; 0;-1; -2;-3;-2; 2; - -1;-1;-3;-3; 0;-4;-3; 4; -3; 2; 1;-3; -3;-3;-3;-2; -1; 3;-3;-1; - - -1;-3;-1; 1; -3;-2;-1;-3; 5;-2;-1; 0; -1; 1; 2; 0; -1;-2;-3;-2; - -1;-1;-4;-3; 0;-4;-3; 2; -2; 4; 2;-3; -3;-1;-1;-1; -1; 1;-2;-1; - -1;-1;-3;-2; 0;-3;-2; 1; -1; 2; 5;-2; -2; 0;-1;-1; -1; 1;-1;-1; - -2;-3; 1; 0; -3; 0; 1;-3; 0;-3;-2; 6; -2; 0; 0; 1; 0;-3;-4;-2; - - -1;-3;-1;-1; -4;-2;-2;-3; -1;-3;-2;-2; 7;-1;-2;-1; -1;-2;-4;-3; - -1;-3; 0; 2; -3;-2; 0;-3; 1;-1; 0; 0; -1; 5; 1; 0; -1;-2;-2;-1; - -1;-3;-2; 0; -3;-2; 0;-3; 2;-1;-1; 0; -2; 1; 5;-1; -1;-3;-3;-2; - -1;-1; 0; 0; -2; 0;-1;-2; 0;-1;-1; 1; -1; 0;-1; 4; 1;-2;-3;-2; - - 0;-1;-1;-1; -2;-2;-2;-1; -1;-1;-1; 0; -1;-1;-1; 1; 5; 0;-2;-2; - 0;-1;-3;-2; -1;-3;-3; 3; -2; 1; 1;-3; -2;-2;-3;-2; 0; 4;-3;-1; - -3;-2;-4;-3; 1;-2;-2;-3; -3;-2;-1;-4; -4;-2;-3;-3; -2;-3;11; 2; - -2;-2;-3;-2; 3;-3; 2;-1; -2;-1;-1;-2; -3;-1;-2;-2; -2;-1; 2 ;7 |] - - let blosum62 aa1 aa2 = - let idx1 = aa2twenty.(Char.code aa1) - let idx2 = aa2twenty.(Char.code aa2) - blosum62_matrix.(20*idx1+idx2) - - -module Codon64 = struct - type t = DNA.t*DNA.t*DNA.t - let dim = 64 - let compare = compare - - let is (nuc1,nuc2,nuc3) = DNA.is nuc1 && DNA.is nuc2 && DNA.is nuc3 - - let index (nuc1,nuc2,nuc3) = - 16 * (DNA.index nuc1) + 4 * (DNA.index nuc2) + (DNA.index nuc3) - - let of_index idx = - let sixteens = idx / 16 - let fours = (idx - 16 * sixteens) / 4 - let ones = (idx - 16 * sixteens - 4 * fours) - (DNA.of_index sixteens, - DNA.of_index fours, - DNA.of_index ones) - - let stop1 = index ('T','A','A') - let stop2 = index ('T','A','G') - let stop3 = index ('T','G','A') - - let is_stop_index ci = ci = stop1 || ci = stop2 || ci = stop3 - - let is_stop c = is_stop_index (index c) - - let translation_table = [| - 'K';'N';'K';'N'; - 'T';'T';'T';'T'; - 'R';'S';'R';'S'; - 'I';'I';'M';'I'; - - 'Q';'H';'Q';'H'; - 'P';'P';'P';'P'; - 'R';'R';'R';'R'; - 'L';'L';'L';'L'; - - 'E';'D';'E';'D'; - 'A';'A';'A';'A'; - 'G';'G';'G';'G'; - 'V';'V';'V';'V'; - - '*';'Y';'*';'Y'; - 'S';'S';'S';'S'; - '*';'C';'W';'C'; - 'L';'F';'L';'F' |] - - let translate c = translation_table.(index c) - let translate_index idx = translation_table.(idx) -module Codon1 = Codon64 - -module Codon61 = struct - type t = DNA.t*DNA.t*DNA.t - let dim = 61 - - let is c = Codon1.is c && not (Codon1.is_stop c) - - let order = [| ('T','T','T'); ('T','T','C'); ('T','T','A'); ('T','T','G'); ('T','C','T'); ('T','C','C'); ('T','C','A'); ('T','C','G'); ('T','A','T'); ('T','A','C'); ('T','G','T'); ('T','G','C'); ('T','G','G'); ('C','T','T'); ('C','T','C'); ('C','T','A'); ('C','T','G'); ('C','C','T'); ('C','C','C'); ('C','C','A'); ('C','C','G'); ('C','A','T'); ('C','A','C'); ('C','A','A'); ('C','A','G'); ('C','G','T'); ('C','G','C'); ('C','G','A'); ('C','G','G'); ('A','T','T'); ('A','T','C'); ('A','T','A'); ('A','T','G'); ('A','C','T'); ('A','C','C'); ('A','C','A'); ('A','C','G'); ('A','A','T'); ('A','A','C'); ('A','A','A'); ('A','A','G'); ('A','G','T'); ('A','G','C'); ('A','G','A'); ('A','G','G'); ('G','T','T'); ('G','T','C'); ('G','T','A'); ('G','T','G'); ('G','C','T'); ('G','C','C'); ('G','C','A'); ('G','C','G'); ('G','A','T'); ('G','A','C'); ('G','A','A'); ('G','A','G'); ('G','G','T'); ('G','G','C'); ('G','G','A'); ('G','G','G') |] - let lookup = ord order - - let index (n1,n2,n3) = lookup (Char.uppercase n1,Char.uppercase n2,Char.uppercase n3) - let of_index idx = order.(idx) - - let compare c1 c2 = compare (index c1) (index c2) - - let translate c = Codon1.translate c - let translate_index idx = translate (of_index idx) -module Codon2 = Codon61 diff --git a/lib/CamlPaml/Code.mli b/lib/CamlPaml/Code.mli deleted file mode 100644 index f390b88..0000000 --- a/lib/CamlPaml/Code.mli +++ /dev/null @@ -1,100 +0,0 @@ -(** abstractions for nucleotides, amino acids, and codons *) - -(** common signature for a code *) -module type S = sig - type t - - (** alphabet size (e.g. 4 for nucleotides, 20 for amino acids) *) - val dim : int - - (** return the index of the given codeword (between 0 and dim-1) *) - val index : t -> int - - (** return a codeword from its index *) - val of_index : int -> t - - val compare : t -> t -> int - -(** 4 DNA nucleotides *) -module DNA : sig - type t = char - val dim : int - val index : t -> int - val of_index : int -> t - val compare : t -> t -> int - - val is : char -> bool - - val comp : t -> t - val revcomp : string -> string - -(** 20 amino acids *) -module AA : sig - type t = char - val dim : int - val index : t -> int - val of_index : int -> t - val compare : t -> t -> int - - val is : char -> bool - - val blosum62 : t -> t -> int - -(** 64 codons (alphabetical, including stop codons) *) -module Codon64 : sig - type t = DNA.t*DNA.t*DNA.t - val dim : int - val index : t -> int - val of_index : int -> t - val compare : t -> t -> int - - val is : char*char*char -> bool - - val is_stop : t -> bool - val is_stop_index : int -> bool - - val translate : t -> AA.t - val translate_index : int -> AA.t - -(** @deprecated old name for Codon64 *) -module Codon1 : sig - type t = DNA.t*DNA.t*DNA.t - val dim : int - val index : t -> int - val of_index : int -> t - val compare : t -> t -> int - - val is : char*char*char -> bool - - val is_stop : t -> bool - val is_stop_index : int -> bool - - val translate : t -> AA.t - val translate_index : int -> AA.t - - -(** 61 sense codons in a distance-based order *) -module Codon61 : sig - type t = DNA.t*DNA.t*DNA.t - val dim : int - val index : t -> int - val of_index : int -> t - val compare : t -> t -> int - - val is : char*char*char -> bool - - val translate : t -> AA.t - val translate_index : int -> AA.t - -(** @deprecated old name for Codon61 *) -module Codon2 : sig - type t = DNA.t*DNA.t*DNA.t - val dim : int - val index : t -> int - val of_index : int -> t - val compare : t -> t -> int - - val is : char*char*char -> bool - - val translate : t -> AA.t - val translate_index : int -> AA.t diff --git a/lib/CamlPaml/Expr.ml b/lib/CamlPaml/Expr.ml deleted file mode 100644 index 7b71316..0000000 --- a/lib/CamlPaml/Expr.ml +++ /dev/null @@ -1,92 +0,0 @@ -type t = - | Val of float - | Var of int - | Add of t*t - | Sub of t*t - | Mul of t*t - | Div of t*t - -let rec eval' v = function - | Val x -> x - | Var (k) -> v.(k) - | Add (l,r) -> eval' v l +. eval' v r - | Sub (l,r) -> eval' v l -. eval' v r - | Mul (l,r) -> eval' v l *. eval' v r - | Div (t,b) -> eval' v t /. eval' v b -let eval e v = eval' v e - -let rec deriv' k = function - | Val _ -> Val 0. - | Var (k') when k = k' -> Val 1. - | Var (k') -> Val 0. - | Add (l,r) -> Add ((deriv' k l),(deriv' k r)) - | Sub (l,r) -> Sub ((deriv' k l),(deriv' k r)) - | Mul (l,r) -> Add ((Mul ((deriv' k l),r)), (Mul (l,(deriv' k r)))) - | Div (t,b) -> Div ((Sub ((Mul ((deriv' k t),b)), (Mul (t,(deriv' k b))))), (Mul (b,b))) -let deriv e k = deriv' k e - -let rec fixed_point f init = - let rslt = f init - if rslt = init then - rslt - else - fixed_point f rslt - -let rec simplify_step = function - | Add (Val 0.,x) | Add (x,Val 0.) - | Sub (x,Val 0.) - | Mul (Val 1.,x) | Mul(x,Val 1.) - | Div (x,Val 1.) -> simplify_step x - - | Sub (e,e') when e=e' -> Val 0. - | Mul (Val 0.,x) | Mul(x,Val 0.) -> Val 0. - - | Div (e,e') when e=e' -> Val 1. - - | Add (Val l,Val r) -> Val (l +. r) - | Sub (Val l,Val r) -> Val (l -. r) - | Mul (Val l,Val r) -> Val (l *. r) - | Div (Val l,Val r) -> Val (l /. r) - - | Add (l,r) -> Add (simplify_step l, simplify_step r) - | Sub (l,r) -> Sub (simplify_step l, simplify_step r) - | Mul (l,r) -> Mul (simplify_step l, simplify_step r) - | Div (l,r) -> Div (simplify_step l, simplify_step r) - - | x -> x - -let simplify = fixed_point simplify_step - -let to_string ?(fmt=string_of_float) x = - let b = Buffer.create 10 - let rec f = function - | Val x -> Buffer.add_string b (fmt x) - | Var k -> - Buffer.add_char b 'v' - Buffer.add_string b (string_of_int k) - | Add (l,r) -> - Buffer.add_char b '(' - f l - Buffer.add_string b " + " - f r - Buffer.add_char b ')' - | Sub (l,r) -> - Buffer.add_char b '(' - f l - Buffer.add_string b " - " - f r - Buffer.add_char b ')' - | Mul (l,r) -> - Buffer.add_char b '(' - f l - Buffer.add_string b " * " - f r - Buffer.add_char b ')' - | Div (l,r) -> - Buffer.add_char b '(' - f l - Buffer.add_string b " / " - f r - Buffer.add_char b ')' - f x - Buffer.contents b diff --git a/lib/CamlPaml/Expr.mli b/lib/CamlPaml/Expr.mli deleted file mode 100644 index 8cb38c1..0000000 --- a/lib/CamlPaml/Expr.mli +++ /dev/null @@ -1,23 +0,0 @@ -(** symbolic representation of arithmetic expressions with variables *) - -type t = - | Val of float (** Constant value *) - | Var of int (** Variable (identified by an integer) *) - | Add of t*t (** Addition *) - | Sub of t*t (** Subtraction *) - | Mul of t*t (** Multiplication *) - | Div of t*t (** Division *) - -(** [eval expr assignments] evaluates [expr] with respect to the given assignment of the variables (i.e. [assignments.(i)] is substituted for variable [i]) *) -val eval : t -> float array -> float - -(** [deriv expr v] computes the derivative of [expr] with respect to variable [v]. *) -val deriv : t -> int -> t - -(** simplify the expression by evaluating operations on constants, removing additions of 0, multiplications by 1, etc.*) -val simplify : t -> t - -(** make a nice infix notation string of the expression -@param fmt if you want to control the precision, etc. (defaults to [string_of_float]) - *) -val to_string : ?fmt:(float->string) -> t -> string diff --git a/lib/CamlPaml/Fit.ml b/lib/CamlPaml/Fit.ml deleted file mode 100644 index 86a0271..0000000 --- a/lib/CamlPaml/Fit.ml +++ /dev/null @@ -1,124 +0,0 @@ -open List - -class maximizer f init lo hi = - - let exn = ref None - let f' x = - try - 0. -. f x - with - | any -> - exn := Some any - nan - let minimizer = Gsl.Min.make Gsl.Min.BRENT f' ~min:init ~lo:lo ~up:hi - - object - method maximum () = Gsl.Min.minimum minimizer - method interval () = Gsl.Min.interval minimizer - method iterate () = - Gsl.Min.iterate minimizer - match !exn with - | Some ex -> raise ex - | None -> () - -let make_maximizer ~f ~init ~lo ~hi = (new maximizer f init lo hi) - -exception Out_of_range of float -let find_init ?(maxtries=1000) ?(logspace=false) ~f ~init ~lo ~hi () = - if lo >= hi || (logspace && lo <= 0.) then invalid_arg "CamlPaml.Fit.find_init" - let width = if logspace then log hi -. log lo else hi -. lo - let flo = f lo - let fhi = f hi - let x = ref init - let fx = ref (f init) - let i = ref 0 - Random.init 0 - while !i < maxtries && (!fx <= flo || !fx <= fhi) do - if logspace then - x := exp (log lo +. Random.float width) - else - x := lo +. Random.float width - fx := f !x - incr i - if !i = maxtries then - if flo > fhi then - x := lo - else - x := hi - !x - -class multi_maximizer f df init = - - let exn = ref None - let n = Array.length init - - let f' ~x = - if !exn = None then - try - 0. -. f (Gsl.Vector.to_array x) - with - | any -> - exn := Some any - nan - else - nan - let df' ~x ~g = - if !exn = None then - try - let dfv = Gsl.Vector.of_array (df (Gsl.Vector.to_array x)) - Gsl.Vector.scale dfv (-1.) - Gsl.Vector.set_zero g - Gsl.Vector.add g dfv - with - | any -> exn := Some any - let gsl_fdf = { - Gsl.Fun.multim_f = f'; - Gsl.Fun.multim_df = df'; - Gsl.Fun.multim_fdf = (fun ~x ~g -> let rslt = f' ~x in (if !exn = None then (df' ~x ~g; rslt) else rslt)); - } - - - let minimizer = Gsl.Multimin.Deriv.make Gsl.Multimin.Deriv.VECTOR_BFGS2 n gsl_fdf ~x:(Gsl.Vector.of_array init) ~step:1. ~tol:1e-6 - - object - method maximum () = - let x = Gsl.Vector.create n - let g = Gsl.Vector.create n - let opt = 0. -. Gsl.Multimin.Deriv.minimum ~x:x ~g:g minimizer - Gsl.Vector.scale g (-1.) - - opt, (Gsl.Vector.to_array x), (Gsl.Vector.to_array g) - method iterate () = - Gsl.Multimin.Deriv.iterate minimizer - match !exn with Some ex -> raise ex | None -> () - -let make_multi_maximizer ~f ~df ~init = (new multi_maximizer f df init) - -type domain = Real | Pos | Neg | NonPos | NonNeg | Probability - -let check_domain domain x = - match domain with - | Real when x=x -> true - | Pos when x > 0. -> true - | Neg when x < 0. -> true - | NonPos when x <= 0. -> true - | NonNeg when x >= 0. -> true - | Probability when x >= 0. && x <= 1. -> true - | _ -> false - - -exception False -let enforce_domain ?(rejection_value=neg_infinity) f domains = - fun x -> - if (Array.length x) <> Array.length domains then invalid_arg "CamlPaml.Fit.enforce_domains: length mismatch" - try - Array.iteri - fun i domain -> if not (check_domain domain x.(i)) then raise False - domains - f x - with - | False -> rejection_value - - - - diff --git a/lib/CamlPaml/Fit.mli b/lib/CamlPaml/Fit.mli deleted file mode 100644 index ad7b2a0..0000000 --- a/lib/CamlPaml/Fit.mli +++ /dev/null @@ -1,54 +0,0 @@ -(** low-level routines for numerical optimization *) - -(** {1 Single-dimensional maximization } *) - -(** a [maximizer] iteratively narrows down a local maximum of a one-dimensional function [f(x)] *) -class type maximizer = object - (** current estimate of the locally maximizing setting, [argmax_x f(x)] *) - method maximum : unit -> float - - (** current lower and upper bounds on [x] around the local maximum *) - method interval : unit -> (float*float) - - (** perform the next iteration *) - method iterate : unit -> unit - -(** create a [maximizer] for the function [f(x)] -@param init initial estimate of [x]. It is required that [f(lo) < f(init) > f(hi)]. -@param lo lower bound on [x] for the search -@param hi upper bound on [x] for the search -*) -val make_maximizer : f:(float -> float) -> init:float -> lo:float -> hi:float -> maximizer - -(** perform a random search within an interval [(lo,hi)] for a suitable initialization point for the one-dimensional maximizer, i.e. a point [x] such that [f(lo) < f(x) > f(hi)]. - @param init any initial guess between [lo] and [hi] (does not have to satisfy any other conditions, but a good guess would make this go faster) - @param maxtries maximum number of random points to try - @param logspace perform the random search over the interval between [lo] and [hi] in log space, with the result that the portion of the interval close to [lo] is searched more thoroughly than the portion close to [hi]. [lo] must be positive. - @raise Out_of_range if a suitable starting point could not be found. The parameter to the exception is [lo] if [f lo > f hi], which suggests that the maximum is at a point less than [lo], or [hi] if [f hi > f lo], which suggests that the maximum is at a point greater than [hi]. - @raise Failure if a suitable starting point could not be found and [f lo = f hi] in fewer than [maxtries] attempts. -*) -val find_init : ?maxtries:int -> ?logspace:bool -> f:(float -> float) -> init:float -> lo:float -> hi:float -> unit -> float -exception Out_of_range of float - -(** {1 Multi-dimensional gradient ascent } *) - -(** a multi_maximizer performs gradient ascent on a multidimensional function *) -class type multi_maximizer = object - (** current estimate of the maximum [f(x)], the corresponding location [x], and the gradient [df(x)] *) - method maximum : unit -> float*(float array)*(float array) - - (** perform the next iteration *) - method iterate : unit -> unit - -(** create a maximizer for the function [f(x)] given its gradient [df] - @param init initial point from which to begin the gardient ascent -*) -val make_multi_maximizer : f:(float array -> float) -> df:(float array -> float array) -> init:(float array) -> multi_maximizer - -type domain = Real | Pos | Neg | NonPos | NonNeg | Probability - -(** [check_domain domain x] returns [true] if [x] is in [domain], false otherwise *) -val check_domain : domain -> float -> bool - -(** wrap the function [f(x)] to prevent the [multi_maximizer] from searching outside of the specified domain for each element of the vector input. *) -val enforce_domain : ?rejection_value:float -> (float array -> float) -> (domain array) -> (float array -> float) diff --git a/lib/CamlPaml/META b/lib/CamlPaml/META deleted file mode 100644 index caf2e42..0000000 --- a/lib/CamlPaml/META +++ /dev/null @@ -1,4 +0,0 @@ -requires = "unix,str,gsl" -description = "phylogenetic analysis by maximum likelihood" -archive(byte)="CamlPaml.cma" -archive(native)="CamlPaml.cmxa" diff --git a/lib/CamlPaml/Makefile b/lib/CamlPaml/Makefile deleted file mode 100644 index 396c917..0000000 --- a/lib/CamlPaml/Makefile +++ /dev/null @@ -1,26 +0,0 @@ -LIBNAME = CamlPaml - -lib: - ocamlbuild -use-ocamlfind ${LIBNAME}.cma ${LIBNAME}.cmxa - -test: - ocamlbuild -use-ocamlfind test.native - _build/test.native - - -install: lib - ocamlfind install ${LIBNAME} META _build/${LIBNAME}.cmi _build/${LIBNAME}.cma _build/${LIBNAME}.cmxa _build/${LIBNAME}.a - -uninstall: - ocamlfind remove ${LIBNAME} - -reinstall: - make uninstall - make install - -clean: - rm -f *~ - ocamlbuild -clean - -doc: - ocamlbuild -use-ocamlfind ${LIBNAME}.docdir/index.html diff --git a/lib/CamlPaml/Newick.ml b/lib/CamlPaml/Newick.ml deleted file mode 100644 index 6fd8ca1..0000000 --- a/lib/CamlPaml/Newick.ml +++ /dev/null @@ -1,61 +0,0 @@ -open List -open Printf - -type branch = float option -type t = Node of (t list)*string*branch - -let lbl_bl lbl = function - | Some bl -> sprintf "%s:%f" lbl bl - | None -> lbl - -let rec to_string = function - | Node ([],lbl,bl) -> lbl_bl lbl bl - | Node (st,lbl,bl) -> - sprintf "(%s)%s" - String.concat "," (map to_string st) - lbl_bl lbl bl - -let rec size (Node (st,_,_)) = 1 + fold_left (+) 0 (map size st) - -let rec leaves = function - | Node ([],_,_) -> 1 - | Node (st,_,_) -> fold_left (+) 0 (map leaves st) - -let rec remove_branch_lengths (Node (st,lbl,_)) = Node (map remove_branch_lengths st,lbl,None) - -let rec list_keep_some f = function - | [] -> [] - | x :: rest -> match f x with Some x -> x :: list_keep_some f rest | None -> list_keep_some f rest - -let maybe_add bl1 bl2 = match (bl1,bl2) with - | (Some x,Some y) -> Some (x +. y) - | _ -> None - -let rec subtree keep = function - | (Node ([],lbl,_) as leaf) when lbl = "" || keep lbl -> Some leaf - | Node (st,lbl,bl) when st <> [] && (lbl = "" || keep lbl) -> - match list_keep_some (subtree keep) st with - | [] -> None - | (Node (sst,snm,sbl)) :: [] -> Some (Node (sst,snm,maybe_add bl sbl)) - | st -> Some (Node (st,lbl,bl)) - | _ -> None - -let reorder compare t = - let rec f = function - | Node ([],lbl,_) as leaf -> (lbl,leaf) - | Node (subtrees,lbl,bl) -> - let f_subtrees = sort (fun (lbl1,_) (lbl2,_) -> compare lbl1 lbl2) (map f subtrees) - let minlbl = fst (hd f_subtrees) - (minlbl, Node (map snd f_subtrees,lbl,bl)) - snd (f t) - -let rec total_length' = function - | Node (st,_,Some bl) -> bl +. (fold_left (+.) 0. (map total_length' st)) - | _ -> invalid_arg "CamlPaml.Newick.total_length: unspecified branch length" - -let total_length ?(count_root=false) t = - if count_root then - total_length' t - else - match t with - | Node (st,lbl,_) -> total_length' (Node (st,lbl,Some 0.)) diff --git a/lib/CamlPaml/Newick.mli b/lib/CamlPaml/Newick.mli deleted file mode 100644 index 275e835..0000000 --- a/lib/CamlPaml/Newick.mli +++ /dev/null @@ -1,43 +0,0 @@ -(** Newick format trees - -The Newick format is a parenthesis notation widely used for sharing phylogenetic trees, which can be used to represent rooted and unrooted trees with multifurcating nodes. The recursive data structure here is good for import/export and manipulating the tree topology, but the array-based representation in {{:T}[T]} is much more convenient for probabilistic inference purposes (though restricted to bifurcating trees). - -A lexer/parser is of course included, typically used as follows: - -[let newick_tree = CamlPaml.NewickParser.parse CamlPaml.NewickLexer.token (Lexing.from_string str)] - -@see information about Newick format -*) - -(** optional branch length *) -type branch = float option - -(** tree data structure *) -type t = Node of (t list)*string*branch - -(** compute the parenthesis representation of the tree (a semicolon is NOT appended) *) -val to_string : t -> string - -(** number of nodes in the tree (including internal nodes) *) -val size : t -> int - -(** number of leaves in the tree (nodes with no subtrees) *) -val leaves : t -> int - -(** remove all branch lengths from the tree *) -val remove_branch_lengths : t -> t - -(** [subtree keep tree] removes any nodes that have a label [x] such that [keep x = false]. If an internal node is left with no subtrees as a result of removal of stuff below it, that node is also removed. If an internal node is left with exactly one subtree, then the node is removed, the subtree is connected to the parent of the node, and the branch length of the node is added to the subtree if applicable. - -This function cannot be used to remove unnamed nodes except as side effects as described above. -*) -val subtree : (string -> bool) -> t -> t option - -(** [reorder cmp t] reorders leaves in the tree to be consistent with the ordering on labels defined by [cmp]. The topology of the tree is not changed, just its arbitrary left-to-right ordering. If the tree is bifurcating, all the leaves will be sorted left-to-right by their labels. In a multifurcating tree, more complicated things can happen (internal nodes are represented by their smallest leaf). The labels, if any, of internal nodes are not used. -*) -val reorder : (string -> string -> int) -> t -> t - -(** Compute the total branch length of the tree. - @param count_root (default false) if true, include the branch length of the topmost node of the tree. If [count_root=false], this branch length is allowed to be unspecified. - @raise Invalid_argument if the length of any branch is unspecified *) -val total_length : ?count_root:bool -> t -> float diff --git a/lib/CamlPaml/NewickLexer.mll b/lib/CamlPaml/NewickLexer.mll deleted file mode 100644 index 1da7957..0000000 --- a/lib/CamlPaml/NewickLexer.mll +++ /dev/null @@ -1,14 +0,0 @@ -{ -open NewickParser -} - -rule token = parse - | [' ' '\t' '\r' '\n' ';'] { token lexbuf } - | '(' { LPAREN } - | ')' { RPAREN } - | ',' { COMMA } - | ':' { COLON } - | ['0'-'9' '.']+ as lxm { BRANCHLEN(float_of_string lxm) } - | ['A'-'Z' 'a'-'z' '0'-'9' '_' '.']+ as lxm { LABEL(lxm) } - | ';' { SEMICOLON } - | eof { EOF } diff --git a/lib/CamlPaml/NewickParser.mly b/lib/CamlPaml/NewickParser.mly deleted file mode 100644 index 1feadd7..0000000 --- a/lib/CamlPaml/NewickParser.mly +++ /dev/null @@ -1,25 +0,0 @@ -%token LABEL -%token BRANCHLEN -%token COLON LPAREN RPAREN COMMA SEMICOLON EOF -%start parse -%type parse -%% -parse: - | node SEMICOLON { $1 } - | node EOF { $1 } -; -node: - | label { Newick.Node ([],fst $1,snd $1) } - | LPAREN subtrees RPAREN label { Newick.Node ($2,fst $4,snd $4) } - | LPAREN subtrees RPAREN { Newick.Node ($2,"",None) } -; -label: - | LABEL { ($1,None) } - | LABEL COLON BRANCHLEN { ($1,Some $3) } - | COLON BRANCHLEN { ("",Some $2) } -; -subtrees: - | node COMMA subtrees { $1 :: $3 } - | node { [$1] } -; -%% diff --git a/lib/CamlPaml/P.ml b/lib/CamlPaml/P.ml deleted file mode 100644 index bdc839d..0000000 --- a/lib/CamlPaml/P.ml +++ /dev/null @@ -1,18 +0,0 @@ -open Printf - -type matrix = Gsl.Matrix.matrix - -let validate ?(tol=1e-6) p = - let (n,n') = Gsl.Matrix.dims p - - if n <> n' then invalid_arg "CamlPaml.P.validate: non-square matrix" - if n < 2 then invalid_arg "CamlPaml.P.validate: trivial matrix" - - for i = 0 to n-1 do - let pi = Gsl.Matrix.row p i - let rowsum = ref 0. - for j = 0 to n-1 do - if pi.{j} < 0. || pi.{j} > 1. then invalid_arg (sprintf "CamlPaml.P.validate: P[%d,%d] = %f" i j pi.{j}) - rowsum := !rowsum +. pi.{j} - if abs_float (!rowsum -. 1.) > tol then - invalid_arg (sprintf "CamlPaml.P.validate: sum(P[%d,]) = %f != 1" i !rowsum) diff --git a/lib/CamlPaml/P.mli b/lib/CamlPaml/P.mli deleted file mode 100644 index 1081d80..0000000 --- a/lib/CamlPaml/P.mli +++ /dev/null @@ -1,7 +0,0 @@ -(** substitution probability matrices (P matrices) *) - -type matrix = (float, Bigarray.float64_elt, Bigarray.c_layout) Bigarray.Array2.t (** [Gsl.Matrix.matrix] *) - -(** validate that given array is a positive square matrix in which the rows sum to 1 -@raise Invalid_argument if not*) -val validate : ?tol:float -> matrix -> unit diff --git a/lib/CamlPaml/Parsimony.ml b/lib/CamlPaml/Parsimony.ml deleted file mode 100644 index d7aa671..0000000 --- a/lib/CamlPaml/Parsimony.ml +++ /dev/null @@ -1,49 +0,0 @@ -open List -let (|>) x f = f x - -module type S = sig - type ty - val infer : T.t -> ty array -> int*(ty array) - -module Make = functor (Ty : Set.OrderedType) -> struct - type ty = Ty.t - module TySet = Set.Make(Ty) - - let infer t lvs = - let n = T.size t - let nl = T.leaves t - if (Array.length lvs) <> nl then - invalid_arg "Parsimony.infer: wrong number of leaves in input" - let sets = Array.make n TySet.empty - let counts = Array.make n [] - let subs = ref 0 - for i = 0 to n-1 do - if i < nl then - sets.(i) <- TySet.singleton lvs.(i) - counts.(i) <- [(lvs.(i),1)] - else - let lc, rc = T.children t i - assert ((lc <> (-1)) && (rc <> (-1))) - let inter = TySet.inter sets.(lc) sets.(rc) - if (TySet.cardinal inter) = 0 then - sets.(i) <- TySet.union sets.(lc) sets.(rc) - incr subs - else - sets.(i) <- inter - let cts = - TySet.elements sets.(i) |> map - fun x -> (x,(try assoc x counts.(lc) with Not_found -> 0) + - (try assoc x counts.(rc) with Not_found -> 0)) - counts.(i) <- cts - let inferred = Array.make n lvs.(0) - for i = n-1 downto 0 do - if i < nl then - inferred.(i) <- lvs.(i) - else - if (i <> T.root t) && TySet.mem inferred.(T.parent t i) sets.(i) then - inferred.(i) <- inferred.(T.parent t i) - else - (* assert ((i = T.root t) || (inferred.(T.parent t i) <> "")) *) - (* TODO prefer synonymous subs? *) - inferred.(i) <- fst (hd (sort (fun (_,ct1) (_,ct2) -> compare ct2 ct1) counts.(i))) - !subs, inferred diff --git a/lib/CamlPaml/Parsimony.mli b/lib/CamlPaml/Parsimony.mli deleted file mode 100644 index 5c5dcb8..0000000 --- a/lib/CamlPaml/Parsimony.mli +++ /dev/null @@ -1,13 +0,0 @@ -(** inference of ancestral states based on the maximum parsimony heuristic *) - -(** output signature of Parsimony functor *) -module type S = sig - (** arbitrary user-defined character type. perhaps a nucleotide, or an amino acid*) - type ty - - (** Infer ancestral states given the tree and the characters observed at the leaves. When several parsimonious assignments to an ancestral node are possible, the algorithm chooses the assignment matching a plurality of the leaves in the subtree under that node. If there is still a tie, then it is chosen according to the order of the character type. - @return [n,states] where [n] is the minimum number of substitutions required to explain the observed leaves, and [states] is the inferred character at each node in the tree. - *) - val infer : T.t -> ty array -> int*(ty array) - -module Make : functor (Ty : Set.OrderedType) -> S with type ty = Ty.t diff --git a/lib/CamlPaml/PhyloEM.ml b/lib/CamlPaml/PhyloEM.ml deleted file mode 100644 index 081caaf..0000000 --- a/lib/CamlPaml/PhyloEM.ml +++ /dev/null @@ -1,182 +0,0 @@ -open List -open Printf -let (|>) x f = f x - -module PM = PhyloModel - -type sufficient_statistics = float array array array - -let new_sufficient_statistics m = - let n = Q.Diag.dim (PM.q m 0) - let t0 = PM.tree m - Array.init (T.size t0 - 1) (fun _ -> Array.make_matrix n n 0.) - -let collect_sufficient_statistics ?workspace m leaves ss = - let inter = PM.prepare_lik ?workspace m leaves - let lik = PhyloLik.likelihood inter - let t = PM.tree m - for i = 0 to T.root t - 1 do - PhyloLik.add_branch_posteriors inter i ss.(i) - lik - -let clean_sufficient_statistics ?(tol=1e-6) ss = - ss |> Array.iteri - fun br ssbr -> - ssbr |> Array.iteri - fun a row -> - row |> Array.iteri - fun b ssab -> - if ssab < tol then - row.(b) <- 0. - -let branch_ell m ss br = - let n = Q.Diag.dim (PM.q m 0) - let tot = ref 0. - - let ssbr = ss.(br) - let pbr = PM.p m br - - for k = 0 to n-1 do - let pbrk = Gsl.Matrix.row pbr k - let ssbrk = ssbr.(k) - for l = 0 to n-1 do - let ssbrkl = ssbrk.(l) - if ssbrkl > 0. then - tot := !tot +. ssbrkl *. log pbrk.{l} - - !tot - -let branches_ell m ss = - let t = PM.tree m - let nbr = T.size t - 1 - let tot = ref 0. - for br = 0 to nbr-1 do - tot := !tot +. branch_ell m ss br - !tot - -let prior_ell m ss = - let n = Q.Diag.dim (PM.q m 0) - let tot = ref 0. - - let tree = PM.tree m - - let rp = PM.prior m - let rlc,_ = T.children tree (T.root tree) - for k = 0 to n-1 do - let ss_root_k = Array.fold_left (+.) 0. ss.(rlc).(k) - if ss_root_k > 0. then - (* root sequence prior *) - tot := !tot +. ss_root_k *. (log rp.(k)) - !tot - - -let ell m ss = prior_ell m ss +. branches_ell m ss - -(* for consistency it would be nice to do this dbranch. only downside is computation of dQ_dxi would be repeated *) -let d_ell_dQ_dxi inst ss i = - let m = PM.P14n.model inst - let p14n = PM.P14n.p14n inst - let q_settings = PM.P14n.q_settings inst - - let tot = ref 0. - - let n = Q.Diag.dim (PM.q m 0) - let tree = PM.tree m - let nbr = T.size tree - 1 - - let previous = ref [] - - for br = 0 to nbr-1 do - let any = ref false - let dQ_dxi = - try - let access ar i = if Array.length ar = 1 then ar.(0) else ar.(i) - let (_,_,last_dQ_dxi,last_any) = - find - function - | (last_q_p14n,last_scale_p14n,last_dQ_dxi,last_any) when last_q_p14n == (access p14n.PM.P14n.q_p14ns br) && last_scale_p14n == (access p14n.PM.P14n.q_scale_p14ns br) -> true - | _ -> false - !previous - any := last_any - last_dQ_dxi - with - | Not_found -> - let scale = Expr.eval p14n.PM.P14n.q_scale_p14ns.(br) q_settings - let scale2 = scale *. scale - let dscale_dxi = Expr.eval (Expr.deriv p14n.PM.P14n.q_scale_p14ns.(br) i) q_settings - let dQ_dxi = - p14n.PM.P14n.q_p14ns.(br) |> Array.map - Array.map - fun expr -> - let qij = Expr.eval expr q_settings - let dqij_dxi = Expr.eval (Expr.deriv expr i) q_settings - (* Doing the quotient rule numerically. We could do it all symbolically - with Expr.deriv, but then we'd be recomputing scale & dscale for - each entry, and those often depend on all the entries in the matrix! *) - let rslt = (dqij_dxi *. scale -. qij *. dscale_dxi) /. scale2 - if rslt <> 0. then any := true - rslt - previous := (p14n.PM.P14n.q_p14ns.(br),p14n.PM.P14n.q_scale_p14ns.(br),dQ_dxi,!any) :: !previous - dQ_dxi - if !any then - let ssbr = ss.(br) - let t = T.branch tree br - let dPt_dxi = Q.Diag.dPt_dQ_dx ~q:(PM.q m br) ~t:t ~dQ_dx:dQ_dxi - let p = PM.p m br - - for a = 0 to n-1 do - let ssbra = ssbr.(a) - let dPt_dxi_a = dPt_dxi.(a) - let pa = Gsl.Matrix.row p a - for b = 0 to n-1 do - let ssbrab = ssbra.(b) - if ssbrab > 0. then - tot := !tot +. ssbrab *. dPt_dxi_a.(b) /. pa.{b} - !tot - -let d_ell_dQ_dx inst ss = - Array.init (Array.length (PM.P14n.p14n inst).PM.P14n.q_domains) (d_ell_dQ_dxi inst ss) - -let d_ell_dbranch inst br ss = - let m = PM.P14n.model inst - let p14n = PM.P14n.p14n inst - let tree_settings = PM.P14n.tree_settings inst - let np = Array.length (PM.P14n.p14n inst).PM.P14n.tree_domains - - (* precompute d(ELL)/dt *) - let tree_dELL_dt = - let n = Q.Diag.dim (PM.q m 0) - let tree = PM.tree m - let q = PM.q m br - - let dPt_dt = Q.Diag.dPt_dt ~q:q ~t:(T.branch tree br) - let p = PM.p m br - let tot = ref 0. - let ssbr = ss.(br) - for a = 0 to n-1 do - let ssbra = ssbr.(a) - let dPt_dt_a = dPt_dt.(a) - let pa = Gsl.Matrix.row p a - for b = 0 to n-1 do - let ssbrab = ssbra.(b) - if ssbrab > 0. then - tot := !tot +. ssbra.(b) *. dPt_dt_a.(b) /. pa.{b} - !tot - - Array.init np - fun i -> - (* dt/dx on this branch*) - let dt_dxi = Expr.eval (Expr.deriv p14n.PM.P14n.tree_p14n.(br) i) tree_settings - (* d(ELL)/dx = d(ELL)/dt dt/dx *) - tree_dELL_dt *. dt_dxi - -let d_ell_dtree inst ss = - let nbr = T.size (PM.P14n.p14n inst).PM.P14n.tree_shape - 1 - let np = Array.length (PM.P14n.p14n inst).PM.P14n.tree_domains - - let rslt = Array.make np 0. - for br = 0 to nbr-1 do - let rsltbr = d_ell_dbranch inst br ss - for i = 0 to np-1 do - rslt.(i) <- rslt.(i) +. rsltbr.(i) - rslt diff --git a/lib/CamlPaml/PhyloEM.mli b/lib/CamlPaml/PhyloEM.mli deleted file mode 100644 index f343d76..0000000 --- a/lib/CamlPaml/PhyloEM.mli +++ /dev/null @@ -1,50 +0,0 @@ -(** supporting functions for estimating the parameters of phylogenetic models by -expectation-maximization (EM) *) - -(** {1 E-step} *) - -(** sufficient statistics for the E-step, composed of estimates of how many times each -character-character substitution occurred on each branch of the tree (summed over all sites) *) -type sufficient_statistics = float array array array - -val new_sufficient_statistics : PhyloModel.t -> sufficient_statistics - -(** compute the E-step statistics for one site, given the leaves (as would be given to -{{:PhyloModel}PhyloModel.prepare_lik}). Update the given [sufficient_statistics] and return the -probability of the leaves under the model. This should be called for each site to collect the -statistics for the whole alignment. *) -val collect_sufficient_statistics : ?workspace:PhyloLik.workspace -> PhyloModel.t -> PhyloLik.leaf array -> sufficient_statistics -> float - -(** any entry in the sufficient statistics less than [tol] is set to zero. useful if e.g. planning -to compress the sufficient statistics for transport between compute nodes *) -val clean_sufficient_statistics : ?tol:float -> sufficient_statistics -> unit - -(** {1 M-step} *) - -(** expected log-likelihood of the model, where the expectation is over the soft assignment of the -ancestral characters represented by the sufficient statistics of the E-step. (objective function of -the M-step, sometimes called the Q function) *) -val ell : PhyloModel.t -> sufficient_statistics -> float - -(** compute the portion of the ell arising from the prior over the ancestral sequence *) -val prior_ell : PhyloModel.t -> sufficient_statistics -> float - -(** compute the portion of the ell arising from the substitution process *) -val branches_ell : PhyloModel.t -> sufficient_statistics -> float - -(** compute the portion of the ell arising from the substitutions on a specific branch*) -val branch_ell : PhyloModel.t -> sufficient_statistics -> int -> float - -(** compute the gradient of the ell with respect to the variables in the model's rate matrix p14n, -based on their symbolic expressions *) -val d_ell_dQ_dx : PhyloModel.P14n.instance -> sufficient_statistics -> float array - -(** compute the partial derivative with respect to one specific rate matrix variable only *) -val d_ell_dQ_dxi : PhyloModel.P14n.instance -> sufficient_statistics -> int -> float - -(** compute the gradient with respect to the variables in the model's p14n for branch lengths, based -on their symbolic expressions*) -val d_ell_dtree : PhyloModel.P14n.instance -> sufficient_statistics -> float array - -(** compute the derivative with respect to one specific branch length variable only *) -val d_ell_dbranch : PhyloModel.P14n.instance -> int -> sufficient_statistics -> float array diff --git a/lib/CamlPaml/PhyloLik.ml b/lib/CamlPaml/PhyloLik.ml deleted file mode 100644 index b1c12e1..0000000 --- a/lib/CamlPaml/PhyloLik.ml +++ /dev/null @@ -1,181 +0,0 @@ -open List -open Printf - -module Int = struct - type t = int - let compare = compare -module IntSet = Set.Make(Int) - -type leaf = [`Certain of int | `Distribution of float array | `Marginalize] - -let raw_leaf (k,i) = Gsl.Vector.of_array (Array.init k (fun j -> if i = j then 1. else 0.)) -let raw_marg k = Gsl.Vector.of_array (Array.make k 1.) -let hashcons_raw_leaf = Tools.weakly_memoize raw_leaf -let hashcons_raw_marg = Tools.weakly_memoize raw_marg - -let get_leaf k leaf = match leaf with - | `Certain i -> hashcons_raw_leaf (k,i) - | `Distribution ar -> Gsl.Vector.of_array ar - | `Marginalize -> hashcons_raw_marg k - -type workspace = { - mutable generation : int; - data : Gsl.Matrix.matrix -} - -type intermediate = { - tree : T.t; - pms : Gsl.Matrix.matrix array; - leaves : leaf array; - - workspace : workspace; - my_generation : int; - - alpha : Gsl.Matrix.matrix; (** actually a sub-matrix of workspace.data *) - mutable z : float; - mutable have_alpha : bool; - beta : Gsl.Matrix.matrix; (** actually a sub-matrix of workspace.data *) - mutable have_beta : bool; -} - -let new_workspace tree dim = - let rows = 2 * (T.size tree) - (T.leaves tree) - { generation = min_int; data = Gsl.Matrix.create rows dim } - -let empty = [||] -let prepare ?workspace tree pms prior leaves = - let k = Array.length prior - let n = T.size tree - let nl = T.leaves tree - - if nl <> Array.length leaves then invalid_arg "CamlPaml.Infer.prepare: length(leaves) != leaves(t)" - if Array.length pms < n-1 then invalid_arg "CamlPaml.Infer.prepare: not enough P matrices" - - let workspace = match workspace with Some x -> x | None -> new_workspace tree k - workspace.generation <- (if workspace.generation = max_int then min_int else workspace.generation+1) - - let rows,cols = Gsl.Matrix.dims workspace.data - if rows < (2*n-nl) || cols <> k then invalid_arg "CamlPaml.Infer.prepare: inappropriate workspace dimensions" - let alpha = Bigarray.Array2.sub_left workspace.data 0 (n-nl) - let beta = Bigarray.Array2.sub_left workspace.data (n-nl) n - - for a = 0 to k-1 do beta.{n-1,a} <- prior.(a) - - { tree = tree; pms = pms; leaves = leaves; workspace = workspace; my_generation = workspace.generation; - alpha = alpha; z = nan; have_alpha = false; beta = beta; have_beta = false } - -(* Inside algo (aka Felsenstein algo.) *) -let alpha_get x br = - let k = snd (Gsl.Matrix.dims x.alpha) - let nl = T.leaves x.tree - if br < nl then get_leaf k x.leaves.(br) else Gsl.Matrix.row x.alpha (br-nl) - -let ensure_alpha x = - if not x.have_alpha then - let n = T.size x.tree - let nl = T.leaves x.tree - let k = snd (Gsl.Matrix.dims x.alpha) - for i = nl to n-1 do - let (lc,rc) = T.children x.tree i - assert (lc >= 0 && rc >= 0) - assert (lc < i && rc < i) - let ls = x.pms.(lc) - let rs = x.pms.(rc) - let alc = alpha_get x lc - let arc = alpha_get x rc - - for a = 0 to k-1 do - let lsa = Gsl.Matrix.row ls a - let rsa = Gsl.Matrix.row rs a - x.alpha.{i-nl,a} <- (Gsl.Blas.dot lsa alc) *. (Gsl.Blas.dot rsa arc) - - x.z <- Gsl.Blas.dot (alpha_get x (n-1)) (Gsl.Matrix.row x.beta (n-1)) - x.have_alpha <- true - -(* Outside algo *) -let ensure_beta x = - ensure_alpha x - if not x.have_beta then - let k = snd (Gsl.Matrix.dims x.beta) - let inter = Gsl.Vector.create k - let ps_colb = Gsl.Vector.create k - for i = (T.root x.tree)-1 downto 0 do - let p = T.parent x.tree i - assert (p > i) - let s = T.sibling x.tree i - let ps = x.pms.(i) - let ss = x.pms.(s) - let bp = Gsl.Matrix.row x.beta p - let xas = alpha_get x s - - for a = 0 to k-1 do - inter.{a} <- bp.{a} *. (Gsl.Blas.dot (Gsl.Matrix.row ss a) xas) - - for b = 0 to k-1 do - for a = 0 to k-1 do - (* idea: instead of this loop it'd probably be a little faster - to transpose ps *) - Bigarray.Array1.unsafe_set ps_colb a (Bigarray.Array2.unsafe_get ps a b) - x.beta.{i,b} <- Gsl.Blas.dot inter ps_colb - x.have_beta <- true - -let likelihood x = - if x.workspace.generation <> x.my_generation then failwith "CamlPaml.PhyloLik.likelihood: invalidated workspace" - ensure_alpha x - x.z - -let node_posterior inferred i = - if inferred.workspace.generation <> inferred.my_generation then failwith "CamlPaml.PhyloLik.node_posterior: invalidated workspace" - ensure_alpha inferred - let k = snd (Gsl.Matrix.dims inferred.alpha) - if inferred.z = 0. then (* the data were impossible by the model *) - Array.make k 0. - else if i < T.leaves inferred.tree then (* leaf: usually certain *) - Gsl.Vector.to_array (alpha_get inferred i) - else - (* calculate the betas (except for the root, whose betas get prefilled in prepare) *) - if i <> T.root inferred.tree then ensure_beta inferred - Array.init k (fun x -> (alpha_get inferred i).{x} *. inferred.beta.{i,x} /. inferred.z) - -let add_branch_posteriors ?(weight=1.0) inferred branch ecounts = - if inferred.workspace.generation <> inferred.my_generation then failwith "CamlPaml.PhyloLik.add_branch_posterior: invalidated workspace" - ensure_beta inferred - let k = snd (Gsl.Matrix.dims inferred.alpha) - - if Array.length ecounts <> k then invalid_arg "CamlPaml.Infer.add_branch_posteriors: wrong matrix dimension" - if branch < 0 || branch >= (T.root inferred.tree) then invalid_arg "CamlPaml.Infer.add_branch_posteriors: invalid branch" - - let z = inferred.z - if z > 0. then - let tree = inferred.tree - let sm = inferred.pms.(branch) - let p = T.parent tree branch - let sib = T.sibling tree branch - - let bp = Gsl.Matrix.row inferred.beta p - let ab = alpha_get inferred branch - - let xas = alpha_get inferred sib - let sms = inferred.pms.(sib) - - for a = 0 to k-1 do - let bpa = bp.{a} - if bpa > 0. then - let sma = Gsl.Matrix.row sm a - let smsa = Gsl.Matrix.row sms a - - let bpa_sibtot = bpa *. (Gsl.Blas.dot smsa xas) - - let ecountsa = ecounts.(a) - if Array.length ecountsa <> k then invalid_arg "CamlPaml.Infer.add_branch_posteriors: wrong matrix dimension" - - for b = 0 to k-1 do - let pr = bpa_sibtot *. sma.{b} *. ab.{b} /. z - ecountsa.(b) <- ecountsa.(b) +. weight *. pr - -let branch_posteriors inferred branch = - let k = snd (Gsl.Matrix.dims inferred.alpha) - let a = Array.make_matrix k k 0. - add_branch_posteriors inferred branch a - a - diff --git a/lib/CamlPaml/PhyloLik.mli b/lib/CamlPaml/PhyloLik.mli deleted file mode 100644 index 88e62a5..0000000 --- a/lib/CamlPaml/PhyloLik.mli +++ /dev/null @@ -1,35 +0,0 @@ -(** core phylogenetic likelihood calculations - -These should usually be accessed through the higher-level {{:PhyloModel}[PhyloModel]} abstractions. *) - -(** Specifying a leaf (extant) character. Usually the extant character is known with certainty; in this case, use [`Certain] with the index of the character, e.g. [`Certain (Code.Codon61.index ('A','T','G'))]. Alternatively, you can specify an arbitrary probability distribution over extant characters. Lastly, you can specify to marginalize a leaf out of the likelihood calculations entirely. *) -type leaf = [`Certain of int | `Distribution of float array | `Marginalize] - -type workspace - -(** The calculations use a workspace of [((2 * T.size tree - T.leaves tree) * k)] [float]s where [k] is the alphabet size. As a performance optimization, you can create a workspace with [new_workspace tree k] and use it across multiple calls to [prepare]; otherwise, it will allocate automatically. *) -val new_workspace : T.t -> int -> workspace - -type intermediate - -(** [prepare tree p_matrices root_prior leaves] initializes the likelihood calculations, given: -- [tree] the phylogenetic tree -- [p_matrices.(i)] is the substitution matrix for the branch leading {e to} node [i] {e from} its parent. -- [root_prior] the prior probability distribution over characters at the root. -- [leaves] is an array of [leaf]s (see above), the appropriate number for the tree -- [workspace] is an appropriately sized workspace; one will be allocated if not given. -@return an abstract value from which various information about ancestral states can be extracted (see below). The time-consuming calculations are not actually performed until needed. If using a shared workspace, be sure to get all the results you need before the next call to [prepare]. -*) -val prepare : ?workspace:workspace -> T.t -> P.matrix array -> float array -> leaf array -> intermediate - -(** calculate the probability of the leaves under the substitution model *) -val likelihood : intermediate -> float - -(** compute the posterior probability distribution over characters at the specified node. *) -val node_posterior : intermediate -> int -> float array - -(** [branch_posteriors intermediate k] computes the posterior probability of each possible substitution on the specified branch [k]. That is, entry [(i,j)] of the returned matrix is [P(parent(k) = i && k = j | Leaves)] *) -val branch_posteriors : intermediate -> int -> float array array - -(** add branch posteriors to the appropriate entries in the given matrix. (useful for summing over many sites) *) -val add_branch_posteriors : ?weight:float -> intermediate -> int -> float array array -> unit diff --git a/lib/CamlPaml/PhyloModel.ml b/lib/CamlPaml/PhyloModel.ml deleted file mode 100644 index 30f3e55..0000000 --- a/lib/CamlPaml/PhyloModel.ml +++ /dev/null @@ -1,156 +0,0 @@ -open List -open Printf -let (|>) x f = f x - -type t = { - tree : T.t; - qms : Q.Diag.t array; - pms : P.matrix array; - prior : float array option -} - -let make ?prior t qms = - let qms = if Array.length qms = 1 then Array.make (T.size t - 1) qms.(0) else Array.copy qms - if Array.length qms <> T.size t - 1 then invalid_arg "CamlPaml.PhyloModel.make" - for i = 0 to T.root t - 1 do - if Q.Diag.dim qms.(i) <> Q.Diag.dim qms.(0) || T.branch t i < 0. then invalid_arg "CamlPaml.PhyloModel.make" - let pms = Array.init (T.size t - 1) (fun br -> Q.Diag.to_Pt qms.(br) (T.branch t br)) - let prior = match prior with - | Some pr -> - if Array.length pr <> Q.Diag.dim qms.(0) then invalid_arg "CamlPaml.PhyloModel.make" - Some (Array.copy pr) - | None -> - if not (Q.Diag.reversible qms.(snd (T.children t (T.root t)))) then invalid_arg "CamlPaml.PhyloModel.make" - None - { tree = T.copy t; qms; pms; prior } - -let tree { tree } = T.copy tree -let q { qms } br = qms.(br) -let p { pms } br = pms.(br) (* Array.map Array.copy pms.(br) *) -let prior { tree; qms; prior } = match prior with - | Some pr -> Array.copy pr - | None -> Q.Diag.equilibrium qms.(snd (T.children tree (T.root tree))) (* q was verified reversible in [make], above*) - -let prepare_lik ?workspace m leaves = PhyloLik.prepare ?workspace m.tree m.pms (prior m) leaves - -let checksum = 1., 1e-6 - -let simulate m = - let branch_choosers = m.pms |> Array.map (fun pm -> (Array.map (Tools.random_chooser ~checksum:checksum) (Gsl.Matrix.to_arrays pm))) - let root_chooser = Tools.random_chooser ~checksum:checksum (prior m) - fun ?root ?a () -> - let t = m.tree - let a = match a with - | Some a -> a - | None -> Array.make (T.size t) (-1) - - a.(T.root t) <- (match root with - | None -> root_chooser () - | Some ch when ch >= 0 && ch < Q.Diag.dim m.qms.(0) -> ch - | _ -> invalid_arg "CamlPaml.PhyloModel.simulate (root)") - for i = T.root t - 1 downto 0 do - let p = a.(T.parent t i) - a.(i) <- branch_choosers.(i).(p) () - a - -module P14n = struct - type q_p14n = Expr.t array array - - type model_p14n = { - q_p14ns : q_p14n array; - q_scale_p14ns : Expr.t array; - q_domains : Fit.domain array; - - tree_shape : T.t; - tree_p14n : Expr.t array; - tree_domains : Fit.domain array - } - - type instance = { - model : t; - p14n : model_p14n; - q_settings : float array; - tree_settings : float array - } - - let fill_q_diagonal q = - let n = Array.length q - for i = 0 to n-1 do - if Array.length q.(i) <> n then invalid_arg "CamlPaml.PhyloModel.P14n.fill_q_diagonal" - let tot = ref (Expr.Val 0.) - for j = 0 to n-1 do - if i <> j then - tot := Expr.Add (q.(i).(j), !tot) - q.(i).(i) <- Expr.simplify (Expr.Sub (Expr.Val 0., !tot)) - - let instantiate_tree shape exprs domains settings = - Array.iteri (fun i domain -> if not (Fit.check_domain domain settings.(i)) then invalid_arg ("CamlPaml.P14n.instantiate_tree: domain violation on variable " ^ (string_of_int i))) domains - - let tree = T.copy shape - for br = 0 to T.root tree - 1 do - T.put_branch tree br (Expr.eval exprs.(br) settings) - tree - - let instantiate_q exprs scale_expr domains settings = - Array.iteri (fun i domain -> if not (Fit.check_domain domain settings.(i)) then invalid_arg ("CamlPaml.P14n.instantiate_q: domain violation on variable " ^ (string_of_int i))) domains - - let scale = Expr.eval scale_expr settings - - if scale <= 0. then - failwith "CamlPaml.P14n.instantiate_q: Q scale evaluated to a non-positive value" - - let qm = exprs |> Array.map (Array.map (fun expr -> Expr.eval expr settings /. scale)) - - let q = Q.Diag.of_Q qm - - q - - let instantiate_qs p14ns scale_p14ns domains settings = - if Array.length p14ns <> Array.length scale_p14ns then invalid_arg ("CamlPaml.P14n.instantiate: different numbers of rate matrix and scale p14ns") - let previous = ref [] (* memoized results from previous branches...I'm assuming the number of independent rate matrix parameterizations to be sublinear in the size of the tree, otherwise this memoization is quadratic... *) - Array.init (Array.length p14ns) - fun br -> - try - let (_,_,q) = - find - function - | (q_p14n,scale_p14n,q) when q_p14n == p14ns.(br) && scale_p14n == scale_p14ns.(br) -> true - | _ -> false - !previous - q - with - | Not_found -> - let q = instantiate_q p14ns.(br) scale_p14ns.(br) domains settings - previous := (p14ns.(br),scale_p14ns.(br),q) :: !previous - q - - let instantiate ?prior p14n ~q_settings ~tree_settings = - let qms = instantiate_qs p14n.q_p14ns p14n.q_scale_p14ns p14n.q_domains q_settings - let tree = instantiate_tree p14n.tree_shape p14n.tree_p14n p14n.tree_domains tree_settings - { model = make ?prior tree qms; p14n = p14n; q_settings = Array.copy q_settings; tree_settings = Array.copy tree_settings } - - let update ?prior ?q_settings ?tree_settings inst = - let pms_changed = ref false - let newq = match q_settings with - | Some q_settings -> - pms_changed := true - instantiate_qs inst.p14n.q_p14ns inst.p14n.q_scale_p14ns inst.p14n.q_domains q_settings - | None -> inst.model.qms - let newtree = match tree_settings with - | Some tree_settings -> - pms_changed := true - instantiate_tree inst.p14n.tree_shape inst.p14n.tree_p14n inst.p14n.tree_domains tree_settings - | None -> inst.model.tree - let model = - if !pms_changed then make ?prior newtree newq - else { inst.model with prior = prior } - { inst with model = model; - q_settings = (match q_settings with Some set -> Array.copy set | None -> inst.q_settings); - tree_settings = (match tree_settings with Some set -> Array.copy set | None -> inst.tree_settings) } - - let model { model = model } = model - let p14n { p14n = p14n } = p14n - let q_settings { q_settings = q_settings } = Array.copy q_settings - let tree_settings { tree_settings = tree_settings } = Array.copy tree_settings - - diff --git a/lib/CamlPaml/PhyloModel.mli b/lib/CamlPaml/PhyloModel.mli deleted file mode 100644 index 7c184a3..0000000 --- a/lib/CamlPaml/PhyloModel.mli +++ /dev/null @@ -1,88 +0,0 @@ -(** unified representation for statistical phylogenetic models, in which the substitution process is a continuous-time Markov process on the phylogeny *) - -(** {1 Fully parameterized models} - -A 'fully parameterized' model has all of its parameters (each entry of the rate matrix, all branch lengths, etc.) specified as [float]s. -*) - -type t - -(** [make tree rate_matrices] creates a new model given the tree and rate matrices for each branch (except the branch leading to the root, i.e. [Array.length rate_matrices = T.size tree - 1]). - -For the common case of a homogeneous substitution process, there is just one {{:Q} Q matrix} shared throughout the tree. Each entry of [rate_matrices] can therefore just reference the same [Q.Diag.t] value, or, as a special case, you can pass an array of length 1. More generally, even when giving a full array, you would usually want fewer actual independent rate matrices. - -@param prior The prior distribution over characters at the root (common ancestor). Defaults to the equilibrium frequencies of [rate_matrices.(Array.length rate_matrices - 1)], the rate matrix on the branch leading to the right child of the root (raises [Invalid_argument] if it's not reversible) *) -val make : ?prior:(float array) -> T.t -> Q.Diag.t array -> t - -val tree : t -> T.t -val q : t -> int -> Q.Diag.t (** retrieve the {{:Q}Q matrix} for a specific branch *) -val p : t -> int -> P.matrix (** retrieve the {{:P}P matrix} for a specific branch *) -val prior : t -> float array - -(** Simulate evolution according to the model. First, a root character is chosen according to the prior. Then, character substitutions are performed down the tree from the root according to the substitution probabilities determined by the rate matrices and branch lengths. -@param root (optional) a specific character to place at the root; chosen from the prior if not specified. -@param a (optional) a preallocated array of length at least [T.size (tree model)], which will be overwritten and returned, to save memory allocation. -@return the assignment of characters to each node in the tree, in the order of the tree nodes (leaves first) -*) -val simulate : t -> (?root:int -> ?a:(int array) -> unit -> int array) - -(** Prepare likelihood calculations for the given configuration of extant characters (leaves). - -@param workspace (optional) a preallocated workspace for {{:PhyloLik}PhyloLik.prepare} - -@return {{:PhyloLik}PhyloLik.intermediate} values, from which additional information can be extracted. -*) -val prepare_lik : ?workspace:PhyloLik.workspace -> t -> PhyloLik.leaf array -> PhyloLik.intermediate - - -(** {1 Symbolic parameterizations} - -In symbolic parameterizations (p14ns), parameters are specified using symbolic variables. -*) - -module P14n : sig - type q_p14n = Expr.t array array (** a symbolic expression for each entry of the rate matrix *) - - (** p14n of a model *) - type model_p14n = { - q_p14ns : q_p14n array; (** the rate matrix parameterization for each branch of the tree. As with [make], the array can be length 1 to specify a homogeneous process (the same rate matrix on all branches). *) - q_scale_p14ns : Expr.t array; (** a positive scale factor, by which each entry of each rate matrix is divided. Again, can be length 1 for homogeneous processes. *) - q_domains : Fit.domain array; (** the domains of all the variables used in the rate matrix p14ns. For example, if [q_domains.(2) = Fit.Pos], then the domain of each occurrence of [(Expr.Var 2)] in the rate matrix p14ns is positive reals. *) - - tree_shape : T.t; (** the tree topology (branch length settings are ignored) *) - tree_p14n : Expr.t array; (** a symbolic expression for each branch length ([tree_exprs.(i)] specifies the length of the branch leading to node [i] from its parent) *) - tree_domains : Fit.domain array (** the domains of all the variables used in the branch length p14ns. Note, variables are NOT shared between rate matrix and tree p14ns. For example [(Expr.Var 3)] in [q_p14n] does not refer to the same variable as [(Expr.Var 3)] in [tree_p14n].*) - - } - - (** convenience function, sets each [Q.(i).(i)] to minus the sum of all [Q.(i).(j)] for [j <> i]. The resulting expression will have [O(n)] terms, so if you know a more compact way to compute this entry, it would be better to specify it explicitly.*) - val fill_q_diagonal : q_p14n -> unit - - (** in an instance of a p14n we have settings for the variables, thus determining a fully parameterized model *) - type instance - - (** instantiate the model by giving settings for all the variables in its p14n. If prior is not provided, it is determined as in [PhyloModel.make], above. *) - val instantiate : ?prior:(float array) -> model_p14n -> q_settings:(float array) -> tree_settings:(float array) -> instance - - val model : instance -> t - val p14n : instance -> model_p14n - val q_settings : instance -> float array - val tree_settings : instance -> float array - - (** return a copy of the instance with a subset of the settings replaced (possibly reusing computed information in the original instance that is not affected by the changed parameters) - - When [prior] is not provided, the prior distribution for the updated model - is determined as follows. If the prior of the provided instance (or any of - its 'ancestral' instances) had been explicitly set in [instantiate], the - updated model will have the same previously set prior. If the provided - instance's prior was instead determined based on rate matrix equilibrium - frequencies (i.e. no prior was provided to [instantiate]), the new - instance's prior will be determined based on the rate matrix equilibrium - frequencies in the new model; thus, if [q_settings] changes as a result of - the update, the prior may also change. - *) - val update : ?prior:(float array) -> ?q_settings:(float array) -> ?tree_settings:(float array) -> instance -> instance - - - - diff --git a/lib/CamlPaml/Q.ml b/lib/CamlPaml/Q.ml deleted file mode 100644 index b2c8f7e..0000000 --- a/lib/CamlPaml/Q.ml +++ /dev/null @@ -1,339 +0,0 @@ -open Printf - -type matrix = float array array - -let validate ?(tol=1e-6) q = - let n = Array.length q - - if n < 2 then invalid_arg "CamlPaml.Q.validate: trivial matrix" - - Array.iteri - fun i qi -> - if Array.length qi <> n then invalid_arg "CamlPaml.Q.validate: non-square matrix" - let rowsum = ref 0. - for j = 0 to n-1 do - if i <> j && qi.(j) < 0. then invalid_arg (sprintf "CamlPaml.Q.validate: Q[%d,%d] = %.2e < 0" i j qi.(j)) - rowsum := !rowsum +. qi.(j) - if abs_float !rowsum > tol then invalid_arg (sprintf "CamlPaml.Q.validate: sum(Q[%d,]) = %.2e != 0" i !rowsum) - q - -let check_real ?(tol=1e-6) ({ Complex.re = re; Complex.im = im } as z) = im = 0. || (abs_float im) *. 1000. < (Complex.norm z) || (abs_float re < tol && abs_float im < tol) - -let real_of_complex ?(tol=1e-6) z = - if not (check_real ~tol:tol z) then - failwith (sprintf "CamlPaml.Q.real_of_complex %g+%gi" z.Complex.re z.Complex.im) - z.Complex.re - -let m_of_cm cm = Gsl.Matrix.of_arrays (Array.map (Array.map real_of_complex) (Gsl.Matrix_complex.to_arrays cm)) - -let cm_of_m m = Gsl.Matrix_complex.of_arrays (Array.map (Array.map (fun re -> { Complex.re = re; im = 0. })) (Gsl.Matrix.to_arrays m)) - -let v_of_cv cv = Gsl.Vector.of_array (Array.map real_of_complex (Gsl.Vector_complex.to_array cv)) - -let gemm ?c a b = - let m,n = Gsl.Matrix.dims a - let n',p = Gsl.Matrix.dims b - if n <> n' then invalid_arg "CamlPaml.Q.gemm: incompatible dimensions" - let c = match c with - | Some c -> c - | None -> Gsl.Matrix.create m p - Gsl.Blas.gemm ~ta:Gsl.Blas.NoTrans ~tb:Gsl.Blas.NoTrans ~alpha:1. ~a:a ~b:b ~beta:0. ~c:c - c - -let zgemm ?c a b = - let m,n = Gsl.Matrix_complex.dims a - let n',p = Gsl.Matrix_complex.dims b - if n <> n' then invalid_arg "CamlPaml.Q.zgemm: incompatible dimensions" - let c = match c with - | Some c -> c - | None -> Gsl.Matrix_complex.create m p - Gsl.Blas.Complex.gemm ~ta:Gsl.Blas.NoTrans ~tb:Gsl.Blas.NoTrans ~alpha:Complex.one ~a:a ~b:b ~beta:Complex.zero ~c:c - c - -let diagm ?c d a = - let m = Gsl.Vector.length d - let (n,p) = Gsl.Matrix.dims a - if m <> n then invalid_arg "CamlPaml.Q.diagm: incompatible dimensions" - let c = match c with - | Some c -> c - | None -> Gsl.Matrix.create m p - - for i = 0 to m-1 do - let d_i = d.{i} - for j = 0 to p-1 do - Bigarray.Array2.unsafe_set c i j (Bigarray.Array2.unsafe_get a i j *. d_i) - - c - -let zdiagm ?c d a = - let m = Gsl.Vector_complex.length d - let (n,p) = Gsl.Matrix_complex.dims a - if m <> n then invalid_arg "CamlPaml.Q.diagm: incompatible dimensions" - let c = match c with - | Some c -> c - | None -> Gsl.Matrix_complex.create m p - - for i = 0 to m-1 do - let d_i = d.{i} - for j = 0 to p-1 do - Bigarray.Array2.unsafe_set c i j (Complex.mul (Bigarray.Array2.unsafe_get a i j) d_i) - - c - -let zinvm m = - let n,n' = Gsl.Matrix_complex.dims m - if n <> n' then invalid_arg "CamlPaml.Q.zinvm: non-square matrix" - let p = Gsl.Permut.make n - let lu = Gsl.Vectmat.cmat_convert (`CM (Gsl.Matrix_complex.copy m)) - ignore (Gsl.Linalg.complex_LU_decomp lu p) - let m' = Gsl.Vectmat.cmat_convert (`CM (Gsl.Matrix_complex.create n n)) - Gsl.Linalg.complex_LU_invert lu p m' - match m' with - | `CM x -> x - | _ -> assert false - -module Diag = struct - (* diagonalized Q = S*L*S' - These are real for reversible models, complex for non-reversible models. *) - type eig_r = { - r_s : Gsl.Matrix.matrix; (* S = right eigenvectors (in the columns) *) - r_s' : Gsl.Matrix.matrix; (* S' = left eigenvectors (in the rows) *) - r_l : Gsl.Vector.vector (* diag(L) = eigenvalues *) - } - type eig_nr = { - nr_s : Gsl.Matrix_complex.matrix; (* S = right eigenvectors (in the columns) *) - nr_s' : Gsl.Matrix_complex.matrix; (* S' = left eigenvectors (in the rows) *) - nr_l : Gsl.Vector_complex.vector; (* diag(L) = eigenvalues *) - } - type t = { - q : Gsl.Matrix.matrix; (* Q *) - eig : [`r of eig_r | `nr of eig_nr]; - pi : Gsl.Vector.vector; - mutable have_pi : bool; - - mutable memoized_to_Pt : (float -> Gsl.Matrix.matrix) option; - - mutable tol : float; - } - - let dim q = - let (n,n') = Gsl.Matrix.dims q.q - assert (n = n') - n - - let of_Q ?(tol=1e-6) ?(force_complex=false) qm = - let qm = Gsl.Matrix.of_arrays qm - let l, s = Gsl.Eigen.nonsymmv ~protect:true (`M qm) - let s' = zinvm s - - let rev = ref true - let n = Gsl.Vector_complex.length l - for i = 0 to n-1 do if not (check_real ~tol l.{i}) then rev := false - - let eig = - if !rev && not force_complex then - `r { r_s = m_of_cm s; r_s' = m_of_cm s'; r_l = v_of_cv l } - else - `nr { nr_s = s; nr_s' = s'; nr_l = l } - - { q = qm; eig; - pi = Gsl.Vector.create (fst (Gsl.Matrix.dims qm)); have_pi = false; - memoized_to_Pt = None; tol = tol } - - let to_Q q = Gsl.Matrix.to_arrays q.q - - let reversible = function - | { eig = `r _ } -> true - | { eig = `nr { nr_l }; tol } -> - let rev = ref true - let n = Gsl.Vector_complex.length nr_l - for i = 0 to n-1 do if not (check_real ~tol:tol nr_l.{i}) then rev := false - !rev - - let equilibrium q = - if not q.have_pi then - let eig = match q.eig with - | `r eig -> eig - | `nr { nr_s; nr_s'; nr_l } when reversible q -> { r_s = m_of_cm nr_s; r_s' = m_of_cm nr_s'; r_l = v_of_cv nr_l } - | _ -> failwith "CamlPaml.Q.equilibrium: non-reversible model" - let n = Gsl.Vector.length eig.r_l - let min_L = ref infinity - let min_Lp = ref (-1) - for i = 0 to n-1 do - let mag_i = abs_float eig.r_l.{i} - if mag_i < !min_L then - min_L := mag_i - min_Lp := i - assert (!min_Lp >= 0) - if (abs_float !min_L) > q.tol then - failwith (sprintf "CamlPaml.Q.equilibrium: smallest-magnitude eigenvalue %e is unacceptably large; check rate matrix validity or increase tol" !min_L) - let lev = Gsl.Matrix.row eig.r_s' !min_Lp - let mass = ref 0. - for i = 0 to n-1 do - mass := !mass +. lev.{i} - for i = 0 to n-1 do - q.pi.{i} <- lev.{i} /. !mass - q.have_pi <- true - Gsl.Vector.to_array q.pi - - (** normalize to unity mean rate of replacement - let normalize ?tol q = - let n = Gsl.Vector_complex.length q.l - let pi = equilibrium ?tol q - let tot = ref 0. - for i = 0 to n-1 do - tot := !tot +. (-1.) *. pi.(i) *. q.q.{i,i} - let nq = Gsl.Matrix.copy q.q - Gsl.Matrix.scale q.q (1. /. !tot) - let nl = Gsl.Vector_complex.copy q.l - for i = 0 to n-1 do - nl.{i} <- Complex.div nl.{i} { Complex.re = !tot; im = 0. } - { q with q = nq; l = nl } *) - - let scale q x = - if x <= 0. then invalid_arg "CamlPaml.Q.scale: nonpositive scale factor" - let xq = Gsl.Matrix.copy q.q - Gsl.Matrix.scale xq x - let xeig = match q.eig with - | `r { r_s; r_s'; r_l } -> - let xl = Gsl.Vector.copy r_l - for i = 0 to (Gsl.Vector.length xl) - 1 do - xl.{i} <- xl.{i} *. x - `r { r_s; r_s'; r_l = xl } - | `nr { nr_s; nr_s'; nr_l } -> - let xl = Gsl.Vector_complex.copy nr_l - let cx = { Complex.re = x; im = 0. } - for i = 0 to (Gsl.Vector_complex.length xl) - 1 do - xl.{i} <- Complex.mul xl.{i} cx - `nr { nr_s; nr_s'; nr_l = xl } - { q with q = xq; eig = xeig; memoized_to_Pt = None } - - let real_to_Pt q t = - if t < 0. then invalid_arg "CamlPaml.Q.to_Pt" - let sm = match q.eig with - | `r { r_s; r_s'; r_l } -> - let expLt = Gsl.Vector.copy r_l - for i = 0 to Gsl.Vector.length expLt - 1 do - expLt.{i} <- exp (t *. expLt.{i}) - gemm r_s (diagm expLt r_s') - | `nr { nr_s; nr_s'; nr_l } -> - let ct = { Complex.re = t; im = 0. } - let expLt = Gsl.Vector_complex.copy nr_l - for i = 0 to Gsl.Vector_complex.length expLt - 1 do - expLt.{i} <- Complex.exp (Complex.mul ct expLt.{i}) - m_of_cm (zgemm nr_s (zdiagm expLt nr_s')) - - let n,_ = Gsl.Matrix.dims sm - for i = 0 to n-1 do - let tot = ref 0. - let smii = ref 1. - - for j = 0 to n-1 do - tot := !tot +. sm.{i,j} - - if sm.{i,j} < 0. then - if abs_float sm.{i,j} > q.tol then - failwith (sprintf "CamlPaml.Q.substition_matrix: expm(%.2e*Q)[%d,%d] = %e < 0" t i j sm.{i,j}) - else - sm.{i,j} <- 0. - - if i <> j then - smii := !smii -. sm.{i,j} - - if abs_float (!tot -. 1.) > q.tol then - failwith (sprintf "CamlPaml.Q.substitution matrix: sum(expm(%.2e*Q)[%d,] = %e > 1" t i !tot) - assert (!smii <= 1. && !smii > 0.) - - sm.{i,i} <- !smii - - sm - - let rec to_Pt q t = - match q.memoized_to_Pt with - | Some f -> f t - | None -> - q.memoized_to_Pt <- Some (Tools.weakly_memoize (real_to_Pt q)) - to_Pt q t - - let to_Pt_gc q = q.memoized_to_Pt <- None - - let dPt_dt ~q ~t = match q.eig with - | `r _ -> failwith "not implemented" - | `nr { nr_s; nr_s'; nr_l } -> - let n,_ = Gsl.Matrix.dims q.q - let (( * ),(+),(/)) = Complex.mul, Complex.add, Complex.div - let exp= Complex.exp - let s, l, s' = nr_s, nr_l, nr_s' - let ct = { Complex.re = t; Complex.im = 0. } - Array.init n - fun a -> - Array.init n - fun b -> - let x = ref Complex.zero - for c = 0 to n-1 do - x := !x + (s.{a,c} * l.{c} * (exp (l.{c} * ct)) * s'.{c,b}) - real_of_complex !x - - (* TODO in richly parameterized models, dQ_dx is likely to be sparse. *) - let dPt_dQ_dx ~q ~t ~dQ_dx = match q.eig with - | `r _ -> failwith "not implemented" - | `nr { nr_s; nr_s'; nr_l } -> - let n,_ = Gsl.Matrix.dims q.q - let dQt_dx = cm_of_m (Gsl.Matrix.of_arrays dQ_dx) - - if Gsl.Matrix_complex.dims dQt_dx <> Gsl.Matrix.dims q.q then - invalid_arg "CamlPaml.Q.dP_dx: wrong dimension of dQ_dx" - - let ct = { Complex.re = t; Complex.im = 0. } - let exp = Complex.exp - let (( * ),(-),(/)) = Complex.mul, Complex.sub, Complex.div - - (* combos 1,3 or 2 (alone) -- 1,3 matches P&S? *) - Gsl.Matrix_complex.scale dQt_dx ct (* 1 *) - - let f = Gsl.Matrix_complex.create n n - for i = 0 to pred n do - for j = 0 to pred n do - if nr_l.{i} = nr_l.{j} then - f.{i,j} <- exp (nr_l.{i} * ct) (* * ct *) (* 2 *) - else - f.{i,j} <- (exp (nr_l.{i} * ct) - exp (nr_l.{j} * ct)) / ((nr_l.{i} - nr_l.{j}) * ct (* 3 *)) - - (* ehh not being too gentle with the allocator/GC here *) - Gsl.Matrix_complex.mul_elements f (zgemm nr_s' (zgemm dQt_dx nr_s)) - Gsl.Matrix.to_arrays (m_of_cm (zgemm nr_s (zgemm f nr_s'))) - -let logm (m:Gsl.Matrix.matrix) = - let n,n' = Gsl.Matrix.dims m - if n <> n' then invalid_arg "CamlPaml.Q.logm: non-square matrix" - let l, s = Gsl.Eigen.nonsymmv ~protect:true (`M m) - let s' = zinvm s - for i = 0 to n-1 do - l.{i} <- Complex.log l.{i} - - m_of_cm (zgemm s (zdiagm l s')) - -(* Correction of a square matrix with zero row-sums but potentially negative off-diagonal entries into a valid rate matrix. As suggested by Israel, Rosenthal & Wei (2001) *) -let irw2001 rawq = - let n,n' = Gsl.Matrix.dims rawq - assert (n = n') - for i = 0 to n-1 do - let g_i = ref (abs_float rawq.{i,i}) - let b_i = ref 0. - for j = 0 to n-1 do - if i <> j then - if rawq.{i,j} >= 0. then - g_i := !g_i +. rawq.{i,j} - else - b_i := !b_i -. rawq.{i,j} - for j = 0 to n-1 do - let rawqij = rawq.{i,j} - if i <> j && rawqij < 0. then - rawq.{i,j} <- 0. - else if !g_i > 0. then - rawq.{i,j} <- rawqij -. !b_i *. (abs_float rawqij) /. !g_i - rawq - -let of_P ?tol m = - P.validate ?tol m - Gsl.Matrix.to_arrays (irw2001 (logm m)) diff --git a/lib/CamlPaml/Q.mli b/lib/CamlPaml/Q.mli deleted file mode 100644 index 4274228..0000000 --- a/lib/CamlPaml/Q.mli +++ /dev/null @@ -1,62 +0,0 @@ -(** rate matrices for continuous-time Markov models (Q matrices) *) - -type matrix = float array array - -(** validate that the given array is a square matrix in which all off-diagonal entries are -nonnegative and rows sum to 0. -@raise Invalid_argument if not -*) - -val validate : ?tol:float -> matrix -> unit - -(** diagonalized representation of a rate matrix, from which various useful information can be -extracted *) -module Diag : sig - type t - - (** Diagonalize the rate matrix. The rate matrix needs not be reversible (the internal - representation can use complex arithmetic). - - @param force_complex force internal use of complex arithmetic, even if the rate matrix - is reversible. *) - val of_Q : ?tol:float -> ?force_complex:bool -> matrix -> t - val to_Q : t -> matrix - - (** return [n] for an [n-by-n] matrix *) - val dim : t -> int - - (** determine if the rate matrix is reversible (<=> the eigenvalues are real) *) - val reversible : t -> bool - - (** for reversible matrices, compute the equilibrium frequencies. The behavior is undefined if - the rate matrix is not reversible. *) - val equilibrium : t -> float array - - (** multiply all the rates by a positive scale factor *) - val scale : t -> float -> t - - (** compute the substitution matrix for running the Markov process for time [t] ([=exp(Qt)]). - The implementation uses "weak memoization" to cache the results for specific values of [t], - memory/GC allowing. *) - val to_Pt : t -> float -> P.matrix - - (** compute the derivative of each entry of [exp(Qt)] with respect to [t]. *) - val dPt_dt : q:t -> t:float -> float array array - - (** compute the derivative of each entry of [exp(Qt)] with respect to some parameter [x] - @param dQ_dx the derivative of each entry of [Q] with respect to [x] - *) - val dPt_dQ_dx : q:t -> t:float -> dQ_dx:(float array array) -> float array array - - (** clear the cached values of P(t). This is a hack needed to marshal a [Q.Diag.t] (eliminates - closures from the data structure) *) - val to_Pt_gc : t -> unit - -(** Given a {{:P}P matrix} [P], compute a rate matrix [Q] such that [exp(Q)] is approximately equal -to [P]. - -This procedure first computes the matrix logarithm [log(P)], which may or may not be a valid rate -matrix. The matrix log is then adjusted to ensure that a valid rate matrix [Q] results, using a -method suggested by Israel, Rosenthal & Wei (2001). This is why [exp(Q)] is only {e approximately} -equal to [P]. Note that, in any case, the resulting [Q] matrix is {e not} necessarily reversible. *) -val of_P : ?tol:float -> P.matrix -> matrix diff --git a/lib/CamlPaml/T.ml b/lib/CamlPaml/T.ml deleted file mode 100644 index d17bf6c..0000000 --- a/lib/CamlPaml/T.ml +++ /dev/null @@ -1,128 +0,0 @@ -open List - -type t = { - labels : string array; - parents : int array; - children : (int*int) array; - siblings : int array; - branches : float array -} - -let infer_siblings parents children = - let n = Array.length parents - Array.init n - fun i -> - if i < (n-1) then - let p = parents.(i) - assert (p >= 0 && p < n) - let (l,r) = children.(p) - if l == i then - r - else if r == i then - l - else - assert false - else - (-1) - -let copy t = { t with labels = Array.copy t.labels; branches = Array.copy t.branches } -let size t = Array.length t.parents -let root t = (size t)-1 -let leaves t = ((size t) + 1)/2 -let is_leaf t i = i >= 0 && i < leaves t -let parent t i = if i < 0 || i >= root t then invalid_arg "CamlPaml.T.parent" else t.parents.(i) -let children t i = if i < leaves t || i > root t then invalid_arg "CamlPaml.T.children" else t.children.(i) -let sibling t i = if i < 0 || i >= root t then invalid_arg "CamlPaml.T.sibling" else t.siblings.(i) -let branch t i = t.branches.(i) -let put_branch t i b = t.branches.(i) <- b -let label t i = t.labels.(i) -let put_label t i tag = t.labels.(i) <- tag - -exception False -let congruent ?(tol=1e-6) ~labels ~branches t1 t2 = - if (size t1 <> size t2) then - false - else - try - for i = 0 to size t1 - 1 do - if i < root t1 && parent t1 i <> parent t2 i then raise False - assert (i = root t1 || sibling t1 i = sibling t2 i) - assert (i < leaves t1 || children t1 i = children t2 i) - if labels && label t1 i <> label t2 i then raise False - if branches && abs_float (branch t1 i -. branch t2 i) > tol then raise False - true - with - | False -> false - -let of_newick ?(default_branch=nan) nt = - let bitch () = invalid_arg "CamlPaml.T.of_newick: input is not a rooted, bifurcating tree" - let n = Newick.size nt - if n < 3 || (n mod 2 = 0) then bitch () - - let labels = Array.make n "" - let parents = Array.make n (-1) - let children = Array.make n (-1,-1) - let branches = Array.make n default_branch - - - let rec find_leaves = function - | (Newick.Node ([],_,_)) as leaf -> [leaf] - | Newick.Node (l :: r :: [],lbl,bl) -> find_leaves l @ find_leaves r - | _ -> bitch () - let leaves = Array.of_list (find_leaves nt) - let nl = Array.length leaves - assert (nl = (n+1)/2) - - let which_leaf leaf = - let j = ref 0 - try - while not (leaves.(!j) == leaf) do - incr j - with - | Invalid_argument _ -> assert false - !j - - let fresh_i = - let i = ref (nl-1) - fun () -> - incr i - !i - - let rec fill = function - | (Newick.Node ([],lbl,bl)) as leaf -> - let i = which_leaf leaf - labels.(i) <- lbl - branches.(i) <- match bl with Some x -> x | None -> default_branch - i - | Newick.Node (l :: r :: [],lbl,bl) -> - let lc = fill l - let rc = fill r - let i = fresh_i () - labels.(i) <- lbl - branches.(i) <- match bl with Some x -> x | None -> default_branch - parents.(lc) <- i - parents.(rc) <- i - children.(i) <- (lc,rc) - i - | _ -> bitch () - - let root = fill nt - assert (root = n-1) - - { labels = labels; parents = parents; branches = branches; children = children; siblings = infer_siblings parents children } - -let to_newick ?(branches=false) t = - let branch i = - if branches then - match classify_float t.branches.(i) with - | FP_infinite | FP_nan -> None - | _ -> Some t.branches.(i) - else - None - let rec cons i = - if is_leaf t i then - Newick.Node ([],t.labels.(i),branch i) - else - let l,r = t.children.(i) - Newick.Node ([cons l; cons r],t.labels.(i),branch i) - cons (root t) diff --git a/lib/CamlPaml/T.mli b/lib/CamlPaml/T.mli deleted file mode 100644 index f98f37e..0000000 --- a/lib/CamlPaml/T.mli +++ /dev/null @@ -1,40 +0,0 @@ -(** array-based representation of rooted bifurcating phylogenetic trees - -For a tree with [n] leaves, the [2n-1] nodes are indexed such that iterating [0] to [2n-2] performs a botom-up traversal of the tree; indices [0] through [n-1] are the leaves and index [2n-2] is the root. By iterating in order, when you visit node [i] you are guaranteed to have visited its children already. Conversely, by iterating in reverse order, when you visit a node, you have already visited its parent. The data structure can be imported from or exported to a rooted {{:Newick}Newick} tree.*) - -type t - -val copy : t -> t -val size : t -> int (** total number of nodes in the tree (incl. internal nodes *) - -val leaves : t -> int (** number of leaves *) -val is_leaf : t -> int -> bool (** is node [i] a leaf? (equivalent to [i < (leaves t)]) *) -val root : t -> int (** index of the root ([= 2*(leaves t)-2 = (size t)-1])*) - -(** parent of the given node -@raise Invalid_argument if the root is given *) -val parent : t -> int -> int - -(** returns the "left" and "right" child of the internal node -@raise Invalid_argument if the specified node is a leaf *) -val children : t -> int -> int*int - -(** return the other child of the parent of the given node. -@raise Invalid_argument if the root is given -*) -val sibling : t -> int -> int - -val branch : t -> int -> float (** branch length*) -val put_branch : t -> int -> float -> unit - -val label : t -> int -> string -val put_label : t -> int -> string -> unit - -(** -@param branch_tol Greatest allowable difference between branch lengths. Default 0, and can be set to infinity to ignore branch lengths. -*) -val congruent : ?tol:float -> labels:bool -> branches:bool -> t -> t -> bool - -(** The conversion will only succeed for rooted, bifurcating Newick trees.*) -val of_newick : ?default_branch:float -> Newick.t -> t -val to_newick : ?branches:bool -> t -> Newick.t diff --git a/lib/CamlPaml/Tools.ml b/lib/CamlPaml/Tools.ml deleted file mode 100644 index 3177d80..0000000 --- a/lib/CamlPaml/Tools.ml +++ /dev/null @@ -1,42 +0,0 @@ -open Printf -open List - -let weakly_memoize f = - let tbl = Hashtbl.create 32 - fun x -> - try - match Weak.get (Hashtbl.find tbl x) 0 with - | None -> - Hashtbl.remove tbl x - raise Not_found - | Some y -> y - with - | Not_found -> - let y = f x - let box = Weak.create 1 - Weak.set box 0 (Some y) - Hashtbl.replace tbl x box - Gc.finalise (fun _ -> Hashtbl.remove tbl x) y - y - -let random_chooser ?checksum weights = - let n = Array.length weights - let cum = Array.copy weights - for i = 1 to n-1 do - cum.(i) <- cum.(i-1) +. cum.(i) - let z = cum.(n-1) - match checksum with - | Some (sum,tol) when abs_float (z -. sum) > tol -> invalid_arg (sprintf "random_chooser checksum |%f - %f| > %f" z sum tol) - | _ -> () - (* binary search for i s.t. cum.(i-1) < x <= cum.(i) *) - let rec bs x lo hi = - assert (lo <= hi) - let mid = (lo+hi)/2 - if x > cum.(mid) then - bs x (mid+1) hi - else if (mid = 0 || x > cum.(mid-1)) then - mid - else - bs x lo (mid-1) - fun () -> bs (Random.float z) 0 n - diff --git a/lib/CamlPaml/_tags b/lib/CamlPaml/_tags deleted file mode 100644 index bd02507..0000000 --- a/lib/CamlPaml/_tags +++ /dev/null @@ -1,7 +0,0 @@ -<**/*.ml> or <**/*.mli>: ocaml, debug, package(gsl), pp(ocaml+twt) -<**/NewickLexer.*>: -pp(ocaml+twt) -<**/NewickParser.*>: -pp(ocaml+twt) -<**/*.cmx>: for-pack(CamlPaml) -: -for-pack(CamlPaml) -: package(oUnit) -: package(gsl), package(oUnit) diff --git a/lib/CamlPaml/test.ml b/lib/CamlPaml/test.ml deleted file mode 100644 index 69dcfc5..0000000 --- a/lib/CamlPaml/test.ml +++ /dev/null @@ -1,105 +0,0 @@ -open OUnit -open Printf - -let fs = sprintf "%.4f" - -let assert_equal_vector ?msg ?epsilon = assert_equal ~cmp:(fun ar1 ar2 -> List.for_all (fun (x,y) -> cmp_float ?epsilon x y) (List.combine (Array.to_list ar1) (Array.to_list ar2))) ~printer:(fun ar -> String.concat " " (Array.to_list (Array.map fs ar))) ?msg - -module TestInfer = struct - let nt = NewickParser.parse NewickLexer.token (Lexing.from_string "(A,(B,C))") - let t = T.of_newick nt - - let sm0 = Gsl.Matrix.of_arrays [| [| 0.8; 0.2; |]; [| 0.25; 0.75 |] |] - let sm1 = Gsl.Matrix.of_arrays [| [| 0.9; 0.1; |]; [| 0.85; 0.15 |] |] - let sms = [| sm0; sm1; sm1; sm1 |] - let prior = [| 0.6; 0.4 |] - - let ( + ) = ( +. ) - let ( * ) = ( *. ) - let ( / ) = ( /. ) - - let case lvs () = - let alf i = [| if lvs.(i) = 0 then 1. else 0.; if lvs.(i) = 1 then 1. else 0. |] - let a0 = alf 0 - let a1 = alf 1 - let a2 = alf 2 - let a3 = [| (sm1.{0,0} * a1.(0) + sm1.{0,1} * a1.(1)) * (sm1.{0,0} * a2.(0) + sm1.{0,1} * a2.(1)); - (sm1.{1,0} * a1.(0) + sm1.{1,1} * a1.(1)) * (sm1.{1,0} * a2.(0) + sm1.{1,1} * a2.(1)) |] - let a4 = [| (sm0.{0,0} * a0.(0) + sm0.{0,1} * a0.(1)) * (sm1.{0,0} * a3.(0) + sm1.{0,1} * a3.(1)); - (sm0.{1,0} * a0.(0) + sm0.{1,1} * a0.(1)) * (sm1.{1,0} * a3.(0) + sm1.{1,1} * a3.(1)) |] - let z = prior.(0) * a4.(0) + prior.(1) * a4.(1) - - let inter = PhyloLik.prepare t sms prior (Array.map (fun x -> `Certain x) lvs) - assert_equal ~cmp:(cmp_float ~epsilon:0.001) ~printer:fs ~msg:"likelihood" z (PhyloLik.likelihood inter) - - let b4 = prior - let b3 = [| (b4.(0) * sm0.{0,0} * a0.(0) + b4.(0) * sm0.{0,1} * a0.(1)) * sm1.{0,0} + - (b4.(1) * sm0.{1,0} * a0.(0) + b4.(1) * sm0.{1,1} * a0.(1)) * sm1.{1,0}; - (b4.(0) * sm0.{0,0} * a0.(0) + b4.(0) * sm0.{0,1} * a0.(1)) * sm1.{0,1} + - (b4.(1) * sm0.{1,0} * a0.(0) + b4.(1) * sm0.{1,1} * a0.(1)) * sm1.{1,1} - |] - - assert_equal_vector ~msg:"posterior(root)" ~epsilon:0.001 [| b4.(0) * a4.(0) / z; b4.(1) * a4.(1) / z |] (PhyloLik.node_posterior inter 4) - assert_equal_vector ~msg:"posterior(internal)" ~epsilon:0.001 [| b3.(0) * a3.(0) / z; b3.(1) * a3.(1) / z |] (PhyloLik.node_posterior inter 3) - - - let tests = "PhyloLik" >::: [ "000" >:: case [| 0; 0; 0 |]; - "001" >:: case [| 0; 0; 1 |]; - "010" >:: case [| 0; 1; 0 |]; - "011" >:: case [| 0; 1; 1 |]; - "100" >:: case [| 1; 0; 0 |]; - "101" >:: case [| 1; 0; 1 |]; - "110" >:: case [| 1; 1; 0 |]; - "111" >:: case [| 1; 1; 1 |]; - ] - -module BeagleTests = struct - (* ports of examples found in the BEAGLE source: http://code.google.com/p/beagle-lib/source/browse/ *) - - module TinyTest = struct - let human = "AGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTACTAGGACTATGAGAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTATACCCTTCCCGTACTAAGAAATTTAGGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTG-CAATACTTAATTTCTGTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTCTAGACCAATGGGACTTAAACCCACAAACACTTAGTTAACAGCTAAGCACCCTAATCAAC-TGGCTTCAATCTAAAGCCCCGGCAGG-TTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAA-TCACCTCGGAGCTTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCA-CTCAGCCATTTTACCACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGGCCTCCATGACTTTTTCAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCT-AAATCCTATATATCTTA-CACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAGAGAACCAACACCTCTTTACAGTGA" - let chimp = "AGAAATATGTCTGATAAAAGAATTACTTTGATAGAGTAAATAATAGGAGTTCAAATCCCCTTATTTCTACTAGGACTATAAGAATCGAACTCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTACACCCTTCCCGTACTAAGAAATTTAGGTTAAGCACAGACCAAGAGCCTTCAAAGCCCTCAGCAAGTTA-CAATACTTAATTTCTGTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTCTAGATTAATGGGACTTAAACCCACAAACATTTAGTTAACAGCTAAACACCCTAATCAAC-TGGCTTCAATCTAAAGCCCCGGCAGG-TTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAA-TCACCTCAGAGCTTGGTAAAAAGAGGCTTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCA-CTCAGCCATTTTACCACAAAAAAGGAAGGAATCGAACCCCCTAAAGCTGGTTTCAAGCCAACCCCATGACCTCCATGACTTTTTCAAAAGATATTAGAAAAACTATTTCATAACTTTGTCAAAGTTAAATTACAGGTT-AACCCCCGTATATCTTA-CACTGTAAAGCTAACCTAGCATTAACCTTTTAAGTTAAAGATTAAGAGGACCGACACCTCTTTACAGTGA" - let gorilla = "AGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGAGGTTTAAACCCCCTTATTTCTACTAGGACTATGAGAATTGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTGTCACACCCCATCCTAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTCACATCCTTCCCGTACTAAGAAATTTAGGTTAAACATAGACCAAGAGCCTTCAAAGCCCTTAGTAAGTTA-CAACACTTAATTTCTGTAAGGACTGCAAAACCCTACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTCTAGATCAATGGGACTCAAACCCACAAACATTTAGTTAACAGCTAAACACCCTAGTCAAC-TGGCTTCAATCTAAAGCCCCGGCAGG-TTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAT-TCACCTCGGAGCTTGGTAAAAAGAGGCCCAGCCTCTGTCTTTAGATTTACAGTCCAATGCCTTA-CTCAGCCATTTTACCACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGACCTTCATGACTTTTTCAAAAGATATTAGAAAAACTATTTCATAACTTTGTCAAGGTTAAATTACGGGTT-AAACCCCGTATATCTTA-CACTGTAAAGCTAACCTAGCGTTAACCTTTTAAGTTAAAGATTAAGAGTATCGGCACCTCTTTGCAGTGA" - let t = T.of_newick (NewickParser.parse NewickLexer.token (Lexing.from_string "((human:0.1,chimp:0.1):0.1,gorilla:0.2);")) - let q = - Q.Diag.scale - Q.Diag.of_Q [| [| (-3.); 1.; 1.; 1.; |]; - [| 1.; (-3.); 1.; 1.; |]; - [| 1.; 1.; (-3.); 1.; |]; - [| 1.; 1.; 1.; (-3.); |] |] - (1. /. 3.) - - let qdiagtests = "Q.Diag" >::: [TestCase (fun () -> assert_bool "Q.Diag.reversible" (Q.Diag.reversible q)); - TestCase (fun () -> assert_equal_vector ~msg:"Q.Diag.equilibrium" (Q.Diag.equilibrium q) [| 0.25; 0.25; 0.25; 0.25 |])] - - let likelihood which_q () = - let m = PhyloModel.make t [| which_q |] - let ll = ref 0. - for i = 0 to String.length human - 1 do - let lf = Array.map (fun ch -> if Code.DNA.is ch then `Certain (Code.DNA.index ch) else `Marginalize) [| human.[i]; chimp.[i]; gorilla.[i] |] - ll := !ll +. log (PhyloLik.likelihood (PhyloModel.prepare_lik m lf)) - assert_equal ~cmp:(cmp_float ~epsilon:0.001) ~printer:string_of_float ~msg:"mismatch" (-1574.63623) !ll - - let qc = - Q.Diag.scale - Q.Diag.of_Q ~force_complex:true [| - [| (-3.); 1.; 1.; 1.; |]; - [| 1.; (-3.); 1.; 1.; |]; - [| 1.; 1.; (-3.); 1.; |]; - [| 1.; 1.; 1.; (-3.); |] - |] - (1. /. 3.) - - let qcdiagtests = "Q.Diag (complex)" >::: [ - TestCase (fun () -> assert_bool "Q.Diag.reversible" (Q.Diag.reversible qc)); - TestCase (fun () -> assert_equal_vector ~msg:"Q.Diag.equilibrium" (Q.Diag.equilibrium qc) [| 0.25; 0.25; 0.25; 0.25 |]) - ] - - let tests = "TinyTest" >::: [ qdiagtests; "likelihood" >:: likelihood q; - qcdiagtests; "likelihood (complex)" >:: likelihood qc ] - - let tests = "BeagleTest" >::: [ TinyTest.tests ] - -let all_tests = TestList [TestInfer.tests; BeagleTests.tests] - -ignore (run_test_tt_main all_tests) diff --git a/src/ECM.ml b/src/ECM.ml deleted file mode 100644 index ed43383..0000000 --- a/src/ECM.ml +++ /dev/null @@ -1,72 +0,0 @@ -(* -Reads empirical codon model (ECM) parameters in the format provided in the supplemental material of: - -Kosiol C, Holmes I and Goldman N. An Empirical Codon Model for Protein Sequence Evolution. Mol. Biol. Evol. 2007 24(7):1464-1479; doi:10.1093/molbev/msm064 - -However, note that Kosiol et al. presented a 61x61 model while PhyloCSF uses a 64x64 model (including stop codons) -*) - -open Batteries -open Printf -open CamlPaml -open Expr - -module PM = PhyloModel -module Codon = Code.Codon64 - -let re_sp = Str.regexp " " -let import_parameters fn_ecm = - let lines = Array.of_enum (File.lines_of fn_ecm) - let raw_sij = - Array.map - fun line -> - Array.of_list - List.map Option.get - List.map - fun s -> - let s = String.trim s - if s <> "" then Some (float_of_string s) else None - Str.split re_sp line - Array.sub lines 0 (Codon.dim - 1) - let sij = - Array.init Codon.dim - fun i -> - Array.init Codon.dim - fun j -> - if i = 0 && j = 0 then - 0. - else if i > j then - raw_sij.(i-1).(j) - else if i < j then - raw_sij.(j-1).(i) - else - 0. - - if String.trim lines.(Codon.dim - 1) <> "" then failwith "ECM.import_parameters" - - let ecm_freqs = - Array.of_list - List.map Option.get - List.map - fun s -> - let s = String.trim s - if s <> "" then Some (float_of_string s) else None - Str.split re_sp lines.(Codon.dim) - - let codons = - Array.of_list - List.map Option.get - List.map - fun s -> - let s = String.trim s - if s <> "" then - assert (String.length s = 3) - Some s - else - None - List.flatten (List.map (fun i -> Str.split re_sp lines.(i)) (List.map ((+) Codon.dim) [3; 4; 5; 6])) - - if Array.length codons <> Codon.dim then failwith "ECM.import_parameters: incorrect codon order" - codons |> Array.iteri (fun i s -> if Codon.index (s.[0],s.[1],s.[2]) <> i then failwith "ECM.import_parameters: incorrect codon order") - - sij, ecm_freqs diff --git a/src/ForkNo.ml b/src/ForkNo.ml deleted file mode 100644 index 4aa2d1e..0000000 --- a/src/ForkNo.ml +++ /dev/null @@ -1,3 +0,0 @@ -let can_fork = false - -let map ?procs f lst = List.map f lst diff --git a/src/ForkYes.ml b/src/ForkYes.ml deleted file mode 100644 index e6d645e..0000000 --- a/src/ForkYes.ml +++ /dev/null @@ -1,8 +0,0 @@ -open Batteries - -let can_fork = true - -let map ?(procs=1) f lst = - if procs=1 || List.length lst = 1 then List.map f lst - else - ForkWork.map_list ~maxprocs:procs f lst diff --git a/src/Makefile b/src/Makefile deleted file mode 100644 index 7ab37f8..0000000 --- a/src/Makefile +++ /dev/null @@ -1,25 +0,0 @@ -OCAMLBUILDFLAGS= -ifdef FORKWORK -OCAMLBUILDFLAGS=-tag "package(forkwork)" -endif - -all: - rm -f ForkMaybe.ml -ifdef FORKWORK - ln -s ForkYes.ml ForkMaybe.ml -else - ln -s ForkNo.ml ForkMaybe.ml -endif - ocamlbuild -use-ocamlfind $(OCAMLBUILDFLAGS) PhyloCSF.native - -test: testexe - ./test.native -verbose - -testexe: all - ocamlbuild -use-ocamlfind $(OCAMLBUILDFLAGS) testSim.native test.native - -clean: - rm -f *~ - ocamlbuild -clean - -.PHONY: all test testexe clean diff --git a/src/OmegaModel.ml b/src/OmegaModel.ml deleted file mode 100644 index 71646e5..0000000 --- a/src/OmegaModel.ml +++ /dev/null @@ -1,219 +0,0 @@ -(** omega (dN/dS) test, similar to using PAML to test for omega<1, but with a few of our own touches *) - -open Batteries -open Printf - -open CamlPaml -open Expr - -module PM = PhyloModel -module Codon = Code.Codon64 - -(* -rate matrix variables: -0 = kappa, transition/transversion factor -1 = omega, dN/dS ratio -2 = sigma, stop codon frequency factor -3,4,5 freq of A, G. and C relative to freq of T in codon position 1 -6,7,8 " in codon position 2 -9,10,11 " in codon position 3 -*) -let kappa = Var 0 -let omega = Var 1 -let sigma = Var 2 -let pi_exprs = - let sc (n1,n2,n3) = - let i1 = Code.DNA.index n1 - let i2 = Code.DNA.index n2 - let i3 = Code.DNA.index n3 - - let f1 = Div ((if i1=3 then Val 1.0 else (Var (3+i1))), - (Add(Var 3,(Add(Var 4,(Add(Var 5,Val 1.0))))))) - let f2 = Div ((if i2=3 then Val 1.0 else (Var (6+i2))), - (Add(Var 6,(Add(Var 7,(Add(Var 8,Val 1.0))))))) - let f3 = Div ((if i3=3 then Val 1.0 else (Var (9+i3))), - (Add(Var 9,(Add(Var 10,(Add(Var 11,Val 1.0))))))) - Mul (f1,Mul(f2,f3)) - let denom = Sub(Val 1.0, - Mul(Sub(Val 1.0, sigma), - Add(sc ('T','A','A'),Add(sc ('T','A','G'),sc ('T','G','A'))))) - Array.init Codon.dim (fun i -> Div (sc (Codon.of_index i),denom)) - -let q_p14n = - let sq = - Array.init Codon.dim - fun i -> - let aai = Codon.translate_index i - let ((i1,i2,i3) as iii) = Codon.of_index i - Array.init Codon.dim - fun j -> - let open List - let ((j1,j2,j3) as jjj) = Codon.of_index j - let diffs = filter (fun (a,b) -> a <> b) [(i1,j1); (i2,j2); (i3,j3)] - - if length diffs = 1 then - let aaj = Codon.translate_index j - let transition = match hd diffs with - | 'A','G' - | 'G','A' - | 'C','T' - | 'T','C' -> true - | _ -> false - - let kappa_part = if transition then kappa else Val 1. - let omega_part = - if not (Codon.is_stop iii || Codon.is_stop jjj) && aai <> aaj then - omega - else - Val 1. - - simplify (Mul (pi_exprs.(j),Mul(kappa_part,omega_part))) - else - Val 0. - PM.P14n.fill_q_diagonal sq - sq - -let q_scale = - let factor = ref (Val 0.) - for i = 0 to Codon.dim - 1 do - factor := Sub (!factor,Mul(pi_exprs.(i),q_p14n.(i).(i))) - simplify !factor - -(* Construct branch length parameterizations (all branches scaled by a variable scale factor) *) -let make_tree_p14n tree_shape = - Array.init (T.size tree_shape - 1) (fun br -> Mul (Var 0,Val (T.branch tree_shape br))) - -(* Complete parameterization for the model *) -let make_p14n tree_shape = - { PM.P14n.q_p14ns = [| q_p14n |]; - q_scale_p14ns = [| q_scale |]; - q_domains = Array.make 12 Fit.NonNeg; - tree_shape = T.copy tree_shape; - tree_p14n = make_tree_p14n tree_shape; - tree_domains = [| Fit.Pos |]; } - -let new_instance ?(kappa=1.0) ?(omega=1.0) ?(sigma=1.0) ?(tree_scale=1.0) tree_shape = - let p14n = make_p14n tree_shape - let q_settings = Array.concat [ [| kappa; omega; sigma |]; (Array.make 9 1.0) ] - let tree_settings = [| tree_scale |] - PM.P14n.instantiate p14n ~q_settings:q_settings ~tree_settings:tree_settings - -(* update the rate matrix f3x4 parameters based on the alignment leaves*) -let update_f3x4 inst leaves = - let counts = Array.init 3 (fun _ -> Array.make 4 1) - leaves |> Array.iter - fun lv -> - lv |> Array.iter - function - | `Certain which_codon -> - let n1,n2,n3 = Codon.of_index which_codon - let inc a b = counts.(a).(b) <- counts.(a).(b) + 1 - inc 0 (Code.DNA.index n1) - inc 1 (Code.DNA.index n2) - inc 2 (Code.DNA.index n3) - | _ -> () - let qs = PM.P14n.q_settings inst - - (* - TODO: Pond et al. Correcting the Bias of Empirical Frequency Parameter Estimators in Codon - Models. PLoS One 5:e11230 (2010). - *) - - qs.(3) <- float counts.(0).(0) /. float counts.(0).(3) - qs.(4) <- float counts.(0).(1) /. float counts.(0).(3) - qs.(5) <- float counts.(0).(2) /. float counts.(0).(3) - - qs.(6) <- float counts.(1).(0) /. float counts.(1).(3) - qs.(7) <- float counts.(1).(1) /. float counts.(1).(3) - qs.(8) <- float counts.(1).(2) /. float counts.(1).(3) - - qs.(9) <- float counts.(2).(0) /. float counts.(2).(3) - qs.(10) <- float counts.(2).(1) /. float counts.(2).(3) - qs.(11) <- float counts.(2).(2) /. float counts.(2).(3) - - PM.P14n.update ~q_settings:qs inst - -(* Calculate log-probability of the alignment *) -let lpr_leaves inst leaves = - let workspace = PhyloLik.new_workspace (PM.tree (PM.P14n.model inst)) Codon.dim - let lik = ref 0. - leaves |> Array.iter - fun lvs -> - let lvslik = PhyloLik.likelihood (PM.prepare_lik ~workspace:workspace (PM.P14n.model inst) lvs) - lik := !lik +. log lvslik - !lik - -(* a little bit of regularization: half-cauchy prior distributions for rho and kappa *) -let pi = acos (-1.0) -let cauchy_cdf scale x = atan (x /. scale) /. pi +. 0.5 -let half_cauchy_lpdf ?(mode=0.0) ~scale x = - if x < 0.0 || scale <= 0.0 || mode < 0.0 then invalid_arg "half_cauchy_lpdf" - let numer = 1.0 /. (pi *. scale *. (1.0 +. ((x -. mode) /. scale) ** 2.0)) - let denom = 1.0 -. cauchy_cdf scale (0.0 -. mode) - assert (denom > 0.0) - log numer -. log denom - -let lpr_rho = half_cauchy_lpdf ~mode:1.0 ~scale:0.5 (* rho = tree_scale (as in manuscript) *) -let lpr_kappa k = log (Gsl.Randist.gamma_pdf ~a:7.0 ~b:0.25 (k -. 1.0 +. epsilon_float)) - -(* find MAP estimates of kappa & rho *) -let kr_map leaves inst = - let f_rho inst rho = - let ts = PM.P14n.tree_settings inst - ts.(0) <- rho - let inst_rho = PM.P14n.update ~tree_settings:ts inst - (lpr_rho rho +. lpr_leaves inst_rho leaves), inst_rho - let f_kappa inst kappa = - let qs = PM.P14n.q_settings inst - qs.(0) <- kappa - let inst_kappa = PM.P14n.update ~q_settings:qs inst - (lpr_kappa kappa +. lpr_leaves inst_kappa leaves), inst_kappa - let round inst = - let _, (_, inst_rho) = - PhyloCSFModel.maximize_lpr - ~init:(PM.P14n.tree_settings inst).(0) - ~lo:0.001 - ~hi:10. - ~accuracy:0.01 - f_rho inst - fst - let _, (lpr, inst_kappa) = - PhyloCSFModel.maximize_lpr - ~init:(PM.P14n.q_settings inst).(0) - ~lo:1.0 - ~hi:10. - ~accuracy:0.01 - f_kappa inst_rho - fst - inst_kappa, lpr - (* 3 rounds, cyclic coordinate ascent *) - round (fst (round (fst (round inst)))) - -let sf = sprintf "%.2f" -let db x = sprintf "%.2f" (10. *. x /. log 10.) - -let score ?(omega_H1=0.2) ?(sigma_H1=0.01) tree_shape leaves = - (* H0: omega=1, sigma=1, MLE(kappa), MLE(rho) *) - let inst0, lpr_H0 = kr_map leaves (update_f3x4 (new_instance ~kappa:2.5 tree_shape) leaves) - let qs0 = PM.P14n.q_settings inst0 - let ts0 = PM.P14n.tree_settings inst0 - - (* H1: omega=0.2, sigma=0.01, MLE(kappa), MLE(rho) *) - let inst1, lpr_H1 = - let qs = PM.P14n.q_settings inst0 - qs.(1) <- omega_H1 - qs.(2) <- sigma_H1 - kr_map leaves (PM.P14n.update ~q_settings:qs inst0) - let qs1 = PM.P14n.q_settings inst1 - let ts1 = PM.P14n.tree_settings inst1 - - let diag = ["L(H0)", (db lpr_H0); - "rho_H0", (sf ts0.(0)); "kappa_H0", (sf qs0.(0)); - "omega_H0", (sf qs0.(1)); "sigma_H0", (sf qs0.(2)); - "L(H1)", (db lpr_H1); - "rho_H1", (sf ts1.(0)); "kappa_H1", (sf qs1.(0)); - "omega_H1", (sf qs1.(1)); "sigma_H1", (sf qs1.(2)) ] - - { PhyloCSFModel.score = (10. *. (lpr_H1 -. lpr_H0) /. log 10.); - anc_comp_score = nan; - diagnostics = diag } diff --git a/src/PhyloCSF.ml b/src/PhyloCSF.ml deleted file mode 100644 index b8d4270..0000000 --- a/src/PhyloCSF.ml +++ /dev/null @@ -1,491 +0,0 @@ -(* Wish list: PHYLIP alignment format *) - -open Batteries -open Extlib.OptParse -open Printf -open CamlPaml - -Gsl.Error.init () - -module SMap = Map.Make(struct type t = string let compare = compare end) -module SSet = Set.Make(struct type t = string let compare = compare end) -module Codon = CamlPaml.Code.Codon64 -type strategy = PhyloCSF of [`MaxLik | `FixedLik] | OmegaTest | Nop -type reading_frame = One | Three | Six -type orf_mode = AsIs | ATGStop | StopStop | StopStop3 | ToFirstStop | FromLastStop | ToOrFromStop - -let opt_parser = OptParser.make ~usage:"%prog parameter_set [file1 file2 ...]\ninput will be read from stdin if no filenames are given." () -let opt ?group ?h ?hide ?s ?short_names ?l ?long_names x = OptParser.add opt_parser ?group ?help:h ?hide ?short_name:s ?long_name:l x; x - -let strategy = (opt ~l:"strategy" ~h:"evaluation strategy (default mle)" - (Opt.value_option "mle|fixed|omega" (Some (PhyloCSF `MaxLik)) - (fun s -> - match String.lowercase s with - | "mle" -> PhyloCSF `MaxLik - | "fixed" -> PhyloCSF `FixedLik - | "omega" -> OmegaTest - | "nop" -> Nop - | x -> invalid_arg x) - (fun _ s -> sprintf "invalid strategy %s" s))) - -let group = OptParser.add_group opt_parser "input interpretation" -let filenames = opt ~group ~l:"files" ~h:"input list(s) of alignment filenames instead of individual alignment(s)" (StdOpt.store_true ()) -let remove_ref_gaps = opt ~group ~l:"removeRefGaps" ~h:"automatically remove any alignment columns that are gapped in the reference sequence (nucleotide columns are removed individually; be careful about reading frame). By default, it is an error for the reference sequence to contain gaps" (StdOpt.store_true ()) -let allow_ref_gaps = opt ~hide:true ~group ~l:"allowRefGaps" ~h:"allow the reference sequence to contain gaps (each group of three nucleotide columns in the consensus alignment is treated as a codon site; be careful about reading frame)" (StdOpt.store_true ()) -let desired_species = opt ~group ~l:"species" ~h:"hint that only this subset of species will be used in any of the alignments; this does not change the calculation mathematically, but can speed it up" (StdOpt.str_option ~metavar:"Species1,Species2,..." ()) - -let group = OptParser.add_group opt_parser "searching mulitple reading frames and ORFs" -let reading_frame = opt ~group ~l:"frames" ~s:'f' ~h:"how many reading frames to search (default 1)" (Opt.value_option "1|3|6" (Some One) (function "1" -> One | "3" -> Three | "6" -> Six | x -> invalid_arg x) (fun _ s -> sprintf "invalid reading frame %s" s)) -let orf_mode = opt ~group ~l:"orf" ~h:"search for ORFs (default AsIs)" (Opt.value_option "AsIs|ATGStop|StopStop|StopStop3|ToFirstStop|FromLastStop|ToOrFromStop" (Some AsIs) (fun s -> match String.lowercase s with "asis" -> AsIs | "atgstop" -> ATGStop | "stopstop" -> StopStop | "stopstop3" -> StopStop3 | "tofirststop" -> ToFirstStop | "fromlaststop" -> FromLastStop | "toorfromstop" -> ToOrFromStop| x -> invalid_arg x) (fun _ s -> sprintf "invalid ORF search mode %s"s)) -let min_codons = opt ~group ~l:"minCodons" ~h:"minimum ORF length for searching over ORFs (default 25 codons)" (StdOpt.int_option ~default:25 ()) -let print_orfs = opt ~group ~l:"allScores" ~h:"report scores of all regions evaluated, not just the max" (StdOpt.store_true ()) -let procs = opt ~group ~s:'p' ~h:"search frames/ORFs using up to p parallel subprocesses" (StdOpt.int_option ~default: 1 ()) - -let group = OptParser.add_group opt_parser "output control" -let print_bls = opt ~group ~l:"bls" ~h:"include alignment branch length score (BLS) for the reported region in output" (StdOpt.store_true ()) -let print_anc_comp_score = opt ~group ~l:"ancComp" ~h:"include ancestral sequence composition score in output" (StdOpt.store_true ()) -let print_dna = opt ~group ~l:"dna" ~h:"include DNA sequence in output, the part of the reference (first) sequence whose score is reported" (StdOpt.store_true ()) -let print_aa = opt ~group ~l:"aa" ~h:"include amino acid translation in output" (StdOpt.store_true ()) -let debug = opt ~l:"debug" ~group ~h:"print extra information about parameters and errors" (StdOpt.store_true ()) - -let cmd = OptParser.parse_argv opt_parser - -if List.length cmd < 1 then - OptParser.usage opt_parser () - exit (-1) - -let paramset = List.hd cmd -let fns_input = List.tl cmd - -if Opt.get orf_mode <> AsIs && Opt.get allow_ref_gaps then - eprintf "--allowRefGaps should not be used with --orf\n" - OptParser.usage opt_parser () - exit (-1) - -if Opt.get orf_mode <> AsIs && Opt.get reading_frame = One then - eprintf "Warning: --orf with --frames=1; are you sure you don't want to search for ORFs in three or six frames?\n" - flush stderr - -if Opt.get procs > 1 && not ForkMaybe.can_fork then - eprintf "Warning: ignoring -p, recompile PhyloCSF with: make FORKWORK=1\n" - flush stderr - -(* -if Opt.get procs > 1 && Opt.get orf_mode = AsIs && Opt.get reading_frame = One then - eprintf "Warning: -p isn't useful without --orf and/or --frames\n" - flush stderr -*) - -if Opt.get debug then Printexc.record_backtrace true - -(******************************************************************************) - -let input_mfa lines = - try - let rec seq sofar = - let buf = match sofar with ((_,buf) :: _) -> buf | _ -> assert false - if not (Enum.is_empty lines) then - let line = String.trim (Option.get (peek lines)) - if String.length line = 0 then - seq sofar - else if line.[0] <> '>' then - Buffer.add_string buf line - junk lines - seq sofar - else - hdr sofar - else - let enum = List.rev sofar |> Array.of_list - let species = Array.map fst enum - let seqs = Array.map (fun (_,buf) -> Buffer.contents buf) enum - let seqlen = String.length seqs.(0) - if seqlen = 0 || exists ((=) "") (Array.enum species) || exists (fun s -> String.length s <> seqlen) (Array.enum seqs) then - failwith "empty species name or sequence, or sequence length mismatch" - species, seqs - and hdr sofar = - let line = Option.get (get lines) - if String.length line = 0 then - hdr sofar - else if line.[0] <> '>' then - failwith "bad header" - else - let hdr = String.lchop line - let sp = String.trim (try String.left hdr (String.index hdr '|') with Not_found -> hdr) - seq ((sp,Buffer.create 256) :: sofar) - hdr [] - with - | Failure msg -> failwith ("invalid MFA alignment: " ^ msg) - | exn -> failwith ("invalid MFA alignment: " ^ (Printexc.to_string exn)) - -(******************************************************************************) - -let maybe_remove_ref_gaps (species,aln) = - if Opt.get remove_ref_gaps then - let bufs = Array.map (fun _ -> Buffer.create 256) aln - let refseq = aln.(0) - for j = 0 to String.length refseq - 1 do - if refseq.[j] <> '-' then - for i = 0 to Array.length aln - 1 do - Buffer.add_char bufs.(i) aln.(i).[j] - species, (Array.map Buffer.contents bufs) - else - species, aln - -let find_orfs ?(ofs=0) dna = - let atg = Opt.get orf_mode = ATGStop - let codon pos = Char.uppercase dna.[pos], Char.uppercase dna.[pos+1], Char.uppercase dna.[pos+2] - let is_start pos = match codon pos with 'A','T','G' -> true | _ -> false - let is_stop pos = match codon pos with 'T','A','A' | 'T','A','G' | 'T','G','A' -> true | _ -> false - - let len = String.length dna - let orfs = ref [] - let starts = ref [] - - for codon_lo = ofs to len-3 do - if (codon_lo-ofs) mod 3 = 0 then - let codon_hi = codon_lo+2 - if (not atg && !starts = [] && not (is_stop codon_lo)) || (atg && is_start codon_lo) then starts := codon_lo :: !starts - if codon_hi+3 < len && is_stop (codon_hi+1) then - !starts |> List.iter - fun start -> - if codon_hi>start+2 then - assert ((start-ofs) mod 3 = 0) - assert ((codon_hi-start+1) mod 3 = 0) - orfs := (start,codon_hi) :: !orfs - starts := [] - - if not atg then - (* add stuff that goes off the end of the alignment *) - !starts |> List.iter - fun start -> - let rem = len-start - orfs := (start,start+(rem/3)*3-1) :: !orfs - - if Opt.get orf_mode = StopStop3 then - (* look at shorter sub-ORFs of each stop-stop ORF *) - let all_suborfs = - !orfs |> List.map - fun (lo,hi) -> - let suborfs = ref [lo,hi] - let codons = (hi-lo+1)/3 - let lo2 = lo+(codons/3)*3 - if lo2 > lo then suborfs := (lo2,hi) :: !suborfs - let lo3 = lo+(2*codons/3)*3 - if lo3 > lo2 && lo3 > lo then suborfs := (lo3,hi) :: !suborfs - !suborfs - orfs := List.flatten all_suborfs - - if Opt.get orf_mode = ToFirstStop && !orfs <> [] then - let ((firstorflo,_) as firstorf) = List.hd (List.rev !orfs) - orfs := if firstorflo = ofs then [firstorf] else [] - - if Opt.get orf_mode = FromLastStop && !orfs <> [] then - let ((_,lastorfhi) as lastorf) = List.hd !orfs - orfs := if len - lastorfhi <= 3 then [lastorf] else [] - - if Opt.get orf_mode = ToOrFromStop && !orfs <> [] then - let ((firstorflo,_) as firstorf) = List.hd (List.rev !orfs) - let ((_,lastorfhi) as lastorf) = List.hd !orfs - orfs := if firstorflo = ofs then [firstorf] else [] - orfs := if len - lastorfhi <= 3 && firstorf <> lastorf then lastorf :: !orfs else !orfs - - !orfs |> List.rev |> List.filter - fun (lo,hi) -> - assert ((hi-lo+1) mod 3 = 0) - assert ((lo-ofs) mod 3 = 0) - (hi-lo+1)/3 >= Opt.get min_codons - -let candidate_regions dna rcdna = - if Opt.get orf_mode = AsIs then - let hi = String.length dna - 1 - [ [false,0,hi]; - (if Opt.get reading_frame <> One then - [ (false,1,hi); (false,2,hi) ] else []); - (if Opt.get reading_frame = Six then - [ (true,0,hi); (true,1,hi); (true,2,hi) ] else []) ] |> List.flatten - else - let aoeu a = List.map (fun (b,c) -> a,b,c) - let all_orfs = ref [aoeu false (find_orfs ~ofs:0 dna)] - if Opt.get reading_frame <> One then - all_orfs := aoeu false (find_orfs ~ofs:1 dna) :: !all_orfs - all_orfs := aoeu false (find_orfs ~ofs:2 dna) :: !all_orfs - if Opt.get reading_frame = Six then - let rcdna = Code.DNA.revcomp dna - all_orfs := aoeu true (find_orfs ~ofs:0 rcdna) :: !all_orfs - all_orfs := aoeu true (find_orfs ~ofs:1 rcdna) :: !all_orfs - all_orfs := aoeu true (find_orfs ~ofs:2 rcdna) :: !all_orfs - List.rev !all_orfs |> List.flatten - -let pleaves ?(lo=0) ?hi t leaf_ord aln = - let hi = match hi with Some x -> x | None -> String.length aln.(0) - 1 - - (* construct enumeration of leaf probability vectors *) - let rec enum starting_pos = - let pos = ref starting_pos - let next () = - if !pos+2 > hi then raise Enum.No_more_elements - let lvs = - Array.init (T.leaves t) - fun t_row -> - match leaf_ord.(t_row) with - | None -> `Marginalize - | Some aln_row -> - let n1 = aln.(aln_row).[!pos] - let n2 = aln.(aln_row).[!pos+1] - let n3 = aln.(aln_row).[!pos+2] - let codon = n1, n2, n3 - if not (Codon.is codon) then - `Marginalize - else - `Certain (Codon.index codon) - pos := !pos + 3 - lvs - let count () = (hi - !pos + 1)/3 - let clone () = enum !pos - Enum.make ~next:next ~count:count ~clone:clone - enum lo - -(******************************************************************************) - -(* based on the Newick tree, compute the average branch length score for each alignment column in -the interval [lo,hi] *) -let bls nt aln which_row lo hi = - assert (hi >= lo) - let pres = function '-' | '.' | 'N' -> false | _ -> true - let bl_total = ref 0. - for i = lo to hi do - let subtree = - Newick.subtree - fun sp -> try pres aln.(SMap.find sp which_row).[i] with Not_found -> false - nt - bl_total := !bl_total +. Option.map_default Newick.total_length 0. subtree - !bl_total /. (Newick.total_length nt *. float (hi-lo+1)) - -(******************************************************************************) - -let u2t = function 'u' -> 't' | 'U' -> 'T' | x -> x -let fn2id fn = if fn = "" then "(STDIN)" else fn -let translate dna = - let aalen = String.length dna / 3 - let pp = String.create aalen - for i = 0 to aalen - 1 do - let codon = dna.[3*i], dna.[3*i+1], dna.[3*i+2] - if Codon.is codon then - let aa = Codon.translate codon - pp.[i] <- aa - else - pp.[i] <- '?' - pp - -let process_alignment (nt,t,evaluator) fn = - try - (* load alignment from file *) - let lines = if fn = "" then IO.lines_of stdin else File.lines_of fn - let (species,aln) = maybe_remove_ref_gaps (input_mfa lines) - let aln = Array.map (String.map u2t) aln - - (* sanity checks *) - if not (Opt.get allow_ref_gaps) && aln.(0) |> String.enum |> exists ((=) '-') then - failwith "the reference sequence (first alignment row) must be ungapped" - let rc_aln = Array.map Code.DNA.revcomp aln (* will check that everything is valid nucleotide or gap. *) - - (* determine how the alignment rows correspond to the tree leaves *) - let t_species = (0 -- (T.leaves t - 1)) /@ T.label t |> fold (fun set sp -> SSet.add sp set) SSet.empty - let aln_species = Array.fold_right SSet.add species SSet.empty - let wtf = SSet.diff aln_species t_species - if SSet.cardinal wtf > 0 then failwith ("parameters not available for species: " ^ (String.join " " (SSet.elements wtf))) - let which_row = Array.fold_lefti (fun m i sp -> SMap.add sp i m) SMap.empty species - let leaf_ord = Array.init (T.leaves t) (fun i -> try Some (SMap.find (T.label t i) which_row) with Not_found -> None) - - (* generate list of candidate regions within the alignment *) - let rgns = candidate_regions aln.(0) rc_aln.(0) - - let rgns = - if Opt.get procs > 1 && ForkMaybe.can_fork then - (* If parallelizing, sort regions longest-to-shortest - in order to optimize utilization *) - List.sort (fun (_,lo1,hi1) (_,lo2,hi2) -> (hi2-lo2) - (hi1-lo1)) rgns - else rgns - - try - if rgns = [] then - assert (Opt.get orf_mode <> AsIs) - failwith "no sufficiently long ORFs found" - - (* evaluate each candidate region, perhaps in parallel *) - let rgns_scores = - rgns |> ForkMaybe.map ~procs:(Opt.get procs) - fun (rc,lo,hi) -> - try - let aln_leaves = Array.of_enum (pleaves ~lo:lo ~hi:hi t leaf_ord (if rc then rc_aln else aln)) - let rslt = evaluator aln_leaves - `Res (rslt,rc,lo,hi) - with - | exn -> - (* problem evaluating an individual region within the - alignment: register complaint, but don't die, as - maybe some other region will succeed. *) - let msg = - sprintf "%s\texception\t%d\t%d%s\t%s" - fn2id fn - lo - hi - if Opt.get reading_frame = Six then (if rc then "\t-" else "\t+") else "" - Printexc.to_string exn - if Opt.get debug then - `Exn [| msg; Printexc.get_backtrace () |] - else - `Exn [| msg |] - - let rgns_scores = - rgns_scores |> List.filter_map - function - | `Res x -> Some x - | `Exn [| msg |] -> print_endline msg; flush stdout; None - | `Exn [| msg; bt |] -> - print_endline msg; flush stdout - prerr_endline bt; flush stderr - None - | _ -> assert false - - if rgns_scores = [] then failwith "no regions successfully evaluated" - - let report_score ty (rslt,rc,lo,hi) = - printf "%s\t%s\t%.4f" (fn2id fn) ty rslt.PhyloCSFModel.score - if Opt.get reading_frame <> One || Opt.get orf_mode <> AsIs then - printf "\t%d\t%d" lo hi - if Opt.get reading_frame = Six then - printf "\t%c" (if rc then '-' else '+') - if Opt.get print_bls then - let rgn_bls = bls nt (if rc then rc_aln else aln) which_row lo hi - printf "\t%.4f" rgn_bls - if Opt.get print_anc_comp_score then - printf "\t%.4f" rslt.PhyloCSFModel.anc_comp_score - let refdna = String.sub (if rc then rc_aln.(0) else aln.(0)) lo (hi-lo+1) - if Opt.get print_dna then - printf "\t%s" refdna - if Opt.get print_aa then - printf "\t%s" (translate refdna) - if Opt.get debug then - printf "\t#" - foreach (List.enum rslt.PhyloCSFModel.diagnostics) (fun (k,v) -> printf " %s=%s" k v) - printf "\n" - - if Opt.get print_orfs then - rgns_scores |> List.iter (report_score "orf_score(decibans)") - List.reduce max rgns_scores |> report_score (if Opt.get orf_mode <> AsIs || Opt.get reading_frame <> One then "max_score(decibans)" else "score(decibans)") - with - | ((Assert_failure _) as exn) -> raise exn - (* move on to the next alignment: convergence problems, no ORFs found, etc. *) - | exn -> printf "%s\tfailure\t%s\n" (fn2id fn) (Printexc.to_string exn) - with (* stop everything: file not found, improperly formatted alignment, etc. *) - | exn -> - printf "%s\tabort\t%s\n" (fn2id fn) (Printexc.to_string exn) - if Opt.get debug then - flush stdout - eprintf "%s" (Printexc.get_backtrace ()) - flush stderr - exit (-1) - flush stdout - -(******************************************************************************) - -(* parse a keyvalue\n file format *) -let parse_kv lines = - let f kv line = - let line = String.strip line - if String.length line = 0 || line.[0] = '#' then - kv - else - try - let (k,v) = String.split line "\t" - Map.add k v kv - with Not_found -> Map.add line "" kv - fold f Map.empty lines - -let initialize_strategy () = - let paramfile ?(required=true) suffix = - let fn = - if (try ignore (String.index paramset '/'); false with Not_found -> true) then - try - let base = Sys.getenv "PHYLOCSF_BASE" - if not (Sys.file_exists base && Sys.is_directory base) then - raise Not_found - Filename.concat (Filename.concat base "PhyloCSF_Parameters") (paramset ^ suffix) - with - | _ -> failwith "PHYLOCSF_BASE environment variable must be set to the root directory of the source or executable distribution" - else - (* paramset is a relative or absolute path *) - paramset ^ suffix - if required && not (Sys.file_exists fn) then failwith (sprintf "could not find required parameter file %s" fn) - fn - - let fn_tree = paramfile ".nh" - let nt = File.with_file_in fn_tree (fun input -> NewickParser.parse NewickLexer.token (Lexing.from_input input)) - - let desired_species = if Opt.is_set desired_species then String.nsplit (Opt.get desired_species) "," |> List.fold_left (flip SSet.add) SSet.empty else SSet.empty - let snt = - if desired_species = SSet.empty then - nt - else - match Newick.subtree (flip SSet.mem desired_species) nt with - | Some snt when Newick.leaves snt > 1 -> snt - | _ -> failwith "specify at least two available --species" - - let t = T.of_newick snt - - let evaluator = - match Opt.get strategy with - | PhyloCSF substrategy -> - let fn_ecm_c = paramfile "_coding.ECM" - let fn_ecm_nc = paramfile "_noncoding.ECM" - - let s1, pi1 = ECM.import_parameters fn_ecm_c - let s2, pi2 = ECM.import_parameters fn_ecm_nc - let model = PhyloCSFModel.make s1 pi1 s2 pi2 t - - fun leaves -> - PhyloCSFModel.score - match substrategy with `MaxLik -> PhyloCSFModel.MaxLik | `FixedLik -> PhyloCSFModel.FixedLik - model - leaves - | OmegaTest -> - let fn_config = paramfile ~required:false "_omega" - - let omega_H1, sigma_H1 = - if Sys.file_exists fn_config then - try - let kv = parse_kv (File.lines_of fn_config) - Some (float_of_string (Map.find "omega_H1" kv)), Some (float_of_string (Map.find "sigma_H1" kv)) - with - | exn -> failwith (sprintf "configuration file %s exists but does not specify valid omega_H1 and sigma_H1 values" fn_config) - else - None, None - - fun leaves -> (OmegaModel.score ?omega_H1 ?sigma_H1 t leaves) - | Nop -> fun leaves -> { PhyloCSFModel.score = 0.0; anc_comp_score = 0.0; diagnostics = [] } - snt, t, evaluator - -let main () = - let strategy = initialize_strategy () - - let fns_alignments = - if Opt.get filenames then - if fns_input = [] then - if Unix.isatty Unix.stdin then - printf "Input alignment filename(s) then EOF (Ctrl+D): " - flush stdout - IO.lines_of stdin - else - (List.enum fns_input) /@ File.lines_of |> Enum.concat - else if fns_input = [] then - if Unix.isatty Unix.stdin then - printf "Input alignment then EOF (Ctrl+D):\n" - flush stdout - Enum.singleton "" - else - List.enum fns_input - - foreach fns_alignments (process_alignment strategy) - -main () diff --git a/src/PhyloCSFModel.ml b/src/PhyloCSFModel.ml deleted file mode 100644 index f33a7de..0000000 --- a/src/PhyloCSFModel.ml +++ /dev/null @@ -1,148 +0,0 @@ -open Batteries -open Printf -open CamlPaml -open CamlPaml.Expr - -module PM = CamlPaml.PhyloModel -module Codon = CamlPaml.Code.Codon64 - -(* Construct rate matrix parameterization from symmetric exchangeability matrix s*) -let pivar i = Var i -let make_q_p14n s = - let sq = - Array.init Codon.dim - fun i -> - let si = s.(i) - Array.init Codon.dim - fun j -> - if i = j then - Val 0. - else - Mul (Val si.(j),pivar j) (* q[i,j] = s[i,j] * pi[j] *) - PM.P14n.fill_q_diagonal sq - sq -let qscale sq = - let factor = ref (Val 0.) - for i = 0 to Codon.dim - 1 do - let sqii = sq.(i).(i) - if sqii <> Val 0. then - factor := Sub (!factor,Mul(pivar i,sq.(i).(i))) - simplify !factor - -(* Construct branch length parameterizations (all branches scaled by a variable scale factor) *) -let make_tree_p14n tree_shape = Array.init (T.size tree_shape - 1) (fun br -> Mul (Var 0,Val (T.branch tree_shape br))) - -(* Complete parameterization for either of the codon models (coding or non-coding *) -let make_p14n s tree_shape = - let tree_exprs = make_tree_p14n tree_shape - let q_exprs = make_q_p14n s - - { PM.P14n.q_p14ns = [| q_exprs |]; q_scale_p14ns = [| qscale q_exprs |]; q_domains = [||]; - tree_shape = (T.copy tree_shape); tree_p14n = tree_exprs; tree_domains = [|Fit.Pos|] } - -(* dot product... *) -let dot v1 v2 = - if (Array.length v1 <> Array.length v2) then invalid_arg "dot" - let tot = ref 0. - for i = 0 to Array.length v1 - 1 do - tot := !tot +. v1.(i) *. v2.(i) - !tot - -(* Instantiate a codon model *) -let new_instance ?(tree_scale=1.) s pi tree_shape = - let p14n = make_p14n s tree_shape - let q_settings = Array.copy pi - let tree_settings = [| tree_scale |] - PM.P14n.instantiate p14n ~prior:pi ~q_settings:q_settings ~tree_settings:tree_settings - -type lpr_leaves = { - lpr_leaves : float; - elpr_anc : float; - inst : PM.P14n.instance -} - -(* Calculate log-probability of the alignment - Simultaneously, calculate expected log-probability of the ancestral sequence -*) -let lpr_leaves inst leaves t = - let ts = PM.P14n.tree_settings inst - ts.(0) <- t - let inst = PM.P14n.update ~tree_settings:ts inst - let workspace = PhyloLik.new_workspace (PM.tree (PM.P14n.model inst)) Codon.dim - let lpr = ref 0. - - let anc_lprior = Array.map log (PM.prior (PM.P14n.model inst)) - let elpr_anc = ref 0. - leaves |> Array.iter - fun lvs -> - let info = PM.prepare_lik ~workspace:workspace (PM.P14n.model inst) lvs - lpr := !lpr +. log (PhyloLik.likelihood info) - let pr_root = PhyloLik.node_posterior info (T.root (PM.tree (PM.P14n.model inst))) - elpr_anc := !elpr_anc +. dot pr_root anc_lprior - { lpr_leaves = !lpr; elpr_anc = !elpr_anc; inst } - -let maximize_lpr ?(init=1.) ?(lo=1e-2) ?(hi=10.) ?(accuracy=0.01) f g = - let good_init = Fit.find_init ~maxtries:250 ~logspace:true ~init:init ~lo:lo ~hi:hi ~f:(fun x -> g (f x)) () - if lo < good_init && good_init < hi then - let maximizer = Fit.make_maximizer ~f:(fun x -> g (f x)) ~lo:lo ~hi:hi ~init:good_init - - let go = ref true - while !go do - maximizer#iterate () - let x = maximizer#maximum () - let lb,ub = maximizer#interval () - go := ((ub -. lb) /. x) > accuracy - - let x = maximizer#maximum () - x, f x - else - good_init, f good_init - -(* Complete PhyloCSF model, with coding and non-coding ECMs *) -type model = { - coding_model : PM.P14n.instance; - noncoding_model : PM.P14n.instance; -} - -let make s1 pi1 s2 pi2 tree_shape = - let coding_model = new_instance s1 pi1 tree_shape - let noncoding_model = new_instance s2 pi2 tree_shape - { coding_model = coding_model; noncoding_model = noncoding_model } - -let sf = sprintf "%.2f" -let db x = (10. *. x /. log 10.) -let dbs x = sprintf "%.2f" (db x) - -type score = { - score : float; - anc_comp_score : float; - diagnostics: (string*string) list; -} - -let llr_FixedLik t model leaves = - let { lpr_leaves = lpr_c; elpr_anc = elpr_anc_c } = lpr_leaves model.coding_model leaves t - let { lpr_leaves = lpr_n; elpr_anc = elpr_anc_n} = lpr_leaves model.noncoding_model leaves t - let diag = ["rho",(sf t); "L(C)",(dbs lpr_c);"L(NC)",(dbs lpr_n)] - { score = db (lpr_c -. lpr_n); - anc_comp_score = db (elpr_anc_c -. elpr_anc_n); - diagnostics = diag } - -let llr_MaxLik ?init model leaves = - let rho_c, { lpr_leaves = lpr_c; elpr_anc = elpr_anc_c } = maximize_lpr ?init (lpr_leaves model.coding_model leaves) (fun { lpr_leaves } -> lpr_leaves) - let rho_n, { lpr_leaves = lpr_n; elpr_anc = elpr_anc_n } = maximize_lpr ?init (lpr_leaves model.noncoding_model leaves) (fun { lpr_leaves } -> lpr_leaves) - let diag = (match init with Some w0 -> ["rho_0", (sf w0)] | None -> []) @ [ "rho_C",(sf rho_c); "rho_N", (sf rho_n); "L(C)", (dbs lpr_c); "L(NC)", (dbs lpr_n)] - { score = db (lpr_c -. lpr_n); - anc_comp_score = db (elpr_anc_c -. elpr_anc_n); - diagnostics = diag } - -type strategy = - | FixedLik - | MaxLik - -let score strategy model leaves = - let compute_score = match strategy with - | FixedLik -> llr_FixedLik 1. - | MaxLik -> llr_MaxLik ~init:1. - compute_score model leaves - - diff --git a/src/_tags b/src/_tags deleted file mode 100644 index f0b6757..0000000 --- a/src/_tags +++ /dev/null @@ -1,4 +0,0 @@ -<**/*.ml> or <**/*.mli>: pp(ocaml+twt) - or : package(should), package(oUnit), package(str) -true: debug, package(batteries), package(CamlPaml) - diff --git a/src/test.ml b/src/test.ml deleted file mode 100644 index d5b744b..0000000 --- a/src/test.ml +++ /dev/null @@ -1,107 +0,0 @@ -open Batteries -open Printf -open OUnit -open Should - -let dn_here = Filename.dirname Sys.argv.(0) - -let fn_PhyloCSF = Filename.concat dn_here "PhyloCSF.native" - -let slow () = skip_if (try ignore (Sys.getenv "SKIP_SLOW"); true with Not_found -> false) "SKIP_SLOW" - -(* test results on the three bundled example alignments *) - -let run_PhyloCSF species params = - let params = - if ForkMaybe.can_fork then params ^ " -p 8" - else params - let cmd = sprintf "%s %s %s" fn_PhyloCSF (Filename.concat dn_here ("../PhyloCSF_Parameters/" ^ species)) params - - let phylocsf_in = Unix.open_process_in ~cleanup:true cmd - - let phylocsf_answer = input_line phylocsf_in - match Unix.close_process_in phylocsf_in with - | Unix.WEXITED 0 -> String.nsplit phylocsf_answer "\t" - | _ -> raise Exit - -let talAA () = - let ans = run_PhyloCSF "12flies" "../PhyloCSF_Examples/tal-AA.fa --ancComp" - print_endline (String.join "\t" ans) - List.nth ans 1 $hould # equal "score(decibans)" - float_of_string (List.nth ans 2) $hould # be # within (297.62,297.63) - float_of_string (List.nth ans 3) $hould # be # within (48.25,48.26) - -let aldh2_ex5_out () = - let ans = run_PhyloCSF "29mammals" "../PhyloCSF_Examples/ALDH2.exon5.fa --ancComp" - print_endline (String.join "\t" ans) - List.nth ans 1 $hould # equal "score(decibans)" - float_of_string (List.nth ans 2) $hould # be # within (-178.93,-178.92) - float_of_string (List.nth ans 3) $hould # be # within (-38.29,-38.28) - -let aldh2_ex5_in () = - let abbreviate = (try ignore (Sys.getenv "SKIP_SLOW"); true with Not_found -> false) - let ans = run_PhyloCSF "29mammals" ("../PhyloCSF_Examples/ALDH2.exon5.fa --frames=" ^ (if abbreviate then "3" else "6")) - print_endline (String.join "\t" ans) - List.nth ans 1 $hould # equal "max_score(decibans)" - float_of_string (List.nth ans 2) $hould # be # within (218.26,218.27) - int_of_string (List.nth ans 3) $hould # equal 1 - int_of_string (List.nth ans 4) $hould # equal 111 - if not abbreviate then List.nth ans 5 $hould # equal "+" - -let aldh2_mRNA () = - slow () - let ans = run_PhyloCSF "29mammals" "../PhyloCSF_Examples/Aldh2.mRNA.fa --orf=ATGStop --frames=3 --removeRefGaps --aa" - print_endline (String.join "\t" ans) - List.nth ans 1 $hould # equal "max_score(decibans)" - float_of_string (List.nth ans 2) $hould # be # within (2013.92,2013.93) - int_of_string (List.nth ans 3) $hould # equal 343 - int_of_string (List.nth ans 4) $hould # equal 1899 - string (List.nth ans 5) $hould # be # matching (Str.regexp "^MLRAALTTVRRGPRLSRLLSAAA.*") - -let example_tests = "examples" >::: [ - "tal-AA" >:: talAA; - "ALDH2 ex5 out-of-frame" >:: aldh2_ex5_out; - "ALDH2 ex5 in-frame" >:: aldh2_ex5_in; - "Aldh2 mRNA" >:: aldh2_mRNA - ] - -(* simulations - FIXME: currently there is no verification of the results except that PhyloCSF - successfully exits; you have to eyeball the test stdout. *) - -let fn_testSim = Filename.concat dn_here "testSim.native" - -let check cmd = match Sys.command cmd with - | 0 -> () - | c when (c=130 || c=255) -> exit c (* ctrl-C *) - | c -> failwith (sprintf "Child process exit code %d" c) - -let sim_AsIs_fixed () = - check (sprintf "%s --maxUTR=0 --constantFrame --constantStrand 12flies ' --strategy=fixed'" fn_testSim) - -let sim_AsIs_mle () = - slow () - check (sprintf "%s --maxUTR=0 --constantFrame --constantStrand 12flies ' --strategy=mle'" fn_testSim) - -let sim_ATGStop_fixed () = - check (sprintf "%s 12flies ' --orf=ATGStop --frames=6 --strategy=fixed'" fn_testSim) - -let sim_ATGStop_mle () = - slow () - check (sprintf "%s 12flies ' --orf=ATGStop --frames=6 --strategy=mle'" fn_testSim) - - -let sim_tests = "simulations" >::: [ - "AsIs_fixed" >:: sim_AsIs_fixed; - "AsIs_mle" >:: sim_AsIs_mle; - "ATGStop_fixed" >:: sim_ATGStop_fixed; - "ATGStop_mle" >:: sim_ATGStop_mle - ] - -let all_tests = - "PhyloCSF" >::: [ - sim_tests; - example_tests - ] - -run_test_tt_main all_tests diff --git a/src/testSim.ml b/src/testSim.ml deleted file mode 100644 index 55ed0e0..0000000 --- a/src/testSim.ml +++ /dev/null @@ -1,161 +0,0 @@ -(* Test harness for PhyloCSF executable...feeds it simulated alignments of - 5'UTR+ORF+3'UTR, to make sure we can recover the ORF. *) - -open Batteries -open Extlib.OptParse -open Printf -open CamlPaml - -Gsl.Error.init () -Random.init 42 - -let dn_here = Filename.dirname Sys.argv.(0) - -module Codon = CamlPaml.Code.Codon64 - -let opt_parser = OptParser.make ~usage:"%prog 12flies \" --frames=6 --orf=ATGStop --strategy=fixed\"" () -let opt ?group ?h ?hide ?s ?short_names ?l ?long_names x = OptParser.add opt_parser ?group ?help:h ?hide ?short_name:s ?long_name:l x; x - -let n = opt ~s:'n' (StdOpt.int_option ~default:5 ()) -let min_utr = opt ~l:"minUTR" (StdOpt.int_option ~default:10 ()) -let max_utr = opt ~l:"maxUTR" (StdOpt.int_option ~default:50 ()) -let min_cds = opt ~l:"minCDS" (StdOpt.int_option ~default:40 ()) -let max_cds = opt ~l:"maxCDS" (StdOpt.int_option ~default:200 ()) -let randomize_frame = opt ~l:"constantFrame" (StdOpt.store_false ()) -let randomize_strand = opt ~l:"constantStrand" (StdOpt.store_false ()) - -let cmd = OptParser.parse_argv opt_parser - -if List.length cmd < 2 then - OptParser.usage opt_parser () - exit (-1) - -let fp_params = Filename.concat (Filename.concat dn_here "../PhyloCSF_Parameters") (List.nth cmd 0) -let fn_exe = (Filename.concat dn_here "PhyloCSF.native") ^ " " ^ (List.nth cmd 1) - -(******************************************************************************) - -let load_parameters () = - let fn_tree = fp_params ^ ".nh" - let fn_ecm_c = fp_params ^ "_coding.ECM" - let fn_ecm_nc = fp_params ^ "_noncoding.ECM" - if not (List.for_all Sys.file_exists [fn_tree; fn_ecm_c; fn_ecm_nc]) then - failwith (sprintf "Could not find required parameter files prefixed by %s\n" fp_params) - - let nt = File.with_file_in fn_tree (fun input -> NewickParser.parse NewickLexer.token (Lexing.from_input input)) - let t = T.of_newick nt - let s1, pi1 = ECM.import_parameters fn_ecm_c - let s2, pi2 = ECM.import_parameters fn_ecm_nc - let model = PhyloCSFModel.make s1 pi1 s2 pi2 t - nt, t, model - -let alignment_column_producer model_instance = - let m = PhyloModel.P14n.model model_instance - let rec next () = - let leaves = PhyloModel.simulate m () - if Codon.is_stop (Codon.of_index leaves.(0)) then - next () - else - Array.init (T.leaves (PhyloModel.tree m)) - fun i -> - let which_codon = leaves.(i) - let n1,n2,n3 = Codon.of_index which_codon - String.of_list [n1; n2; n3] - let rec enum () = Enum.make ~next:next ~count:(fun () -> raise Enum.Infinite_enum) ~clone:(fun () -> enum ()) - enum () - -let full_alignment_columns { PhyloCSFModel.coding_model = coding_model; noncoding_model = noncoding_model } = - let leaves = T.leaves (PhyloModel.tree (PhyloModel.P14n.model coding_model)) - - let sites5' = if Opt.get max_utr > 0 then (Opt.get min_utr) + (Random.int (Opt.get max_utr - Opt.get min_utr)) else 0 - let sites3' = if Opt.get max_utr > 0 then (Opt.get min_utr) + (Random.int (Opt.get max_utr - Opt.get min_utr)) else 0 - let sitesCDS = if Opt.get max_cds > 0 then (Opt.get min_cds) + (Random.int (Opt.get max_cds - Opt.get min_cds)) else 0 - - let utr_producer = alignment_column_producer noncoding_model - let cds_producer = alignment_column_producer coding_model - - let site1 = - if Opt.get max_utr = 0 then - None - else - let site = Option.get (get utr_producer) - if Opt.get randomize_frame then - let trim = Random.int 3 - site |> Array.iteri (fun i s -> site.(i) <- String.sub s 0 trim) - Some site - - let atg = Array.make leaves "ATG" - let stop = Array.init leaves (fun _ -> match Random.int 3 with 0 -> "TAA" | 1 -> "TAG" | 2 -> "TGA" | _ -> assert false) - - let orf_lo = (match site1 with Some site -> String.length site.(0) | None -> 0) + (sites5' * 3) - let orf_hi = orf_lo + 2 + (sitesCDS * 3) - printf "\t%d\t%d" orf_lo orf_hi - - Enum.concat (List.enum [ (match site1 with Some site -> Enum.singleton site | None -> Enum.empty ()); - Enum.take sites5' utr_producer; - Enum.singleton atg; - Enum.take sitesCDS cds_producer; - Enum.singleton stop; - Enum.take sites3' utr_producer ]) - -let stringify_alignment_columns cols = - let col0 = Option.get (Enum.peek cols) - let rows = Array.length col0 - let bufs = Array.init rows (fun _ -> Buffer.create 1000) - cols |> iter - fun col -> - for i = 0 to rows-1 do - Buffer.add_string bufs.(i) col.(i) - Array.map Buffer.contents bufs - -let maybe_revcomp seqs = - if Opt.get randomize_strand && Random.bool () then - printf "\t-" - Array.map Code.DNA.revcomp seqs - else - printf "\t+" - seqs - -let mfa headers seqs = - assert (Array.length headers = Array.length seqs) - let buf = Buffer.create 1000 - Array.iter2 - fun header seq -> - Buffer.add_string buf (sprintf ">%s\n" header) - Buffer.add_string buf seq - Buffer.add_char buf '\n' - headers - seqs - Buffer.contents buf - -let run_phylocsf aln = - let cmd = sprintf "%s %s%s" fn_exe fp_params (if ForkMaybe.can_fork then " -p 8" else "") - - let phylocsf_in, phylocsf_out = Unix.open_process ~cleanup:true cmd - output_string phylocsf_out aln - close_out phylocsf_out - - let phylocsf_answer = input_line phylocsf_in - match Unix.close_process (phylocsf_in,phylocsf_out) with - | Unix.WEXITED 0 -> String.nsplit phylocsf_answer "\t" - | Unix.WEXITED c -> exit c - | _ -> raise Exit - -let main () = - let _, t, model = load_parameters () - - let headers = Array.init (T.leaves t) (T.label t) - - for i = 1 to Opt.get n do - printf "\ttruth\t\t\t\t" - let aln = mfa headers (maybe_revcomp (stringify_alignment_columns (full_alignment_columns model))) - printf "\n" - flush stdout - flush stderr - - let phylocsf_result = run_phylocsf aln - printf "%s\n" (String.join "\t" phylocsf_result) - printf "\n" - flush stdout - -main ()