diff --git a/.gitignore b/.gitignore
deleted file mode 100644
index f852435..0000000
--- a/.gitignore
+++ /dev/null
@@ -1,5 +0,0 @@
-PhyloCSF.Linux.x86_64
-PhyloCSF.Darwin.x86_64
-_build
-*.native
-ForkMaybe.ml
diff --git a/.travis-ci.sh b/.travis-ci.sh
deleted file mode 100644
index d7bf67f..0000000
--- a/.travis-ci.sh
+++ /dev/null
@@ -1,18 +0,0 @@
-OPAM_DEPENDS="batteries gsl ocaml+twt forkwork ounit should"
-
-sudo add-apt-repository -y ppa:avsm
-sudo apt-get update -qq
-sudo apt-get install -qq libgsl0-dev ocaml ocaml-native-compilers camlp4-extra opam
-export OPAMYES=1
-echo OCaml version
-ocaml -version
-echo OPAM versions
-opam --version
-
-opam init
-opam install ${OPAM_DEPENDS}
-eval `opam config env`
-bash -c "while :; do date; sleep 60; done" &
-killme=$!
-make test
-kill $killme || true
diff --git a/.travis.yml b/.travis.yml
deleted file mode 100644
index 959dcaf..0000000
--- a/.travis.yml
+++ /dev/null
@@ -1,6 +0,0 @@
-language: c
-script: bash -ex .travis-ci.sh
-env:
- matrix:
- - SKIP_SLOW=1
- - FORKWORK=1
diff --git a/100vertebrates.nh.png b/100vertebrates.nh.png
new file mode 100644
index 0000000..cd611f3
Binary files /dev/null and b/100vertebrates.nh.png differ
diff --git a/12flies.nh.png b/12flies.nh.png
new file mode 100644
index 0000000..2238b26
Binary files /dev/null and b/12flies.nh.png differ
diff --git a/20flies.nh.png b/20flies.nh.png
new file mode 100644
index 0000000..5cbf12a
Binary files /dev/null and b/20flies.nh.png differ
diff --git a/21mosquitoes.nh.png b/21mosquitoes.nh.png
new file mode 100644
index 0000000..8b0982c
Binary files /dev/null and b/21mosquitoes.nh.png differ
diff --git a/23flies.nh.png b/23flies.nh.png
new file mode 100644
index 0000000..ddd2920
Binary files /dev/null and b/23flies.nh.png differ
diff --git a/29mammals.nh.png b/29mammals.nh.png
new file mode 100644
index 0000000..7d38cdd
Binary files /dev/null and b/29mammals.nh.png differ
diff --git a/49birds.nh.png b/49birds.nh.png
new file mode 100644
index 0000000..7cfb912
Binary files /dev/null and b/49birds.nh.png differ
diff --git a/58mammals.nh.png b/58mammals.nh.png
new file mode 100644
index 0000000..b074907
Binary files /dev/null and b/58mammals.nh.png differ
diff --git a/7yeast.nh.png b/7yeast.nh.png
new file mode 100644
index 0000000..4eb06d9
Binary files /dev/null and b/7yeast.nh.png differ
diff --git a/BrowserTracks.png b/BrowserTracks.png
new file mode 100644
index 0000000..eb18cad
Binary files /dev/null and b/BrowserTracks.png differ
diff --git a/LICENSE b/LICENSE
deleted file mode 100644
index dba13ed..0000000
--- a/LICENSE
+++ /dev/null
@@ -1,661 +0,0 @@
- GNU AFFERO GENERAL PUBLIC LICENSE
- Version 3, 19 November 2007
-
- Copyright (C) 2007 Free Software Foundation, Inc.
- Everyone is permitted to copy and distribute verbatim copies
- of this license document, but changing it is not allowed.
-
- Preamble
-
- The GNU Affero General Public License is a free, copyleft license for
-software and other kinds of works, specifically designed to ensure
-cooperation with the community in the case of network server software.
-
- The licenses for most software and other practical works are designed
-to take away your freedom to share and change the works. By contrast,
-our General Public Licenses are intended to guarantee your freedom to
-share and change all versions of a program--to make sure it remains free
-software for all its users.
-
- When we speak of free software, we are referring to freedom, not
-price. Our General Public Licenses are designed to make sure that you
-have the freedom to distribute copies of free software (and charge for
-them if you wish), that you receive source code or can get it if you
-want it, that you can change the software or use pieces of it in new
-free programs, and that you know you can do these things.
-
- Developers that use our General Public Licenses protect your rights
-with two steps: (1) assert copyright on the software, and (2) offer
-you this License which gives you legal permission to copy, distribute
-and/or modify the software.
-
- A secondary benefit of defending all users' freedom is that
-improvements made in alternate versions of the program, if they
-receive widespread use, become available for other developers to
-incorporate. Many developers of free software are heartened and
-encouraged by the resulting cooperation. However, in the case of
-software used on network servers, this result may fail to come about.
-The GNU General Public License permits making a modified version and
-letting the public access it on a server without ever releasing its
-source code to the public.
-
- The GNU Affero General Public License is designed specifically to
-ensure that, in such cases, the modified source code becomes available
-to the community. It requires the operator of a network server to
-provide the source code of the modified version running there to the
-users of that server. Therefore, public use of a modified version, on
-a publicly accessible server, gives the public access to the source
-code of the modified version.
-
- An older license, called the Affero General Public License and
-published by Affero, was designed to accomplish similar goals. This is
-a different license, not a version of the Affero GPL, but Affero has
-released a new version of the Affero GPL which permits relicensing under
-this license.
-
- The precise terms and conditions for copying, distribution and
-modification follow.
-
- TERMS AND CONDITIONS
-
- 0. Definitions.
-
- "This License" refers to version 3 of the GNU Affero General Public License.
-
- "Copyright" also means copyright-like laws that apply to other kinds of
-works, such as semiconductor masks.
-
- "The Program" refers to any copyrightable work licensed under this
-License. Each licensee is addressed as "you". "Licensees" and
-"recipients" may be individuals or organizations.
-
- To "modify" a work means to copy from or adapt all or part of the work
-in a fashion requiring copyright permission, other than the making of an
-exact copy. The resulting work is called a "modified version" of the
-earlier work or a work "based on" the earlier work.
-
- A "covered work" means either the unmodified Program or a work based
-on the Program.
-
- To "propagate" a work means to do anything with it that, without
-permission, would make you directly or secondarily liable for
-infringement under applicable copyright law, except executing it on a
-computer or modifying a private copy. Propagation includes copying,
-distribution (with or without modification), making available to the
-public, and in some countries other activities as well.
-
- To "convey" a work means any kind of propagation that enables other
-parties to make or receive copies. Mere interaction with a user through
-a computer network, with no transfer of a copy, is not conveying.
-
- An interactive user interface displays "Appropriate Legal Notices"
-to the extent that it includes a convenient and prominently visible
-feature that (1) displays an appropriate copyright notice, and (2)
-tells the user that there is no warranty for the work (except to the
-extent that warranties are provided), that licensees may convey the
-work under this License, and how to view a copy of this License. If
-the interface presents a list of user commands or options, such as a
-menu, a prominent item in the list meets this criterion.
-
- 1. Source Code.
-
- The "source code" for a work means the preferred form of the work
-for making modifications to it. "Object code" means any non-source
-form of a work.
-
- A "Standard Interface" means an interface that either is an official
-standard defined by a recognized standards body, or, in the case of
-interfaces specified for a particular programming language, one that
-is widely used among developers working in that language.
-
- The "System Libraries" of an executable work include anything, other
-than the work as a whole, that (a) is included in the normal form of
-packaging a Major Component, but which is not part of that Major
-Component, and (b) serves only to enable use of the work with that
-Major Component, or to implement a Standard Interface for which an
-implementation is available to the public in source code form. A
-"Major Component", in this context, means a major essential component
-(kernel, window system, and so on) of the specific operating system
-(if any) on which the executable work runs, or a compiler used to
-produce the work, or an object code interpreter used to run it.
-
- The "Corresponding Source" for a work in object code form means all
-the source code needed to generate, install, and (for an executable
-work) run the object code and to modify the work, including scripts to
-control those activities. However, it does not include the work's
-System Libraries, or general-purpose tools or generally available free
-programs which are used unmodified in performing those activities but
-which are not part of the work. For example, Corresponding Source
-includes interface definition files associated with source files for
-the work, and the source code for shared libraries and dynamically
-linked subprograms that the work is specifically designed to require,
-such as by intimate data communication or control flow between those
-subprograms and other parts of the work.
-
- The Corresponding Source need not include anything that users
-can regenerate automatically from other parts of the Corresponding
-Source.
-
- The Corresponding Source for a work in source code form is that
-same work.
-
- 2. Basic Permissions.
-
- All rights granted under this License are granted for the term of
-copyright on the Program, and are irrevocable provided the stated
-conditions are met. This License explicitly affirms your unlimited
-permission to run the unmodified Program. The output from running a
-covered work is covered by this License only if the output, given its
-content, constitutes a covered work. This License acknowledges your
-rights of fair use or other equivalent, as provided by copyright law.
-
- You may make, run and propagate covered works that you do not
-convey, without conditions so long as your license otherwise remains
-in force. You may convey covered works to others for the sole purpose
-of having them make modifications exclusively for you, or provide you
-with facilities for running those works, provided that you comply with
-the terms of this License in conveying all material for which you do
-not control copyright. Those thus making or running the covered works
-for you must do so exclusively on your behalf, under your direction
-and control, on terms that prohibit them from making any copies of
-your copyrighted material outside their relationship with you.
-
- Conveying under any other circumstances is permitted solely under
-the conditions stated below. Sublicensing is not allowed; section 10
-makes it unnecessary.
-
- 3. Protecting Users' Legal Rights From Anti-Circumvention Law.
-
- No covered work shall be deemed part of an effective technological
-measure under any applicable law fulfilling obligations under article
-11 of the WIPO copyright treaty adopted on 20 December 1996, or
-similar laws prohibiting or restricting circumvention of such
-measures.
-
- When you convey a covered work, you waive any legal power to forbid
-circumvention of technological measures to the extent such circumvention
-is effected by exercising rights under this License with respect to
-the covered work, and you disclaim any intention to limit operation or
-modification of the work as a means of enforcing, against the work's
-users, your or third parties' legal rights to forbid circumvention of
-technological measures.
-
- 4. Conveying Verbatim Copies.
-
- You may convey verbatim copies of the Program's source code as you
-receive it, in any medium, provided that you conspicuously and
-appropriately publish on each copy an appropriate copyright notice;
-keep intact all notices stating that this License and any
-non-permissive terms added in accord with section 7 apply to the code;
-keep intact all notices of the absence of any warranty; and give all
-recipients a copy of this License along with the Program.
-
- You may charge any price or no price for each copy that you convey,
-and you may offer support or warranty protection for a fee.
-
- 5. Conveying Modified Source Versions.
-
- You may convey a work based on the Program, or the modifications to
-produce it from the Program, in the form of source code under the
-terms of section 4, provided that you also meet all of these conditions:
-
- a) The work must carry prominent notices stating that you modified
- it, and giving a relevant date.
-
- b) The work must carry prominent notices stating that it is
- released under this License and any conditions added under section
- 7. This requirement modifies the requirement in section 4 to
- "keep intact all notices".
-
- c) You must license the entire work, as a whole, under this
- License to anyone who comes into possession of a copy. This
- License will therefore apply, along with any applicable section 7
- additional terms, to the whole of the work, and all its parts,
- regardless of how they are packaged. This License gives no
- permission to license the work in any other way, but it does not
- invalidate such permission if you have separately received it.
-
- d) If the work has interactive user interfaces, each must display
- Appropriate Legal Notices; however, if the Program has interactive
- interfaces that do not display Appropriate Legal Notices, your
- work need not make them do so.
-
- A compilation of a covered work with other separate and independent
-works, which are not by their nature extensions of the covered work,
-and which are not combined with it such as to form a larger program,
-in or on a volume of a storage or distribution medium, is called an
-"aggregate" if the compilation and its resulting copyright are not
-used to limit the access or legal rights of the compilation's users
-beyond what the individual works permit. Inclusion of a covered work
-in an aggregate does not cause this License to apply to the other
-parts of the aggregate.
-
- 6. Conveying Non-Source Forms.
-
- You may convey a covered work in object code form under the terms
-of sections 4 and 5, provided that you also convey the
-machine-readable Corresponding Source under the terms of this License,
-in one of these ways:
-
- a) Convey the object code in, or embodied in, a physical product
- (including a physical distribution medium), accompanied by the
- Corresponding Source fixed on a durable physical medium
- customarily used for software interchange.
-
- b) Convey the object code in, or embodied in, a physical product
- (including a physical distribution medium), accompanied by a
- written offer, valid for at least three years and valid for as
- long as you offer spare parts or customer support for that product
- model, to give anyone who possesses the object code either (1) a
- copy of the Corresponding Source for all the software in the
- product that is covered by this License, on a durable physical
- medium customarily used for software interchange, for a price no
- more than your reasonable cost of physically performing this
- conveying of source, or (2) access to copy the
- Corresponding Source from a network server at no charge.
-
- c) Convey individual copies of the object code with a copy of the
- written offer to provide the Corresponding Source. This
- alternative is allowed only occasionally and noncommercially, and
- only if you received the object code with such an offer, in accord
- with subsection 6b.
-
- d) Convey the object code by offering access from a designated
- place (gratis or for a charge), and offer equivalent access to the
- Corresponding Source in the same way through the same place at no
- further charge. You need not require recipients to copy the
- Corresponding Source along with the object code. If the place to
- copy the object code is a network server, the Corresponding Source
- may be on a different server (operated by you or a third party)
- that supports equivalent copying facilities, provided you maintain
- clear directions next to the object code saying where to find the
- Corresponding Source. Regardless of what server hosts the
- Corresponding Source, you remain obligated to ensure that it is
- available for as long as needed to satisfy these requirements.
-
- e) Convey the object code using peer-to-peer transmission, provided
- you inform other peers where the object code and Corresponding
- Source of the work are being offered to the general public at no
- charge under subsection 6d.
-
- A separable portion of the object code, whose source code is excluded
-from the Corresponding Source as a System Library, need not be
-included in conveying the object code work.
-
- A "User Product" is either (1) a "consumer product", which means any
-tangible personal property which is normally used for personal, family,
-or household purposes, or (2) anything designed or sold for incorporation
-into a dwelling. In determining whether a product is a consumer product,
-doubtful cases shall be resolved in favor of coverage. For a particular
-product received by a particular user, "normally used" refers to a
-typical or common use of that class of product, regardless of the status
-of the particular user or of the way in which the particular user
-actually uses, or expects or is expected to use, the product. A product
-is a consumer product regardless of whether the product has substantial
-commercial, industrial or non-consumer uses, unless such uses represent
-the only significant mode of use of the product.
-
- "Installation Information" for a User Product means any methods,
-procedures, authorization keys, or other information required to install
-and execute modified versions of a covered work in that User Product from
-a modified version of its Corresponding Source. The information must
-suffice to ensure that the continued functioning of the modified object
-code is in no case prevented or interfered with solely because
-modification has been made.
-
- If you convey an object code work under this section in, or with, or
-specifically for use in, a User Product, and the conveying occurs as
-part of a transaction in which the right of possession and use of the
-User Product is transferred to the recipient in perpetuity or for a
-fixed term (regardless of how the transaction is characterized), the
-Corresponding Source conveyed under this section must be accompanied
-by the Installation Information. But this requirement does not apply
-if neither you nor any third party retains the ability to install
-modified object code on the User Product (for example, the work has
-been installed in ROM).
-
- The requirement to provide Installation Information does not include a
-requirement to continue to provide support service, warranty, or updates
-for a work that has been modified or installed by the recipient, or for
-the User Product in which it has been modified or installed. Access to a
-network may be denied when the modification itself materially and
-adversely affects the operation of the network or violates the rules and
-protocols for communication across the network.
-
- Corresponding Source conveyed, and Installation Information provided,
-in accord with this section must be in a format that is publicly
-documented (and with an implementation available to the public in
-source code form), and must require no special password or key for
-unpacking, reading or copying.
-
- 7. Additional Terms.
-
- "Additional permissions" are terms that supplement the terms of this
-License by making exceptions from one or more of its conditions.
-Additional permissions that are applicable to the entire Program shall
-be treated as though they were included in this License, to the extent
-that they are valid under applicable law. If additional permissions
-apply only to part of the Program, that part may be used separately
-under those permissions, but the entire Program remains governed by
-this License without regard to the additional permissions.
-
- When you convey a copy of a covered work, you may at your option
-remove any additional permissions from that copy, or from any part of
-it. (Additional permissions may be written to require their own
-removal in certain cases when you modify the work.) You may place
-additional permissions on material, added by you to a covered work,
-for which you have or can give appropriate copyright permission.
-
- Notwithstanding any other provision of this License, for material you
-add to a covered work, you may (if authorized by the copyright holders of
-that material) supplement the terms of this License with terms:
-
- a) Disclaiming warranty or limiting liability differently from the
- terms of sections 15 and 16 of this License; or
-
- b) Requiring preservation of specified reasonable legal notices or
- author attributions in that material or in the Appropriate Legal
- Notices displayed by works containing it; or
-
- c) Prohibiting misrepresentation of the origin of that material, or
- requiring that modified versions of such material be marked in
- reasonable ways as different from the original version; or
-
- d) Limiting the use for publicity purposes of names of licensors or
- authors of the material; or
-
- e) Declining to grant rights under trademark law for use of some
- trade names, trademarks, or service marks; or
-
- f) Requiring indemnification of licensors and authors of that
- material by anyone who conveys the material (or modified versions of
- it) with contractual assumptions of liability to the recipient, for
- any liability that these contractual assumptions directly impose on
- those licensors and authors.
-
- All other non-permissive additional terms are considered "further
-restrictions" within the meaning of section 10. If the Program as you
-received it, or any part of it, contains a notice stating that it is
-governed by this License along with a term that is a further
-restriction, you may remove that term. If a license document contains
-a further restriction but permits relicensing or conveying under this
-License, you may add to a covered work material governed by the terms
-of that license document, provided that the further restriction does
-not survive such relicensing or conveying.
-
- If you add terms to a covered work in accord with this section, you
-must place, in the relevant source files, a statement of the
-additional terms that apply to those files, or a notice indicating
-where to find the applicable terms.
-
- Additional terms, permissive or non-permissive, may be stated in the
-form of a separately written license, or stated as exceptions;
-the above requirements apply either way.
-
- 8. Termination.
-
- You may not propagate or modify a covered work except as expressly
-provided under this License. Any attempt otherwise to propagate or
-modify it is void, and will automatically terminate your rights under
-this License (including any patent licenses granted under the third
-paragraph of section 11).
-
- However, if you cease all violation of this License, then your
-license from a particular copyright holder is reinstated (a)
-provisionally, unless and until the copyright holder explicitly and
-finally terminates your license, and (b) permanently, if the copyright
-holder fails to notify you of the violation by some reasonable means
-prior to 60 days after the cessation.
-
- Moreover, your license from a particular copyright holder is
-reinstated permanently if the copyright holder notifies you of the
-violation by some reasonable means, this is the first time you have
-received notice of violation of this License (for any work) from that
-copyright holder, and you cure the violation prior to 30 days after
-your receipt of the notice.
-
- Termination of your rights under this section does not terminate the
-licenses of parties who have received copies or rights from you under
-this License. If your rights have been terminated and not permanently
-reinstated, you do not qualify to receive new licenses for the same
-material under section 10.
-
- 9. Acceptance Not Required for Having Copies.
-
- You are not required to accept this License in order to receive or
-run a copy of the Program. Ancillary propagation of a covered work
-occurring solely as a consequence of using peer-to-peer transmission
-to receive a copy likewise does not require acceptance. However,
-nothing other than this License grants you permission to propagate or
-modify any covered work. These actions infringe copyright if you do
-not accept this License. Therefore, by modifying or propagating a
-covered work, you indicate your acceptance of this License to do so.
-
- 10. Automatic Licensing of Downstream Recipients.
-
- Each time you convey a covered work, the recipient automatically
-receives a license from the original licensors, to run, modify and
-propagate that work, subject to this License. You are not responsible
-for enforcing compliance by third parties with this License.
-
- An "entity transaction" is a transaction transferring control of an
-organization, or substantially all assets of one, or subdividing an
-organization, or merging organizations. If propagation of a covered
-work results from an entity transaction, each party to that
-transaction who receives a copy of the work also receives whatever
-licenses to the work the party's predecessor in interest had or could
-give under the previous paragraph, plus a right to possession of the
-Corresponding Source of the work from the predecessor in interest, if
-the predecessor has it or can get it with reasonable efforts.
-
- You may not impose any further restrictions on the exercise of the
-rights granted or affirmed under this License. For example, you may
-not impose a license fee, royalty, or other charge for exercise of
-rights granted under this License, and you may not initiate litigation
-(including a cross-claim or counterclaim in a lawsuit) alleging that
-any patent claim is infringed by making, using, selling, offering for
-sale, or importing the Program or any portion of it.
-
- 11. Patents.
-
- A "contributor" is a copyright holder who authorizes use under this
-License of the Program or a work on which the Program is based. The
-work thus licensed is called the contributor's "contributor version".
-
- A contributor's "essential patent claims" are all patent claims
-owned or controlled by the contributor, whether already acquired or
-hereafter acquired, that would be infringed by some manner, permitted
-by this License, of making, using, or selling its contributor version,
-but do not include claims that would be infringed only as a
-consequence of further modification of the contributor version. For
-purposes of this definition, "control" includes the right to grant
-patent sublicenses in a manner consistent with the requirements of
-this License.
-
- Each contributor grants you a non-exclusive, worldwide, royalty-free
-patent license under the contributor's essential patent claims, to
-make, use, sell, offer for sale, import and otherwise run, modify and
-propagate the contents of its contributor version.
-
- In the following three paragraphs, a "patent license" is any express
-agreement or commitment, however denominated, not to enforce a patent
-(such as an express permission to practice a patent or covenant not to
-sue for patent infringement). To "grant" such a patent license to a
-party means to make such an agreement or commitment not to enforce a
-patent against the party.
-
- If you convey a covered work, knowingly relying on a patent license,
-and the Corresponding Source of the work is not available for anyone
-to copy, free of charge and under the terms of this License, through a
-publicly available network server or other readily accessible means,
-then you must either (1) cause the Corresponding Source to be so
-available, or (2) arrange to deprive yourself of the benefit of the
-patent license for this particular work, or (3) arrange, in a manner
-consistent with the requirements of this License, to extend the patent
-license to downstream recipients. "Knowingly relying" means you have
-actual knowledge that, but for the patent license, your conveying the
-covered work in a country, or your recipient's use of the covered work
-in a country, would infringe one or more identifiable patents in that
-country that you have reason to believe are valid.
-
- If, pursuant to or in connection with a single transaction or
-arrangement, you convey, or propagate by procuring conveyance of, a
-covered work, and grant a patent license to some of the parties
-receiving the covered work authorizing them to use, propagate, modify
-or convey a specific copy of the covered work, then the patent license
-you grant is automatically extended to all recipients of the covered
-work and works based on it.
-
- A patent license is "discriminatory" if it does not include within
-the scope of its coverage, prohibits the exercise of, or is
-conditioned on the non-exercise of one or more of the rights that are
-specifically granted under this License. You may not convey a covered
-work if you are a party to an arrangement with a third party that is
-in the business of distributing software, under which you make payment
-to the third party based on the extent of your activity of conveying
-the work, and under which the third party grants, to any of the
-parties who would receive the covered work from you, a discriminatory
-patent license (a) in connection with copies of the covered work
-conveyed by you (or copies made from those copies), or (b) primarily
-for and in connection with specific products or compilations that
-contain the covered work, unless you entered into that arrangement,
-or that patent license was granted, prior to 28 March 2007.
-
- Nothing in this License shall be construed as excluding or limiting
-any implied license or other defenses to infringement that may
-otherwise be available to you under applicable patent law.
-
- 12. No Surrender of Others' Freedom.
-
- If conditions are imposed on you (whether by court order, agreement or
-otherwise) that contradict the conditions of this License, they do not
-excuse you from the conditions of this License. If you cannot convey a
-covered work so as to satisfy simultaneously your obligations under this
-License and any other pertinent obligations, then as a consequence you may
-not convey it at all. For example, if you agree to terms that obligate you
-to collect a royalty for further conveying from those to whom you convey
-the Program, the only way you could satisfy both those terms and this
-License would be to refrain entirely from conveying the Program.
-
- 13. Remote Network Interaction; Use with the GNU General Public License.
-
- Notwithstanding any other provision of this License, if you modify the
-Program, your modified version must prominently offer all users
-interacting with it remotely through a computer network (if your version
-supports such interaction) an opportunity to receive the Corresponding
-Source of your version by providing access to the Corresponding Source
-from a network server at no charge, through some standard or customary
-means of facilitating copying of software. This Corresponding Source
-shall include the Corresponding Source for any work covered by version 3
-of the GNU General Public License that is incorporated pursuant to the
-following paragraph.
-
- Notwithstanding any other provision of this License, you have
-permission to link or combine any covered work with a work licensed
-under version 3 of the GNU General Public License into a single
-combined work, and to convey the resulting work. The terms of this
-License will continue to apply to the part which is the covered work,
-but the work with which it is combined will remain governed by version
-3 of the GNU General Public License.
-
- 14. Revised Versions of this License.
-
- The Free Software Foundation may publish revised and/or new versions of
-the GNU Affero General Public License from time to time. Such new versions
-will be similar in spirit to the present version, but may differ in detail to
-address new problems or concerns.
-
- Each version is given a distinguishing version number. If the
-Program specifies that a certain numbered version of the GNU Affero General
-Public License "or any later version" applies to it, you have the
-option of following the terms and conditions either of that numbered
-version or of any later version published by the Free Software
-Foundation. If the Program does not specify a version number of the
-GNU Affero General Public License, you may choose any version ever published
-by the Free Software Foundation.
-
- If the Program specifies that a proxy can decide which future
-versions of the GNU Affero General Public License can be used, that proxy's
-public statement of acceptance of a version permanently authorizes you
-to choose that version for the Program.
-
- Later license versions may give you additional or different
-permissions. However, no additional obligations are imposed on any
-author or copyright holder as a result of your choosing to follow a
-later version.
-
- 15. Disclaimer of Warranty.
-
- THERE IS NO WARRANTY FOR THE PROGRAM, TO THE EXTENT PERMITTED BY
-APPLICABLE LAW. EXCEPT WHEN OTHERWISE STATED IN WRITING THE COPYRIGHT
-HOLDERS AND/OR OTHER PARTIES PROVIDE THE PROGRAM "AS IS" WITHOUT WARRANTY
-OF ANY KIND, EITHER EXPRESSED OR IMPLIED, INCLUDING, BUT NOT LIMITED TO,
-THE IMPLIED WARRANTIES OF MERCHANTABILITY AND FITNESS FOR A PARTICULAR
-PURPOSE. THE ENTIRE RISK AS TO THE QUALITY AND PERFORMANCE OF THE PROGRAM
-IS WITH YOU. SHOULD THE PROGRAM PROVE DEFECTIVE, YOU ASSUME THE COST OF
-ALL NECESSARY SERVICING, REPAIR OR CORRECTION.
-
- 16. Limitation of Liability.
-
- IN NO EVENT UNLESS REQUIRED BY APPLICABLE LAW OR AGREED TO IN WRITING
-WILL ANY COPYRIGHT HOLDER, OR ANY OTHER PARTY WHO MODIFIES AND/OR CONVEYS
-THE PROGRAM AS PERMITTED ABOVE, BE LIABLE TO YOU FOR DAMAGES, INCLUDING ANY
-GENERAL, SPECIAL, INCIDENTAL OR CONSEQUENTIAL DAMAGES ARISING OUT OF THE
-USE OR INABILITY TO USE THE PROGRAM (INCLUDING BUT NOT LIMITED TO LOSS OF
-DATA OR DATA BEING RENDERED INACCURATE OR LOSSES SUSTAINED BY YOU OR THIRD
-PARTIES OR A FAILURE OF THE PROGRAM TO OPERATE WITH ANY OTHER PROGRAMS),
-EVEN IF SUCH HOLDER OR OTHER PARTY HAS BEEN ADVISED OF THE POSSIBILITY OF
-SUCH DAMAGES.
-
- 17. Interpretation of Sections 15 and 16.
-
- If the disclaimer of warranty and limitation of liability provided
-above cannot be given local legal effect according to their terms,
-reviewing courts shall apply local law that most closely approximates
-an absolute waiver of all civil liability in connection with the
-Program, unless a warranty or assumption of liability accompanies a
-copy of the Program in return for a fee.
-
- END OF TERMS AND CONDITIONS
-
- How to Apply These Terms to Your New Programs
-
- If you develop a new program, and you want it to be of the greatest
-possible use to the public, the best way to achieve this is to make it
-free software which everyone can redistribute and change under these terms.
-
- To do so, attach the following notices to the program. It is safest
-to attach them to the start of each source file to most effectively
-state the exclusion of warranty; and each file should have at least
-the "copyright" line and a pointer to where the full notice is found.
-
-
- Copyright (C)
-
- This program is free software: you can redistribute it and/or modify
- it under the terms of the GNU Affero General Public License as published by
- the Free Software Foundation, either version 3 of the License, or
- (at your option) any later version.
-
- This program is distributed in the hope that it will be useful,
- but WITHOUT ANY WARRANTY; without even the implied warranty of
- MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the
- GNU Affero General Public License for more details.
-
- You should have received a copy of the GNU Affero General Public License
- along with this program. If not, see .
-
-Also add information on how to contact you by electronic and paper mail.
-
- If your software can interact with users remotely through a computer
-network, you should also make sure that it provides a way for users to
-get its source. For example, if your program is a web application, its
-interface could display a "Source" link that leads users to an archive
-of the code. There are many ways you could offer source, and different
-solutions will be better for different programs; see section 13 for the
-specific requirements.
-
- You should also get your employer (if you work as a programmer) or school,
-if any, to sign a "copyright disclaimer" for the program, if necessary.
-For more information on this, and how to apply and follow the GNU AGPL, see
-.
diff --git a/Makefile b/Makefile
deleted file mode 100644
index 9667ce0..0000000
--- a/Makefile
+++ /dev/null
@@ -1,22 +0,0 @@
-all: PhyloCSF
-
-.PHONY: PhyloCSF CamlPaml clean
-
-ARCH := $(shell uname).$(shell uname -m)
-
-PhyloCSF: CamlPaml
- $(MAKE) -C src clean
- $(MAKE) -C src $(MFLAGS)
- cp src/_build/PhyloCSF.native PhyloCSF.$(ARCH)
-
-CamlPaml:
- $(MAKE) -C lib/CamlPaml $(MFLAGS) reinstall
-
-test: PhyloCSF
- $(MAKE) -C lib/CamlPaml $(MFLAGS) test
- $(MAKE) -C src $(MFLAGS) test
-
-clean:
- $(MAKE) -C lib/CamlPaml clean
- $(MAKE) -C src clean
- rm -f PhyloCSF.*
diff --git a/OmegaTest.pdf b/OmegaTest.pdf
new file mode 100644
index 0000000..bf36d41
Binary files /dev/null and b/OmegaTest.pdf differ
diff --git a/PhyloCSF b/PhyloCSF
deleted file mode 100755
index f5580d0..0000000
--- a/PhyloCSF
+++ /dev/null
@@ -1,15 +0,0 @@
-#!/bin/bash
-
-ARCH=`uname`.`uname -m`
-case $0 in
- ./*) export PHYLOCSF_BASE=`pwd` ;;
- * ) export PHYLOCSF_BASE=`dirname $0`
-esac
-
-if [ -f "$PHYLOCSF_BASE/PhyloCSF.$ARCH" ]; then
- $PHYLOCSF_BASE/PhyloCSF.$ARCH $@
-else
- echo "No PhyloCSF executable found for architecture: $ARCH"
- echo "You may need to compile/install it according to the README."
- exit 1
-fi
diff --git a/PhyloCSF.png b/PhyloCSF.png
new file mode 100755
index 0000000..7b80109
Binary files /dev/null and b/PhyloCSF.png differ
diff --git a/PhyloCSF_Examples/ALDH2.exon5.fa b/PhyloCSF_Examples/ALDH2.exon5.fa
deleted file mode 100644
index ac7eb7e..0000000
--- a/PhyloCSF_Examples/ALDH2.exon5.fa
+++ /dev/null
@@ -1,12 +0,0 @@
->Human
-GTATTATGCCGGCTGGGCTGATAAGTACCACGGGAAAACCATCCCCATTGACGGAGACTTCTTCAGCTACACACGCCATGAACCTGTGGGGGTGTGCGGGCAGATCATTCCG
->Mouse
-CTATTACGCTGGCTGGGCTGACAAGTACCATGGGAAAACCATTCCCATCGACGGCGACTTCTTCAGCTATACCCGCCATGAGCCTGTGGGCGTGTGTGGACAGATCATTCCG
->Rat
-CTATTATGCTGGCTGGGCTGACAAGTACCACGGGAAAACCATTCCCATCGATGGCGACTTCTTCAGCTACACCCGCCACGAGCCTGTGGGCGTGTGTGGACAGATCATTCCG
->Cow
-TTACTATGCCGGCTGGGCTGACAAATACCATGGGAAAACCATTCCCATTGACGGGGACTACTTCAGCTACACCCGCCATGAACCTGTGGGAGTGTGTGGGCAGATCATCCCA
->Horse
-TTATTATGCTGGCTGGGCCGATAAGTACCATGGGAAAACCATTCCCATCGATGGGGACTTCTTCAGCTACACCCGCCATGAACCTGTGGGGGTGTGTGGGCAGATCATTCCG
->Dog
-TTACTATGCTGGCTGGGCTGATAAGTACCATGGGAAAACCATTCCTATCGATGGGGACTTTTTCAGTTATACCCGCCATGAACCTGTCGGGGTGTGCGGGCAGATCATTCCA
diff --git a/PhyloCSF_Examples/Aldh2.mRNA.fa b/PhyloCSF_Examples/Aldh2.mRNA.fa
deleted file mode 100644
index 9beb3e2..0000000
--- a/PhyloCSF_Examples/Aldh2.mRNA.fa
+++ /dev/null
@@ -1,132 +0,0 @@
->Mouse|NM_009656.3
----ATTCTCTTCGCCGCCATATCTGCACAGATGTGAGCCTTAGGC-----GCCAGCCACC
-CTGCTAGGAGCGCACACCACTCTGGCTAGGCTTTCTCAGGGTTCTGCAAACTCCATCT--
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------CTGACTTGGCTTTGGGAGCCAGGGGTCGCGCCCCTT
-AGGCCGTGAGGGGCTGGGACTCCCTGACCACGCCCCCGTGTCTCCGCCTCCCATTGGCGG
-CTGCAGGGGGCGGAGGCGAGGACTTGTTCTTCAACGCTGCAGTCGCCCTCCGATCGGCAA
-GGCTTCTCTCGGCTCCGTTCGGCTCGGCTCGCCCATTTCAGTTCAGTTCGGGTCAGTTAA
-GCTCCGCTCAGTTCAGCATGCTGCG---CGCCGCACTCACCACTGTCCGCCGCGGACCGC
-GCCTGA---GCCGCCTGTTGTCCGCCGCCGCCACCAGCGCGGTGCCAGCCCCCAACCATC
-AGCCTGAGGTCTTCTGCAACCAGATCTTCATTAACAATGAGTGGCACGACGCCGTCAGCA
-GGAAAACATTTCCCACCGTCAACCCTTCCACAGGGGAGGTCATCTGCCAGGTGGCCGAAG
-GGAACAAGGAGGACGTAGACAAGGCAGTGAAGGCTGCTCGTGCAGCCTTCCAGCTGGGCT
-CGCCCTGGCGCCGCATGGATGCATCTGACCGGGGCCGGCTGTTGTACCGATTGGCGGATC
-TCATTGAACGGGACCGGACCTACCTAGCGGCCTTGGAGACCCTGGACAACGGCAAGCCTT
-ATGTCATCTCGTACCTGGTGGATTTGGACATGGTCCTGAAATGTCTCCGCTATTACGCTG
-GCTGGGCTGACAAGTACCATGGGAAAACCATTCCCATCGACGGCGACTTCTTCAGCTATA
-CCCGCCATGAGCCTGTGGGCGTGTGTGGACAGATCATTCCGTGGAACTTCCCGCTCCTGA
-TGCAAGCATGGAAACTGGGCCCAGCCCTGGCAACCGGGAACGTGGTGGTGATGAAGGTGG
-CCGAGCAGACACCGCTCACCGCGCTCTACGTGGCCAACTTGATCAAGGAGGCAGGCTTTC
-CCCCTGGCGTGGTCAATATCGTTCCCGGATTCGGCCCTACCGCCGGGGCTGCCATCGCAT
-CCCATGAGGGTGTGGACAAAGTGGCGTTCACAGGCTCCACGGAGGTTGGTCACCTAATCC
-AGGTGGCCGCCGGGAGCAGCAACCTCAAGAGAGTAACCCTGGAGCTGGGGGGAAAGAGTC
-CCAACATCATCATGTCCGACGCTGACATGGACTGGGCTGTGGAGCAGGCCCACTTTGCCC
-TGTTCTTCAACCAGGGCCAGTGCTGCTGCGCAGGCTCCCGGACCTTCGTGCAGGAGAATG
-TGTATGACGAATTCGTGGAACGCAGCGTGGCTCGGGCCAAGTCTCGGGTGGTGGGGAACC
-CCTTCGACAGCCGGACGGAGCAGGGGCCTCAGGTGGATGAAACTCAGTTTAAGAAGATCC
-TCGGCTACATCAAATCGGGACAACAAGAAGGGGCGAAGCTGCTGTGTGGTGGGGGCGCTG
-CCGCGGACCGTGGCTACTTTATCCAGCCCACCGTGTTCGGGGACGTAAAAGACGGCATGA
-CCATTGCCAAGGAGGAGATCTTTGGACCAGTGATGCAAATCCTCAAATTCAAGACCATCG
-AGGAGGTTGTGGGGCGGGCCAATGATTCTAAGTATGGGCTGGCAGCCGCCGTCTTCACAA
-AGGACCTGGATAAAGCCAATTACCTGTCCCAAGCTCTGCAGGCTGGCACTGTGTGGATCA
-ACTGCTACGATGTGTTTGGGGCCCAGTCTCCATTTGGGGGCTATAAGATGTCAGGGAGTG
-GCAGGGAGCTGGGCGAGTATGGCCTGCAGGCGTACACAGAAGTGAAGACGGTTACTGTCA
-AAGTGCCACAGAAGAACTCGTAAAGCGGCATGCCTGCTTC----CTCAGCCCGCACCCGA
-AAACCCAACAAGAT--------ATACTGAGAAAA---ACCGCCACACACACTGCGCCTCC
-AAAGAGAAACCCCTTCACCAAAGTGTCTTGGGTCAAGAAAG-----------AATTTTAT
-AAACAGGGCGGGGCTGGTGGGGGGGAAAGCTCCTGATAAACTGGGTAGGGGATGAAGCT-
------------CAA--------------TGCAGACCGATC--------ACGCGTCCAGAT
-GTG--------------CAGGATGCTGCCTTCAACCTGCAGTCCCTAAGCAGCAAATGAG
-CAATAA---------AAATCAGCAGATCAAAGCCACGG----------GGTCAGTTCTCT
-------------------------------------------------------------
---------------------
->Human|NM_000690.2
-ACCTCGTTCATCTCCTTCACCTCCGAAATGATCTCGCTTTTGGGTTTACGGCCGGTCTCT
-TCACCTGGAGCATCAGCCGGGAAGGTCAGGGTCGCCCTGGCTCGGGCCTGTTCACATTGG
-GGTCAAAGGCACACATTGGGGGCTCAACCAAGGCGAGCTGCGTTCGCGGGGCCGGGTCTT
-TCCGCACAGGCGGAGGGCGGTGGCGGGCGCGGAGGCGTCGCGCGAGCCAGGGGGCAGCCA
-CGGGCCGGGGGTACCTAGCGCCACCCGCTTCGCTTGCATCAGCTGCGCGCCCCATCCCGA
-GGAATGGTAGAGGCAGCCCCGCCCCCGGCCCGCCCCCGC-------CTTTCCATTGGCTG
-CCGCGCGGGGCGGGGAGCGGGGTCGGCT-----------CAGTGGCCCTGAGACC-CTAG
-CTCTGCTCTCGGTCCGCTCGCTGTCCGCTAGCCCGCTGCG--------------------
------------------ATGTTGCG------------CGCTGCCGCCCGCTTCGGGCCCC
-GCCTGGGCCGCCGCCTCTTGTCAGCCGCCGCCACCCAGGCCGTGCCTGCCCCCAACCAGC
-AGCCCGAGGTCTTCTGCAACCAGATTTTCATAAACAATGAATGGCACGATGCCGTCAGCA
-GGAAAACATTCCCCACCGTCAATCCGTCCACTGGAGAGGTCATCTGTCAGGTAGCTGAAG
-GGGACAAGGAAGATGTGGACAAGGCAGTGAAGGCCGCCCGGGCCGCCTTCCAGCTGGGCT
-CACCTTGGCGCCGCATGGACGCATCACACAGGGGCCGGCTGCTGAACCGCCTGGCCGATC
-TGATCGAGCGGGACCGGACCTACCTGGCGGCCTTGGAGACCCTGGACAATGGCAAGCCCT
-ATGTCATCTCCTACCTGGTGGATTTGGACATGGTCCTCAAATGTCTCCGGTATTATGCCG
-GCTGGGCTGATAAGTACCACGGGAAAACCATCCCCATTGACGGAGACTTCTTCAGCTACA
-CACGCCATGAACCTGTGGGGGTGTGCGGGCAGATCATTCCGTGGAATTTCCCGCTCCTGA
-TGCAAGCATGGAAGCTGGGCCCAGCCTTGGCAACTGGAAACGTGGTTGTGATGAAGGTAG
-CTGAGCAGACACCCCTCACCGCCCTCTATGTGGCCAACCTGATCAAGGAGGCTGGCTTTC
-CCCCTGGTGTGGTCAACATTGTGCCTGGATTTGGCCCCACGGCTGGGGCCGCCATTGCCT
-CCCATGAGGATGTGGACAAAGTGGCATTCACAGGCTCCACTGAGATTGGCCGCGTAATCC
-AGGTTGCTGCTGGGAGCAGCAACCTCAAGAGAGTGACCTTGGAGCTGGGGGGGAAGAGCC
-CCAACATCATCATGTCAGATGCCGATATGGATTGGGCCGTGGAACAGGCCCACTTCGCCC
-TGTTCTTCAACCAGGGCCAGTGCTGCTGTGCCGGCTCCCGGACCTTCGTGCAGGAGGACA
-TCTATGATGAGTTTGTGGAGCGGAGCGTTGCCCGGGCCAAGTCTCGGGTGGTCGGGAACC
-CCTTTGATAGCAAGACCGAGCAGGGGCCGCAGGTGGATGAAACTCAGTTTAAGAAGATCC
-TCGGCTACATCAACACGGGGAAGCAAGAGGGGGCGAAGCTGCTGTGTGGTGGGGGCATTG
-CTGCTGACCGTGGTTACTTCATCCAGCCCACTGTGTTTGGAGATGTGCAGGATGGCATGA
-CCATCGCCAAGGAGGAGATCTTCGGGCCAGTGATGCAGATCCTGAAGTTCAAGACCATAG
-AGGAGGTTGTTGGGAGAGCCAACAATTCCACGTACGGGCTGGCCGCAGCTGTCTTCACAA
-AGGATTTGGACAAGGCCAATTACCTGTCCCAGGCCCTCCAGGCGGGCACTGTGTGGGTCA
-ACTGCTATGATGTGTTTGGAGCCCAGTCACCCTTTGGTGGCTACAAGATGTCGGGGAGTG
-GCCGGGAGTTGGGCGAGTACGGGCTGCAGGCATACACTGAAGTGAAAACTGTCACAGTCA
-AAGTGCCTCAGAAGAACTCAT-AAGAATCATGCAAGCTTCCTCCCTCAGCCATTGATGGA
-AAGTTCAGCAAGATCAGCAACAAAACCAAGAAAAATGATCCTTGCGTGCTGAATATCTGA
-AAAGAGAAATTTTTCCTACAAAATCTCTTGGGTCAAGAAAGTTCTAGAATTTGAATTGAT
-AAACATGGTGG-GTTGGCTGAGGGTAA---------------GAGTATATGAGGAACCTT
-TTAAACGACAACAA---TACTGCTAGCTTTCAGGATGATTTTTAAAAAATAGATTCAAAT
-GTGTTATCCTCTC--TCTGAAACGCTTCCTATAACTCGAGTTTATAGGGGAAGAAA-AAG
-CTATTGTTTACAATTATATCACCA--TTAAGGCAACTGCTA-CACCCTGCTTTGTATTCT
-GGGCTAAGATTCATTAAAAACTA-GCTGCTCTTAAAAAAAAAAAAAAAAAAAAAAAAAAA
-AAAAAAAAAAAAAAAAAAAA
->Dog|XM_848535.1
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------------------------------------------
-------------------------------------------------------------
-----------------------------------------------TCGCTCCGTCCCGC
-AGG-------------------------CCCGCTCCCGC---------------------
-------------------------------------------------------------
-------------------------------------------------------------
------------CGCAGCATGTTGCGCGCCGCCGCGCTCGCTGCCGCCGGCCTCCGGCCCC
-GCCTGGGCCGCCGCCTCCTGTCGGCCGCCTCCTCCCAGGCCGTGCCGGCCCCCAACCAGC
-AGCCCGAGGTCTTCTACAACCAGATCTTCATAAACAATGAGTGGCACGATGCTGTTAGCA
-AGAAAACGTTCCCCACCATCAATCCATCCACTGGAGAAGTCATCTGTCAGGTAGCTGAAG
-GAGATAAGGAAGATGTGGACAAGGCAGTAAAGGCTGCCCGGGCTGCCTTCCAGCTAGGTT
-CACCCTGGCGCCGCATGGACGCATCTGACAGAGGCCGCTTGCTGAACCGCCTGGCAGATC
-TGATTGAGCGAGACCGGACCTATCTGGCAGCCTTGGAGACCCTGGATAATGGCAAGCCCT
-ATGTCATCTCTTACCTTGTGGATCTGGACATGGTCCTCAGATGCCTCCGTTACTATGCTG
-GCTGGGCTGATAAGTACCATGGGAAAACCATTCCTATCGATGGGGACTTTTTCAGTTATA
-CCCGCCATGAACCTGTCGGGGTGTGCGGGCAGATCATTCCATGGAACTTCCCCCTCCTGA
-TGCAAGCCTGGAAACTGGGCCCAGCTCTGGCGACCGGAAATGTGATTGTGATGAAGGTAG
-CTGAGCAGACTCCACTCACTGCCCTGTATGTGGCCAACCTGATTAAGGAGGCTGGCTTTC
-CTCCTGGCGTGGTCAATATTATTCCTGGATTTGGCCCCACAGCTGGGGCTGCCATCGCCT
-CCCACGAGGATGTGGACAAAGTGGCCTTCACAGGCTCCACCGAGGTTGGCCACCTAGTCC
-AGGTTGCTGCAGGGAACAGTAACCTCAAGAGAGTGACCCTGGAGCTGGGAGGAAAGAGCC
-CCAATATCATCATGTCAGATGCAGACATGAACTGGGCCGTAGAGCAGGCCCACTTTGCCC
-TGTTCTTCAACCAGGGCCAGTGCTGCTGTGCCGGCTCCCGGACCTTTGTGCAAGAAGATG
-TTTATGCTGAGTTTGTGGAGCGGAGTGTTGCCAGGGCCAAGTCACGTGTAGTTGGGAACC
-CCTTTGACAGCCAGACTGAGCAGGGGCCACAGGTGGATGAAACTCAGTTTAAGAAGATCC
-TTGGTTATATCAAATCTGGGAAGGAGGAGGGGGCGAAACTATTGTGTGGTGGAGGGGCGG
-CTGCTGACCGAGGCTACTTTATCCAGCCCACCGTGTTTGGAGATGTACAAGACACCATGA
-CTATCGCCAAGGAGGAGATCTTTGGGCCAGTGATGCAGATCCTGAAGTTCAAGACCATAG
-AGGAAGTTATTGGGAGAGCCAATAATTCCAAGTATGGGCTGGCTGCAGCTGTCTTCACCA
-AGGACTTGGACAAAGCCAATTATCTGTCCCAAGCCCTCCAGGCTGGCACTGTGTGGATCA
-ACTGCTATGATGTATTTGGGGCCCAGTCACCATTCGGTGGCTACAAGATGTCTGGGAGTG
-GCCGGGAGCTGGGAGAGTATGGGTTGCAGGCATACACGGAAGTGAAAACTGTCACGATCA
-AAGTGCCTCAGAAGAACTCCTAAAGAACTCCACCAGCTCCCTCACTCATCCAGCGACTGA
-GG--TCAAGGACATCAGCAGCAAAACCAAGAAAAATGACGCTTGCACACGAAAAGTCTCA
-AGAGAGAAATTTGCTCA-TAGAATCTCTT-GATCAAGAAAGTCACAGATTTTGAATTGGT
-AAATGGGA----GTGGGTGCAGGGCAAA--------------GAGTACAGGGAGAGCCTT
-TTACCCTGCAACAGTACTACTGCTAGGTTTCAGGCTGATTTTTCAAAACTAGATTCAAAT
-GTCTTATCTTGTCCATCTGGTATCCTT-CTGTAACTTGCCCTTGTGGGGGAACAAA-AAG
-CTATTGTTTATCCTTGTACTAACAAGTTGGGGCAACAACTAGTGCCTTCCTTTGTATTCT
-GGACTAAAACTCATTAAAAACAATGCTGC-------------------------------
---------------------
diff --git a/PhyloCSF_Examples/tal-AA.fa b/PhyloCSF_Examples/tal-AA.fa
deleted file mode 100644
index 9fcdc74..0000000
--- a/PhyloCSF_Examples/tal-AA.fa
+++ /dev/null
@@ -1,10 +0,0 @@
->dmel|chr3R:9,639,593-9,639,688|
-ATGCTGGATCCCACTGGAACATACCGGCGACCACGCGACACGCAGGACTCCCGCCAAAAGAGGCGACAGGACTGCCTGGATCCAACCGGGCAGTAC
->dana
-ATGCTGGATCCCACAGGAACGTACAGGCGACCCCGCGACTCGCAGGACACACGCCAGAAGCGGCGCCAGGATTGCCTGGATCCAACCGGGCAGTAC
->dpse
-ATGCTGGATCCCACAGGAACCTACCGTCGCCCACGCGACACAAAAGACACACGCCAGAAACGGCGTCAGGACTGCCTAGATCCCACCGGGCAGTAC
->dwil
-ATGCTGGATCCAACTGGTACATATCGCCGACCAAGGGATACACAGGACACACGCCATAAACGGC---------GCCTGGATCCAACTGGACAATAT
->dvir
-ATGCTGGATCCAACGGGCACCTATCGGCGGCCGCGTGAGTCGCGTGACACGCGCCACAAGCAGCGGCAGCTGGCGCTGGATCCTACCGGGCAGTAC
diff --git a/PhyloCSF_Parameters/100vertebrates.nh b/PhyloCSF_Parameters/100vertebrates.nh
deleted file mode 100644
index d9039f2..0000000
--- a/PhyloCSF_Parameters/100vertebrates.nh
+++ /dev/null
@@ -1,100 +0,0 @@
-((((((((((((((((((Human:0.00655,
- Chimp:0.00684):0.00422,
- Gorilla:0.008964):0.009693,
- Orangutan:0.01894):0.003471,
- Gibbon:0.02227):0.01204,
- (((Rhesus:0.004991,
- Crab_eating_macaque:0.004991):0.003,
- Baboon:0.008042):0.01061,
- Green_monkey:0.027):0.025):0.02183,
- (Marmoset:0.03,
- Squirrel_monkey:0.01035):0.01965):0.07261,
- Bushbaby:0.13992):0.013494,
- Chinese_tree_shrew:0.174937):0.002,
- (((Squirrel:0.125468,
- (Lesser_Egyptian_jerboa:0.1,
- ((Prairie_vole:0.08,
- (Chinese_hamster:0.04,
- Golden_hamster:0.04):0.04):0.06,
- (Mouse:0.084509,
- Rat:0.091589):0.047773):0.06015):0.1):0.022992,
- (Naked_mole_rat:0.1,
- (Guinea_pig:0.065629,
- (Chinchilla:0.06,
- Brush_tailed_rat:0.1):0.06):0.05):0.06015):0.025746,
- (Rabbit:0.114227,
- Pika:0.201069):0.101463):0.015313):0.020593,
- (((Pig:0.12,
- ((Alpaca:0.047275,
- Wild_bactrian_camel:0.04):0.04,
- ((Dolphin:0.034688,
- Killer_whale:0.039688):0.03,
- (Tibetan_antelope:0.1,
- (Cow:0.1,
- (Sheep:0.05,
- Domestic_goat:0.05):0.05):0.01):0.013592):0.025153):0.020335):0.02,
- (((Horse:0.059397,
- White_rhinoceros:0.025):0.05,
- (Cat:0.098612,
- (Dog:0.052458,
- (Ferret:0.05,
- (Panda:0.02,
- (Pacific_walrus:0.02,
- Weddell_seal:0.02):0.02):0.03):0.03):0.02):0.049845):0.006219,
- ((Black_flying_fox:0.05,
- Megabat:0.063399):0.05,
- (Big_brown_bat:0.02,
- (Davids_myotis:0.04,
- Microbat:0.04254):0.05):0.06):0.033706):0.004508):0.011671,
- (Hedgehog:0.221785,
- (Shrew:0.169562,
- Star_nosed_mole:0.1):0.1):0.056393):0.021227):0.023664,
- (((((Elephant:0.002242,
- Cape_elephant_shrew:0.05):0.04699,
- Manatee:0.1):0.049697,
- (Cape_golden_mole:0.03,
- Tenrec:0.235936):0.01):0.03,
- Aardvark:0.03):0.02,
- Armadillo:0.169809):0.006717):0.234728,
- (Opossum:0.125686,
- (Tasmanian_devil:0.1,
- Wallaby:0.072008):0.05):0.2151):0.071664,
- Platypus:0.456592):0.109504,
- (((((Rock_pigeon:0.1,
- ((Saker_falcon:0.1,
- Peregrine_falcon:0.1):0.03,
- (((Collared_flycatcher:0.04,
- ((White_throated_sparrow:0.034457,
- Medium_ground_finch:0.041261):0.015,
- Zebra_finch:0.06):0.01):0.052066,
- Tibetan_ground_jay:0.06):0.025,
- (Budgerigar:0.046985,
- (Puerto_Rican_parrot:0.026,
- Scarlet_macaw:0.026):0.01):0.04):0.064703):0.06):0.05,
- (Mallard_duck:0.1,
- (Chicken:0.041254,
- Turkey:0.085718):0.031045):0.09):0.22,
- American_alligator:0.25):0.045143,
- ((Green_seaturtle:0.1,
- Painted_turtle:0.1):0.05,
- (Chinese_softshell_turtle:0.1,
- Spiny_softshell_turtle:0.1):0.05):0.04):0.01,
- Lizard:0.447):0.122):0.05,
- Frog_X._tropicalis:0.977944):0.1,
- Coelacanth:0.977944):0.111354,
- (((((((Tetraodon:0.124159,
- (Fugu:0.103847,
- Yellowbelly_pufferfish:0.1):0.1):0.09759,
- (Nile_tilapia:0.1,
- (Princess_of_Burundi:0.05,
- (Burtons_mouthbreeder:0.05,
- (Zebra_mbuna:0.05,
- Pundamilia_nyererei:0.05):0.05):0.05):0.1):0.1):0.09759,
- (Medaka:0.38197,
- Southern_platyfish:0.4):0.1):0.015,
- Stickleback:0.246413):0.045,
- Atlantic_cod:0.25):0.22564,
- (Zebrafish:0.430752,
- Mexican_tetra:0.4):0.3):0.143632,
- Spotted_gar:0.4):0.326688):0.2,
-Lamprey:0.975747);
diff --git a/PhyloCSF_Parameters/100vertebrates_coding.ECM b/PhyloCSF_Parameters/100vertebrates_coding.ECM
deleted file mode 100644
index f894011..0000000
--- a/PhyloCSF_Parameters/100vertebrates_coding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-0.771493279396
-14.5180982851 0.547433994462
-0.829799770357 31.1892114825 0.7020007509
-1.2357249048 0.0591436724948 0.143021129459 0.0723670336788
-0.0491379655094 1.68015082454 0.0198294354489 0.039540785463 10.4536837099
-0.0705620171551 0.0966709944264 1.69743422922 0.142387839362 91.937054195 27.5243026465
-0.0429527042192 0.105163194816 0.0172649210373 2.25040676661 10.8921310832 29.7216988175 32.0319353336
-7.4338524426 0.17080527673 0.354723692547 0.186750900063 1.57462078709 0.053744234112 0.0267286337571 0.0670392311205
-0.15475952294 7.04751773186 0.133727701692 0.272371840933 0.0995168546074 2.91545126347 0.241247972617 0.30307911252 1.14819950914
-0.523684400979 0.193336177917 7.27785844907 0.248082744588 0.28292064082 0.0737402201706 2.22444630107 0.0911973524823 39.1328554206 1.20406413448
-0.173018086183 0.206353768518 0.171683630752 10.768130388 0.0919414494248 0.0323218254172 0.205978125948 4.34740100489 1.16358434945 33.6941468224 1.7233728365
-0.72844506036 0.0408900267574 0.0984268008214 0.0606490247723 6.27625068709 0.108522818556 0.732902667282 0.156984045956 1.27333682927 0.0371320946863 0.190371215329 0.0649658426497
-0.0107338084319 0.332629598166 0.0135926658879 0.022093725551 0. 2.18866127674 0.143671679617 0.121521316476 0.0119565599453 0.549500917257 0.0356995023641 0.0243544304587 12.7843674905
-0.0520823421344 0.0350655628839 0.405289748819 0.067795684311 1.27336050355 0.160287788944 6.57922720905 0.299427412867 0.0786854813099 0.0488940935773 0.960805451861 0.0665927661081 5.34516996652 0.736796631636
-0.0216049508162 0.0160718839072 0.0223163001706 0.605907271879 0.0245681166778 0.0205049564898 0.158269973844 3.87244486996 0.0304252144396 0.0317223740088 0.0589426989831 0.873730975438 9.99938453006 25.8255751638 1.22569015347
-2.18663674868 0.111696040966 0.0634197481102 0.154784667253 0.211944334747 0.0142851196137 0.0249872010961 0.0178329430869 0.632866998477 0.0456544602052 0.155643358185 0.0852409113534 0.114188793132 0.00538347477404 0.0172684858959 0.00982443430665
-0.0806194749382 1.82202603689 0.0700874839516 0.139029576933 0.0180592441769 0.131956497224 0.0167764425897 0.0204819995985 0.0337369858375 0.495354204564 0.0430768582 0.0598964584571 0.00958027358921 0.0336402412939 0.0100876385187 0. 2.33982994684
-0.0813812527058 0.072537901315 0.967025850778 0.0745340778643 0.0311639252932 0.00984056819269 0.180306689601 0.00854548443289 0.0545028256988 0.042940471875 0.398138428286 0.0395461759513 0.0155719958588 0.00453736963474 0.0574916836341 0.00557974117017 23.6795913232 1.61299074838
-0.0890303815424 0.0309711104056 0.075284329732 2.72022205635 0.0173828570078 0.00889347376972 0.0250244061361 0.189896560082 0.0470550538246 0.0369691647928 0.0517741235211 0.814461875725 0.0113513697564 7.49810654027e-05 0.0161305091349 0.0857488913528 2.52155138217 51.8301587085 1.73431675231
-0.0831502869336 0.00623291475441 0.0140485960681 0.00222815351908 1.85271487285 0.0142595343747 0. 0.0240393018298 0.100035548941 0.00744094731676 0.0208705373804 0.00714801356087 0.202643068745 0.00840395811706 0.0485674719118 0. 2.58108992655 0.0610588913053 0.288098926224 0.0640178651307
-0.0121507251646 0.0924520030781 0.00836826924209 0.0186151696838 0.0836537312744 1.54107027962 0.0440270652618 0.131930258067 0.00717636251265 0.120684206891 0.0125595231276 0.0212153052835 0.000324249078674 0.075269096427 0.0148448619927 0.0162954435488 0.135980978245 1.38509214833 0.0582990476554 0.097001138788 10.3565106085
-0.0327561377247 0.0194019854761 0.151645046369 0.0216308024113 0.16219698802 0.0736088846667 3.56703356477 0.0906683018246 0.0211444376486 0.0293098893392 0.213048465069 0.030853222824 0.105229675827 0.0117895396449 0.238615514744 0.00758025850283 0.383949439837 0.217940094945 3.42317049457 0.151800096828 80.196430788 26.5641853165
-0.00712174354816 0.00723985090453 0.00595505344662 0.0975294587912 0.0438607458733 0.0573004108171 0. 2.03540765518 0.0049271871924 0.0089011742123 0.00755042591788 0.131884297209 0.0101448079456 0.00832642054426 0.0156458916585 0.109023373526 0.0378815314904 0.0463207771448 0.0165605454301 1.6138138067 9.1542408524 28.6750081769 21.9548306605
-0.342652952354 0. 0.00831817472204 0.0019578776316 0.0256561801987 0.00396518185496 0. 0.00828598360004 24.819368396 0. 0.692289530387 0.00221688308001 0.0423207748289 0. 0.00421964524011 0.0102462249253 9.72150853477 0.287135700558 0.111035024588 0.161520784401 0.987246541018 0.0268612351287 0.14984953371 0.0013382555295
-0.0274952800589 0.239907400328 0.130619934855 0.0199908101654 0.00651256013327 0.0940574219685 0.0188049255523 0.0154651516836 0.731121345902 1.44205827826 1.47351708949 0.0159273184405 0. 0.0478071542405 0.00524987299297 0. 0.337092192699 7.2223642138 0.298762023217 0. 0.0197476073108 0.971106449371 0.23665637847 0.000783759865199 22.6147561126
-0.126747246284 0.00525348090503 0.431201251443 0.00871397252545 0.00260008330902 0.00505104531015 0.154413324232 0. 1.38751553761 0.0069785180879 24.2115845119 0. 0.0154314907887 0. 0.026146215906 0.00674642096354 0.249262272475 0.264254321875 5.15802336393 0.282622534951 0.100276942636 0.0464677107833 2.8678028547 0.0103939496336 58.2624766604 19.1638370992
-0.0407572307445 0.0541760472627 0.0408884489312 0.594154801521 0.00637997251286 0.0198824741158 0.0398930112025 0.199496998649 0.131755897653 0.18449888875 0.326574404736 2.81319866554 0.014151320102 0.0153460674176 0.00990532258908 0.0946255220831 0.573596562106 0.632515608499 0.283840725565 16.0063596615 0.075905929081 0.0826477869133 0.145510045956 1.80628209641 29.347029641 79.0811920949 24.1343195351
-0.0670321669475 0.000563067043618 0.00709263218583 0.0160730475881 0.397475218922 0.0108774166451 0.0224531700364 0.0117432492443 0.110217799898 0.00741770540948 0.0106037107321 0.00421212203971 6.34377872097 0. 0.30644392794 0.0507575748744 1.9736613358 0.0556021195246 0.102283849299 0.0480436043823 4.00887120044 0.0417641609514 0.653798644135 0.0359958557139 1.53421130077 0.0163428855889 0.117515458291 0.0242819224677
-0.00643748166518 0.0295649828891 0.000637970407505 0.019754645672 0.0030508665228 0.178930335275 0. 0.00883618689765 0.0253554586766 0.0635021784113 0.0114766272275 0.0282686114778 0.159188805299 2.05296843661 0.0831033972167 0.158454009429 0.0790863053832 0.843181005219 0.0366298173461 0.107941366273 0.0245725600104 1.92780227841 0.103817357813 0.139569513175 0.0230997188178 0.954192866331 0.0226992195858 0.144293124685 11.6702094631
-0. 0.000741264056699 0.0321762732716 0.00876551202277 0.0409627203061 0.0066341456828 0.289776596366 0.0104730362024 0.00188148859201 0.00415933999863 0.0531027228242 0.00397499828712 0.277347255409 0.081204120774 1.47530308516 0.0831617109488 0.0348369494271 0.0330910542007 0.514722517892 0.0315293996595 0.448937601962 0.0560895061976 3.50959324007 0.0672410028933 0.000363858402076 0.0325302162526 0.698509928297 0.0222160316559 31.3936914479 7.82675950727
-0.0103057326894 0.0209560410928 0. 0.0432390313139 0. 0.000598674783837 0. 0.331194702356 0.0159021216996 0.0263734927337 0.0229446661305 0.0793998208566 0.0655491795789 0.0771818086854 0.0755945133111 2.56835350509 0.0801848672594 0.0780599264085 0.0459870926371 1.38822655563 0.0245587112418 0.105445060089 0.157688337733 2.56327777985 0.00606283188176 0.0292401665627 0.0516866860149 1.68499310101 9.08011950879 26.1164046404 6.89513673659
-1.52942036217 0.0973183013281 0.0388353247448 0.117166119514 0.201990514263 0.015333596402 0.0128796043445 0.0124927834828 0.391532889031 0.0313292278453 0.0213395537798 0.046335054843 0.111001960231 0.00549068726692 0.0162640654866 0.00404973027084 1.6718235251 0.0500267310822 0.0517100980774 0.0537247281374 0.0619851968551 0.00546186911396 0.00987533716152 0.00386417990485 0.0791417803087 0.0355024148452 0. 0.0324557541248 0.0530512896758 0.0027411404153 0.003400456723 0.00422901561025
-0.0827672478108 2.45968541101 0.0634654669355 0.173632559347 0.0131604282059 0.164795491269 0.0131791154447 0.0351360772548 0.0335412538099 0.474036367211 0.03667071173 0.0671758266016 0.0124420599637 0.0313192578121 0.00897011881742 0.0123210571936 0.0862780006103 0.62622938248 0.0460793037594 0.0418612404259 0.00488689931062 0.0558122415879 0.0175672823754 0.00628262205823 0.00715550696459 0.0910460725338 0.00443029935197 0.0287613924571 0.00313419211364 0.0319575833704 0.00226776365132 0. 1.70115845114
-0.0522505604502 0.0898926251941 1.06240549924 0.112920569564 0.0463514147993 0.0149556757989 0.290216053777 0.0126916204037 0.0444314578346 0.0425138927353 0.346736063384 0.0532746125015 0.0239887410771 0.00428625042153 0.0806840702641 0.00726198943985 0.0617898168537 0.0606229656609 0.929748659037 0.0607814405512 0.0130660362186 0.00815276835162 0.144015583909 0.00475002529722 0.0297003498473 0. 0.132271963252 0.0101996218813 0.00843968014492 0.00444182503798 0.0259434869283 0.00418488182163 13.9895365789 1.74259584965
-0.069879625366 0.0502569650608 0.0601726449853 3.10841773214 0.0194174772813 0.00880592559668 0.026064139331 0.183837737792 0.0384232333402 0.0386598563856 0.028491177004 0.66561597344 0.0178802430678 0.0106144479446 0.010721316501 0.0584953860606 0.0488555874011 0.0240956518334 0.0447701807091 0.81606944054 0.00601727190495 0.00644546124483 0.00707166378557 0.0505635979412 0. 0.00103456844645 0.00427279006237 0.187146494621 0.00269164053833 0. 0.00100987468273 0.047653345948 1.4140884143 23.7236399779 1.55601401505
-0.181158453397 0.0260123477086 0.0397790253368 0.0100844740285 8.86889734423 0.0461483266391 0. 0.107929568028 0.256807798045 0.0320388886734 0.0695661905816 0.0188244726856 0.942228107881 0. 0.280430428925 0. 0.177260190745 0.0103616000988 0.0309089068449 0.00733443583341 2.08534651761 0.0619419333752 0.0385046664547 0.040395753471 0.063159608537 0.00541444268653 0.00590389620526 0.00982289064588 0.298133346746 0.00680478222793 0.0432921772456 0.00757149486997 1.03013073458 0.0486682637201 0.188686676483 0.0246949247744
-0.0122577305366 0.191980971044 0.0161067868229 0.0275695037423 0.14003002796 5.91146468912 0.134860570052 0.387425224734 0.0209047479093 0.400275840087 0.021321233877 0.0329212682449 0.00736037530406 0.286707031154 0.0674343529579 0.0311016087688 0.01510330413 0.0812436776202 0.00951252481602 0.0089036753564 0.0500637131568 1.53342839158 0.129298933272 0.11420040671 0.00657888694428 0.0901221706124 0.00747913674455 0.0199622847226 0.0126688373082 0.175994119126 0.0118295798482 0.00036469247377 0.0486596453358 0.628137800632 0.0473421611494 0.0308176979667 8.69450787125
-0.0555064568149 0.0480629442424 0.276262166032 0.0331518765262 0.562775127606 0.281398177498 15.7085436131 0.333136469932 0.0406317413376 0.107810107191 0.523491550083 0.0915018349276 0.234333738224 0.0552067621755 1.18046200077 0.0590812702434 0.043050916247 0.0231734472692 0.204509977331 0.0233882916335 0. 0.16346581468 6.09067753677 0.0888615500043 0.0279377722441 0.0701278427092 0.269656981301 0.0300336306608 0.0285534734776 0.0334291528371 0.323865691396 0.0205253370633 0.126702292889 0.134698271566 1.9279992831 0.0830503615842 68.895319709 18.1269451688
-0.0105930094914 0.0197467947894 0.00672572148301 0.219652037737 0.0569481631527 0.192199885757 0.0770026769259 8.2030334245 0.00992272063324 0.0406733489963 0.0200757655693 0.465563570471 0.00648442428788 0.0322131056713 0.0652316603109 0.434810615786 0.00266089608895 0.00461778904828 0.00596362923912 0.0916196214411 0.0124266748599 0.0905298871638 0.0352078645817 1.75296746263 0. 0.011915518628 0.0064691624691 0.117966135277 0. 0. 0.00641417426938 0.263264203083 0.0294620633383 0.0517569597285 0.0297106128632 0.775854199415 9.25329006582 21.8046714515 21.0184122059
-0.254177076964 0.0466163962153 0.013775505342 0.0165752917716 0.2541994313 0. 0.0234895802647 0. 3.51441514201 0.0628800416072 0.126836526076 0.113077846139 0.202105100057 0.00982962599455 0.00967118786199 0.0052933427804 0.301915015348 0.0209447385129 0.0262482055616 0.021515034263 0.0805828810913 0.00282008757285 0.0242510782787 0. 0.874922102518 0.0133118469457 0.0278638597687 0.0256982967577 0.0830735772627 0.0140431178472 0.00152631760016 0.00512338828271 2.14076248522 0.109913868096 0.127066667315 0.0860586763677 1.85126960484 0.0189655004627 0.22577819126 0.02214203147
-0.0187961223364 0.536260801381 0.0187201885281 0.0570722129956 0. 0.249122534002 0.0247618945167 0.0347282919429 0.119844529013 5.89713390113 0.135529295696 0.37862421452 0. 0.0716822297298 0.0139552063489 0.0090504051125 0.0143990351069 0.218599982006 0.0201367961938 0.0288787666884 0. 0.0953004938169 0.0184742524512 0.0163365894936 0.0148614517249 0.91696743349 0.010473158236 0.102230161422 0.00781085519074 0.0411893350182 0.00772386312203 7.845967971e-05 0.0513084582793 1.83647544751 0.0711026312034 0.0484847347439 0.0136165169786 1.40745470677 0.258157562514 0.135820730719 8.13762983681
-0.0328636713303 0.0187769783312 0.235179486576 0.0733364272614 0.0926161334728 0.00838022497616 0.408607171412 0.0113896740303 0.230797267043 0.166509619107 4.62098300244 0.355598938915 0.0707469720138 0.00499944094366 0.1819732433 0.0220544026913 0.0721575489303 0.0276836910024 0.222982276164 0.0331777831189 0.0244250690124 0.00613550182328 0.289795200046 0.00732929200673 0.0844588490175 0.0304535572718 1.0957917311 0.0567580546743 0.0173063494738 0.00490556988502 0.0661130308739 0.0183619577456 0.0948448651991 0.101343657162 1.83229308595 0.0912091468367 0.433113687149 0.0715023194908 4.13594806656 0.0258080154165 30.5908569921 10.0811942943
-0.0243094808513 0.0577216517943 0.0200297769648 0.877392683846 0.00616672142884 0.0133710129811 0.0101473425531 0.425742741255 0.141560490571 0.443900074406 0.191187943803 9.36899545687 0. 0.018888775476 0.0149073518673 0.13913130704 0.0462748737881 0.0379647006055 0.0137169525908 0.459494094526 0. 0.0190014624053 0.00446871333479 0.110939295873 0. 0.0330973044641 0.020129035622 1.80187002398 0. 0.00776890685305 0.000484586777783 0.0693812551183 0.0801448777091 0.218228314494 0.10116895754 3.17665838205 0.0223213571149 0.107982033724 0.190590547393 2.20919088952 7.91138478576 34.3882055135 12.7244322854
-0.15434282613 0.00935208126288 0.0151733883381 0.013729475622 1.71785898184 0.0271358624608 0.146655133895 0.0177553776853 0.30178866371 0.0182577297541 0.0375645028041 0.0274235268157 26.8094991811 0. 0.612478351302 0. 0.142234190974 0.0114076697294 0.011520354398 0.0142505051056 0.280313823039 0.00876817134547 0.0630840357167 0.0103192072714 0.0826066155485 0.0047477806076 0.00469973766013 0.00628193768667 4.58278302533 0.0291050999455 0.0296673134073 0.0479828667289 0.725647477002 0.0270877926263 0.0588757234687 0.0273951850099 6.40325605509 0.0438568294629 0.732225073977 0.00651736008295 1.44810954129 0.0184942984015 0.172245324759 0.0349897269167
-0.00969533647635 0.0999488616985 0.0052454488918 0.0131800710292 0.0337929099917 1.0749439893 0.0326869238681 0.111456192054 0.0264268584625 0.224134039428 0.0199444908588 0.0290530701962 0.562736693539 10.7237952641 0.118229726105 0.506770835596 0.0102800806728 0.0606173209593 0.00751054512132 0.0133113286074 0.0105443090872 0.183782605146 0.0204709347631 0.0276985652596 0.00129705656982 0.0754620175889 0. 0.025804891967 0.030298070793 2.03508410924 0.0447055642363 0.132059900606 0.0301183881127 0.37615525312 0.015908228653 0.0213106603965 0.0431287073534 3.93391823581 0.275853026894 0.265254577006 0. 0.929017326538 0.0360346586025 0.121805115134 12.2774917757
-0.00781203656183 0.00305032194564 0.0716340021864 0.00950419017431 0.290444381626 0.0363585294956 1.48832591097 0.0531160643028 0.00529187417067 0.0181792465187 0.1898146219 0.0202367292531 1.25814605694 0.340506545072 3.55342590032 0.340626708068 0.00543938441184 0.00876335637772 0.0465035840453 0.00925919109869 0.0557620647879 0.0126977754034 0.284454447223 0.0133494203904 0. 0.00517806534409 0.0414239861961 0.0147777238638 0.0411492373521 0.0355017967194 1.07082122249 0.0287025328326 0.0124956170788 0.0109304744587 0.34347636804 0.0163556298762 1.02652889428 0.14159544335 6.96484884785 0.145598748684 0.0100539151045 0.00261004468069 1.03235017399 0.0320664273316 34.9286691378 8.23239114357
-0.0114083420209 0.0199984874197 0.00840313920552 0.139176400973 0.0135290119007 0.0655614948349 0.0271933719352 1.45516931 0.0142193129151 0.0186767358189 0.0235742444493 0.348139821213 0.292921217267 0.0772705614775 0.146955588856 13.0029095601 0.0128252811737 0.0160174998411 0.00344783997877 0.0854516604554 0. 0.0306215484952 0.00135298295599 0.197945344879 0.00398803702332 0. 0.0112408821513 0.130903293586 0.0345087851993 0.0350951206775 0.024019772453 2.51762209502 0.0236558879595 0.033012214447 0.0321554878851 0.53405164739 0.0272060510773 0.175337751612 0.294680297433 5.21552771342 0.0246904606628 0.0948001199036 0.0427269667822 1.71316918042 10.4885072326 28.6013786797 8.76793221684
-2.77594356032 0.0993047870626 0.258987813235 0.196747240033 0.159727053992 0.0201599544009 0.0456494718309 0.014416684875 0.453919642655 0.0552728098673 0.176877082092 0.105471229855 0.386772302504 0.00718586592846 0.0321231644917 0.025169217975 6.78299214328 0.375237957265 0.480908376528 0.294621559134 0.387630790093 0.0702904544528 0.169324529386 0.0583382719292 0.390108022986 0.150928696164 0.18405706465 0.0963763242996 0.894999246158 0.0063632664085 0.0562162829768 0.0486748216443 2.62332950228 0.20035925212 0.35459689191 0.134554657987 0.228256251997 0.0429382995137 0.0430277011087 0. 0.499835267232 0.0872802166146 0. 0.00901740735283 0.289857331321 0.0270375266701 0.04838186141 0.0374696887996
-0.0121894520849 0.410790063033 0.011133598533 0.00165056619402 0.0051843131731 0.0431018327577 0.00539237299706 0.0150623598867 0.0170708870198 0.0840406186667 0. 0.0242935664732 0.0080513219032 0.0398494896751 0.00545725560213 0. 0.0790745463878 3.2078145507 0.0532472065717 0.010043455522 0.00635188554487 0.0880596706435 0.013721224767 0.00651922284968 0.025457891714 0.304325536564 0.00707279853229 0.0675357009414 0.0172192049667 0.106767001377 0.00573203678181 0.0136987547062 0.013655212029 0.297543754748 0.0119723251101 0.00318746283208 0.00162010996025 0.0299444434255 0.0108699938489 0.0166143146908 0.00169048351502 0.0635594253576 0.00467473667675 0.0232766714606 0.00173091362045 0.0456155333578 0.00257003829396 0.00549671428511 3.59183812996
-0.0128603903345 0.155272434481 2.90473676882 0.0921884295404 0.018003235893 0.0088919464121 0.332278027108 0.029517979277 0.0950845378976 0.0814115848686 1.02293237377 0.0782302611672 0.124932670117 0.0147696168081 0.209777697594 0.0191860423374 1.17481497084 0.422005627993 7.16881310532 0.519389046385 0.138828982528 0.0537440354805 1.18848446499 0.053710043866 0.258890930878 0.191467019998 2.4094721595 0.233810974308 0.141415434357 0.0802249814486 0.478853644692 0.0570549680101 0.186570124039 0.158525054764 3.30106333889 0.127155955145 0.070267211767 0. 0.703384400913 0.0418228555285 0. 0. 0.981935304195 0.0968146005396 0.0783266440087 0.00763974452017 0.23785171402 0.0201171111811 507.765111884 2.44158816723
-0.0298412769399 0.0122551089064 0.0159708172401 0.662041901317 0.00734282838376 0.0100875430507 0.00631171792731 0.0627729308325 0.00317881402807 0.0217712378384 0.0380502109864 0.181154195019 0.0147807967765 0.000693398311567 0.0108043597623 0.083547251776 0.124351036848 0.181987183493 0.0659530747008 4.28844853026 0.00751655604012 0.0154663468996 0.00513218639619 0.101949747019 0. 0.00997028720563 0.0172390346722 0.836591636433 0.0182342555086 0.019835677565 0.0069782151758 0.16156444993 0.022796908347 0.0389716219568 0.0269186753463 0.441801768503 0.00596547916974 0.014701676295 0.00739562555348 0.0342721533618 0.00495950613705 0.0217814491004 0.00623597741371 0.141948440236 0.0124771328796 0.0118889570172 0.00259482001219 0.0781727135773 2.98967538063 49.2839591139 3.316675155
-0.0722278190998 0.00500866092764 0.0173192942569 0.023154035384 3.4470883287 0.0171508279517 0.0554954011444 0.091309482244 0.0662760011389 0.00829980119382 0.022354058005 0.0338946495945 0.235314951058 0. 0.0763098378531 0.0332331474469 0.286505793562 0.01505939157 0.0464968416988 0.0254099705532 6.29714726079 0.0976069040919 0.476439604983 0.0361553588411 0.122280514014 0. 0.040880462884 0.0107976740267 0.516163749196 0.011360889129 0.0121972794524 0.0203193196188 0.0695019404399 0.00472048511553 0.0113007052678 0.0118761160785 4.26073713503 0.0861649940812 0.310162417427 0.051843758979 0.103507527036 0. 0.0457793711362 0. 0.430028495412 0. 0.0801999766326 0.0205470075237 2.81788640408 0.00323540880644 0.44167841641 0.0268487689328
-0.0109315724616 0.144616714606 0.00821707597789 0.000456726857907 0.0764913882054 2.45357074876 0.0661435744316 0.176744922702 0.00819456481366 0.266597495417 0.0182759357264 0.00846119421793 0.0313617134389 0.0966495049223 0.0162790413192 0.00163711843708 0.0369439154618 0.234872736279 0.0123576787921 0.0265123221939 0.036042397569 4.81163765756 0.150265642397 0.164785582551 0. 0.180317458513 0.00458491922496 0.0367902105118 0. 0.389255850299 0.00174760112765 0. 0.00257753728933 0.0635580300716 0.0084535343221 0.00282624864339 0.0447019415675 2.88017138187 0.289532320254 0.123735336689 0.00324188461583 0.118078308966 0.0100812848724 0.0198277053741 0.0116340464762 0.243292793662 0.0120482062486 0.0176763288885 0.263693820924 0.709176626674 0.248550219855 0.0328825526141 12.6242878278
-0.0135254471713 0.0224138900757 0.096798546819 0.0154444374282 0.469113896116 0.22743490158 7.79328364964 0.213279371798 0.0161344840406 0.0784909371759 0.179648483473 0.0628751158954 0.0423341383387 0.00630178455457 0.312339853289 0.0234883695029 0.0322889750944 0.0291162192912 0.247846604119 0.0201655279496 0.0518907117023 0.0661747311717 12.1031163415 0.0342292472337 0.0670292507246 0.0263262931891 0.406923875717 0.00490776541097 0. 0.0160598832211 0.353791691237 0.026544047596 0.0118193968718 0.00791022068661 0.109843293866 0.0158225402976 0.333300299142 0.31958909408 12.0613669426 0.0616488096615 0.0107388318896 0.0148583295769 0.233395457926 0.0229189251464 0.0725987489501 0.0224009938245 0.366753524194 0.0033444418443 0.435154262392 0. 5.18531608176 0.0337930801197 103.370411838 30.2187145757
-0.00889801311401 0.014314272414 0.00733263507062 0.139923321215 0.0599475336812 0.151241438878 0.0626266723432 3.26792392121 0.0168047793112 0.0355345341123 0.00841349152452 0.279741113857 0.0269058261891 0.0203136714086 0.0172489856388 0.100526472268 0.00951741783187 0.0365100909268 0.0188076923165 0.311852144931 0.0234901851248 0.406481108084 0.118585605774 5.59567167405 0. 0.0209633844747 0.0017276477389 0.386993411551 0.0356811825554 0.00753007889328 0.0256322285828 0.467310381695 0.00386274806443 0.01299145289 0.00713480561887 0.0563915408293 0.0270058369068 0.251044072283 0.255733515669 3.20974363638 0.00242786317209 0.0191998396281 0.0137316622378 0.150868053414 0.0179523093513 0.0494934567133 0.0152084857496 0.22043068467 0.265435129553 0.0233293793875 0.240040834453 1.01421579934 10.035477583 28.3055731705 29.0099153961
-0.161412798087 0.00424480446191 0. 0. 0.0906916476566 0.00563968805371 0.0321857317281 0.00625169793881 2.32459802666 0.18028353771 0.402169481502 0.146021735821 0.180738849749 0.0152470119891 0.0594309552204 0. 1.59918269474 0.0878914404839 0.151488329592 0.0644464394055 0.433227437698 0.0415119312985 0.134563380307 0.0308938272344 12.8269080058 0.586851670675 1.37028858456 0.768958451975 0.504903662999 0.0401830542296 0.179516483383 0.0260615738593 0.320069615284 0.0514874328311 0.0730906239858 0.0500704875043 0.126989204283 0.0185452770624 0.120931812654 0.0233211166859 2.57821698158 0.137637074862 0.52477780815 0.185823198291 0.14069243508 0.0436555868557 0.0759002609233 0.0304916977712 351.484733517 0.0751625144229 26.381564856 0.10755263699 1.62508488908 0.117164738243 0.443351098266 0.125852859682
-0.00540817019885 0.109532143682 0.00466186168276 0.0119570850765 0.0158619374367 0.0807774228921 0.0133696167272 0.00519688621966 0.029392784273 1.27871496477 0.063722905148 0.04128067384 0.00632884583531 0.0453137431349 0.00843806244594 0.0123184356638 0.0549166610956 0.828580129577 0.0498266614372 0.0502292974892 0.0199171150784 0.185872475093 0.0251441786984 0.010719019886 0.089127529091 3.4296456957 0.103967035845 0.239907865574 0.00468334570237 0.206251061571 0.0138674587778 0.0283270941681 0.00773883894314 0.0717966354105 0.0039461417809 0.00130873744795 0.00796058746493 0.112416234141 0.0258843362023 0.0102273571283 0.0143618403641 1.09404680854 0.0371145501871 0.0742827896751 0.00597837009967 0.0989926626628 0.00732532644804 0.0141200991997 0.297694270758 1.90815280778 0.448236037837 0.0662766472026 0.0370265810511 1.47916590967 0.115943259122 0.102962006329 2.53689270085
-0.0102444412948 0.00509286785591 0.0526826133572 0.00865174390146 0.0167207453137 0.0078067338281 0.0680018616885 0.00652270728479 0.0529708932914 0.0317393901905 0.953237491747 0.0460080390141 0.0202225963419 0.00647460880487 0.0627457859646 0.00621514632303 0.0849084781118 0.0605758785434 0.430500146762 0.0760617630848 0.0368909715192 0.0130987377349 0.289812358407 0.0111800529475 0.15870666689 0.105782269501 3.01587355888 0.129715864077 0.0292980098652 0.0140236078572 0.161233068931 0.013554679652 0.00638065202681 0.00383023188484 0.0462524279848 0.00467115363075 0.0143634062062 0.00687250339689 0.106692653386 0.00553305812419 0.0427454939109 0.0298804720595 0.989563854742 0.0360911542865 0.0145669991601 0.00652825936214 0.0693258497758 0.00506439035447 0. 0.0616959880557 9.95680242469 0.105688196253 0.162332902184 0.0468444399235 1.27307344663 0.0459595842087 8.27606578348 0.715389857412
-0.00789939435885 0.01212501017 0.00773363835482 0.175301373497 0. 0.0143690209499 0.00126452851364 0.132117818087 0.0582018868707 0.0711103982248 0.0578686515489 1.756951756 0.00998972583202 0.0120449704688 0.0114545328219 0.0634532707085 0.0744891940437 0.0686263990691 0.0484135563166 1.44153871334 0.00450888748208 0.0272210780702 0.0240257116739 0.208900041641 0.0398056574747 0. 0.113109727358 5.32058987453 0.0150482576711 0.0314730538069 0.0119754249663 0.256988726401 0.00098902044467 0.0131515986558 0.0105575625281 0.10786533181 0.00903471281231 0.0072515426398 0.0277375045236 0.110148076992 0.0208083242687 0.0755742185728 0.0905113037895 1.71936164198 0.00966856631646 0.0179622299535 0.0146245333127 0.12178135613 0.294662757949 0.0974744910442 0.572307858294 3.67660894718 0.0571583781106 0.0395596260121 0.107882138908 2.20567784646 1.91713540938 48.0143648972 0.853169465851
-0.0531643487552 0.00046790400605 0.000838453691686 0.01812896729 0.208420547857 0.0343787330744 0. 0.0231920471902 0.043685055595 0.00732004830476 0. 0. 4.11106061846 0.048722096716 0.146088640727 0.0560625049253 0.0474926500595 0.00475721733224 0.00484972824452 0. 0.197182079712 0.0457824201776 0. 0. 0.058950641239 0.0289413524406 0.0136873269902 0.0229852647113 41.3472328531 1.0528307594 1.29285877772 0.306280922598 0.0345768065397 0.00451575537032 0.00714407574213 0.00383630480052 0.231578282487 0.027634098434 0.0463528990383 0. 0.0637039348201 0.0184746799941 0.00875762872995 0. 4.32985621739 0.117782272716 0.022019255005 0.0681679785543 3.64445607755 0.0592877548457 0.525086277223 0.0756449030113 4.56261330482 0.110131050888 0.0439052051569 0.0797889683874 2.06518561996 0.0666683510558 0.0762726044496 0.0517838499854
-0.0055199762485 0.0334289719786 0.00390763608714 0.00102384267646 0. 0.106196580492 0.00818508580281 0.0136642809574 0.00357284653328 0.0457468056207 0.00694679633975 0. 0.0911050824201 0.599678869518 0.0489300439061 0.0108088282083 0.0105832559291 0.145765335695 0.00690974052474 0.0114920430125 0.0175529106988 0.175936238339 0.0413270786918 0.00872752794066 0.00466216314537 0.0913950125537 0.00860719686636 0.0243677507458 0.0585882757321 2.80334749919 0.0872701701452 0.111401177662 0.00200006153919 0.0217250647562 0.00433905371471 0. 0. 0.110447906903 0.0173404257969 0.00995287043434 0.00388615508611 0.0438806416399 0.00902124309974 0.00312743519908 0.0425164571122 0.955534749424 0.0288747192586 0.0248716875581 0.206472713399 1.77357320853 0.123522093577 0.193297452822 0.0928470465172 1.53245881476 0.111006305099 0.117335749811 0.105553436644 0.742828630094 0.0622235265575 0.0423426485008 1.43526430491
-0.00783695049608 0.0250727545388 0.0365535857915 0. 0.104520783638 0.0175266123984 0.423097003684 0.0372719485901 0. 0.00118601758413 0.0980061451082 0.0165691637301 0.398423196665 0.0736727127086 1.87900199944 0.0923264680767 0.0174427982474 0. 0.0558435587249 0.0325636812093 0.0600891313087 0. 0.53367919355 0.0668040000349 0. 0.0149063765247 0.118853989326 0.0549025463859 2.14712512855 0.312763441889 20.1875336549 0.347860470677 0.0066552531376 0.00307323366926 0.0412644723982 0.00610625387445 0.0831499855006 0.0075476627928 0.537235020729 0.0317779628223 0. 0.0021195066801 0.103937315422 0.0444811941521 0.209725175735 0.0477753255181 1.65952099137 0.0698039587929 0.0802054038476 0.0387196706916 2.78319794878 0.061028317299 1.47838527252 0.204511470784 7.10912954036 0.256877041263 0.549142746907 0.0751592976177 1.26735185125 0.109280267489 34.4959393706 1.05085922221
-0.00746472259056 0.00204899373295 0.00581141364371 0.0491987450047 0.0279931733762 0. 0.0187164230282 0.139287436956 0.00599351063267 0. 0.00799680673582 0.0650958058285 0.0344787803875 0.0123348960029 0.0622609147898 0.851318265478 0.0137965285149 0.0171589122973 0.00792908114731 0.177351717033 0.0066528572533 0.0210605579391 0.0315464539473 0.18248378446 0.00953680519322 0.00890950686499 0.00910725738233 0.174716153118 0.0532132015906 0.106932799171 0.0628787450617 3.22751790841 0.00644393995935 0.002174043541 0.00377513820975 0.0273030924407 0.0338199259892 0.00125051939221 0.0390614305644 0.10632141054 0.00310445049144 0.00717703221063 0.00848650791657 0.0783047449268 0.0456723888635 0.0516488993956 0.0415544937568 1.15249307403 0.265892650003 0.126252301003 0.188030143058 2.21350162545 0.0711131598547 0.0498530038432 0.14039933692 1.62206226821 0.0927215536591 0.0268076213023 0.0997798597602 0.992253660267 1.28408120875 24.4950942036 1.65934183601
-
-0.0255410031621 0.0196994410272 0.0329436805941 0.0171683371063 0.0149396985614 0.0183708104275 0.00645076614979 0.0131771277358 0.0119329780996 0.019404291813 0.0110661479582 0.0126066351598 0.00767281125434 0.0211476929741 0.0217199500715 0.0162144992548 0.0125788049362 0.0153824193819 0.0351900543795 0.0107925691178 0.016594963679 0.0192878934182 0.0069342750228 0.0174443586684 0.00639363526807 0.00974852461103 0.0111678900222 0.00443298791246 0.00723674640067 0.0193993823623 0.0394721937175 0.0134712866574 0.0308697977783 0.0261955025614 0.0398854098195 0.0222118074114 0.0157269211794 0.0271424443752 0.00716582944527 0.018409347815 0.015995194452 0.0210047367317 0.0151538538426 0.00983855721495 0.00727530179348 0.0147630423609 0.0279360948926 0.0111035450087 0.000586877417582 0.0155362448361 0.000536216447671 0.0120197877511 0.0121507344448 0.0176708896065 0.00473584340384 0.0155784373036 0.0010210997268 0.0121177246907 0.0119605502469 0.0104896896194 0.00812470878645 0.0202026177119 0.0134871493447 0.0175201850745
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/100vertebrates_noncoding.ECM b/PhyloCSF_Parameters/100vertebrates_noncoding.ECM
deleted file mode 100644
index 2e3e718..0000000
--- a/PhyloCSF_Parameters/100vertebrates_noncoding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-2.78592743423
-6.58600444004 3.19341169223
-1.63519457982 12.1399355041 2.45567860959
-2.43476285124 0.137196047767 0.462787891603 0.0687994720539
-0.0828676812999 4.64297827314 0.0583439047427 0.114333277922 4.54770228198
-0.569910594763 0.269905137878 10.0658717921 0.227536068622 36.0992488386 10.3039899411
-0.0485017841297 0.412819154555 0.0211222634573 2.74491138612 2.97356015436 14.4767642696 13.8730044691
-4.91172089731 0.155166943916 0.607308551579 0.0926673262207 2.93090865811 0.0568018331327 0.563736806771 0.0419502454502
-0.110594870229 14.1973016288 0.227814935065 0.348821740023 0.0698012930426 4.35673029912 0.320289189969 0.205259373689 3.19849897319
-0.200634258787 0.0561388860069 9.29335938844 0.0929695932917 0.395913544434 0.0764056737434 8.35592589299 0.0734485882052 10.2333897454 3.31735868963
-0.13798910766 1.0340072599 0.318823468155 10.7213291459 0.0794339571607 0.150236344311 0.308812958798 4.11390908902 2.34629268324 13.7678588818 3.75348569698
-1.61163899145 0.0903822534676 0.0978724405796 0.103846672592 13.0480744395 0.227582308607 2.33026717206 0.158960500271 2.75288101677 0.0415967285977 0.155011835538 0.0774147142431
-0.0539412039354 2.7175215174 0.0197134073579 0.160319614896 0.188046082887 17.3910431275 0.852712504949 0.990756643627 0.0714613184066 4.0085387173 0.0637586828172 0.239230657001 3.72498943433
-0.115504297981 0.0554316110801 2.62956148456 0.108596913546 3.44821535373 0.624122455894 46.1826203189 0.819390424217 0.144340307998 0.0767389836681 3.45253752203 0.0918946223283 11.0581166867 2.78890551354
-0.0686425149198 0.126358582519 0.0353234891621 1.62786654769 0.112834294186 0.366312347819 0.910925474064 10.8159929664 0.0420270072454 0.121652373835 0.041021549888 2.70393912639 1.97744280002 8.57968016608 3.32159829656
-2.7544269435 0.0893651329767 0.147541427462 0.045588254393 0.13118461025 3.18524470568e-05 0.00511362108266 0.00177951014407 0.415950418678 0.00274376193493 0.00295069255731 0. 0.0490110518677 0.0109095971916 0. 0.
-0.0792482672501 3.8269663053 0.0600975342331 0.169229443099 0.0235434410828 0.20555593481 0.0187169473997 0.027489303549 0.00704240140764 0.842055408475 0.0204804845935 0.00228597224206 0.011244526864 0.0757896416031 0. 0. 3.49147912066
-0.140350659206 0.0519225842332 2.88395589756 0.0273793218983 0.0160717268365 0.00476194914635 0.256665151464 0.000945031287224 0.0457491179596 0.0221450577789 0.598936842192 0.0157356154024 0.000732141038617 0. 0.0653627423271 0.0024299228541 10.7164632866 3.57233983814
-0.0420703782816 0.245254684763 0.0661881569729 3.31052265197 0.00921779748141 0. 0.0187176169492 0.0941345819645 0.00889233349389 0. 0.00988308290204 0.825507301736 0.0116464934505 0.0265891275072 0.0121580600248 0.105930373584 2.27706263405 16.0355075221 2.99806680412
-0.0835624220006 0.00882220161046 0. 0. 3.08974563007 0.122047945762 0.580194800746 0.0527490707359 0.0735023766671 0.00433095387463 0.0343457304593 0.00511087269641 0.0846597799348 0. 0.0288920646816 0.00160328304007 3.89374822857 0.145724186109 0.859411475778 0.0977710846653
-0.0154152275448 0.104820298736 0. 0.0105463060181 0.115102782565 5.17009625533 0.237854650192 0.172608828294 0.00557693962982 0.118368017498 0.00724878346524 0. 0. 0.182319021431 0. 0. 0.138898774156 5.03284649814 0.138658093089 0.165678358789 4.79323321106
-0.00482910140346 0. 0.20777458312 0. 0.532995768631 0.254053586795 16.2610321 0.173403286842 0. 0. 0.157481114874 0. 0. 0. 0.394080739918 0. 0.69328323564 0.320689384456 9.88649042287 0.167025974959 34.8139406207 10.1133870094
-0. 0.00961312458577 0.00777720146138 0.0421416632552 0.0668430982448 0.316055827456 0.310161085324 3.80578081572 0. 0. 0.00286341134589 0.0655755234675 0. 0. 0.0111015655273 0.0940823246107 0.0501235340082 0.388529007176 0.100853422779 3.47803826662 3.01358288946 13.5549050105 9.5786073322
-0.468309814243 0. 0.00422239547645 0. 0.26830641753 0.00846178333649 0.154305577789 0. 11.2231238988 0.279262732154 0.668330937867 0.193652679992 0.219677620446 7.2077574577e-05 0.00604055276834 0. 33.2452989031 0.811222421625 2.55659342609 0.452160447674 7.64549509172 0.263216471122 4.7802784332 0.143871982185
-0.000860877233951 0.834462206337 0. 0. 0.00360228322614 0.414239512028 0.197936924501 0.00823935352163 0.11774285457 11.2493424316 0.201884259842 0.497799451235 0. 0.266084682123 0. 0. 0.266110848103 34.7258580282 0.547536957554 1.46118924155 0.160338489022 9.08023328703 2.77572496514 0.635232621196 20.7884238597
-0.00982618500386 0. 0.591865235112 0. 0. 0.00218531337504 1.27017090395 0. 0.339648545761 0.16161338633 9.56757283704 0.183239415868 0. 0. 0.190549769126 0. 0.939489900239 0.401541837309 30.6896731945 0.378631582678 0.49544403824 0.338076522141 40.5444710727 0.154867530415 51.5670070065 18.1748961464
-0. 0.00305450479455 0.0135564060988 0.917987071428 0.0121496291976 0.00940515686116 0.119119559264 0.323445066476 0.137627082052 0.973331878132 0.317403241123 13.7268039631 0. 0.00385237606388 0.0129442098625 0.2243721539 0.436381800076 4.66762939214 0.890960051922 46.0687746218 0.159821879484 0.606560651364 1.3124413836 8.44478548018 12.4665171004 49.6206423643 16.2525872954
-0.0480997542122 0. 0.0120069171917 0.00705871640247 0.365898539349 0.00331565177772 0.00828798187583 0.0190617177772 0.0566983820258 0.00206195136388 0. 0.000851243591405 4.13290256325 0.0778480013042 0.257064930071 0.0532942502359 2.58623674767 0.0627896589555 0.130295452685 0.0607415410117 12.6708354607 0.127040124001 2.19987609742 0.174617163404 12.8946521218 0.0747252598411 0.446429410446 0.0977030126566
-0.00562265261444 0.0764307547465 0. 0. 0.0063414974605 0.380861788353 0.00753424639752 0.0220559286448 0.00980976134525 0.101156083167 0. 0.0138619086514 0.072833456771 3.75912497016 0.0471465843163 0.106431837705 0.0803441627835 3.285182125 0.0552749886049 0.164538257304 0.2503607233 12.1799982117 0.873441856704 0.770053907325 0.397759952713 10.5237799774 0.22377862705 0.742945113248 4.04528522945
-0. 0. 0.0539015946056 0.00278364992127 0.0377957707833 0.0135963635668 0.89440013158 0.0147550321805 0. 0.000295662566089 0.101859214026 0.000945192222413 0.107777801947 0.0455856315413 2.95431984048 0.0299580499308 0.0692407005928 0.0777213018462 2.8342950611 0.0597295499215 3.20392772547 0.525791072418 30.2914067842 0.591091345872 0.778259117844 0.196799800294 9.7436291249 0.250287033284 14.0153836355 3.34075289278
-0.0029775553938 0.000481714381558 0.00995582674459 0.0354561987446 0. 0.00988402515618 0.00175895315694 0.319479264747 0. 0. 0.00856538884321 0.0181925584499 0.038841902373 0.144236561331 0.0680763995227 2.45864879147 0.0532891365325 0.207694885915 0.0544091024245 2.62133140043 0.124628865738 0.386482949994 0.605612447182 9.29643383867 0.193490205147 0.508707708341 0.224730774419 9.95732384776 2.2284772758 9.79481604528 2.83331650296
-6.56858255082 0.157040779976 0.412175038103 0.0941892466145 0.22602139234 0. 0. 0.000432028561943 0.578215659146 0. 0.0122850462384 0.0100014809361 0.11167679813 0.00640756227736 0. 0.00161147255275 2.46904674823 0.0456773806562 0.15229360324 0.0314539380676 0.0534554009708 0. 0. 0.00927397630364 0.447179203281 0. 0. 0. 0.0367299291555 0. 0. 0.00903617543561
-0.154254426169 12.0194888817 0.188385564082 0.404976306527 0.0330397145777 0.450121271064 0.0489176001655 0.0370399636967 0.05094694887 0.990991883141 0.0180840722072 0.00384380211183 0. 0.169457512386 0.00819708281146 0.00870799638103 0.0573145148162 3.61306377769 0.0855272437255 0.154782328737 0.00748232676517 0.0881927464735 0.0049964336753 0.012854379142 0.0301713814632 0.72400213014 0.00648062632878 0.0198374976478 0. 0.0571707574935 0. 0.00247035561626 4.34813916207
-0.227788108235 0.0799299082191 9.79896923451 0.103053796284 0. 0. 0.78255650198 0.015579837746 0.128340355924 0.046279605209 0.779068029741 0.0225234611853 0.00602103326625 0.00493313737968 0.161693747513 0. 0.0772646124819 0.0784651311818 3.39842393239 0.0430785142297 0.00319153334055 0.0200545515437 0.226232620884 0. 0.0820883049329 0.0265643135942 0.866371736819 0.0183432125543 0. 0.0250462788848 0.0482691177232 0. 10.1583124061 4.45404934624
-0.107881419785 0.624537506527 0.143524792543 8.57913984856 0. 0. 0. 0.243607905648 0.0376568369585 0. 0.0123913692603 0.977051019802 0.0286899775315 0.0401590208837 0.0222659759274 0.159355783736 0.0382060716859 0.180359387973 0.0471829513688 2.82761809762 0.00499074984672 0.00488669031459 0. 0.053752763036 0.00691320221159 0. 0. 0.829310276526 0.00323386746488 0.00593988613076 0. 0.021522244845 2.40542589088 19.5417991861 3.75671940857
-0.12834113079 0.000631024810323 0. 0.00370534372453 12.9755000578 0.249546857178 2.2428079352 0.16858926865 0.167087689576 0.02383686429 0.0439490546363 0. 0.655221811919 0. 0.0906015436812 0. 0.0942550375717 0.0144616778276 0.0351737751326 0.0112630245205 3.31439870246 0.0682789714328 0.43347001132 0.0516315018829 0.281101289081 0. 0.00916726942431 0. 0.230196247012 0. 0.0403187341028 0. 3.34331662861 0.0971515456628 0.781046975592 0.0872172134872
-0.00147272373388 0.231637836881 0.00034595435521 0. 0.239177344728 19.0321903198 0.682121242987 0.58023907979 0. 0.362869697142 0.00491708358301 0. 0. 0.711707470265 0. 0. 0. 0.117504471461 0.0121911148736 0. 0.111229457943 4.4199412059 0.306313105926 0.250843260075 0.0151977356619 0.530844103954 0.0200689115308 0.0183915886966 0. 0.240685558284 0.00716322812369 0.0025539038592 0.0720097295311 5.06653931434 0.0792452953844 0.173890272432 5.19879437497
-0.00584157821457 0.00981900567978 0.501161696619 0. 1.70123466465 0.457547343541 50.4645366614 0.516148327511 0. 0.0476676401932 0.633934534495 0.0154289667092 0. 0. 1.41536414927 0. 0. 0. 0.204730338169 0. 0.317299779043 0.262826758155 18.4505803511 0.196113664614 0.541248280455 0.708760121856 2.67512354266 0.181899268955 0. 0.0231037960197 0.546155668327 0.000709150651529 0.690762503945 0.31210703086 10.5525498701 0.251830847873 35.1062120167 9.24273876406
-0. 0. 0. 0.121219395501 0.173500127538 0.732707640921 0.967955772341 13.9456042856 0.0142592910443 0.0661696110665 0. 0.204245055816 0. 0. 0. 0.335284741585 0.00120828759341 0.000770045425943 0. 0.0762604530737 0.0474049343197 0.13927094387 0.17189083881 3.32796677053 0.00836207794708 0.0417538220573 0. 0.302116718197 0.0100602962328 0.0446388722815 0.0203652287305 0.233869284809 0.0606199672857 0.338796931585 0.101822437413 4.01419582769 3.59460760499 14.1246349223 11.2167674822
-0.305915296181 0.00387290678178 0.0283900521037 0.000168284862403 0.103145819992 0.00682213703837 0. 0.0069105622856 10.8506353065 0.143162318594 0.606240184459 0.101575092269 0.174857843309 0. 0. 0. 0.379874892195 0.0135188840515 0.0283892888726 0. 0.0866224362335 0.00680603807226 0.00423745111466 0.00363287262812 9.81027429037 0.148538407691 0.484853262019 0.110578511 0.0796243853214 0. 0. 0.00845303045711 10.3935417311 0.412884043486 0.946160277011 0.227669238572 3.3309009611 0.119274560321 0.88047907047 0.0227475613468
-0. 0.464728116785 0.00308746578916 0. 0. 0.199886815768 0.0125122178155 0. 0.180705625194 14.0947925672 0.252641224242 0.547186742156 0.00366396625264 0.171718229624 0. 0. 0.00256090204409 0.636746675067 0.00960274978496 0. 0. 0.146270560184 0.017249053838 0.000316098567487 0.285378211168 9.24014013085 0.305949089687 0.718193549725 0.00312219292709 0.0773155035163 0.00955123407451 0.00198881136206 0.144809836717 19.3056982127 0.243438772992 0.717540645624 0.151265661762 4.92211351063 0.504292174964 0.361202903197 4.49006892216
-0.087451981084 0.00842338129519 0.392290124716 0.00139847334073 0.027044155128 0.0139774661244 0.638507439152 0. 0.556961222423 0.13882239836 13.5150909923 0.166561693382 0. 0.000756205239141 0.188613940486 0.0144571766857 0. 0.0167131216833 0.532700702004 0. 0.0320969284915 0.02326036368 0.33353910299 0.0105399567991 0.600959423559 0.261734253996 10.1713107581 0.238032618109 0. 0.0199740705072 0.139539542607 0. 0.57217221198 0.216745519905 12.1940990023 0.178514589947 0.592929555019 0.137803794033 9.00742699427 0.129076334826 15.0682981859 4.38093295403
-0.00986884400482 0. 0.00714910857349 0.367847444687 0.0166385250797 0. 0.0210436940204 0.155361065995 0.170480142873 0.717744368709 0.312410321473 14.2913544055 0. 0. 0. 0.120387628276 0.000292448770617 0.0183996746206 0.0118009941572 0.612374176547 0. 0.00880187636181 0. 0.0810806480573 0.211302552782 0.467407092312 0.246211628106 10.2837358385 0.000671732121191 0. 0.00544000385484 0.0566344860084 0.152106508386 1.52277218051 0.373232827818 17.3834665486 0.088560075074 0.196177361201 0.380258104422 4.36085934855 3.18437134081 18.8510841125 5.14520276184
-0.140188964873 0. 0.0151920530983 0.0153098032383 1.21840798939 0.0200771021955 0.013828583721 0. 0.298711554809 0.013282000644 0. 0.0167204186218 17.9923373684 0.232696535903 0.984057841766 0.142431651545 0.0594158796265 0. 0. 0.0137989912116 0.12040947048 0. 0. 0. 0.311981750261 0. 0. 0.0153840209357 5.10599693577 0.060058085426 0.192867675621 0.0439372706467 2.29950758326 0.107264463125 0.122983893731 0.0764090093826 14.9222894425 0.206524497422 2.86780466508 0.159494635211 3.80306505617 0.0334445588107 0.325190963647 0.151947105188
-0. 0.207669384822 0.00189721251573 0.00553485636554 0. 1.52235490048 0.0214143749539 0. 0.0145960413034 0.32793862831 0.00705339082687 0.0457414280331 0.268825669828 19.5855144187 0.172589090786 0.409132980287 0.00554476834153 0.1076229582 0. 0.00240622379516 0.00804850693051 0.206710892449 0.00818525905021 0.0258785461201 0.000760289922815 0.311325590969 0.0118866698369 0.0359508735092 0.0658382096549 4.45507109341 0.0857620092788 0.184552789051 0.0797894222264 3.9481700794 0.0581303052042 0.16676938791 0.269272847366 19.2295897427 0.73594417452 0.978955856639 0.125122027026 5.05506631457 0.0973955577781 0.428928296452 4.82612419107
-0. 0.0187625080249 0.20621297091 0. 0.215475351118 0.00846225603838 4.56136559967 0.013451185552 0. 0. 0.397015828795 0.0315660915039 0.710900933484 0.189198512858 15.8999065484 0.160971621735 0.00628354924211 0.0161321594066 0.0723294391078 0. 0.0117968393571 0.0236982978919 0.433978791462 0.0143668477172 0.00817272892114 0. 0.316429262812 0.0198151164693 0.153450120451 0.0773647680014 3.50455393025 0.0618333636644 0.166520883576 0.0976239406896 3.24864400372 0.0837585483462 4.31483949393 0.648545185882 34.2984034321 0.819405183509 0.266907960006 0.122705495208 4.9548758249 0.199588957896 16.6777618142 3.57079368656
-0.0124471120403 0.0272087327615 0.00155187404069 0.125233490839 0. 0. 0.00895158073499 1.06491980832 0. 0. 0.00715827430729 0.414147587417 0.180211554628 0.623836427105 0.241870122255 12.2059095361 0.00658301673438 0.0125565086887 0. 0.058709761226 0. 0.0151374969764 0. 0.0571779694018 0. 0. 0. 0.285486228445 0.0388450921219 0.0813947228349 0.0513523513133 3.2140738289 0.0593540209486 0.20347229722 0.0794482293815 2.69456850247 0.178836946955 0.472832758926 0.844501463372 14.1545062979 0.111742476081 0.237178456371 0.101985554242 4.60324813954 2.89376135367 11.9743180489 3.79180138166
-1.85192230366 0.0693790157141 0.106402926385 0.0608024713276 0.0436329895839 0.00107179024991 0. 0.00390362798834 0.0808916951667 0. 0.00433532953897 0.00866563775885 0.115681448961 0.00244887631965 0.0122927075949 0.00307380568859 8.32999782753 0.126029974553 0.460073198431 0.120793949772 0.115673876081 0.00271733825314 0. 0.0047754974823 1.70598507161 0. 0. 0. 0.178363763058 0. 0. 0. 3.00967295837 0.0788741164722 0.103306012195 0.0385900978126 0.0418440750087 0.000122216607141 0. 0. 0.136527075723 0. 0.00566931440696 0.00251708868497 0.105111201226 0.00419097275684 0. 0.00485924133915
-0.0549154541207 3.03224643496 0.0428847156108 0.133703532383 0.0202336985508 0.140949578231 0.00900894226931 0.0250639669303 0.0048425257738 0.128268392937 0. 0.0115912491402 0. 0.0827492946191 0.0160830178931 0.0111482505672 0.24141129768 17.0668338244 0.206414807432 1.00003095748 0. 0.311079374201 0. 0. 0.0145169454496 3.04001941638 0. 0. 0.0331464951668 0.127673716292 0. 0.00965378489659 0.0589629693926 4.9678210571 0.0571303284523 0.248965454673 0. 0.0493384833039 0. 0.00239893485768 0. 0.230692698695 0. 0. 0.0422766872909 0.0920739167052 0. 0.00133058864128 4.29048773271
-0.101517404125 0.0343491447041 2.27313430775 0.0554319415663 0.0210799624769 0. 0.0821407508018 0. 0.0329140841083 0.0175891419447 0.184042580709 0.0134375573067 0.0238409003486 0.0035029716646 0.0557026739775 0.0110516944291 0.449722568316 0.159306400865 14.0744663646 0.253068276327 0.0121885022963 0. 0.46176793784 0. 0. 0. 2.26889710649 0.0224957316916 0.0300941303173 0. 0.127312288213 0.0124284578828 0.147104057547 0.0639672848033 4.10550614777 0.0825088546667 0. 0.00813367565483 0.0729990890482 0.00689730236854 0.00599463654984 0.00116099561615 0.127372168082 0. 0.0374612069485 0. 0.0641437950891 0. 8.9067174944 5.26727004749
-0.0634587178075 0.164446070886 0.0389132563161 1.99737117863 0.00282180434061 0. 0. 0.0774665806316 0.00868272364467 0. 0. 0.14300480576 0.0283602289446 0.023588473164 0.0105163231084 0.108103678501 0.14614846102 0.666021762766 0.113838834063 11.0648283984 0.00197426866049 0. 0. 0.151913570895 0. 0. 0. 2.32294437496 0.0235773309743 0.00278112713673 0. 0.0949326087762 0.0380151845809 0.268793047678 0.0730886004517 3.71246743415 0.00918507483228 0. 0. 0.046609892172 0.000579927622744 0. 0. 0.246691875092 0. 0. 0.0121177322723 0.0858990441967 2.11327446775 18.4850191794 4.13292946501
-0.0454886898633 0. 0.00608734618322 0.0016151106611 1.98767482394 0.0527684920215 0.210535924194 0.0536827040618 0.0420252303951 0.00588687958894 0. 0.00066928368527 0.154395852194 0.0186920369151 0.0166574139067 0.00359586340379 0.217447880351 0.0227868287022 0.0421451566115 0.0208986894064 9.79650280147 0.141230586854 0.926171845582 0.120065761888 0.483172002247 0. 0. 0.00519099356137 0.715526565594 0.0222416221031 0.134580169449 0.00972160824641 0.0897851212753 0.00130881885851 0.0166280705267 0.00142630838426 3.27162515516 0.0628333601292 0.197931476966 0.048359439559 0.0588224129141 0.00505944834557 0.00615546676895 0.00148701250206 0.266009222204 0.0152178532484 0.0375628245831 0.0051968742038 3.10505375421 0.0921325112832 0.494869259187 0.057954196026
-0. 0.10375058827 0.00895116015077 0. 0.0488589220103 3.23100578316 0.102852989537 0.0992758415717 0.00335181630037 0.0273009328923 0.00169258214181 0.0021720572221 0. 0.232980339437 0.00106980475086 0.00264157628508 0. 0.26583153922 0.000454703033684 0. 0.257433667291 15.0764556279 0.475982048683 0.612573787407 0.00127451046421 0.854042044641 0.010430565389 0. 0.00892929688638 0.951084070718 0.0305638428038 0.0291998661887 0.0103191984664 0.128858289569 0. 0. 0.065182747413 4.50215646981 0.141527513151 0.149054910944 0.00381937078567 0.113453281622 0.001544157525 0.0163706083748 0.00216907007472 0.425752972949 0.015172048448 0. 0.090884506002 3.94010288909 0.0822907479248 0.143448913247 3.94613664994
-0. 0. 0.17631552808 0. 0.541360468027 0.191544494061 12.9177085683 0.19141559287 0. 0.0077944473201 0.150455878283 0.00425317702852 0. 0.0157869881978 0.441933004077 0. 0. 0.0027451427081 0.813018154846 0.00629319249643 1.82975513433 0.614583853488 51.1610794325 0.680185321452 0.680808083455 0.482636692887 4.63806009414 0.190710087212 0.0255917056117 0.0788586973079 2.51305147376 0.0223075594435 0.00821325826844 0.0118380563154 0.387025791712 0. 0.731484041325 0.285688609037 20.8451309518 0.274016052876 0.00281011791009 0.00386208802479 0.271546419145 0.00882315670346 0.00814020975936 0.0353938170827 0.810935235854 0. 0.719888232788 0.317147489876 13.0266914958 0.209522978429 42.3850162604 9.79461368788
-0.0087248402762 0. 0. 0.0388028267706 0.0544601295802 0.167312785248 0.128592356538 2.38092749378 0. 0.0136994402801 0.00208139452493 0.0426199782934 0.00783642738883 0.0384048442744 0.00683574723219 0.0935666624087 0. 0. 0. 0.143036392756 0.145858915325 0.559774631266 0.33719131026 10.2273191348 0. 0.0102269689265 0. 0.517426541896 0.0328635291206 0.129812799345 0.0471040742776 0.610397195218 0.000429440743348 0.011649854694 0.00926334868987 0.0765859221309 0.0363917814826 0.183338074344 0.124125168139 3.20750017235 0.00108884405549 0. 0.00709815195924 0.0494190173154 0.00181848086765 0.0479824177173 0.0093094534245 0.152251675425 0.0411876400152 0.292750010335 0.0548809377424 2.76386105945 2.22257855879 10.8628930542 11.1413927804
-0.0760250538715 0.00700421836525 0.00866648194089 0.00435986152497 0.0540827397947 0. 0.00391636097676 0. 2.23283740478 0.0477354909763 0.119722467157 0.0512077291182 0.0582828087579 1.84450841094e-05 0.0212705156613 0.00347637118437 2.3444294707 0.0387767742541 0.13871448845 0.0161289290258 0.404228283439 0.00670727864772 0. 0. 42.6257611554 0.196792049636 0.929369177618 0.221868715408 0.489384967201 0.0168388452585 0.0398846300782 0.00512133729322 0.141547888798 0.01482634149 0.0254244831056 0.0210919924281 0.052656552978 0.0045449028405 0. 0.00716446340832 3.97333759429 0.0632861016144 0.142570150692 0.0496143346137 0.0894119344944 0.00143211187454 0.0202383137864 0. 7.73808578168 0.269236099363 0.714173337151 0.148482271426 2.27460367338 0.0612555216636 0.506093630745 0.0397805658951
-0.00335948534388 0.166811362037 0. 0. 0.00163245648269 0.0869115764053 0.00145131831787 0. 0.0366620864637 3.60332218814 0.0569434943281 0.162544597515 0.0101552271511 0.0862933628427 0.00997209836899 0.00614153543388 0.0143543479853 4.36503411421 0.0404557851182 0.0829539975305 0.0279204536382 0.591301367783 0.00185763764181 0.0353923010908 0.707502598715 35.0815245817 0.426555047875 2.24727598232 0. 0.78485920919 0.0292031839397 0. 0.00180239766365 0.267951329933 0. 0. 0.022120304753 0.153353668133 0.000864485448678 0.0247743262171 0.0575696359221 5.18508259902 0.0736462414271 0.260305286917 0. 0.0968691355895 0.0138850315085 0. 0.138838219983 15.4052198753 0.211229746893 0.59906033101 0.0515508895799 3.32129727819 0.27694555062 0.169235739566 3.26958964513
-0.00315205571841 0. 0.119858587196 0. 0.00965168066826 0.0035616261757 0.172854630017 0.0111622195472 0.148179057638 0.0410147698761 3.03403380457 0.0541614715481 0.000563097911286 0.00489601991308 0.0940862857026 0. 0.0217924575442 0.0129881466992 3.25778010704 0.028965386855 0.140292613723 0.0293657555445 0.484832092218 0.0345007483117 1.88077579645 0.325730094754 34.7467555829 0.561059668728 0.0149027296968 0.004157980621 0.846966791909 0. 0.00260535739846 0.00911471818673 0.243798651713 0.00180356314893 0.0271269185037 0. 0.165004321262 0. 0.256825819514 0.106302800681 4.81357755061 0.126885076615 0. 0.00848265494272 0.154125731765 0.00945871747585 0.250541358334 0.119835918567 12.7448935237 0.0835390299321 0.403266783084 0.0841562495728 7.56357418722 0.074228113326 9.80967504055 3.27871254942
-0.0103556018408 0. 0.0011816109884 0.113633952737 0.0118785975884 0.0125379387686 0.0104722121626 0.0788538391735 0.0533571273803 0.168525336551 0.0621319164848 2.95416541639 0.00242580625115 0.00146091373886 0.0100088353982 0.0663269954569 0.025369860271 0.22434540866 0.0343720715155 3.46956439231 0.0131447148201 0.0215679445196 0. 0.405073060412 0.556475593543 1.67817531836 0.545977564286 35.7061721804 0.0116939219962 0. 0.0183565441501 0.460092201302 0.00074238992399 0. 0.00579123310552 0.191431140758 0.00108942651377 0. 0.00297715155179 0.0726203290199 0.0534914770371 0.244946229554 0.115786843235 4.52310415665 0.0183960883988 0.0315494387759 0.0220921785763 0.138487740821 0.1498026314 1.20488541655 0.374457402337 13.0091599938 0.0516036232577 0.0991638339044 0.272220445341 2.92620666289 1.97016748469 12.8367518412 3.06689854949
-0.125733907422 0.00436972047946 0. 0.00353647416495 0.154469830792 0.00266701849446 0. 0.00747470692383 0.0428772107152 0. 0.00651486169726 0.0038758756817 2.12423784206 0.0396390768058 0.119676126216 0.0613113344595 0.0934530446047 0.00100486685685 0. 0.0099634245887 0.255867138922 0.00432278305936 0. 0.0033608119693 0.709920584226 0. 0. 0. 8.76488154869 0.108747954622 0.443139983406 0.108862992226 0.0592114869062 0.0021774332275 0. 0.00310486942886 0.146282632535 0. 0. 0. 0.0932659832328 0. 0.00226265698012 0.000437508156089 4.17379919929 0.0813437704349 0.132209517747 0.0702854009238 2.40862742376 0.105698824568 0.178043076253 0.112608616225 7.73500464643 0.139203650826 1.69519019403 0.0810436611991 3.09662064828 0.0385681117838 0.111269521996 0.0489347359831
-0. 0.0609872263047 0.00933842716192 0.000948328196705 0.00374889004249 0.15253027804 0. 0.00952953880298 0. 0.0572009319937 0.00837445788167 0. 0.039770266434 2.41207882465 0.0293270824384 0.0921186610183 0.0023267112147 0.166351748457 0. 0. 0.00216144889003 0.575616954777 0. 0.0148745203406 0.0015650455934 0.679423704369 0. 0.00801061566315 0.145315119018 10.0943879764 0.149402556355 0.412657654327 0.0098602040256 0.0757051733271 0. 0.00455281594064 0. 0.147595745939 0. 0. 0.0110837912317 0.0745131511445 0. 0. 0.0561028712269 4.3424873055 0.0450383438033 0.159410591003 0.0585146883274 2.37207001639 0.0359509499726 0.111435198427 0.139595758963 10.3724187684 0.454590596885 0.57005580893 0.0887282266365 3.33992114556 0.0553897405699 0.22588766036 2.97958638551
-0.00884501661763 0.00822019802007 0.0567978754604 0.00153576505523 0.0229617810989 0. 0.413469077511 0. 0. 0.00113601739474 0.044920740573 0. 0.149636695726 0.0400778032714 2.29007985767 0.0437062887372 0.00940439830966 0.00173005848216 0.0763644279553 0.00198872511095 0.0318057542977 0. 0.959001128734 0.00686764151641 0. 0. 0.69893106591 0.00227248143697 0.431545896385 0.0834627522463 10.4903910182 0.146065626468 0.000137938557632 0.00373652129917 0.0823752461755 0.00739167528714 0.0129600361132 0.00022436885351 0.262261843382 0.00530115881603 0. 0. 0.140415389848 0. 0.238536586546 0.0597236814982 3.45822422879 0.0896154132005 0.0942643358202 0.0515910631369 2.61062231714 0.0494450785923 2.33496905686 0.373558427272 32.9662411021 0.412373005557 0.212265840597 0.0992654681453 3.89618387928 0.130112261982 8.22472527244 2.42902491323
-0.0340591581891 0.012593100295 0.00323337401409 0.0685872694336 0.0105214233326 0.0112649491742 0. 0.139366554692 0.00843066624747 0. 0. 0.04777707531 0.0625981591408 0.106881090187 0.0405634111512 1.64631472157 0.00949918338782 0. 0.000604291454891 0.114526662756 0.00372564611188 0.0921689564017 0.00746205552917 0.200492727878 0. 0.000282518921569 0.00466192088992 0.57052517656 0.101107481918 0.229025687261 0.137716530929 6.54507791785 0. 0. 0.00460225123511 0.0532545275311 0.00269316586069 0. 0. 0.107055482973 0. 0.000186005327605 0.0156408180693 0.0835639144202 0.0562034194714 0.152712853513 0.0782557471793 2.78045654664 0.124962081181 0.143982562493 0.0473902723691 1.60216771614 0.0746132290942 0.308205816866 0.464655090752 4.89934528676 0.0455440791486 0.127170079697 0.0816795449481 2.41190068084 1.8126811407 6.5182404037 2.72920933193
-
-0.0357983654718 0.0146634321466 0.0209916853044 0.0241608300459 0.0196605104347 0.0113786862615 0.0029009138093 0.0163015785126 0.0225609755057 0.0145991965297 0.0181825729424 0.0164781957079 0.0186856678405 0.0130405682814 0.0179309987722 0.0240968720195 0.0181775551111 0.0146957289426 0.0210180199751 0.0178777837456 0.0179375335248 0.014026410045 0.00304930001685 0.0181980546371 0.00237235102112 0.00247910724881 0.00304553476624 0.00292174613484 0.0129216428963 0.016886060241 0.0212194293029 0.021001239545 0.0207025677211 0.0101079314077 0.0168739180256 0.0130368421188 0.0145312058205 0.0117191223335 0.00248094305692 0.0145761834505 0.0160538354021 0.0117605522361 0.0140380390381 0.0114567437712 0.0112780796487 0.0101486396189 0.0148519084459 0.0147005486842 0.0206773071958 0.0111337585868 0.012890738691 0.0187059909187 0.0197741432688 0.0160489156219 0.00237751747496 0.0226108300737 0.0197730187728 0.0145713864549 0.0179588059761 0.0198394530312 0.0208205335746 0.0208303362555 0.0183984258157 0.0360132307673
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/12flies.nh b/PhyloCSF_Parameters/12flies.nh
deleted file mode 100644
index 94d2a0c..0000000
--- a/PhyloCSF_Parameters/12flies.nh
+++ /dev/null
@@ -1,2 +0,0 @@
-((((((dmel:0.061361,(dsim:0.054894,dsec:0.031243):0.031837):0.063495,(dyak:0.111338,dere:0.100461):0.039892):0.357431,dana:0.581114):0.243592,(dpse:0.033045,dper:0.036095):0.495254):0.224541,dwil:0.801425):0.249420,((dvir:0.301255,dmoj:0.453117):0.141069,dgri:0.434875):0.249455);
-
diff --git a/PhyloCSF_Parameters/12flies_coding.ECM b/PhyloCSF_Parameters/12flies_coding.ECM
deleted file mode 100644
index 13c9a37..0000000
--- a/PhyloCSF_Parameters/12flies_coding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-0.856979977161
-21.3799807399 0.243048702626
-1.07282632554 23.2891199352 0.417014024371
-1.70189173492 0.188155975062 0. 0.179377976204
-0.0606628059885 1.25594389172 0.0229550444473 0.00328435713687 18.1364766697
-0. 0. 0.566942262009 0.137821071867 31.7666032929 13.2859098957
-0.363302169127 0.3216200572 0.0779713622622 2.07370722097 27.2607785838 28.7642437906 21.1732174575
-11.2727606341 0.582021939541 0.450519061187 0.520525692578 2.87314674986 0.160184415377 0.0417616105268 0.392943810626
-0.197373806562 3.66356232072 0.129128041228 0.379280117156 0.326199666848 2.74555693992 0.150499848254 0.667770340927 1.87830419013
-1.86834815872 0.345363208373 7.04665342055 0.577755480658 0.355521388131 0.0612681556016 1.5212484594 0.479173384021 91.0051457762 1.3573969268
-0.568971981177 0.457370202419 0.104759904219 3.91042274811 0.352600386489 0.20108530169 0.150446124992 5.47395727586 2.78281874049 33.1384407846 1.6359111141
-0.796825184123 0. 0.0403648471502 0.101591604765 2.6530525349 0.199481018682 0. 0. 1.47135196603 0. 0.224999116277 0.0620080781057
-0. 0.416451433015 0.0365778147437 0.024970392227 0.100800143598 0.874204165608 0.130583286588 0. 0.141999370164 0.485936631223 0.110543922695 0.0881051473082 16.2840553339
-0.12641874075 0.065507193128 0.253613039853 0.0876476849427 0.354732481143 0.0224235730108 1.13456690845 0.205922054122 0.256670135609 0.0609082999619 0.993578689887 0.102531431492 2.2112993571 0.489455389074
-0.142167147587 0.0841528499849 0.00545185023752 0.468645974403 0. 0. 0.0245735447417 2.73514077321 0.0321517883643 0.0681718672235 0.190961252265 0.564971900021 24.1383229355 25.0045526655 0.960565154999
-2.61068586388 0.212857299965 0.0161926638881 0.436376510995 0.488945589229 0.0490126748638 0.0436777528509 0.118779224993 0.825672501796 0.248397282773 0.124449316407 0. 0.189414008686 0.0401485471222 0.0881524691569 0.
-0.101975766087 1.1738270611 0.127110430158 0.28355571795 0.014758840992 0.189405643318 0. 0.108577951241 0.15192674656 0.262657678883 0.186613378152 0.243660589481 0. 0.103957104833 0.0352873054316 0.00482802362259 1.79658789534
-0.0314277315691 0.169819246298 0.71866826475 0.165419543032 0.0377534774895 0.0241395904101 0.254563562124 0.0674618895841 0.0993905843497 0.0137652380848 0.619525928607 0.195521335534 0.026722114036 0.0130894039763 0.151205759774 0.0269324846295 24.088796861 0.961987674941
-0.344940619174 0.305455398829 0.0709676514016 1.60031795914 0.0704789063483 0.0159279589167 0.0877851061075 0.250696459521 0.0910258661535 0.17314633403 0.0620955543552 0.22104611078 0.0349971452587 0. 0.0470746037141 0.110016087229 2.54181455243 40.8651006557 1.46068774674
-0.306136639675 0.0365068756611 0. 0.0217224466725 2.73433734021 0.110586423354 0. 0.0381219899006 0.151571445904 0.0326945160705 0.267764377037 0. 0.441539418948 0. 0.0665640592016 0. 2.58642595246 0.109367108497 0.14611246525 0.118659911293
-0.000573614519137 0.104253395908 0.0250383204733 0.0533636462092 0.073014643704 0.473103940343 0.257984331274 0. 0.00615865469376 0.150482492584 0.00442777476089 0.0945035122737 0. 0.251993614389 0.00524930812503 0. 0. 0.603166504243 0. 0. 19.5110085343
-0. 0.0326516117459 0.105921316773 0. 0. 0.218109844754 0.880892812609 0.0206567660033 0.135717490267 0.0100217453445 0.0691830645025 0. 0.265895553088 0. 0.131840210044 0.0385783794127 0.0903101309711 0.0618145555718 1.02475793811 0.0557339105725 35.1407733276 15.6280698007
-0.114378433963 0.0755380229992 0.0334696841663 0.234076002893 0.109622016168 0. 0.043579809404 4.14976553074 0.124020445748 0.0276682901455 0. 0.420860301583 0. 0.0337486778241 0.0482465610908 0.384833201848 0.259016000851 0.0333608744166 0.0967913002381 1.77059360242 32.5414384022 37.4249875733 23.6322118109
-0.76872051314 0.0518496635313 0.206790445458 0.0103357986514 0. 0.0648947518157 0.155573814444 0. 41.6367496355 0.00897871779297 8.10178576716 0.0463408459908 0.010090972335 0.0200177545988 0.0153924623022 0. 4.03988737059 0.223383788962 0. 0.346561611784 1.15593423028 0. 0.0565558183642 0.0376120984804
-0.176940860673 0.0966444861601 0. 0.0785592690521 0. 0.0772313331586 0. 0. 4.89241326509 0.483964741726 5.93138982216 0. 0.0179416028768 0.059548694535 0. 0. 0.101310940279 1.40994629437 0.043866333123 0. 0. 0.309580947376 0. 0.0507115815889 21.2902489182
-0.0629795298351 0.0473604696912 0.688318325575 0.0412159006215 0.168097795855 0.0101942613411 0.0337230410753 0. 6.16756316069 0.0735969582839 42.0857806752 0. 0. 0. 0.0832000654832 0.0846535128153 0.379681833159 0.263413123194 2.16045669637 0.351469470996 0.0788557433647 0. 0.826518430639 0.128090672973 58.0453855015 20.923641997
-0.076094298316 0.135288219525 0.091294048816 0.0922485327941 0.0209863103834 0. 0. 0.226369136758 6.18143228454 0. 5.15573649415 1.07125192286 0. 0. 0.00125691002419 0.0937402627757 0.189747523371 0. 0.0665289703423 2.24488710932 0.0379550972204 0.0159773467171 0. 1.01770296266 37.3377363307 36.4584471667 29.0745428077
-0.158160420516 0.0120556276078 0.0238578426229 0.0160045795938 0.492716547477 0.0131875041541 0. 0.0403949866778 0.453580964347 0.00926804861436 0. 0. 3.34467930183 0.162615843816 0.670668819393 0.285564105445 1.96192533786 0.0700417989899 0.0707320089966 0.121981173462 2.44581946984 0. 0. 0.0576424452148 1.16342540608 0.011075412755 0.158559659269 0.
-0.0193224380447 0.0923148288235 0.00365268936531 0.0102066825968 0. 0.316452253978 0. 0.0163413226077 0. 0.0900658323965 0.0912448768615 0.00658190908684 0.689809618606 1.64922141668 0.179746039009 0. 0.115396665688 0.717152347661 0.0138497664298 0.0176041997189 0. 0.667969566413 0.0655661331862 0. 0. 0.418688777634 0.0945356085407 0.053164878132 20.4544469922
-0.00863512879095 0. 0.0369467829568 0.0019694946879 0.0365641334362 0. 0.13284384295 0.0243929829242 0.0517560523386 0.0189830161506 0.0335419847401 0. 0.137834606237 0.135640691099 1.08284486544 0.26921951135 0.0109947403896 0.0402028321664 0.514219812106 0.0267652516336 0.0695645290054 0. 0.494204070935 0. 0.04564276207 0. 0.466875712102 0. 24.3036054086 11.1181661776
-0.0665448209559 0.0548921830946 0.0255372736646 0.1507258224 0.0917147710424 0.108998077057 0. 0.714672482528 0. 0.0329706332436 0.143626874104 0.24454328392 0.454910519719 0.19417661262 0.486820556809 3.68990164995 0.330541181565 0.0645236037793 0.0890425798061 1.62529759913 0.0855851253897 0. 0. 4.55168880801 0.408631955389 0.0763223679712 0. 0.997577985124 33.009352379 41.648977566 14.3264529944
-2.36523488606 0.149863093615 0. 0.388052184684 0.52351318356 0.0445107931652 0.0361304571772 0.146675648637 0.99510305123 0.252054393805 0.140935161049 0. 0.18178207578 0. 0.0469925022234 0.0740502996711 2.51861283466 0.0877276849259 0.01053357318 0.170037651281 0.332126116503 0.0147257337575 0. 0.114800469765 0.249414968805 0.0054522238743 0.0234992906199 0.0284634729163 0.161617184985 0.0132888628625 0. 0.0387208308101
-0.101044364903 1.12349591734 0.0964056709973 0.2949678621 0.0362440735034 0.209698409121 0. 0.115482498535 0.138591958729 0.347197050615 0.153933364371 0.186391760757 0. 0.0478883109412 0.0165935750516 0.0401249768569 0.114390244071 0.49073782611 0.102735060828 0. 0.0353325854985 0.0724307861011 0.0317606016453 0.0186358072982 0.00708915904149 0.0667930926635 0.0365349171106 0. 0. 0.0491828806638 0.000975790213379 0.0211275510994 2.2053619905
-0. 0.125850443125 0.469382098904 0.107088504706 0.0211899645054 0.012870331311 0.184537424832 0.0724449792169 0.0673464126781 0.00496543008336 0.444779446067 0.185963125037 0.0352736521034 0.0262935981441 0.0696281314347 0.00380919013691 0. 0.0789108992446 0.80195467336 0.073867922517 0.00129773029579 0.0152333914511 0.123120315853 0.0284519012919 0. 0.0107614194593 0.150140280137 0.00385025472898 0. 0.00301557967663 0.0454687658394 0.0154784915455 19.7948511659 1.21145935309
-0.232011173528 0.189044125172 0.0671282746214 1.4109043465 0.0604442877758 0.00258249629862 0.0744724196011 0.297633359298 0.121744849668 0.0995804707507 0.0631436303072 0.346908534413 0.0238862732448 0.0141354459264 0.0184355860263 0.0442828901294 0.161643875125 0. 0.10663812361 0.54656952131 0.0150492508722 0.0294819232815 0.00857969312713 0.178824935467 0.0273276064468 0.01153190045 0.00718248290439 0.0860298814355 0.0105820559511 0.00157089298236 0. 0.0834596470596 2.70870019447 22.1270471209 1.31422399551
-0.50529296361 0.133370235344 0.0498469357135 0.0867569048185 8.82982471481 0. 0.106854987591 0.315354807755 0.937948880112 0.100630138883 0.0469600368516 0.108537395112 0.609587756716 0.107449051201 0.202699480512 0. 0.464926806749 0.0274366896291 0.0685629106518 0.0267324573674 3.59299923769 0.130531963383 0.0440063078142 0.395885476632 0.338260573182 0.0014435613204 0. 0. 0.436574638249 0.0363221474819 0.0508433777347 0. 1.75460515603 0.158313429179 0.10276476705 0.0621464281103
-0.0284461790952 0.212253431123 0.0262704624699 0.119807369257 0. 1.69439137847 0. 0.0238200232328 0.0499311140125 0.42812763174 0.0433483934406 0.0779343651887 0.124238771678 0.21961026491 0.0394061124296 0.00784799084073 0.0370027169509 0.0818947112047 0.0252533899205 0.021747647579 0.0113094179791 0.724512682025 0.134472285662 0.0310957722831 0.0167745448161 0.057197304014 0.0272889977886 0. 0. 0.204127343375 0. 0.0576450975873 0.0922046679477 0.353390774491 0.041312983612 0.042153189286 12.3630468079
-0.0608058541496 0.148482722226 0.207943699078 0.027915342068 0.208619559066 0. 3.91408287845 0.0952994427658 0.0239980660381 0.103208669958 0.542149892427 0. 0.00398056690156 0.180172992896 0.396999764442 0. 0.101691932539 0.0381385297924 0.286539177894 0.0133204803183 0.101634701266 0.219858353351 1.59519726774 0.231309758435 0. 0.0118070853546 0.270096461369 0. 0. 0. 0.125163131058 0.0331786840056 0.209190222596 0.181921325117 0.779148128217 0. 29.3362421982 10.5727352608
-0.104224724824 0.149896543597 0.0408462440613 0.351541033243 0. 0.0470545780751 0. 6.29767077478 0.0638605912434 0.0203328796665 0.17882849221 0.863911458009 0. 0. 0.0945005781775 0.716896467078 0.0594344511385 0.0112326757614 0.0486622115963 0.155235197328 0.170785316863 0.0397408684506 0. 3.70884461498 0. 0. 0. 0.198998766469 0.187561459576 0. 0.0383346884399 0.655329719253 0.204713395657 0.0710634862878 0.0957111473389 0.724858046892 21.5035212342 20.2117021205 17.0975384559
-0.243814221546 0. 0.108824678522 0.264420182206 0.364793101017 0.108006155671 0.0205920780887 0.170326493076 4.50859744421 0.269800396052 0. 0.173323615768 0.225395739418 0. 0.0520477021147 0. 0.284281705356 0.0953344886278 0.0515911206625 0. 0.234186592483 0.0289777763915 0. 0.161158840873 0.796843962108 0. 0.115827793356 0. 0.0987136739611 0.00029047619079 0.0112748855466 0.0121835662905 1.77155307137 0.0169763500914 0. 0.18823403339 3.31343536517 0. 0.101946039966 0.368466135555
-0.105733514394 0.55778792064 0. 0.0456698894765 0. 0.152841815427 0.0976274621557 0.114331444121 0.138690469977 2.07292580293 0. 0.0995490839043 0. 0.11553472201 0.00936734365735 0. 0.0639926611674 0.0711496517083 0. 0.072945462527 0.0165240972727 0.0563383181792 0.0301863217865 0.072033684696 0.0895041669733 0.234873522908 0. 0. 0.00334416438512 0.0658256490442 0. 0.0201119425472 0.0142221784569 0.796802944169 0.00644729862263 0. 0. 0.969675795578 0. 0.259312270938 16.7988341937
-0.123747011131 0.148762152389 0.448086643454 0.341823632575 0.34476022895 0.110877804612 0.468103639003 0.0517409316386 0. 0.472120665461 6.98729985985 0.569550979079 0.129146686061 0.0224600289171 0.282942379039 0.0547809756015 0.0529083010131 0.126121884865 0.464817592539 0.0563535784111 0.157848239294 0.0690716512742 0.284621038424 0. 1.26223251509 0. 0.425919459795 0. 0.021314959391 0.040206047527 0.10390150134 0. 0.474503890347 0.253280616196 1.80381788864 0.35821099567 0.457002815235 0.154061170371 4.27766696355 0.386090358293 47.9325619303 19.6808295645
-0.0940392483601 0.156428897336 0. 0.555747149715 0.265719451989 0.0591439377268 0. 0.388837541416 0. 0.092604306386 0.707672059766 4.16244419308 0. 0. 0.017844959855 0.191326971468 0.0214867140775 0.038793811958 0.0231011617586 0.178575314934 0.0264742042909 0.0665555390941 0.00974038240155 0.233148293816 0. 0. 0.312691113373 0.796448296354 0.0276668298469 0. 0.00576986511196 0.161257921724 0.0740679232858 0.0435058827918 0.0146785759452 0.935073559881 0.130985969118 0.150459907519 0.104142974561 2.2937251156 25.9167566891 27.9672543534 30.3671736585
-0.434058116582 0.0243009357809 0.0664865836138 0.0549805741932 1.85695152847 0.145837441361 0.119526026661 0.451736279288 0.93810077143 0.0667330549159 0. 0.0784036993055 9.77530236961 0.436725089765 0.58316203681 0.977490399744 0.341726863473 0.0390561119246 0.0380593521652 0.0286543721396 0.781823693643 0.00218133774376 0.0685003177396 0. 0.271085249245 0.0104602785429 0. 0. 3.47120842402 0. 0. 2.30786650813 1.50791862083 0.0483963919454 0.0300621606704 0.0735252786412 5.61717661886 0. 0.634793867133 0.742661472684 1.55918666263 0. 0.841314002074 0.
-0.0113667677619 0.139097021802 0.0266279055959 0.0649110059928 0.271165225002 0.356374200249 0.462447049335 0.0812554110799 0. 0.261906579666 0.214962406813 0.150876194512 0. 4.85246662164 0.112885739127 0.128479081658 0.00382441531228 0.0963471511583 0.0288968160516 0.0380575513004 0. 0.460646796364 0. 0.0526747725656 0. 0.0635182874082 0.0624795281108 0.0496585258215 0.249922297538 0.880126512364 0.104923430442 0.0475178691005 0.0469942044593 0.377726315 0.02396015719 0.0058029211923 0.400818155317 1.88399437755 0.0249683518635 0.276514482787 0.0333431132158 0.479895695338 0.0844193920514 0.0624254941258 21.7592101953
-0.0331799427383 0. 0.0666993209566 0. 0.0659147301184 0.256960995461 0.286462654957 0.0701466885296 0. 0.0107854883592 0.295165736711 0. 1.21447464954 0.180018476203 1.01556150887 0.426925008475 0.0425154209715 0.0198069960443 0.0949639914014 0.00626698048332 0.10953938333 0. 0.300853421045 0. 0. 0. 0.0831189682586 0.00455574777414 0.229147001649 0.243060751563 0.659201322877 0.00153006753369 0.0140756082878 0.0077442567221 0.264077928925 0.00835488167252 0.342760335106 0. 1.80433636682 0. 0. 0. 1.1713441614 0. 31.8153346162 13.500934857
-0.0753651521978 0.0829572682127 0.0469876926104 0.213057044827 0.276108755483 0. 0.205795926871 2.07448463232 0.414603494325 0.108654113555 0. 0.42829121982 0.438401644702 0.326753757929 0.233179693471 7.21268221952 0.0721202274211 0.0136132175223 0.0214700972484 0.181444564043 0.0226930454947 0.0998250535633 0. 1.02344251681 0.27821255631 0.0066081187679 0. 0.0411768797912 0. 0.18792017758 0.056173201874 2.58754316069 0.240544111649 0.0391893694734 0.0120639862744 0.591089276474 0.41302815344 0.0800084271644 0.145503183728 5.00734758378 0.188951138852 0.0153168225304 0.00275019000738 1.24518227851 30.5503637373 34.0462233841 18.6930893112
-3.5612805718 0.185576667155 0. 0.261882000557 0.552498356896 0. 0. 0.0454188913343 2.18033142306 0. 0.913055260815 0.148167561548 0.979499033508 0. 0.0276967036387 0.0462666186648 6.87550522201 0.409269139199 0. 0.385739048816 1.2307998883 0. 0.175887843684 0.0906161829493 0.735716867884 0. 0.600993186416 0. 0.729833033914 0. 0. 0.026483433212 2.74504384982 0.155811527469 0. 0.123461266078 0.427731161393 0.0289604446028 0. 0.0303196385124 0.493373112815 0. 0.222411828762 0. 0.699369865327 0. 0.00201358602267 0.0716169942232
-0.104325456084 0.463481189267 0. 0. 0.0326564812186 0.0193838763331 0.0364109108089 0.0460004723167 0. 0.098968148224 0. 0.0447017063462 0. 0. 0.0257930407901 0.263414933857 0.206483480307 1.24027101417 0.00160980668212 0.258419493927 0.0376900584074 0.045732253611 0. 0.0414234180165 0.064309867278 0.0667778675875 0.0394817700222 0.0782429690108 0.0462470882557 0.145607151232 0. 0.124089860161 0.120025598718 0.113313102447 0. 0.0293429859405 0. 0.0944873791495 0. 0.0538686904815 0.237650500843 0. 0.145663879182 0.0422859300375 0.0328957650127 0.0011783331156 0.0268609220906 0.109848171138 0.708962533642
-0.0440826539721 0.183543317224 1.31985453104 0.29760797105 0.0134450303614 0.0627229514106 0.31279883249 0.0806111169421 0. 0.157442294141 0.297999910948 0.109689823 0. 0.282760962173 0.218720526434 0.0560052611502 0.251959973649 0.420273990731 3.41918753696 0.491882578276 0.0896406707367 0.186494631066 0.439708062254 0.197947369192 0. 0.497223431254 1.2424461357 0.258879085594 0. 0.00808306260146 0.0470148067102 0.17542811997 0.0509391703359 0.148001904375 1.04860067906 0.194814679614 0.115927749447 0. 0.449370327984 0.0200324395713 0. 0.0892899979766 1.23078140878 0.079658732789 0. 0.0477979550569 0.168444216083 0.0449592501719 352.932298864 0.757542891626
-0.0260133112348 0. 0.0533392790958 0.709830630177 0. 0.0772589390514 0. 0.102456250928 0.164849778116 0.0404640512768 0.190001520841 0.135220074865 0.314847205215 0.153220567324 0.0365803390517 0. 0.060206598525 0.364682449198 0.133569747889 1.93244338701 0. 0.0246104772359 0.0254103916945 0.227563058626 0.0076539393152 0.0631550795105 0.0293457012601 0.108828143742 0.0226945449551 0.0322923760681 0.0514989763176 0.297520720886 0. 0.0872796679636 0.0728170451125 0.210120628582 0.0723105238391 0. 0.187833239399 0.0353299664323 0. 0.176256670958 0. 0.0721598798001 0.0450225348449 0.13074927379 0. 0.0585416392465 1.78059816087 39.161107698 1.08904133074
-0.32285906089 0.0859967474225 0.0561149741506 0.0997333958055 6.22297209977 0.0880669876225 0.726694491183 1.01646558779 1.08531977553 0.28612993001 0. 0.315673439399 0.410167922953 0.131920417886 0.104283886065 0. 0.778552681658 0.0466109104441 0.0770193625443 0.0954793310376 5.88489430467 0. 0.189290015679 1.20033163478 1.04257180512 0.0240800875658 0. 0. 0. 0.258693504552 0. 0. 0.410407385613 0.0417471510459 0.0229055164516 0.0633805100821 6.20291445659 0.268643999351 1.00503843064 0.172686305629 0.447784867539 0. 0.134286796325 0.220374931404 0.988209249538 0.132976168404 0. 0.323609598337 4.25915133684 0.0849966076834 0.374585594363 0.00669084346932
-0.0592120190495 0.317137404498 0.00996511224837 0.024970726587 0.184469819546 2.22580329794 0. 0.361810497613 0. 0.982607661126 0.136268953756 0.2043280624 0.45640423584 0. 0.0106817429255 0.0328444321006 0.0648093172502 0.237096986804 0.0178648037634 0.0197756543926 0.0919299997176 1.2554947586 0.164755867238 0.454088869701 0. 0.112459471987 0.0808505600423 0.0371170702525 0.169759857654 0.2913277705 0. 0.237002712084 0.0475003073893 0.184783472255 0.0192972493559 0.00777830381048 0.314901795686 2.11204235155 0.159218972699 0.385608776687 0.0617656827024 0.219401023947 0.0421932203634 0.0692095788129 0.0936204368 0. 0.21065062495 0. 0.146933837691 0.28561463973 0. 0.0412013552127 21.1669501142
-0.0214242844445 0. 0.0890509476222 0.106347387581 0.50477863564 0. 3.09784136779 0.0459525854663 0. 0.165204710987 0.445843862583 0.278213722528 0. 0.210736910449 0.177706552924 0.0380595760919 0.058570696183 0.0201420132449 0.258429258273 0.0560705901873 0.0251972854114 0.140893674403 1.42610603808 0. 0. 0. 0.317799605587 0.0506989312525 0.255831368443 0. 0.0806293001956 0.0168824151148 0.00475962470686 0. 0.0971995733402 0.0437031245498 0.500973292004 0.0774839884335 2.90438537811 0.202071520986 0.0937165711889 0.0216420775447 0.46085520615 0. 0. 0.386212730776 0. 0.0439111871227 0. 0.00142019617832 1.72372488346 0.00353564686792 39.2916179068 18.2449713723
-0.12772333616 0.202937477234 0.0456262887699 0.384240827481 0.750471298595 0.566716666735 0.329482300209 7.9730276104 0.348733256117 0.416616268506 0. 1.60604961709 0.153626160452 0. 0.051816532713 0.517553659832 0.191648788308 0.0783717598123 0.0620273916294 0.517147043007 0.757054829915 0.271320901834 0.0610169937309 7.83805440567 0.26049598552 0.0116099054579 0. 0.271192109703 0. 0.269401620363 0. 0.869217204478 0.173886539068 0.101559401417 0.0513360463705 0.25313978055 0.814021622311 0.542152688427 0.661009268928 6.26229632635 0.0789158873422 0.140136062493 0.459696135584 0.449218526527 0.242718586153 0. 0.036411591094 1.15509068397 0.3893585454 0.0424108621429 0.560890848122 1.09144238728 32.8955493322 38.4940460748 24.077551687
-0.892146421339 0.105792977881 0. 0.203727471191 0.937054097698 0. 0.11392298206 0.0306223345718 9.42292304392 0.368889170803 1.66077364659 0.579325085445 0.114146365789 0.149157964404 0.0775871861269 0.0452777917467 1.87236487125 0.253819545628 0.136018977537 0.389932585883 1.67509605282 0.0552503571781 0. 0.161064385475 15.4813846104 0. 0.20972813964 0. 0.675574459504 0. 0. 0. 0.942992935462 0.141984025502 0.0271301662091 0.0830153582675 0.959015469118 0. 0.279990642381 0. 5.26272896639 0. 1.3089471879 0. 0.932609036265 0.0129723246839 0.0293439782823 0.0631589397541 280.629762483 0.33921123514 61.6326568199 0.574254177642 6.51206780811 0. 0.154805300534 0.571105398762
-0.0543459569035 0. 0. 0.175082894371 0.0300029311488 0.152289336153 0.0213642624993 0.0474803694279 0.272378780882 1.11185426229 0.195192906777 0. 0. 0.0422434128828 0.0236417440157 0.153894931667 0. 0.159478557231 0.0581249296853 0.0888637596587 0.00774711463909 0.0797019570098 0.0220358018891 0. 0. 0.788772412095 0. 0. 0.0125193864137 0.157865057283 0. 0.053199968005 0. 0.103059554852 0.0214087156837 0. 0.036253294775 0.171112602984 0.0185506897953 0.0201440173115 0.180508780553 0.379647848599 0.165082219653 0. 0.0387162959041 0.17589011491 0.0166076794048 0.0888466997722 0.278144013414 0.516232169639 0.134276520095 0.0356284139123 0.110707261879 0.765365154596 0.0484784571802 0.105517140489 1.956996971
-0.0426453273696 0.0191205668943 0.0368964641593 0.0195993734266 0.020426687841 0.0071332799582 0.052440437308 0.0188225003564 0.137720655499 0.050220433979 0.791577703309 0.0569744636126 0.0490397005783 0.0154243449821 0.0854117057841 0.0247958613472 0.0837332655223 0.0474247246812 0.120026567666 0.0690972261089 0.0520473599944 0. 0.0770543128608 0.0275746063381 0.105528767172 0. 1.05765165507 0. 0.0503584622369 0.00540933675393 0.0512677354683 0.0567514547181 0.0241550573068 0.00713138366743 0.0322524761285 0.00510242031931 0.0275438433454 0.00454715835838 0.0660427342198 0.010682243118 0.066443063198 0. 1.06220346525 0. 0.0369033385963 0.0104664832187 0.053823143186 0.0247144334391 0.396443415435 0.162886463316 2.81533142291 0.303786834202 0.122329738726 0.0197654206404 0.301045311419 0.0927439142057 4.07574873867 0.297231398254
-0. 0.387694492842 0.0566264290759 0. 0.0420389430627 0.0372263203947 0.0284009571392 0.391280067504 0. 0. 0. 2.62120940939 0.235208821229 0.174126629446 0.0377333685393 0. 0.266507634665 0.140780997735 0. 0.274461791044 0.024251685869 0.0123437067252 0. 0.42174418179 0.386142599092 0. 0.280878402933 2.26656277487 0.0668300289241 0.00484107193822 0.0120421621438 0.467512964536 0.140861595319 0. 0. 0.152886951063 0.0726618429342 0.00881337066215 0.0765283799663 0.323564236667 0. 0.104293437079 0.0656777320123 1.27568533433 0.0936900727309 0.114534588299 0.0388409803721 0.261207870269 0.539598476857 0.057248937284 0.709959826108 1.31873341905 0.149748324813 0.0137692137083 0.021682240931 2.67377221412 3.34744003832 63.6215057037 0.552099970733
-0.262658101564 0.0330856130484 0.0318435467419 0.06434557919 0.956294914676 0. 0.0362010379979 0.210563484821 0.649823236136 0. 0. 0.178067726788 6.14046266775 0.484508818038 0.969822459383 0.0908273537571 0.569261086804 0.0475523632477 0. 0.0356114691876 1.12898507341 0.0473037858179 0. 0. 0.60621623873 0.00374427661168 0. 0. 49.6159095859 4.68022066218 5.91403524205 12.128423537 0.343023643831 0.0170291972708 0. 0.0286948987936 1.10355826045 0. 0. 0.247628287953 0.256927506886 0.00389918558072 0.0386987944657 0.0462994870786 4.38167122112 0.749142928044 0.326128125834 0.155704509341 6.93877030376 0.243950655216 0.795264519656 0.219296014971 6.28903338562 0.253404687172 0.350852805934 0.514188082347 7.10336662893 0.17185837391 0.250117723726 0.310340196655
-0.0836251079889 0. 0. 0.0759521765583 0.025061096046 0.128763746911 0.0365471490099 0. 0.0513270168229 0.115390559489 0.0136726811189 0. 0.494123395556 0.738187904377 0.113320681627 0. 0. 0.172946985827 0.0634101240401 0.0303155000782 0. 0.113804414616 0.0536675968956 0. 0. 0.0934146779956 0. 0. 0.157608968678 1.11946201469 0.163383148328 0. 0. 0.0151230114653 0.0171489957776 0.0145945353819 0.015584347954 0.11246152727 0.0672202658176 0. 0.102939183862 0. 0.0860115508942 0. 0.0968596103594 0.564102323427 0.0442859710728 0. 0.114886652857 1.58908101447 0.0640408949033 0.904737091043 0.0464952209978 0.55079298779 0.0350352055003 0. 0.223792473206 0.138240250676 0.128815431027 0.47979472309 1.00317623422
-0.0291577441272 0.00710949998472 0.0678309421565 0.0296178528991 0.0382507639617 0. 0.440552472665 0. 0. 0. 0.41775879454 0.0882600115553 0.481363126311 0.40262892409 2.18167671879 0.22263115552 0.0849711406145 0. 0.121560618927 0.0125624650954 0. 0.0428371422818 0.191018400085 0.137560451816 0. 0. 0.250171892144 0.0477011893207 9.6100077808 4.83686618095 20.5612112307 6.14952831179 0.0434614128121 0.00814219912045 0.0536473772114 0.00722447169821 0.0567220784066 0.0346109731334 0.477257172205 0. 0.0159230494094 0.00672775637493 0.312424461243 0. 0.926206563236 0.170008698136 1.00901362295 0.595253476155 0. 0.0829218608049 1.88426764212 0.0861787526896 0.826858434307 0. 1.08578916825 0.406345336454 0.693518216334 0.0723512495772 0.686787071396 0.139318568235 37.7467182911 0.407872757386
-0. 0.118017675903 0.0516491740649 0. 0.0245749501147 0. 0. 0.515743121688 0.00349160199675 0. 0.0461156753177 0.227277037273 0. 0. 0.195669278198 1.81813346514 0.222473192805 0.0396850438219 0. 0.267936923992 0.111696900826 0. 0. 0.551653259568 0.081951854164 0. 0.082737441961 0.133720495134 0.299280716335 0. 0. 3.68142435956 0.070474856968 0.0253494371084 0. 0.0186977483264 0.0484115177612 0. 0. 0.364949634323 0. 0.0637057162944 0. 0.118085161486 0.136351224149 0. 0.0098593477854 1.37279032042 0.347644700635 1.0187663532 0.267201375923 2.77745201989 0.207254836317 0. 0. 2.06876811139 0.505268712448 0.346609972923 0.303669059181 0.251430422297 3.04304016233 34.0403102714 1.13479757826
-
-0.0181562543195 0.0237541470812 0.0374678167352 0.0229356112767 0.0128689037304 0.0198976366858 0.0146655632375 0.00919594319685 0.00472893318106 0.0211913632303 0.0055799304347 0.0110186011298 0.011298864648 0.0212572494848 0.0236085461411 0.0174040193786 0.0162290051584 0.0148443207067 0.0353528716219 0.0119611294267 0.0135951768286 0.0180305546134 0.0153945069058 0.0065457378099 0.0078695600931 0.0191529378739 0.0083646520671 0.0103291428757 0.00819577204868 0.0151009637038 0.0395263872133 0.00821847799094 0.0207915459753 0.0230931017409 0.0422829154308 0.0282726539789 0.0135792875468 0.0329056051667 0.0141017924951 0.0139740807157 0.0140824034252 0.0275383935595 0.00496476036542 0.0118834390088 0.00615824907675 0.0144300896903 0.0275466491572 0.0105317037816 0.000922468535899 0.0174195794121 0.000696348080875 0.01351829124 0.0078555121632 0.0176405660316 0.016049381888 0.00653336051055 0.000634022586315 0.0136299552106 0.0103827981635 0.0061971613548 0.00498147886533 0.021300710268 0.0173922639928 0.014968849752
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/12flies_noncoding.ECM b/PhyloCSF_Parameters/12flies_noncoding.ECM
deleted file mode 100644
index 6b40287..0000000
--- a/PhyloCSF_Parameters/12flies_noncoding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-2.60522165174
-5.52510067718 3.46892355586
-2.06752205896 4.87084817478 2.21791845944
-2.3195381658 0.29942855373 0.528228212208 0.26648971101
-0.330068073364 4.34832138922 0.432834075405 0.566200533823 4.59841842144
-0.552416252538 0.261795105 3.90539440681 0.215698594141 8.6764671226 4.28639980545
-0.295548791599 0.827336939107 0.393001102173 2.30234170923 3.81729458011 9.33029881664 4.31982049419
-5.82573631847 0.801834999525 1.86182286498 0.602393752325 3.81311102277 0.474788400945 0.721304810831 0.329054451704
-0.595892512437 9.69926539657 0.842946055917 0.971814913776 0.399337020469 5.15799117581 0.236792300614 0.73713375116 5.37263336106
-1.05273301983 0.621797096011 10.3561262134 0.615594998571 0.720352431384 0.636012240368 4.08598201643 0.288342417197 12.6654887488 4.68843038831
-0.511007461668 1.27482190234 0.770931708347 5.14006094873 0.263064404428 0.72057905066 0.31199670561 4.78418938995 4.77782550368 8.79650954363 4.02459238797
-2.45614751139 0.368323546282 0.896011440009 0.345330822663 6.38445607882 0.812447241133 1.22688836396 0.89846227661 3.86123785872 0.054624957844 0.807672411047 0.284218649159
-0.297071771517 3.3301080317 0.294244712813 0.594387565738 0.630325090791 8.22791956827 0.60941585104 1.39405066498 0.518559738627 3.74891441167 0.432486622264 0.886834747439 3.57278649553
-0.491952797003 0.211319243882 3.22926300477 0.288114933896 1.46193024122 0.664041941702 8.73877116939 0.711829787348 0.610050659555 0.26177882384 3.52009446056 0.282194809626 6.51970381022 2.46888502102
-0.270311769619 0.53701253113 0.253466034556 2.07899632569 0.389073083667 1.18867330633 0.366846269651 5.2275473054 0.266988648959 0.45562665342 0.293347630878 2.23924111386 2.99584349371 5.01115562509 2.53862842844
-2.54429183679 0.208897902088 0.690631250814 0.202027264705 0.244791690551 0. 0.102010744231 0.068623129321 0.718867473979 0.0861791543005 0.200678256294 0.0277198677359 0.358710455289 0.0198590262246 0.0727513233457 0.0181667907683
-0.205741251989 3.54878426463 0.282535784093 0.442820226573 0.0371097332821 0.472702213865 0.00924159247056 0.0270547897495 0.217166271741 0.809157527615 0.0731064332526 0.167555106759 0.0823809711156 0.233703673635 0.0507150524041 0.0118325287932 2.79594212608
-0.454462784752 0.221619695452 3.94980098948 0.192503544533 0.20057130093 0.110679640482 0.366954674621 0. 0.294065885262 0.0422692166612 1.19442307203 0.136885521587 0. 0.00705222137801 0.38732889744 0.0336198621798 7.61431848979 4.1790760497
-0.250017930855 0.600751819008 0.2532882811 2.48072248044 0. 0.096910416293 0.033071836568 0.3330380543 0.106896588224 0.221471925649 0.184154952423 0.71515124614 0.0787027589041 0.197544782653 0.00291609470126 0.293131845465 2.57577732798 6.94208324896 3.27585074853
-0.267538861181 0.0782973620584 0.140990405947 0.0415135512486 3.26788735517 0.391466887355 0.584485074743 0.223924105786 0.53967272806 0.030939550127 0.104490034188 0.0907393878631 0.706815630064 0.118344611019 0.181283524607 0.00908489560399 3.65214779623 0.43161700393 0.963510202506 0.268388623877
-0.122528796445 0.403492967439 0. 0.0753976110614 0.345763756346 7.95722267283 0.351981375839 0.660662480024 0. 0.519980399021 0.311961640455 0.087688748179 0. 0.665982021083 0.153361405173 0.157150510133 0.289733588913 4.91280159829 0.597746315167 0.783123601521 6.85421562286
-0.157896529141 0.125849840503 0.258837222819 0.0262407555021 0.546585213019 0.250136220871 6.1023022464 0.27858435627 0.0965962927904 0.0837203126736 0.41309497354 0.0651975505063 0.167610924662 0.0863019690749 0.523540972714 0.0356231133228 0.524246028168 0.427565464426 5.77089638668 0.309151292801 14.7964854058 6.03102821436
-0.170436883784 0.101171673737 0. 0.235477601463 0.290761451767 0.986145223945 0.298849243214 4.18240167889 0.0838301866341 0.217688815126 0. 0.367784454716 0. 0.171407551321 0.172665624586 0.622087066397 0.206350807788 0.679113628723 0.477771364745 3.59103421041 5.56204335797 17.2297122913 6.90886230132
-0.637707469457 0.0980845253209 0. 0.0386222159964 0.23291610923 0. 0.133387182059 0.140114698057 6.19099261505 0.286769228317 0.917424235416 0.222350439907 0.196014430766 0.0438704080348 0.171320870319 0.029495951056 8.61610724776 0.740338142792 1.897591966 0.504461228772 3.89883392169 0.303737900124 0.940750518231 0.582602259878
-0.0552030861191 0.406515753038 0.126757954568 0.17902632355 0.0429018761926 0.167792025667 0.088308826142 0. 0.397029203581 4.18595899237 0.361569523204 0.629291039745 0.012095057946 0.218555477593 0.0338811067771 0. 0.714975070526 9.88809944498 0.73947683568 1.01131929346 0.212139146705 4.47739869358 0.282032128892 0.788958556228 5.0147010624
-0.142317397722 0. 0.858132236596 0.0524028347981 0.0845413370276 0.223285798859 0.477504820704 0.0313574645896 0.741621629651 0.381515213112 6.79910727345 0.185605422378 0. 0. 0.307194239723 0.0334611209093 1.51778663185 0.633300960636 12.5139215776 0.52321566535 0.907058407988 0.803636621863 5.54890362758 0.353466300082 11.6791489514 5.62326450239
-0.0632604351817 0.293940871922 0.120172031706 0.408175611648 0. 0.168880218778 0. 0.226461793393 0.424688374337 0.644519008495 0.35940974446 4.21139730687 0.0533289483047 0.179151278901 0.0389341139928 0.233983621214 0.450540732963 1.44704264599 0.891610313991 8.79731335796 0.453587541817 0.501626596963 0.419745943993 4.04719461146 5.37510573152 11.5732278696 5.93235816792
-0.271934817808 0.0220389805083 0.360919166698 0.0306140044835 0.752318321992 0.463319481404 0.0237920653271 0.0472648305889 0.410951022594 0. 0.206617433612 0.0490180837447 4.19715565416 0.331859055831 0.636355522299 0.327688640142 3.84097030894 0.240503800507 0.665107401131 0.398453372736 9.89885147868 0.797924695707 1.41658091675 0.962105284807 4.14390656934 0.185723871788 0.927757405015 0.447505455533
-0.0441422651003 0.351697700152 0.0540161434958 0.0395732774663 0.203771372951 0.550631712994 0.174017431879 0.41203269941 0. 0.58734824068 0.119062840479 0.144323912746 0.232310518672 4.00520653295 0.346972105194 0.468054735393 0.25509398801 5.26566329901 0.623159418873 0.565609802428 0.854434133855 14.9117484413 0.845802974661 1.85608265587 0.403055949032 6.4442609397 0.519341640143 0.848589689817 5.39834773416
-0.0732180070149 0.0968521775348 0.228828756215 0.0184219094418 0.135688516825 0.0237881831167 0.859989660933 0.163967324751 0.0963793084962 0.050979981086 0.468537052022 0.0523032717653 0.495209908214 0.192641952809 3.0982481819 0.17865921222 0.416996695586 0.345414736546 5.03705465074 0.330159736313 1.67298903994 0.841108082877 11.9450323105 1.20722675626 0.740920305434 0.26598753344 5.3213295419 0.35148359416 11.7501313957 4.96184490401
-0.0221615561397 0. 0.18053780639 0.232847292427 0.0886419985582 0.311519768132 0.0782740903323 0.768657876222 0.20478676049 0.104330422709 0.0149957938401 0.355174837782 0.401325655323 0.669743397933 0.240594251687 2.21617894499 0.239479204102 0.463301114039 0.257639362336 3.21848934944 0.614917578254 1.24161518748 0.753701089267 10.3962486969 0.4724551404 0.72561003943 0.346683864076 3.8853095069 4.48167836817 11.5738315211 3.84920008886
-6.46152443068 0.688877807506 0.907244785869 0.467331091131 0.611857479133 0.38000697963 0.274957472129 0.0417115243384 1.78039895393 0.0931120924274 0.92558963629 0.11139615157 0.719672704195 0.108813780714 0.14630642316 0.108187658319 3.08393052516 0.224878585989 0.620023085921 0.308954907803 0.492547578464 0.174234124077 0.0130567187595 0. 0.675106424614 0. 0.254520863205 0.206575237598 0.501861233193 0.157443454569 0.0158713688637 0.0253774110209
-0.383814344165 6.97508651301 0.535744016959 0.869608553356 0.125634803092 1.1992165745 0.0482168945747 0.166215809035 0.385867165096 1.79183536119 0.134729159035 0.42852869417 0.0405646931802 0.896198342106 0.110650667529 0.062369015921 0.167364953657 3.41846809715 0.263196922934 0.481586151241 0.062064983602 0.31960756476 0.056698891866 0.0686419515445 0.163067764246 0.637468886748 0.0931119682843 0.152959353192 0.103874145219 0.320755915959 0.0585407497123 0.159114390453 3.3705044899
-1.05022340326 0.581026804078 11.2240678679 0.470465861776 0.317218721951 0.0630525248766 0.778161858589 0.181788766574 0.277449520997 0.361212044249 2.08515796396 0.43619236315 0.452696901317 0.173696696033 0.642502390054 0.0404014311909 0.682778351182 0.544672566316 5.21922208324 0.355151721135 0.107162523901 0.062248643198 0.663306402484 0.19162270899 0.522764714146 0.0335688758657 0.782763482094 0.163106673887 0. 0.0465122608892 0.585116516325 0.0171956340661 9.69575537066 5.40056188954
-0.463555302185 1.36885645104 0.629145708589 5.01894573147 0.116251331227 0.0907081671292 0.202939025922 0.905680697885 0.304403966397 0.432168130854 0.187380395451 1.35467307484 0.114572366551 0.0821882529413 0.176377339242 0.592215505168 0.305818323259 0.543871427782 0.216286614077 2.53109375099 0. 0.153558117059 0. 0.542581004971 0.20674612679 0.192504536483 0.0298525823301 0.547588985676 0.0805929436176 0.128518226387 0.0298694150466 0.255215461869 3.37416853428 8.46230911018 4.07152778919
-0.480383982717 0.113564278539 0.255623640736 0.00307653945662 7.39516897953 0.599690149253 1.27957922996 0.551895856538 0.710140444653 0.11711866548 0.203456778477 0.0768765888675 1.03022447997 0.13889393181 0.360875415287 0.143429116955 0.192790074292 0.0229978012169 0.0474128199143 0. 4.07431891567 0.348455094593 0.615092758097 0.2789288752 0.231998468985 0.16665458539 0.0999114485727 0. 0.545458431919 0.140425511194 0.252964601793 0.0641235109003 3.45150022822 0.25341181581 0.85537272809 0.336373802126
-0.0498994970469 0.659298255503 0.120756811598 0.110625856911 0.499397078742 13.156694884 0.527902627276 1.17450655751 0.0979999890977 0.783058133349 0. 0.234245741379 0.242028577174 1.27297503647 0.198144716023 0.226456646017 0.0392688783335 0.310112026688 0. 0.0478714335742 0.362254930416 5.85652628067 0.393384006798 0.85767141986 0.189282416135 0.204461461925 0. 0.249713282975 0.063213200208 0.772616833904 0.0880407062257 0.0621511474181 0.267377413205 4.93887836005 0.75208565002 0.499218431241 3.95581023001
-0.178490254361 0.113243779052 0.680601416525 0.0123851259926 1.07307674091 0.663960519495 11.4793867882 0.595067811349 0.255354019327 0.112138018559 0.72108127423 0. 0.2947402588 0.171527002844 1.04678252153 0.166942144533 0.0207482608192 0.0515545866334 0.294103848407 0.00675470149663 0.722558600771 0.21081306386 5.61878406624 0.353707057708 0.143153986138 0.0295066441118 0.27082080531 0.036527617573 0.392923461837 0.0543021739285 0.73796041319 0.111898158653 0.607469043142 0.42658669437 6.48078550527 0.214897870972 8.25817958502 3.64643404483
-0. 0.208975293263 0.113922477378 0.454907336945 0.527947416158 1.52290075472 0.499491662628 8.81867782892 0.162144537939 0.176899300708 0.339150496892 0.68155736895 0.243904893911 0.392613238257 0.235077576555 0.989929641162 0.0598904480749 0.0274939063586 0.0573185360404 0.220558213277 0.421217145809 0.469155144997 0.277763898137 4.77918871671 0. 0.0794382166745 0.130631183539 0.276353468502 0.158423765967 0.375150759131 0.0250784177391 0.818554705267 0.423651854092 0.932897423151 0.511556304679 3.77771578835 3.94974067907 10.060749705 4.3142715615
-1.06919091118 0.176544118626 0.62815843859 0.106929919545 0.625172320518 0.0983476708752 0.321057017741 0.0707726923527 13.0461448409 0.740214098892 0.5323200039 0.662033161825 0.555671637344 0.167882921301 0.254232048068 0.100907764286 0.612709770406 0.242146767217 0.324412275851 0.0715175841763 0.541526056137 0. 0.0203467517845 0.128916507747 4.65809384137 0.181788404383 1.09871502383 0.370878527838 0.517539462064 0.00597018697316 0.027004886244 0.130423699596 9.71419503953 0.996475979239 2.30362027852 0.771326354775 3.68110740354 0.574069449478 0.667747864717 0.357518830067
-0.124255890974 1.29327498652 0.049216033785 0.222982127914 0.0604731034924 0.80299117925 0.336520079351 0.239465907053 0.668765775192 10.0008088688 0.89905029628 1.10329562756 0.0812623827644 0.521666447963 0.020478509012 0.0788716826363 0.0723017837057 0.627028740646 0.0793409847722 0.183569879309 0. 0.535168096864 0. 0.154780680418 0.339970756151 3.70808312049 0.271651366993 0.458888099002 0.0631968307521 0.60855138889 0.000969590450287 0.129408342384 0.74578001827 10.9642335764 0.809321015463 1.26043846525 0.443541303106 6.32079872143 0.187046545446 0.779603904702 5.78656154224
-0.430633667495 0.216900752581 1.22423556589 0.1379606532 0.423782004361 0. 0.465596630589 0.125839128325 1.57018052588 0.499595707407 17.1424388709 0.630510821719 0.0770546407886 0.184781829392 0.80194232831 0.0778331486629 0.272675568284 0.154344824097 0.816164640218 0.181261351779 0. 0.289203423792 0.724311118449 0.430547822512 0.640397034316 0.185400847809 6.06769299227 0.336957380147 0. 0.0785717850552 0.563809365013 0. 0.879107248925 0.570402654692 15.1934005002 0.692558665128 0.543186719362 0.656469474346 4.55015113356 0.455496393966 14.8406602979 5.87378021279
-0.10782961655 0.397922832562 0.303043906275 1.15134235508 0.204418853685 0.371359365018 0.0922161117302 0.671905577877 0.407876429368 1.49131224744 1.22316074924 9.31364010052 0.0659344552593 0.144574201112 0.0925735408299 0.582475702388 0.0363355228639 0.297656428736 0.138440193879 0.659881107176 0.131631371164 0.0386775112254 0.149568084225 0.15703864353 0.245809837971 0.604325605926 0.462539132915 4.32018874731 0. 0.241384207368 0.00943776558503 0.474622377065 0.930923295825 1.57505991892 0.448160445025 8.27984902319 0.212526985917 0.662027832874 0.271951734254 5.3932152289 7.01796079889 13.2819260064 7.73152824174
-0.785114366281 0. 0.190582516962 0.0437245001644 1.60902617329 0.267703675237 0.172723544963 0.203174364247 0.24840311051 0.23889140142 0.287781434575 0.029901601348 8.72032227161 0.809949936009 1.27012921147 0.646006066362 0.263858017466 0.0911580000312 0. 0.0649890857122 0.588978777883 0.0593159278304 0.11311914885 0.127673720151 0.547537065571 0.00890813618702 0. 0.0160219806526 5.36614341439 0.321823878762 0.433766701507 0.153232412137 3.70023837835 0.451404912321 0.667859184893 0.381159496482 7.15133975759 0.765693663643 1.16326409239 0.756193823975 3.97556787065 0.0739449366022 1.30928853238 0.487292257318
-0.0932330048649 0.626458702051 0.147020840639 0.0783894286927 0.261572302761 1.54108436263 0.0203356376929 0.435931519232 0.163874623407 0.857984858575 0.215844705736 0.132020661072 0.581596595914 8.440142681 0.489582070011 0.887531645778 0.0330134663461 0.273150370312 0.142226319085 0.0929907118425 0.046271815886 0.616275281387 0.029319930779 0.139365079455 0. 0.44593197596 0.16281235461 0.131885848282 0.137662554377 5.38384064088 0.231910649926 0.405129195554 0.249998695284 4.60624374682 0.259025590052 0.940729844945 0.70354790234 10.809106611 0.673222830015 1.76599423259 0.383056109368 4.94461024512 0.324289399806 1.27641294791 3.64226215594
-0.115671087631 0.11099052262 0.523966729459 0.00825619242947 0.355096190579 0.273626760734 1.42924086577 0.190326900145 0.383735854706 0. 0.652083379392 0.0276221627974 1.28837929594 0.522186746577 6.74328786096 0.446545887313 0.109097648858 0.0210803305946 0.363099787521 0.0189067390323 0.207581570135 0.160645760092 0.651889079029 0.075801742214 0. 0.0473877911129 0.468659407859 0. 0.462535958607 0.518887856133 4.02344182321 0.297666753421 0.682490917891 0.251494236206 5.17276559213 0.229920577423 1.30998499607 0.620950341384 9.80097842168 0.792641443266 0.716049028897 0.340371268778 4.75383838917 0.398584556613 10.8895201843 3.39222524377
-0.0848119993015 0.0497111753355 0. 0.529676147046 0.218063169303 0.393785170806 0.389534896176 1.37035309167 0.181035586425 0.20545759066 0. 0.856323451482 0.631963013807 1.3992801786 0.563353589371 4.87278695277 0.0211020424287 0.0819252907359 0.0456965121717 0.197177035324 0.051473249901 0.188027970631 0.0844195663027 0.611932893809 0.0856434000193 0.161610141343 0.0593737882724 0.270441938039 0.169490119886 0.559077869937 0.245904264031 3.55100653969 0.328551756953 0.604424375658 0.392278042947 3.38035008941 0.520756692006 1.35443032822 0.371276014057 9.72265927134 0.398852401405 0.681732161833 0.397171209847 4.22304365899 4.28169336076 7.01100597142 3.51268072128
-2.2963661213 0.163164534263 0.572357770823 0.268914073677 0.329726654283 0. 0. 0. 0.618819652738 0.0340760214334 0.15660069592 0.137629051393 0.464863762542 0.0482339350431 0.0765141331328 0.0223618722052 4.93641399381 0.53919507183 0.778870379206 0.469274391055 0.529410506384 0.0102089226755 0.22936863473 0.00911296317807 0.951615777102 0.152092158452 0.195633518988 0.299143403733 0.792403150648 0.136536824369 0.292380158659 0.0634072465286 2.67929976566 0.111090266371 0.397993600546 0.273477085143 0.20004454144 0. 0. 0. 0.772323580557 0.0460467490792 0.274422295287 0.180438769889 0.345031512095 0.1169411809 0. 0.0862887154545
-0.36221886721 4.43749633365 0.198705602053 0.648323746956 0.068704432249 0.279665861526 0.00260402382336 0.141985679692 0.0423421376083 0.801368750052 0.223824905685 0.277391236847 0.0381087967915 0.497983733464 0.0469589556908 0.0268327207866 0.551348074861 10.1600786946 0.532862806093 1.2972973744 0. 1.35996071209 0. 0.457780412711 0.390328433347 1.35639448115 0.0821727427381 0.153319290359 0.407256454251 0.513142352844 0.0111661994826 0.336157828438 0.527409566821 3.84832736431 0.239717899947 0.829973779517 0.0644161274506 0.182748240199 0.0127517474922 0.174565348311 0.013411761878 0.849321327846 0.114319422746 0.116665223506 0.0177312509882 0.353509116466 0.108648716676 0.0492162804168 3.55997377287
-0.662844734956 0.24718672961 4.44643944812 0.312155165897 0.125249804856 0. 0.452865252824 0.0902557562959 0.780092420005 0. 1.08300931948 0.13064833238 0. 0.151981557649 0.403639021805 0.0102513824782 1.33684469853 0.5338563919 10.3812633396 0.691151745857 0.216592999189 0. 0.988823139793 0.297160088089 0.590577033043 0.412386887601 1.4165299385 0.0504868122996 0.308776833086 0. 0.765724055981 0.289704632468 0.598650479144 0.0352777339578 5.83174099423 0.37437356017 0.130108430271 0.114499334124 0.176488935715 0. 0. 0.281216744974 0.678643505586 0.216726769023 0.437232408654 0.0169010207316 0.193734873381 0.107114237976 7.62089842807 5.82215745173
-0.39718927436 0.582256314986 0.447372089267 3.00510556006 0.00523208328632 0.192717126765 0.0504732351332 0.271183148591 0.0739618424566 0.297135925765 0. 0.857837202389 0.0136678015112 0.112114970511 0.065541380167 0.354750352898 0.584297791039 1.24696119807 0.528300740757 6.53236720694 0.101472510413 0.110976638701 0. 0.70469406721 0.143001511783 0.292934968547 0.217703115206 1.18711697484 0.00759432390077 0.575520856236 0. 0.860908450835 0.326804098134 0.652075620805 0.265602198793 3.54052358699 0.0529274692445 0. 0. 0.13065909266 0.0921045261971 0.222944690332 0. 0.904397126722 0.0339390870035 0.0493798526259 0.077727243165 0.350455381219 3.06691219618 9.43091121002 4.23747456331
-0.266754024104 0.00650093716495 0.12800911926 0.0772980128718 2.86683009967 0.234582115115 0.445501850035 0.157126406069 0.290399172749 0.107595239865 0.108077202261 0.161561897413 0.699113848226 0.191697057858 0.162509316102 0. 0.607692951274 0.0469956221946 0.198918977485 0.0922159160776 7.58433037129 0.368490961564 1.08674774904 0.496812861248 0.666102043238 0.0990191396224 0.0920136908503 0.0821908436717 1.49081558785 0.154597741226 0.174755637165 0.146478461101 0.269216683997 0. 0.253567617568 0. 2.98327563942 0.233736190464 0.351757273558 0.139263081868 0.239430381403 0.0208928742124 0.222252319178 0.0175789101065 0.810861806823 0.279608431283 0.179458188958 0.195866758858 2.6854820791 0.398053984532 0.89809834227 0.247935202602
-0. 0.350679119366 0.171770055102 0.104925151245 0.27569187295 6.94829024374 0.334803148398 0.67706013313 0.193350480379 0.412581822479 0.0992653935902 0. 0.10635427699 0.699016591819 0.0539186926384 0.138446373546 0.153056250509 0.713312843099 0.0600509965939 0.255963010535 0.977892604151 14.4889648601 0.9706502979 0.881312161472 0.0346182115187 0.64545890404 0.134577713879 0.290715313336 0. 2.39103151387 0.273437271363 0.464611330894 0.246713626684 0.40332369024 0. 0.145163680564 0.372829638364 5.88638743233 0.226345198689 0.660313641705 0.190871514078 0.468824543611 0. 0.342786925459 0.0289876816848 0.926564298096 0.264713948349 0.168913634851 0.247713670257 4.30894205465 0.435130299606 0.538207204466 4.09158908846
-0.0852410654989 0.0511030057169 0.509274844394 0.0373529090687 0.702993747187 0.420627472897 5.42647743174 0.131536971718 0.0544918473889 0.0128070613042 0.524612151038 0.126370441821 0.153615064327 0.18902932533 0.51889155516 0.0343168562204 0.177500342967 0. 0.829123397045 0.142488350733 1.72654391503 0.629020310446 11.7406994673 0.890649274227 0.0675687379755 0.11742638392 1.01918916916 0.169065502496 0.563238316532 0.404080301794 1.757981046 0.033475292508 0.116203786627 0. 0.327480025776 0.0230249387485 0.594810129652 0.230254744366 5.0646899971 0.418798741428 0.104334665716 0.104697825563 0.407467483724 0.0406246231031 0.348189622419 0.21390374221 0.705834513063 0.0642328453938 0.553054947903 0.513442901514 4.26222018466 0.208573091283 10.5015585013 4.79812930239
-0.016450712606 0.216977814459 0.196903475283 0.251042590329 0.381360395441 0.413738227705 0.369887142101 4.88259977716 0.188049445316 0.176146965588 0.0503173213445 0.269668758345 0.0782349657847 0.280488056823 0.120251545162 0.618000796657 0.126134853645 0.401182869233 0.114756316467 0.597468154008 0.532005117974 1.72633341664 0.896161496941 12.3577660392 0.126652444404 0.183007805123 0.0120862345708 0.810724156403 0.546614503908 0.381149400912 0.262332528854 1.85559847553 0. 0.149062776866 0.0200114447219 0.530378592208 0.310737212864 0.615825997783 0.409391933973 5.39308092496 0.200657743084 0.0952515324537 0. 0.521862066811 0.0957681689554 0.441655874781 0.173274569629 0.711991153156 0.264993223104 0.150780925398 0.398721418433 3.85456065949 4.25450384849 13.2346289613 6.0736547061
-0.440603456097 0.175073392063 0.119622864329 0. 0.241873704132 0.0710770145015 0.0666045777945 0.13396754322 4.24467760612 0.219451207928 0.47068741368 0.159446593493 0.26107084768 0. 0.101681207607 0.0920335638825 1.24654760408 0.189595106863 0.221227691285 0.169635541932 0.565777108883 0.24512236772 0.122082481977 0.106034887959 10.4509269008 0.388387008742 1.12670684035 0.421873919179 0.887638019557 0.230073415723 0.215867259065 0.141579391234 0.747688670763 0.322956986932 0.151769782551 0.145090356887 0.19983239471 0. 0.138068910759 0.162894030212 4.12944027014 0.222269703418 0.334749332402 0.304982463476 0.380209684032 0. 0.0599817853084 0. 5.64715544394 0.843531318989 1.49518330985 0.696491513928 2.82691991286 0.272897891241 0.647969513561 0.270271138196
-0.0368326690502 0.516163584717 0.0402954019228 0.182113461448 0.0267329337356 0.295453650877 0. 0.0391106979068 0.346195590601 3.90722002563 0.251453752135 0.499977068872 0.0438768001794 0.3121885514 0. 0.0101561918638 0.194163815105 1.35154136626 0.256764960023 0.351956461653 0.170903537116 0.571102158636 0.106497372506 0.146134689188 0.650963876986 8.25974889116 0.620138351612 1.28022944042 0.122665881254 0.902940935388 0.0514628555172 0.223518006413 0.0584356644606 0.677203763896 0.159679451097 0.12007911109 0.00334815605962 0.3959196116 0.174551188289 0.159757167432 0.400908679613 3.8883577563 0.339738184481 0.655622431939 0.0665622505526 0.301088437109 0.0532895087776 0.074214780687 0.467362675757 7.53716823196 0.459313777385 0.972487425198 0.169797309845 3.67327701095 0.226350163374 0.743267916615 2.90494533079
-0.171217381999 0.0497713256843 0.703690916737 0.00377987735703 0.0210415170442 0.0860663292958 0.467325777053 0.128714715206 0.496303416213 0.423708568916 5.52927750422 0.209280636062 0.0873057422167 0. 0.259365039118 0.0275367980795 0.383471027046 0.204822857403 1.80740883282 0.200378182483 0.40275582395 0. 0.892186378848 0.0663342198387 1.69920321307 0.698565335305 14.5160708517 0.633401751827 0.234001345722 0.147947342925 0.935226991803 0.0778740557829 0.250771561241 0.0176325172834 0.747036852503 0.101064900471 0.139891600514 0.0267744784649 0.156853529895 0. 1.03113066727 0.393691514117 6.82845384705 0.361457674159 0. 0.0227540771818 0.432779186274 0.121581588911 1.00417952833 0.528467331925 10.1998063449 0.70292632121 0.575173027014 0.53026533446 3.85919571034 0.583793843694 7.55826014247 3.99957544825
-0.11046481743 0.259409163754 0.0640200209963 0.387824432047 0. 0.116530780141 0. 0.269206680089 0.396274595634 0.501678979087 0.285561984975 3.75701797435 0.0203002997396 0.117638129845 0. 0.276900338114 0.209721834182 0.425937609857 0.160289713534 1.42478289884 0.0133090770313 0.356482366509 0.0707080376994 0.809766978853 0.717499678142 1.05863963611 0.545701151656 8.66185832183 0.108602644392 0.230637865059 0.207292284638 0.538602837775 0.105996038363 0.180389920988 0.186551695414 0.654473921306 0.0307507719021 0.155170777697 0.0354792755932 0.326333864235 0.281965140344 0.534045303356 0.36860222882 4.52696158832 0.0512746128742 0.109908902216 0.031024119875 0.337401611895 0.399978877574 1.62914608647 0.776194566993 6.37590575281 0.26209124539 0.628104114236 0.229319936808 3.77378987738 2.82365702231 7.35426366874 3.24606543855
-0.28348427334 0.0699109092497 0.0115243665938 0.0247539692896 0.417015450631 0.135875392068 0.268295082193 0.145629497336 0.260780495373 0. 0. 0. 3.10401749226 0.233910519211 0.50550031745 0.274249624795 0.502928793045 0. 0.30256369977 0.102945787798 0.992034505912 0.241353238048 0.198457172634 0.154684893909 0.573358343749 0. 0.227077915261 0. 7.45434830156 0.424948012815 0.712630951997 0.524185596935 0.361367267025 0.0744190424464 0.112792427081 0.0734282242981 0.484091834767 0.111218952303 0.150743797934 0.0021339917222 0.293650150546 0. 0.02116599467 0. 3.38903656196 0.112898399837 0.478710281107 0.129217440647 3.21303018321 0.333544983719 0.784623002124 0.447344524196 5.70524160401 0.749006476972 0.94290384194 0.635394355901 2.6809463432 0.190350416362 0.506824958659 0.311522768636
-0.0441271017621 0.295578059389 0.00538296576352 0.110839307911 0.0967261383251 0.879962963336 0.239929977946 0.130401327035 0. 0.340950951096 0. 0.137440936288 0.346025987669 3.47636446237 0.278642779927 0.470025718811 0.112692964798 0.619099122427 0.00242780561576 0.173907015881 0.201742176005 0.999189599873 0.219477527941 0.921815929995 0.131841137033 0.676395318803 0. 0.194240135011 0.609370026677 9.57208990388 0.584905018757 0.898643131352 0.0236332695617 0.208932252302 0.217701165002 0.178589346395 0.0707708189865 0.75565077833 0. 0.0793080592395 0.179063482307 0.379112828132 0.176743685886 0.103537317554 0.461838184221 3.38109025265 0.227764370549 0.711382935742 0.33354958253 4.06165867022 0.524877361639 0.658211390383 0.735233306573 9.7497109579 0.731821772009 1.73956580152 0.265634075375 3.47770284375 0.463685252076 0.662645060954 2.65607159046
-0.0683387462584 0.0219629130994 0.277538132256 0.0218956105837 0.206201631706 0.0684822381157 0.407023501116 0.0451269026509 0.123393342911 0.072966956579 0.247768523847 0.0483266332068 0.606740463055 0.29820535935 2.6061321606 0.175109875588 0.144201033078 0.0824589690667 0.503437283862 0.0753138053082 0.392349366718 0.255603880722 1.52451708358 0.172409143922 0.189011576962 0.0325607363443 0.588467389971 0.0933720092444 1.2780171571 0.690762189525 7.24187169913 0.644942406325 0.0762203715741 0.045675693536 0.286183717598 0.0152119119626 0.180745081545 0.0659332293219 0.690175236215 0.126163675168 0.128302974079 0. 0.318741829473 0.0326199410537 0.498619723618 0.187967114517 2.82346513173 0.227608501656 0.505109007998 0.258054431799 3.92125357864 0.364902097321 1.24245726327 0.602397752765 8.63586700945 0.759728453173 0.583845430492 0.20994437703 3.64889395544 0.242635624424 4.90403632008 3.05311621448
-0.0306716260713 0.0814321197009 0.0263314010054 0.272678801329 0.106013680564 0.129532610405 0.0907157735716 0.532493488287 0.0109148306893 0. 0.162164771732 0.265180903915 0.392021613007 0.447741723488 0.282872330359 2.08107153488 0.0784322946977 0.148287907702 0.0731834628584 0.480938701331 0.194862987879 0.41943849415 0.136885175806 1.07543696247 0.0733045890116 0.170090519611 0.152154070687 0.575338518819 0.651042513614 0.990533484602 0.402752307023 5.51178277187 0.0423383577472 0.114394597746 0.0322564050447 0.290883488614 0.0176772594012 0.130997979349 0.0554591676 0.600771271188 0. 0.0290669346423 0.130598018554 0.373034762049 0.33093489787 0.412308156247 0.201480408382 2.63346193838 0.288284729936 0.743880049931 0.285467677785 2.4778577813 0.413816264532 1.08713768724 0.625062767287 5.87760116803 0.261761111281 0.472862376536 0.281657222631 2.33927651605 2.25924727523 6.49703836519 2.52893187835
-
-0.0436588705204 0.0180416592111 0.0172705049816 0.0313059619256 0.0204318574391 0.00866565654901 0.00855826696922 0.0141519128344 0.0142075650725 0.0143506931474 0.00948176289506 0.0144385885967 0.0225118414231 0.0129557312092 0.0174966181456 0.0312026568728 0.0239028750731 0.014100885263 0.0142807205131 0.0174958592717 0.0150062262476 0.00953963818715 0.00766268420971 0.00948917307515 0.0109028479501 0.00974640899548 0.00766468852951 0.00853983079827 0.00982133662971 0.0113346471791 0.0146598494319 0.0173023151885 0.0185232762774 0.00942946755785 0.0112331321758 0.0129178678673 0.0182808830371 0.0124702528141 0.00976065350432 0.0142632664142 0.0110575600113 0.0125490239213 0.00953313419174 0.00870953731425 0.0110807056641 0.00941450435082 0.014224693302 0.0178827153121 0.0237376950165 0.0107759910236 0.00965035342006 0.0224624342706 0.015863351958 0.0110733401237 0.0109487196432 0.0142092703067 0.0157160768607 0.0182943776 0.015043406603 0.0204114839078 0.0240554444316 0.0186483208344 0.0239797623875 0.0436191635614
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/20flies.nh b/PhyloCSF_Parameters/20flies.nh
deleted file mode 100644
index 67ecba4..0000000
--- a/PhyloCSF_Parameters/20flies.nh
+++ /dev/null
@@ -1 +0,0 @@
-((dgri:0.183954, dvir:0.093575):0.000000, (dmoj:0.110563, ((((dbip:0.034265, dana:0.042476):0.121927, (dkik:0.097564, ((dfic:0.109823, (((dmel:0.023047, (dsim:0.015485, dsec:0.015184):0.013850):0.016088, (dyak:0.026909, dere:0.029818):0.008929):0.047596, (deug:0.102473, (dbia:0.069103, dtak:0.060723):0.015855):0.005098):0.010453):0.008044, (dele:0.062413, drho:0.051516):0.015405):0.046129):0.018695):0.078585, (dper:0.007065, dpse:0.005900):0.185269):0.068212, dwil:0.259408):0.097093):0.035250);
diff --git a/PhyloCSF_Parameters/20flies_coding.ECM b/PhyloCSF_Parameters/20flies_coding.ECM
deleted file mode 100644
index 13c9a37..0000000
--- a/PhyloCSF_Parameters/20flies_coding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-0.856979977161
-21.3799807399 0.243048702626
-1.07282632554 23.2891199352 0.417014024371
-1.70189173492 0.188155975062 0. 0.179377976204
-0.0606628059885 1.25594389172 0.0229550444473 0.00328435713687 18.1364766697
-0. 0. 0.566942262009 0.137821071867 31.7666032929 13.2859098957
-0.363302169127 0.3216200572 0.0779713622622 2.07370722097 27.2607785838 28.7642437906 21.1732174575
-11.2727606341 0.582021939541 0.450519061187 0.520525692578 2.87314674986 0.160184415377 0.0417616105268 0.392943810626
-0.197373806562 3.66356232072 0.129128041228 0.379280117156 0.326199666848 2.74555693992 0.150499848254 0.667770340927 1.87830419013
-1.86834815872 0.345363208373 7.04665342055 0.577755480658 0.355521388131 0.0612681556016 1.5212484594 0.479173384021 91.0051457762 1.3573969268
-0.568971981177 0.457370202419 0.104759904219 3.91042274811 0.352600386489 0.20108530169 0.150446124992 5.47395727586 2.78281874049 33.1384407846 1.6359111141
-0.796825184123 0. 0.0403648471502 0.101591604765 2.6530525349 0.199481018682 0. 0. 1.47135196603 0. 0.224999116277 0.0620080781057
-0. 0.416451433015 0.0365778147437 0.024970392227 0.100800143598 0.874204165608 0.130583286588 0. 0.141999370164 0.485936631223 0.110543922695 0.0881051473082 16.2840553339
-0.12641874075 0.065507193128 0.253613039853 0.0876476849427 0.354732481143 0.0224235730108 1.13456690845 0.205922054122 0.256670135609 0.0609082999619 0.993578689887 0.102531431492 2.2112993571 0.489455389074
-0.142167147587 0.0841528499849 0.00545185023752 0.468645974403 0. 0. 0.0245735447417 2.73514077321 0.0321517883643 0.0681718672235 0.190961252265 0.564971900021 24.1383229355 25.0045526655 0.960565154999
-2.61068586388 0.212857299965 0.0161926638881 0.436376510995 0.488945589229 0.0490126748638 0.0436777528509 0.118779224993 0.825672501796 0.248397282773 0.124449316407 0. 0.189414008686 0.0401485471222 0.0881524691569 0.
-0.101975766087 1.1738270611 0.127110430158 0.28355571795 0.014758840992 0.189405643318 0. 0.108577951241 0.15192674656 0.262657678883 0.186613378152 0.243660589481 0. 0.103957104833 0.0352873054316 0.00482802362259 1.79658789534
-0.0314277315691 0.169819246298 0.71866826475 0.165419543032 0.0377534774895 0.0241395904101 0.254563562124 0.0674618895841 0.0993905843497 0.0137652380848 0.619525928607 0.195521335534 0.026722114036 0.0130894039763 0.151205759774 0.0269324846295 24.088796861 0.961987674941
-0.344940619174 0.305455398829 0.0709676514016 1.60031795914 0.0704789063483 0.0159279589167 0.0877851061075 0.250696459521 0.0910258661535 0.17314633403 0.0620955543552 0.22104611078 0.0349971452587 0. 0.0470746037141 0.110016087229 2.54181455243 40.8651006557 1.46068774674
-0.306136639675 0.0365068756611 0. 0.0217224466725 2.73433734021 0.110586423354 0. 0.0381219899006 0.151571445904 0.0326945160705 0.267764377037 0. 0.441539418948 0. 0.0665640592016 0. 2.58642595246 0.109367108497 0.14611246525 0.118659911293
-0.000573614519137 0.104253395908 0.0250383204733 0.0533636462092 0.073014643704 0.473103940343 0.257984331274 0. 0.00615865469376 0.150482492584 0.00442777476089 0.0945035122737 0. 0.251993614389 0.00524930812503 0. 0. 0.603166504243 0. 0. 19.5110085343
-0. 0.0326516117459 0.105921316773 0. 0. 0.218109844754 0.880892812609 0.0206567660033 0.135717490267 0.0100217453445 0.0691830645025 0. 0.265895553088 0. 0.131840210044 0.0385783794127 0.0903101309711 0.0618145555718 1.02475793811 0.0557339105725 35.1407733276 15.6280698007
-0.114378433963 0.0755380229992 0.0334696841663 0.234076002893 0.109622016168 0. 0.043579809404 4.14976553074 0.124020445748 0.0276682901455 0. 0.420860301583 0. 0.0337486778241 0.0482465610908 0.384833201848 0.259016000851 0.0333608744166 0.0967913002381 1.77059360242 32.5414384022 37.4249875733 23.6322118109
-0.76872051314 0.0518496635313 0.206790445458 0.0103357986514 0. 0.0648947518157 0.155573814444 0. 41.6367496355 0.00897871779297 8.10178576716 0.0463408459908 0.010090972335 0.0200177545988 0.0153924623022 0. 4.03988737059 0.223383788962 0. 0.346561611784 1.15593423028 0. 0.0565558183642 0.0376120984804
-0.176940860673 0.0966444861601 0. 0.0785592690521 0. 0.0772313331586 0. 0. 4.89241326509 0.483964741726 5.93138982216 0. 0.0179416028768 0.059548694535 0. 0. 0.101310940279 1.40994629437 0.043866333123 0. 0. 0.309580947376 0. 0.0507115815889 21.2902489182
-0.0629795298351 0.0473604696912 0.688318325575 0.0412159006215 0.168097795855 0.0101942613411 0.0337230410753 0. 6.16756316069 0.0735969582839 42.0857806752 0. 0. 0. 0.0832000654832 0.0846535128153 0.379681833159 0.263413123194 2.16045669637 0.351469470996 0.0788557433647 0. 0.826518430639 0.128090672973 58.0453855015 20.923641997
-0.076094298316 0.135288219525 0.091294048816 0.0922485327941 0.0209863103834 0. 0. 0.226369136758 6.18143228454 0. 5.15573649415 1.07125192286 0. 0. 0.00125691002419 0.0937402627757 0.189747523371 0. 0.0665289703423 2.24488710932 0.0379550972204 0.0159773467171 0. 1.01770296266 37.3377363307 36.4584471667 29.0745428077
-0.158160420516 0.0120556276078 0.0238578426229 0.0160045795938 0.492716547477 0.0131875041541 0. 0.0403949866778 0.453580964347 0.00926804861436 0. 0. 3.34467930183 0.162615843816 0.670668819393 0.285564105445 1.96192533786 0.0700417989899 0.0707320089966 0.121981173462 2.44581946984 0. 0. 0.0576424452148 1.16342540608 0.011075412755 0.158559659269 0.
-0.0193224380447 0.0923148288235 0.00365268936531 0.0102066825968 0. 0.316452253978 0. 0.0163413226077 0. 0.0900658323965 0.0912448768615 0.00658190908684 0.689809618606 1.64922141668 0.179746039009 0. 0.115396665688 0.717152347661 0.0138497664298 0.0176041997189 0. 0.667969566413 0.0655661331862 0. 0. 0.418688777634 0.0945356085407 0.053164878132 20.4544469922
-0.00863512879095 0. 0.0369467829568 0.0019694946879 0.0365641334362 0. 0.13284384295 0.0243929829242 0.0517560523386 0.0189830161506 0.0335419847401 0. 0.137834606237 0.135640691099 1.08284486544 0.26921951135 0.0109947403896 0.0402028321664 0.514219812106 0.0267652516336 0.0695645290054 0. 0.494204070935 0. 0.04564276207 0. 0.466875712102 0. 24.3036054086 11.1181661776
-0.0665448209559 0.0548921830946 0.0255372736646 0.1507258224 0.0917147710424 0.108998077057 0. 0.714672482528 0. 0.0329706332436 0.143626874104 0.24454328392 0.454910519719 0.19417661262 0.486820556809 3.68990164995 0.330541181565 0.0645236037793 0.0890425798061 1.62529759913 0.0855851253897 0. 0. 4.55168880801 0.408631955389 0.0763223679712 0. 0.997577985124 33.009352379 41.648977566 14.3264529944
-2.36523488606 0.149863093615 0. 0.388052184684 0.52351318356 0.0445107931652 0.0361304571772 0.146675648637 0.99510305123 0.252054393805 0.140935161049 0. 0.18178207578 0. 0.0469925022234 0.0740502996711 2.51861283466 0.0877276849259 0.01053357318 0.170037651281 0.332126116503 0.0147257337575 0. 0.114800469765 0.249414968805 0.0054522238743 0.0234992906199 0.0284634729163 0.161617184985 0.0132888628625 0. 0.0387208308101
-0.101044364903 1.12349591734 0.0964056709973 0.2949678621 0.0362440735034 0.209698409121 0. 0.115482498535 0.138591958729 0.347197050615 0.153933364371 0.186391760757 0. 0.0478883109412 0.0165935750516 0.0401249768569 0.114390244071 0.49073782611 0.102735060828 0. 0.0353325854985 0.0724307861011 0.0317606016453 0.0186358072982 0.00708915904149 0.0667930926635 0.0365349171106 0. 0. 0.0491828806638 0.000975790213379 0.0211275510994 2.2053619905
-0. 0.125850443125 0.469382098904 0.107088504706 0.0211899645054 0.012870331311 0.184537424832 0.0724449792169 0.0673464126781 0.00496543008336 0.444779446067 0.185963125037 0.0352736521034 0.0262935981441 0.0696281314347 0.00380919013691 0. 0.0789108992446 0.80195467336 0.073867922517 0.00129773029579 0.0152333914511 0.123120315853 0.0284519012919 0. 0.0107614194593 0.150140280137 0.00385025472898 0. 0.00301557967663 0.0454687658394 0.0154784915455 19.7948511659 1.21145935309
-0.232011173528 0.189044125172 0.0671282746214 1.4109043465 0.0604442877758 0.00258249629862 0.0744724196011 0.297633359298 0.121744849668 0.0995804707507 0.0631436303072 0.346908534413 0.0238862732448 0.0141354459264 0.0184355860263 0.0442828901294 0.161643875125 0. 0.10663812361 0.54656952131 0.0150492508722 0.0294819232815 0.00857969312713 0.178824935467 0.0273276064468 0.01153190045 0.00718248290439 0.0860298814355 0.0105820559511 0.00157089298236 0. 0.0834596470596 2.70870019447 22.1270471209 1.31422399551
-0.50529296361 0.133370235344 0.0498469357135 0.0867569048185 8.82982471481 0. 0.106854987591 0.315354807755 0.937948880112 0.100630138883 0.0469600368516 0.108537395112 0.609587756716 0.107449051201 0.202699480512 0. 0.464926806749 0.0274366896291 0.0685629106518 0.0267324573674 3.59299923769 0.130531963383 0.0440063078142 0.395885476632 0.338260573182 0.0014435613204 0. 0. 0.436574638249 0.0363221474819 0.0508433777347 0. 1.75460515603 0.158313429179 0.10276476705 0.0621464281103
-0.0284461790952 0.212253431123 0.0262704624699 0.119807369257 0. 1.69439137847 0. 0.0238200232328 0.0499311140125 0.42812763174 0.0433483934406 0.0779343651887 0.124238771678 0.21961026491 0.0394061124296 0.00784799084073 0.0370027169509 0.0818947112047 0.0252533899205 0.021747647579 0.0113094179791 0.724512682025 0.134472285662 0.0310957722831 0.0167745448161 0.057197304014 0.0272889977886 0. 0. 0.204127343375 0. 0.0576450975873 0.0922046679477 0.353390774491 0.041312983612 0.042153189286 12.3630468079
-0.0608058541496 0.148482722226 0.207943699078 0.027915342068 0.208619559066 0. 3.91408287845 0.0952994427658 0.0239980660381 0.103208669958 0.542149892427 0. 0.00398056690156 0.180172992896 0.396999764442 0. 0.101691932539 0.0381385297924 0.286539177894 0.0133204803183 0.101634701266 0.219858353351 1.59519726774 0.231309758435 0. 0.0118070853546 0.270096461369 0. 0. 0. 0.125163131058 0.0331786840056 0.209190222596 0.181921325117 0.779148128217 0. 29.3362421982 10.5727352608
-0.104224724824 0.149896543597 0.0408462440613 0.351541033243 0. 0.0470545780751 0. 6.29767077478 0.0638605912434 0.0203328796665 0.17882849221 0.863911458009 0. 0. 0.0945005781775 0.716896467078 0.0594344511385 0.0112326757614 0.0486622115963 0.155235197328 0.170785316863 0.0397408684506 0. 3.70884461498 0. 0. 0. 0.198998766469 0.187561459576 0. 0.0383346884399 0.655329719253 0.204713395657 0.0710634862878 0.0957111473389 0.724858046892 21.5035212342 20.2117021205 17.0975384559
-0.243814221546 0. 0.108824678522 0.264420182206 0.364793101017 0.108006155671 0.0205920780887 0.170326493076 4.50859744421 0.269800396052 0. 0.173323615768 0.225395739418 0. 0.0520477021147 0. 0.284281705356 0.0953344886278 0.0515911206625 0. 0.234186592483 0.0289777763915 0. 0.161158840873 0.796843962108 0. 0.115827793356 0. 0.0987136739611 0.00029047619079 0.0112748855466 0.0121835662905 1.77155307137 0.0169763500914 0. 0.18823403339 3.31343536517 0. 0.101946039966 0.368466135555
-0.105733514394 0.55778792064 0. 0.0456698894765 0. 0.152841815427 0.0976274621557 0.114331444121 0.138690469977 2.07292580293 0. 0.0995490839043 0. 0.11553472201 0.00936734365735 0. 0.0639926611674 0.0711496517083 0. 0.072945462527 0.0165240972727 0.0563383181792 0.0301863217865 0.072033684696 0.0895041669733 0.234873522908 0. 0. 0.00334416438512 0.0658256490442 0. 0.0201119425472 0.0142221784569 0.796802944169 0.00644729862263 0. 0. 0.969675795578 0. 0.259312270938 16.7988341937
-0.123747011131 0.148762152389 0.448086643454 0.341823632575 0.34476022895 0.110877804612 0.468103639003 0.0517409316386 0. 0.472120665461 6.98729985985 0.569550979079 0.129146686061 0.0224600289171 0.282942379039 0.0547809756015 0.0529083010131 0.126121884865 0.464817592539 0.0563535784111 0.157848239294 0.0690716512742 0.284621038424 0. 1.26223251509 0. 0.425919459795 0. 0.021314959391 0.040206047527 0.10390150134 0. 0.474503890347 0.253280616196 1.80381788864 0.35821099567 0.457002815235 0.154061170371 4.27766696355 0.386090358293 47.9325619303 19.6808295645
-0.0940392483601 0.156428897336 0. 0.555747149715 0.265719451989 0.0591439377268 0. 0.388837541416 0. 0.092604306386 0.707672059766 4.16244419308 0. 0. 0.017844959855 0.191326971468 0.0214867140775 0.038793811958 0.0231011617586 0.178575314934 0.0264742042909 0.0665555390941 0.00974038240155 0.233148293816 0. 0. 0.312691113373 0.796448296354 0.0276668298469 0. 0.00576986511196 0.161257921724 0.0740679232858 0.0435058827918 0.0146785759452 0.935073559881 0.130985969118 0.150459907519 0.104142974561 2.2937251156 25.9167566891 27.9672543534 30.3671736585
-0.434058116582 0.0243009357809 0.0664865836138 0.0549805741932 1.85695152847 0.145837441361 0.119526026661 0.451736279288 0.93810077143 0.0667330549159 0. 0.0784036993055 9.77530236961 0.436725089765 0.58316203681 0.977490399744 0.341726863473 0.0390561119246 0.0380593521652 0.0286543721396 0.781823693643 0.00218133774376 0.0685003177396 0. 0.271085249245 0.0104602785429 0. 0. 3.47120842402 0. 0. 2.30786650813 1.50791862083 0.0483963919454 0.0300621606704 0.0735252786412 5.61717661886 0. 0.634793867133 0.742661472684 1.55918666263 0. 0.841314002074 0.
-0.0113667677619 0.139097021802 0.0266279055959 0.0649110059928 0.271165225002 0.356374200249 0.462447049335 0.0812554110799 0. 0.261906579666 0.214962406813 0.150876194512 0. 4.85246662164 0.112885739127 0.128479081658 0.00382441531228 0.0963471511583 0.0288968160516 0.0380575513004 0. 0.460646796364 0. 0.0526747725656 0. 0.0635182874082 0.0624795281108 0.0496585258215 0.249922297538 0.880126512364 0.104923430442 0.0475178691005 0.0469942044593 0.377726315 0.02396015719 0.0058029211923 0.400818155317 1.88399437755 0.0249683518635 0.276514482787 0.0333431132158 0.479895695338 0.0844193920514 0.0624254941258 21.7592101953
-0.0331799427383 0. 0.0666993209566 0. 0.0659147301184 0.256960995461 0.286462654957 0.0701466885296 0. 0.0107854883592 0.295165736711 0. 1.21447464954 0.180018476203 1.01556150887 0.426925008475 0.0425154209715 0.0198069960443 0.0949639914014 0.00626698048332 0.10953938333 0. 0.300853421045 0. 0. 0. 0.0831189682586 0.00455574777414 0.229147001649 0.243060751563 0.659201322877 0.00153006753369 0.0140756082878 0.0077442567221 0.264077928925 0.00835488167252 0.342760335106 0. 1.80433636682 0. 0. 0. 1.1713441614 0. 31.8153346162 13.500934857
-0.0753651521978 0.0829572682127 0.0469876926104 0.213057044827 0.276108755483 0. 0.205795926871 2.07448463232 0.414603494325 0.108654113555 0. 0.42829121982 0.438401644702 0.326753757929 0.233179693471 7.21268221952 0.0721202274211 0.0136132175223 0.0214700972484 0.181444564043 0.0226930454947 0.0998250535633 0. 1.02344251681 0.27821255631 0.0066081187679 0. 0.0411768797912 0. 0.18792017758 0.056173201874 2.58754316069 0.240544111649 0.0391893694734 0.0120639862744 0.591089276474 0.41302815344 0.0800084271644 0.145503183728 5.00734758378 0.188951138852 0.0153168225304 0.00275019000738 1.24518227851 30.5503637373 34.0462233841 18.6930893112
-3.5612805718 0.185576667155 0. 0.261882000557 0.552498356896 0. 0. 0.0454188913343 2.18033142306 0. 0.913055260815 0.148167561548 0.979499033508 0. 0.0276967036387 0.0462666186648 6.87550522201 0.409269139199 0. 0.385739048816 1.2307998883 0. 0.175887843684 0.0906161829493 0.735716867884 0. 0.600993186416 0. 0.729833033914 0. 0. 0.026483433212 2.74504384982 0.155811527469 0. 0.123461266078 0.427731161393 0.0289604446028 0. 0.0303196385124 0.493373112815 0. 0.222411828762 0. 0.699369865327 0. 0.00201358602267 0.0716169942232
-0.104325456084 0.463481189267 0. 0. 0.0326564812186 0.0193838763331 0.0364109108089 0.0460004723167 0. 0.098968148224 0. 0.0447017063462 0. 0. 0.0257930407901 0.263414933857 0.206483480307 1.24027101417 0.00160980668212 0.258419493927 0.0376900584074 0.045732253611 0. 0.0414234180165 0.064309867278 0.0667778675875 0.0394817700222 0.0782429690108 0.0462470882557 0.145607151232 0. 0.124089860161 0.120025598718 0.113313102447 0. 0.0293429859405 0. 0.0944873791495 0. 0.0538686904815 0.237650500843 0. 0.145663879182 0.0422859300375 0.0328957650127 0.0011783331156 0.0268609220906 0.109848171138 0.708962533642
-0.0440826539721 0.183543317224 1.31985453104 0.29760797105 0.0134450303614 0.0627229514106 0.31279883249 0.0806111169421 0. 0.157442294141 0.297999910948 0.109689823 0. 0.282760962173 0.218720526434 0.0560052611502 0.251959973649 0.420273990731 3.41918753696 0.491882578276 0.0896406707367 0.186494631066 0.439708062254 0.197947369192 0. 0.497223431254 1.2424461357 0.258879085594 0. 0.00808306260146 0.0470148067102 0.17542811997 0.0509391703359 0.148001904375 1.04860067906 0.194814679614 0.115927749447 0. 0.449370327984 0.0200324395713 0. 0.0892899979766 1.23078140878 0.079658732789 0. 0.0477979550569 0.168444216083 0.0449592501719 352.932298864 0.757542891626
-0.0260133112348 0. 0.0533392790958 0.709830630177 0. 0.0772589390514 0. 0.102456250928 0.164849778116 0.0404640512768 0.190001520841 0.135220074865 0.314847205215 0.153220567324 0.0365803390517 0. 0.060206598525 0.364682449198 0.133569747889 1.93244338701 0. 0.0246104772359 0.0254103916945 0.227563058626 0.0076539393152 0.0631550795105 0.0293457012601 0.108828143742 0.0226945449551 0.0322923760681 0.0514989763176 0.297520720886 0. 0.0872796679636 0.0728170451125 0.210120628582 0.0723105238391 0. 0.187833239399 0.0353299664323 0. 0.176256670958 0. 0.0721598798001 0.0450225348449 0.13074927379 0. 0.0585416392465 1.78059816087 39.161107698 1.08904133074
-0.32285906089 0.0859967474225 0.0561149741506 0.0997333958055 6.22297209977 0.0880669876225 0.726694491183 1.01646558779 1.08531977553 0.28612993001 0. 0.315673439399 0.410167922953 0.131920417886 0.104283886065 0. 0.778552681658 0.0466109104441 0.0770193625443 0.0954793310376 5.88489430467 0. 0.189290015679 1.20033163478 1.04257180512 0.0240800875658 0. 0. 0. 0.258693504552 0. 0. 0.410407385613 0.0417471510459 0.0229055164516 0.0633805100821 6.20291445659 0.268643999351 1.00503843064 0.172686305629 0.447784867539 0. 0.134286796325 0.220374931404 0.988209249538 0.132976168404 0. 0.323609598337 4.25915133684 0.0849966076834 0.374585594363 0.00669084346932
-0.0592120190495 0.317137404498 0.00996511224837 0.024970726587 0.184469819546 2.22580329794 0. 0.361810497613 0. 0.982607661126 0.136268953756 0.2043280624 0.45640423584 0. 0.0106817429255 0.0328444321006 0.0648093172502 0.237096986804 0.0178648037634 0.0197756543926 0.0919299997176 1.2554947586 0.164755867238 0.454088869701 0. 0.112459471987 0.0808505600423 0.0371170702525 0.169759857654 0.2913277705 0. 0.237002712084 0.0475003073893 0.184783472255 0.0192972493559 0.00777830381048 0.314901795686 2.11204235155 0.159218972699 0.385608776687 0.0617656827024 0.219401023947 0.0421932203634 0.0692095788129 0.0936204368 0. 0.21065062495 0. 0.146933837691 0.28561463973 0. 0.0412013552127 21.1669501142
-0.0214242844445 0. 0.0890509476222 0.106347387581 0.50477863564 0. 3.09784136779 0.0459525854663 0. 0.165204710987 0.445843862583 0.278213722528 0. 0.210736910449 0.177706552924 0.0380595760919 0.058570696183 0.0201420132449 0.258429258273 0.0560705901873 0.0251972854114 0.140893674403 1.42610603808 0. 0. 0. 0.317799605587 0.0506989312525 0.255831368443 0. 0.0806293001956 0.0168824151148 0.00475962470686 0. 0.0971995733402 0.0437031245498 0.500973292004 0.0774839884335 2.90438537811 0.202071520986 0.0937165711889 0.0216420775447 0.46085520615 0. 0. 0.386212730776 0. 0.0439111871227 0. 0.00142019617832 1.72372488346 0.00353564686792 39.2916179068 18.2449713723
-0.12772333616 0.202937477234 0.0456262887699 0.384240827481 0.750471298595 0.566716666735 0.329482300209 7.9730276104 0.348733256117 0.416616268506 0. 1.60604961709 0.153626160452 0. 0.051816532713 0.517553659832 0.191648788308 0.0783717598123 0.0620273916294 0.517147043007 0.757054829915 0.271320901834 0.0610169937309 7.83805440567 0.26049598552 0.0116099054579 0. 0.271192109703 0. 0.269401620363 0. 0.869217204478 0.173886539068 0.101559401417 0.0513360463705 0.25313978055 0.814021622311 0.542152688427 0.661009268928 6.26229632635 0.0789158873422 0.140136062493 0.459696135584 0.449218526527 0.242718586153 0. 0.036411591094 1.15509068397 0.3893585454 0.0424108621429 0.560890848122 1.09144238728 32.8955493322 38.4940460748 24.077551687
-0.892146421339 0.105792977881 0. 0.203727471191 0.937054097698 0. 0.11392298206 0.0306223345718 9.42292304392 0.368889170803 1.66077364659 0.579325085445 0.114146365789 0.149157964404 0.0775871861269 0.0452777917467 1.87236487125 0.253819545628 0.136018977537 0.389932585883 1.67509605282 0.0552503571781 0. 0.161064385475 15.4813846104 0. 0.20972813964 0. 0.675574459504 0. 0. 0. 0.942992935462 0.141984025502 0.0271301662091 0.0830153582675 0.959015469118 0. 0.279990642381 0. 5.26272896639 0. 1.3089471879 0. 0.932609036265 0.0129723246839 0.0293439782823 0.0631589397541 280.629762483 0.33921123514 61.6326568199 0.574254177642 6.51206780811 0. 0.154805300534 0.571105398762
-0.0543459569035 0. 0. 0.175082894371 0.0300029311488 0.152289336153 0.0213642624993 0.0474803694279 0.272378780882 1.11185426229 0.195192906777 0. 0. 0.0422434128828 0.0236417440157 0.153894931667 0. 0.159478557231 0.0581249296853 0.0888637596587 0.00774711463909 0.0797019570098 0.0220358018891 0. 0. 0.788772412095 0. 0. 0.0125193864137 0.157865057283 0. 0.053199968005 0. 0.103059554852 0.0214087156837 0. 0.036253294775 0.171112602984 0.0185506897953 0.0201440173115 0.180508780553 0.379647848599 0.165082219653 0. 0.0387162959041 0.17589011491 0.0166076794048 0.0888466997722 0.278144013414 0.516232169639 0.134276520095 0.0356284139123 0.110707261879 0.765365154596 0.0484784571802 0.105517140489 1.956996971
-0.0426453273696 0.0191205668943 0.0368964641593 0.0195993734266 0.020426687841 0.0071332799582 0.052440437308 0.0188225003564 0.137720655499 0.050220433979 0.791577703309 0.0569744636126 0.0490397005783 0.0154243449821 0.0854117057841 0.0247958613472 0.0837332655223 0.0474247246812 0.120026567666 0.0690972261089 0.0520473599944 0. 0.0770543128608 0.0275746063381 0.105528767172 0. 1.05765165507 0. 0.0503584622369 0.00540933675393 0.0512677354683 0.0567514547181 0.0241550573068 0.00713138366743 0.0322524761285 0.00510242031931 0.0275438433454 0.00454715835838 0.0660427342198 0.010682243118 0.066443063198 0. 1.06220346525 0. 0.0369033385963 0.0104664832187 0.053823143186 0.0247144334391 0.396443415435 0.162886463316 2.81533142291 0.303786834202 0.122329738726 0.0197654206404 0.301045311419 0.0927439142057 4.07574873867 0.297231398254
-0. 0.387694492842 0.0566264290759 0. 0.0420389430627 0.0372263203947 0.0284009571392 0.391280067504 0. 0. 0. 2.62120940939 0.235208821229 0.174126629446 0.0377333685393 0. 0.266507634665 0.140780997735 0. 0.274461791044 0.024251685869 0.0123437067252 0. 0.42174418179 0.386142599092 0. 0.280878402933 2.26656277487 0.0668300289241 0.00484107193822 0.0120421621438 0.467512964536 0.140861595319 0. 0. 0.152886951063 0.0726618429342 0.00881337066215 0.0765283799663 0.323564236667 0. 0.104293437079 0.0656777320123 1.27568533433 0.0936900727309 0.114534588299 0.0388409803721 0.261207870269 0.539598476857 0.057248937284 0.709959826108 1.31873341905 0.149748324813 0.0137692137083 0.021682240931 2.67377221412 3.34744003832 63.6215057037 0.552099970733
-0.262658101564 0.0330856130484 0.0318435467419 0.06434557919 0.956294914676 0. 0.0362010379979 0.210563484821 0.649823236136 0. 0. 0.178067726788 6.14046266775 0.484508818038 0.969822459383 0.0908273537571 0.569261086804 0.0475523632477 0. 0.0356114691876 1.12898507341 0.0473037858179 0. 0. 0.60621623873 0.00374427661168 0. 0. 49.6159095859 4.68022066218 5.91403524205 12.128423537 0.343023643831 0.0170291972708 0. 0.0286948987936 1.10355826045 0. 0. 0.247628287953 0.256927506886 0.00389918558072 0.0386987944657 0.0462994870786 4.38167122112 0.749142928044 0.326128125834 0.155704509341 6.93877030376 0.243950655216 0.795264519656 0.219296014971 6.28903338562 0.253404687172 0.350852805934 0.514188082347 7.10336662893 0.17185837391 0.250117723726 0.310340196655
-0.0836251079889 0. 0. 0.0759521765583 0.025061096046 0.128763746911 0.0365471490099 0. 0.0513270168229 0.115390559489 0.0136726811189 0. 0.494123395556 0.738187904377 0.113320681627 0. 0. 0.172946985827 0.0634101240401 0.0303155000782 0. 0.113804414616 0.0536675968956 0. 0. 0.0934146779956 0. 0. 0.157608968678 1.11946201469 0.163383148328 0. 0. 0.0151230114653 0.0171489957776 0.0145945353819 0.015584347954 0.11246152727 0.0672202658176 0. 0.102939183862 0. 0.0860115508942 0. 0.0968596103594 0.564102323427 0.0442859710728 0. 0.114886652857 1.58908101447 0.0640408949033 0.904737091043 0.0464952209978 0.55079298779 0.0350352055003 0. 0.223792473206 0.138240250676 0.128815431027 0.47979472309 1.00317623422
-0.0291577441272 0.00710949998472 0.0678309421565 0.0296178528991 0.0382507639617 0. 0.440552472665 0. 0. 0. 0.41775879454 0.0882600115553 0.481363126311 0.40262892409 2.18167671879 0.22263115552 0.0849711406145 0. 0.121560618927 0.0125624650954 0. 0.0428371422818 0.191018400085 0.137560451816 0. 0. 0.250171892144 0.0477011893207 9.6100077808 4.83686618095 20.5612112307 6.14952831179 0.0434614128121 0.00814219912045 0.0536473772114 0.00722447169821 0.0567220784066 0.0346109731334 0.477257172205 0. 0.0159230494094 0.00672775637493 0.312424461243 0. 0.926206563236 0.170008698136 1.00901362295 0.595253476155 0. 0.0829218608049 1.88426764212 0.0861787526896 0.826858434307 0. 1.08578916825 0.406345336454 0.693518216334 0.0723512495772 0.686787071396 0.139318568235 37.7467182911 0.407872757386
-0. 0.118017675903 0.0516491740649 0. 0.0245749501147 0. 0. 0.515743121688 0.00349160199675 0. 0.0461156753177 0.227277037273 0. 0. 0.195669278198 1.81813346514 0.222473192805 0.0396850438219 0. 0.267936923992 0.111696900826 0. 0. 0.551653259568 0.081951854164 0. 0.082737441961 0.133720495134 0.299280716335 0. 0. 3.68142435956 0.070474856968 0.0253494371084 0. 0.0186977483264 0.0484115177612 0. 0. 0.364949634323 0. 0.0637057162944 0. 0.118085161486 0.136351224149 0. 0.0098593477854 1.37279032042 0.347644700635 1.0187663532 0.267201375923 2.77745201989 0.207254836317 0. 0. 2.06876811139 0.505268712448 0.346609972923 0.303669059181 0.251430422297 3.04304016233 34.0403102714 1.13479757826
-
-0.0181562543195 0.0237541470812 0.0374678167352 0.0229356112767 0.0128689037304 0.0198976366858 0.0146655632375 0.00919594319685 0.00472893318106 0.0211913632303 0.0055799304347 0.0110186011298 0.011298864648 0.0212572494848 0.0236085461411 0.0174040193786 0.0162290051584 0.0148443207067 0.0353528716219 0.0119611294267 0.0135951768286 0.0180305546134 0.0153945069058 0.0065457378099 0.0078695600931 0.0191529378739 0.0083646520671 0.0103291428757 0.00819577204868 0.0151009637038 0.0395263872133 0.00821847799094 0.0207915459753 0.0230931017409 0.0422829154308 0.0282726539789 0.0135792875468 0.0329056051667 0.0141017924951 0.0139740807157 0.0140824034252 0.0275383935595 0.00496476036542 0.0118834390088 0.00615824907675 0.0144300896903 0.0275466491572 0.0105317037816 0.000922468535899 0.0174195794121 0.000696348080875 0.01351829124 0.0078555121632 0.0176405660316 0.016049381888 0.00653336051055 0.000634022586315 0.0136299552106 0.0103827981635 0.0061971613548 0.00498147886533 0.021300710268 0.0173922639928 0.014968849752
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/20flies_noncoding.ECM b/PhyloCSF_Parameters/20flies_noncoding.ECM
deleted file mode 100644
index 6b40287..0000000
--- a/PhyloCSF_Parameters/20flies_noncoding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-2.60522165174
-5.52510067718 3.46892355586
-2.06752205896 4.87084817478 2.21791845944
-2.3195381658 0.29942855373 0.528228212208 0.26648971101
-0.330068073364 4.34832138922 0.432834075405 0.566200533823 4.59841842144
-0.552416252538 0.261795105 3.90539440681 0.215698594141 8.6764671226 4.28639980545
-0.295548791599 0.827336939107 0.393001102173 2.30234170923 3.81729458011 9.33029881664 4.31982049419
-5.82573631847 0.801834999525 1.86182286498 0.602393752325 3.81311102277 0.474788400945 0.721304810831 0.329054451704
-0.595892512437 9.69926539657 0.842946055917 0.971814913776 0.399337020469 5.15799117581 0.236792300614 0.73713375116 5.37263336106
-1.05273301983 0.621797096011 10.3561262134 0.615594998571 0.720352431384 0.636012240368 4.08598201643 0.288342417197 12.6654887488 4.68843038831
-0.511007461668 1.27482190234 0.770931708347 5.14006094873 0.263064404428 0.72057905066 0.31199670561 4.78418938995 4.77782550368 8.79650954363 4.02459238797
-2.45614751139 0.368323546282 0.896011440009 0.345330822663 6.38445607882 0.812447241133 1.22688836396 0.89846227661 3.86123785872 0.054624957844 0.807672411047 0.284218649159
-0.297071771517 3.3301080317 0.294244712813 0.594387565738 0.630325090791 8.22791956827 0.60941585104 1.39405066498 0.518559738627 3.74891441167 0.432486622264 0.886834747439 3.57278649553
-0.491952797003 0.211319243882 3.22926300477 0.288114933896 1.46193024122 0.664041941702 8.73877116939 0.711829787348 0.610050659555 0.26177882384 3.52009446056 0.282194809626 6.51970381022 2.46888502102
-0.270311769619 0.53701253113 0.253466034556 2.07899632569 0.389073083667 1.18867330633 0.366846269651 5.2275473054 0.266988648959 0.45562665342 0.293347630878 2.23924111386 2.99584349371 5.01115562509 2.53862842844
-2.54429183679 0.208897902088 0.690631250814 0.202027264705 0.244791690551 0. 0.102010744231 0.068623129321 0.718867473979 0.0861791543005 0.200678256294 0.0277198677359 0.358710455289 0.0198590262246 0.0727513233457 0.0181667907683
-0.205741251989 3.54878426463 0.282535784093 0.442820226573 0.0371097332821 0.472702213865 0.00924159247056 0.0270547897495 0.217166271741 0.809157527615 0.0731064332526 0.167555106759 0.0823809711156 0.233703673635 0.0507150524041 0.0118325287932 2.79594212608
-0.454462784752 0.221619695452 3.94980098948 0.192503544533 0.20057130093 0.110679640482 0.366954674621 0. 0.294065885262 0.0422692166612 1.19442307203 0.136885521587 0. 0.00705222137801 0.38732889744 0.0336198621798 7.61431848979 4.1790760497
-0.250017930855 0.600751819008 0.2532882811 2.48072248044 0. 0.096910416293 0.033071836568 0.3330380543 0.106896588224 0.221471925649 0.184154952423 0.71515124614 0.0787027589041 0.197544782653 0.00291609470126 0.293131845465 2.57577732798 6.94208324896 3.27585074853
-0.267538861181 0.0782973620584 0.140990405947 0.0415135512486 3.26788735517 0.391466887355 0.584485074743 0.223924105786 0.53967272806 0.030939550127 0.104490034188 0.0907393878631 0.706815630064 0.118344611019 0.181283524607 0.00908489560399 3.65214779623 0.43161700393 0.963510202506 0.268388623877
-0.122528796445 0.403492967439 0. 0.0753976110614 0.345763756346 7.95722267283 0.351981375839 0.660662480024 0. 0.519980399021 0.311961640455 0.087688748179 0. 0.665982021083 0.153361405173 0.157150510133 0.289733588913 4.91280159829 0.597746315167 0.783123601521 6.85421562286
-0.157896529141 0.125849840503 0.258837222819 0.0262407555021 0.546585213019 0.250136220871 6.1023022464 0.27858435627 0.0965962927904 0.0837203126736 0.41309497354 0.0651975505063 0.167610924662 0.0863019690749 0.523540972714 0.0356231133228 0.524246028168 0.427565464426 5.77089638668 0.309151292801 14.7964854058 6.03102821436
-0.170436883784 0.101171673737 0. 0.235477601463 0.290761451767 0.986145223945 0.298849243214 4.18240167889 0.0838301866341 0.217688815126 0. 0.367784454716 0. 0.171407551321 0.172665624586 0.622087066397 0.206350807788 0.679113628723 0.477771364745 3.59103421041 5.56204335797 17.2297122913 6.90886230132
-0.637707469457 0.0980845253209 0. 0.0386222159964 0.23291610923 0. 0.133387182059 0.140114698057 6.19099261505 0.286769228317 0.917424235416 0.222350439907 0.196014430766 0.0438704080348 0.171320870319 0.029495951056 8.61610724776 0.740338142792 1.897591966 0.504461228772 3.89883392169 0.303737900124 0.940750518231 0.582602259878
-0.0552030861191 0.406515753038 0.126757954568 0.17902632355 0.0429018761926 0.167792025667 0.088308826142 0. 0.397029203581 4.18595899237 0.361569523204 0.629291039745 0.012095057946 0.218555477593 0.0338811067771 0. 0.714975070526 9.88809944498 0.73947683568 1.01131929346 0.212139146705 4.47739869358 0.282032128892 0.788958556228 5.0147010624
-0.142317397722 0. 0.858132236596 0.0524028347981 0.0845413370276 0.223285798859 0.477504820704 0.0313574645896 0.741621629651 0.381515213112 6.79910727345 0.185605422378 0. 0. 0.307194239723 0.0334611209093 1.51778663185 0.633300960636 12.5139215776 0.52321566535 0.907058407988 0.803636621863 5.54890362758 0.353466300082 11.6791489514 5.62326450239
-0.0632604351817 0.293940871922 0.120172031706 0.408175611648 0. 0.168880218778 0. 0.226461793393 0.424688374337 0.644519008495 0.35940974446 4.21139730687 0.0533289483047 0.179151278901 0.0389341139928 0.233983621214 0.450540732963 1.44704264599 0.891610313991 8.79731335796 0.453587541817 0.501626596963 0.419745943993 4.04719461146 5.37510573152 11.5732278696 5.93235816792
-0.271934817808 0.0220389805083 0.360919166698 0.0306140044835 0.752318321992 0.463319481404 0.0237920653271 0.0472648305889 0.410951022594 0. 0.206617433612 0.0490180837447 4.19715565416 0.331859055831 0.636355522299 0.327688640142 3.84097030894 0.240503800507 0.665107401131 0.398453372736 9.89885147868 0.797924695707 1.41658091675 0.962105284807 4.14390656934 0.185723871788 0.927757405015 0.447505455533
-0.0441422651003 0.351697700152 0.0540161434958 0.0395732774663 0.203771372951 0.550631712994 0.174017431879 0.41203269941 0. 0.58734824068 0.119062840479 0.144323912746 0.232310518672 4.00520653295 0.346972105194 0.468054735393 0.25509398801 5.26566329901 0.623159418873 0.565609802428 0.854434133855 14.9117484413 0.845802974661 1.85608265587 0.403055949032 6.4442609397 0.519341640143 0.848589689817 5.39834773416
-0.0732180070149 0.0968521775348 0.228828756215 0.0184219094418 0.135688516825 0.0237881831167 0.859989660933 0.163967324751 0.0963793084962 0.050979981086 0.468537052022 0.0523032717653 0.495209908214 0.192641952809 3.0982481819 0.17865921222 0.416996695586 0.345414736546 5.03705465074 0.330159736313 1.67298903994 0.841108082877 11.9450323105 1.20722675626 0.740920305434 0.26598753344 5.3213295419 0.35148359416 11.7501313957 4.96184490401
-0.0221615561397 0. 0.18053780639 0.232847292427 0.0886419985582 0.311519768132 0.0782740903323 0.768657876222 0.20478676049 0.104330422709 0.0149957938401 0.355174837782 0.401325655323 0.669743397933 0.240594251687 2.21617894499 0.239479204102 0.463301114039 0.257639362336 3.21848934944 0.614917578254 1.24161518748 0.753701089267 10.3962486969 0.4724551404 0.72561003943 0.346683864076 3.8853095069 4.48167836817 11.5738315211 3.84920008886
-6.46152443068 0.688877807506 0.907244785869 0.467331091131 0.611857479133 0.38000697963 0.274957472129 0.0417115243384 1.78039895393 0.0931120924274 0.92558963629 0.11139615157 0.719672704195 0.108813780714 0.14630642316 0.108187658319 3.08393052516 0.224878585989 0.620023085921 0.308954907803 0.492547578464 0.174234124077 0.0130567187595 0. 0.675106424614 0. 0.254520863205 0.206575237598 0.501861233193 0.157443454569 0.0158713688637 0.0253774110209
-0.383814344165 6.97508651301 0.535744016959 0.869608553356 0.125634803092 1.1992165745 0.0482168945747 0.166215809035 0.385867165096 1.79183536119 0.134729159035 0.42852869417 0.0405646931802 0.896198342106 0.110650667529 0.062369015921 0.167364953657 3.41846809715 0.263196922934 0.481586151241 0.062064983602 0.31960756476 0.056698891866 0.0686419515445 0.163067764246 0.637468886748 0.0931119682843 0.152959353192 0.103874145219 0.320755915959 0.0585407497123 0.159114390453 3.3705044899
-1.05022340326 0.581026804078 11.2240678679 0.470465861776 0.317218721951 0.0630525248766 0.778161858589 0.181788766574 0.277449520997 0.361212044249 2.08515796396 0.43619236315 0.452696901317 0.173696696033 0.642502390054 0.0404014311909 0.682778351182 0.544672566316 5.21922208324 0.355151721135 0.107162523901 0.062248643198 0.663306402484 0.19162270899 0.522764714146 0.0335688758657 0.782763482094 0.163106673887 0. 0.0465122608892 0.585116516325 0.0171956340661 9.69575537066 5.40056188954
-0.463555302185 1.36885645104 0.629145708589 5.01894573147 0.116251331227 0.0907081671292 0.202939025922 0.905680697885 0.304403966397 0.432168130854 0.187380395451 1.35467307484 0.114572366551 0.0821882529413 0.176377339242 0.592215505168 0.305818323259 0.543871427782 0.216286614077 2.53109375099 0. 0.153558117059 0. 0.542581004971 0.20674612679 0.192504536483 0.0298525823301 0.547588985676 0.0805929436176 0.128518226387 0.0298694150466 0.255215461869 3.37416853428 8.46230911018 4.07152778919
-0.480383982717 0.113564278539 0.255623640736 0.00307653945662 7.39516897953 0.599690149253 1.27957922996 0.551895856538 0.710140444653 0.11711866548 0.203456778477 0.0768765888675 1.03022447997 0.13889393181 0.360875415287 0.143429116955 0.192790074292 0.0229978012169 0.0474128199143 0. 4.07431891567 0.348455094593 0.615092758097 0.2789288752 0.231998468985 0.16665458539 0.0999114485727 0. 0.545458431919 0.140425511194 0.252964601793 0.0641235109003 3.45150022822 0.25341181581 0.85537272809 0.336373802126
-0.0498994970469 0.659298255503 0.120756811598 0.110625856911 0.499397078742 13.156694884 0.527902627276 1.17450655751 0.0979999890977 0.783058133349 0. 0.234245741379 0.242028577174 1.27297503647 0.198144716023 0.226456646017 0.0392688783335 0.310112026688 0. 0.0478714335742 0.362254930416 5.85652628067 0.393384006798 0.85767141986 0.189282416135 0.204461461925 0. 0.249713282975 0.063213200208 0.772616833904 0.0880407062257 0.0621511474181 0.267377413205 4.93887836005 0.75208565002 0.499218431241 3.95581023001
-0.178490254361 0.113243779052 0.680601416525 0.0123851259926 1.07307674091 0.663960519495 11.4793867882 0.595067811349 0.255354019327 0.112138018559 0.72108127423 0. 0.2947402588 0.171527002844 1.04678252153 0.166942144533 0.0207482608192 0.0515545866334 0.294103848407 0.00675470149663 0.722558600771 0.21081306386 5.61878406624 0.353707057708 0.143153986138 0.0295066441118 0.27082080531 0.036527617573 0.392923461837 0.0543021739285 0.73796041319 0.111898158653 0.607469043142 0.42658669437 6.48078550527 0.214897870972 8.25817958502 3.64643404483
-0. 0.208975293263 0.113922477378 0.454907336945 0.527947416158 1.52290075472 0.499491662628 8.81867782892 0.162144537939 0.176899300708 0.339150496892 0.68155736895 0.243904893911 0.392613238257 0.235077576555 0.989929641162 0.0598904480749 0.0274939063586 0.0573185360404 0.220558213277 0.421217145809 0.469155144997 0.277763898137 4.77918871671 0. 0.0794382166745 0.130631183539 0.276353468502 0.158423765967 0.375150759131 0.0250784177391 0.818554705267 0.423651854092 0.932897423151 0.511556304679 3.77771578835 3.94974067907 10.060749705 4.3142715615
-1.06919091118 0.176544118626 0.62815843859 0.106929919545 0.625172320518 0.0983476708752 0.321057017741 0.0707726923527 13.0461448409 0.740214098892 0.5323200039 0.662033161825 0.555671637344 0.167882921301 0.254232048068 0.100907764286 0.612709770406 0.242146767217 0.324412275851 0.0715175841763 0.541526056137 0. 0.0203467517845 0.128916507747 4.65809384137 0.181788404383 1.09871502383 0.370878527838 0.517539462064 0.00597018697316 0.027004886244 0.130423699596 9.71419503953 0.996475979239 2.30362027852 0.771326354775 3.68110740354 0.574069449478 0.667747864717 0.357518830067
-0.124255890974 1.29327498652 0.049216033785 0.222982127914 0.0604731034924 0.80299117925 0.336520079351 0.239465907053 0.668765775192 10.0008088688 0.89905029628 1.10329562756 0.0812623827644 0.521666447963 0.020478509012 0.0788716826363 0.0723017837057 0.627028740646 0.0793409847722 0.183569879309 0. 0.535168096864 0. 0.154780680418 0.339970756151 3.70808312049 0.271651366993 0.458888099002 0.0631968307521 0.60855138889 0.000969590450287 0.129408342384 0.74578001827 10.9642335764 0.809321015463 1.26043846525 0.443541303106 6.32079872143 0.187046545446 0.779603904702 5.78656154224
-0.430633667495 0.216900752581 1.22423556589 0.1379606532 0.423782004361 0. 0.465596630589 0.125839128325 1.57018052588 0.499595707407 17.1424388709 0.630510821719 0.0770546407886 0.184781829392 0.80194232831 0.0778331486629 0.272675568284 0.154344824097 0.816164640218 0.181261351779 0. 0.289203423792 0.724311118449 0.430547822512 0.640397034316 0.185400847809 6.06769299227 0.336957380147 0. 0.0785717850552 0.563809365013 0. 0.879107248925 0.570402654692 15.1934005002 0.692558665128 0.543186719362 0.656469474346 4.55015113356 0.455496393966 14.8406602979 5.87378021279
-0.10782961655 0.397922832562 0.303043906275 1.15134235508 0.204418853685 0.371359365018 0.0922161117302 0.671905577877 0.407876429368 1.49131224744 1.22316074924 9.31364010052 0.0659344552593 0.144574201112 0.0925735408299 0.582475702388 0.0363355228639 0.297656428736 0.138440193879 0.659881107176 0.131631371164 0.0386775112254 0.149568084225 0.15703864353 0.245809837971 0.604325605926 0.462539132915 4.32018874731 0. 0.241384207368 0.00943776558503 0.474622377065 0.930923295825 1.57505991892 0.448160445025 8.27984902319 0.212526985917 0.662027832874 0.271951734254 5.3932152289 7.01796079889 13.2819260064 7.73152824174
-0.785114366281 0. 0.190582516962 0.0437245001644 1.60902617329 0.267703675237 0.172723544963 0.203174364247 0.24840311051 0.23889140142 0.287781434575 0.029901601348 8.72032227161 0.809949936009 1.27012921147 0.646006066362 0.263858017466 0.0911580000312 0. 0.0649890857122 0.588978777883 0.0593159278304 0.11311914885 0.127673720151 0.547537065571 0.00890813618702 0. 0.0160219806526 5.36614341439 0.321823878762 0.433766701507 0.153232412137 3.70023837835 0.451404912321 0.667859184893 0.381159496482 7.15133975759 0.765693663643 1.16326409239 0.756193823975 3.97556787065 0.0739449366022 1.30928853238 0.487292257318
-0.0932330048649 0.626458702051 0.147020840639 0.0783894286927 0.261572302761 1.54108436263 0.0203356376929 0.435931519232 0.163874623407 0.857984858575 0.215844705736 0.132020661072 0.581596595914 8.440142681 0.489582070011 0.887531645778 0.0330134663461 0.273150370312 0.142226319085 0.0929907118425 0.046271815886 0.616275281387 0.029319930779 0.139365079455 0. 0.44593197596 0.16281235461 0.131885848282 0.137662554377 5.38384064088 0.231910649926 0.405129195554 0.249998695284 4.60624374682 0.259025590052 0.940729844945 0.70354790234 10.809106611 0.673222830015 1.76599423259 0.383056109368 4.94461024512 0.324289399806 1.27641294791 3.64226215594
-0.115671087631 0.11099052262 0.523966729459 0.00825619242947 0.355096190579 0.273626760734 1.42924086577 0.190326900145 0.383735854706 0. 0.652083379392 0.0276221627974 1.28837929594 0.522186746577 6.74328786096 0.446545887313 0.109097648858 0.0210803305946 0.363099787521 0.0189067390323 0.207581570135 0.160645760092 0.651889079029 0.075801742214 0. 0.0473877911129 0.468659407859 0. 0.462535958607 0.518887856133 4.02344182321 0.297666753421 0.682490917891 0.251494236206 5.17276559213 0.229920577423 1.30998499607 0.620950341384 9.80097842168 0.792641443266 0.716049028897 0.340371268778 4.75383838917 0.398584556613 10.8895201843 3.39222524377
-0.0848119993015 0.0497111753355 0. 0.529676147046 0.218063169303 0.393785170806 0.389534896176 1.37035309167 0.181035586425 0.20545759066 0. 0.856323451482 0.631963013807 1.3992801786 0.563353589371 4.87278695277 0.0211020424287 0.0819252907359 0.0456965121717 0.197177035324 0.051473249901 0.188027970631 0.0844195663027 0.611932893809 0.0856434000193 0.161610141343 0.0593737882724 0.270441938039 0.169490119886 0.559077869937 0.245904264031 3.55100653969 0.328551756953 0.604424375658 0.392278042947 3.38035008941 0.520756692006 1.35443032822 0.371276014057 9.72265927134 0.398852401405 0.681732161833 0.397171209847 4.22304365899 4.28169336076 7.01100597142 3.51268072128
-2.2963661213 0.163164534263 0.572357770823 0.268914073677 0.329726654283 0. 0. 0. 0.618819652738 0.0340760214334 0.15660069592 0.137629051393 0.464863762542 0.0482339350431 0.0765141331328 0.0223618722052 4.93641399381 0.53919507183 0.778870379206 0.469274391055 0.529410506384 0.0102089226755 0.22936863473 0.00911296317807 0.951615777102 0.152092158452 0.195633518988 0.299143403733 0.792403150648 0.136536824369 0.292380158659 0.0634072465286 2.67929976566 0.111090266371 0.397993600546 0.273477085143 0.20004454144 0. 0. 0. 0.772323580557 0.0460467490792 0.274422295287 0.180438769889 0.345031512095 0.1169411809 0. 0.0862887154545
-0.36221886721 4.43749633365 0.198705602053 0.648323746956 0.068704432249 0.279665861526 0.00260402382336 0.141985679692 0.0423421376083 0.801368750052 0.223824905685 0.277391236847 0.0381087967915 0.497983733464 0.0469589556908 0.0268327207866 0.551348074861 10.1600786946 0.532862806093 1.2972973744 0. 1.35996071209 0. 0.457780412711 0.390328433347 1.35639448115 0.0821727427381 0.153319290359 0.407256454251 0.513142352844 0.0111661994826 0.336157828438 0.527409566821 3.84832736431 0.239717899947 0.829973779517 0.0644161274506 0.182748240199 0.0127517474922 0.174565348311 0.013411761878 0.849321327846 0.114319422746 0.116665223506 0.0177312509882 0.353509116466 0.108648716676 0.0492162804168 3.55997377287
-0.662844734956 0.24718672961 4.44643944812 0.312155165897 0.125249804856 0. 0.452865252824 0.0902557562959 0.780092420005 0. 1.08300931948 0.13064833238 0. 0.151981557649 0.403639021805 0.0102513824782 1.33684469853 0.5338563919 10.3812633396 0.691151745857 0.216592999189 0. 0.988823139793 0.297160088089 0.590577033043 0.412386887601 1.4165299385 0.0504868122996 0.308776833086 0. 0.765724055981 0.289704632468 0.598650479144 0.0352777339578 5.83174099423 0.37437356017 0.130108430271 0.114499334124 0.176488935715 0. 0. 0.281216744974 0.678643505586 0.216726769023 0.437232408654 0.0169010207316 0.193734873381 0.107114237976 7.62089842807 5.82215745173
-0.39718927436 0.582256314986 0.447372089267 3.00510556006 0.00523208328632 0.192717126765 0.0504732351332 0.271183148591 0.0739618424566 0.297135925765 0. 0.857837202389 0.0136678015112 0.112114970511 0.065541380167 0.354750352898 0.584297791039 1.24696119807 0.528300740757 6.53236720694 0.101472510413 0.110976638701 0. 0.70469406721 0.143001511783 0.292934968547 0.217703115206 1.18711697484 0.00759432390077 0.575520856236 0. 0.860908450835 0.326804098134 0.652075620805 0.265602198793 3.54052358699 0.0529274692445 0. 0. 0.13065909266 0.0921045261971 0.222944690332 0. 0.904397126722 0.0339390870035 0.0493798526259 0.077727243165 0.350455381219 3.06691219618 9.43091121002 4.23747456331
-0.266754024104 0.00650093716495 0.12800911926 0.0772980128718 2.86683009967 0.234582115115 0.445501850035 0.157126406069 0.290399172749 0.107595239865 0.108077202261 0.161561897413 0.699113848226 0.191697057858 0.162509316102 0. 0.607692951274 0.0469956221946 0.198918977485 0.0922159160776 7.58433037129 0.368490961564 1.08674774904 0.496812861248 0.666102043238 0.0990191396224 0.0920136908503 0.0821908436717 1.49081558785 0.154597741226 0.174755637165 0.146478461101 0.269216683997 0. 0.253567617568 0. 2.98327563942 0.233736190464 0.351757273558 0.139263081868 0.239430381403 0.0208928742124 0.222252319178 0.0175789101065 0.810861806823 0.279608431283 0.179458188958 0.195866758858 2.6854820791 0.398053984532 0.89809834227 0.247935202602
-0. 0.350679119366 0.171770055102 0.104925151245 0.27569187295 6.94829024374 0.334803148398 0.67706013313 0.193350480379 0.412581822479 0.0992653935902 0. 0.10635427699 0.699016591819 0.0539186926384 0.138446373546 0.153056250509 0.713312843099 0.0600509965939 0.255963010535 0.977892604151 14.4889648601 0.9706502979 0.881312161472 0.0346182115187 0.64545890404 0.134577713879 0.290715313336 0. 2.39103151387 0.273437271363 0.464611330894 0.246713626684 0.40332369024 0. 0.145163680564 0.372829638364 5.88638743233 0.226345198689 0.660313641705 0.190871514078 0.468824543611 0. 0.342786925459 0.0289876816848 0.926564298096 0.264713948349 0.168913634851 0.247713670257 4.30894205465 0.435130299606 0.538207204466 4.09158908846
-0.0852410654989 0.0511030057169 0.509274844394 0.0373529090687 0.702993747187 0.420627472897 5.42647743174 0.131536971718 0.0544918473889 0.0128070613042 0.524612151038 0.126370441821 0.153615064327 0.18902932533 0.51889155516 0.0343168562204 0.177500342967 0. 0.829123397045 0.142488350733 1.72654391503 0.629020310446 11.7406994673 0.890649274227 0.0675687379755 0.11742638392 1.01918916916 0.169065502496 0.563238316532 0.404080301794 1.757981046 0.033475292508 0.116203786627 0. 0.327480025776 0.0230249387485 0.594810129652 0.230254744366 5.0646899971 0.418798741428 0.104334665716 0.104697825563 0.407467483724 0.0406246231031 0.348189622419 0.21390374221 0.705834513063 0.0642328453938 0.553054947903 0.513442901514 4.26222018466 0.208573091283 10.5015585013 4.79812930239
-0.016450712606 0.216977814459 0.196903475283 0.251042590329 0.381360395441 0.413738227705 0.369887142101 4.88259977716 0.188049445316 0.176146965588 0.0503173213445 0.269668758345 0.0782349657847 0.280488056823 0.120251545162 0.618000796657 0.126134853645 0.401182869233 0.114756316467 0.597468154008 0.532005117974 1.72633341664 0.896161496941 12.3577660392 0.126652444404 0.183007805123 0.0120862345708 0.810724156403 0.546614503908 0.381149400912 0.262332528854 1.85559847553 0. 0.149062776866 0.0200114447219 0.530378592208 0.310737212864 0.615825997783 0.409391933973 5.39308092496 0.200657743084 0.0952515324537 0. 0.521862066811 0.0957681689554 0.441655874781 0.173274569629 0.711991153156 0.264993223104 0.150780925398 0.398721418433 3.85456065949 4.25450384849 13.2346289613 6.0736547061
-0.440603456097 0.175073392063 0.119622864329 0. 0.241873704132 0.0710770145015 0.0666045777945 0.13396754322 4.24467760612 0.219451207928 0.47068741368 0.159446593493 0.26107084768 0. 0.101681207607 0.0920335638825 1.24654760408 0.189595106863 0.221227691285 0.169635541932 0.565777108883 0.24512236772 0.122082481977 0.106034887959 10.4509269008 0.388387008742 1.12670684035 0.421873919179 0.887638019557 0.230073415723 0.215867259065 0.141579391234 0.747688670763 0.322956986932 0.151769782551 0.145090356887 0.19983239471 0. 0.138068910759 0.162894030212 4.12944027014 0.222269703418 0.334749332402 0.304982463476 0.380209684032 0. 0.0599817853084 0. 5.64715544394 0.843531318989 1.49518330985 0.696491513928 2.82691991286 0.272897891241 0.647969513561 0.270271138196
-0.0368326690502 0.516163584717 0.0402954019228 0.182113461448 0.0267329337356 0.295453650877 0. 0.0391106979068 0.346195590601 3.90722002563 0.251453752135 0.499977068872 0.0438768001794 0.3121885514 0. 0.0101561918638 0.194163815105 1.35154136626 0.256764960023 0.351956461653 0.170903537116 0.571102158636 0.106497372506 0.146134689188 0.650963876986 8.25974889116 0.620138351612 1.28022944042 0.122665881254 0.902940935388 0.0514628555172 0.223518006413 0.0584356644606 0.677203763896 0.159679451097 0.12007911109 0.00334815605962 0.3959196116 0.174551188289 0.159757167432 0.400908679613 3.8883577563 0.339738184481 0.655622431939 0.0665622505526 0.301088437109 0.0532895087776 0.074214780687 0.467362675757 7.53716823196 0.459313777385 0.972487425198 0.169797309845 3.67327701095 0.226350163374 0.743267916615 2.90494533079
-0.171217381999 0.0497713256843 0.703690916737 0.00377987735703 0.0210415170442 0.0860663292958 0.467325777053 0.128714715206 0.496303416213 0.423708568916 5.52927750422 0.209280636062 0.0873057422167 0. 0.259365039118 0.0275367980795 0.383471027046 0.204822857403 1.80740883282 0.200378182483 0.40275582395 0. 0.892186378848 0.0663342198387 1.69920321307 0.698565335305 14.5160708517 0.633401751827 0.234001345722 0.147947342925 0.935226991803 0.0778740557829 0.250771561241 0.0176325172834 0.747036852503 0.101064900471 0.139891600514 0.0267744784649 0.156853529895 0. 1.03113066727 0.393691514117 6.82845384705 0.361457674159 0. 0.0227540771818 0.432779186274 0.121581588911 1.00417952833 0.528467331925 10.1998063449 0.70292632121 0.575173027014 0.53026533446 3.85919571034 0.583793843694 7.55826014247 3.99957544825
-0.11046481743 0.259409163754 0.0640200209963 0.387824432047 0. 0.116530780141 0. 0.269206680089 0.396274595634 0.501678979087 0.285561984975 3.75701797435 0.0203002997396 0.117638129845 0. 0.276900338114 0.209721834182 0.425937609857 0.160289713534 1.42478289884 0.0133090770313 0.356482366509 0.0707080376994 0.809766978853 0.717499678142 1.05863963611 0.545701151656 8.66185832183 0.108602644392 0.230637865059 0.207292284638 0.538602837775 0.105996038363 0.180389920988 0.186551695414 0.654473921306 0.0307507719021 0.155170777697 0.0354792755932 0.326333864235 0.281965140344 0.534045303356 0.36860222882 4.52696158832 0.0512746128742 0.109908902216 0.031024119875 0.337401611895 0.399978877574 1.62914608647 0.776194566993 6.37590575281 0.26209124539 0.628104114236 0.229319936808 3.77378987738 2.82365702231 7.35426366874 3.24606543855
-0.28348427334 0.0699109092497 0.0115243665938 0.0247539692896 0.417015450631 0.135875392068 0.268295082193 0.145629497336 0.260780495373 0. 0. 0. 3.10401749226 0.233910519211 0.50550031745 0.274249624795 0.502928793045 0. 0.30256369977 0.102945787798 0.992034505912 0.241353238048 0.198457172634 0.154684893909 0.573358343749 0. 0.227077915261 0. 7.45434830156 0.424948012815 0.712630951997 0.524185596935 0.361367267025 0.0744190424464 0.112792427081 0.0734282242981 0.484091834767 0.111218952303 0.150743797934 0.0021339917222 0.293650150546 0. 0.02116599467 0. 3.38903656196 0.112898399837 0.478710281107 0.129217440647 3.21303018321 0.333544983719 0.784623002124 0.447344524196 5.70524160401 0.749006476972 0.94290384194 0.635394355901 2.6809463432 0.190350416362 0.506824958659 0.311522768636
-0.0441271017621 0.295578059389 0.00538296576352 0.110839307911 0.0967261383251 0.879962963336 0.239929977946 0.130401327035 0. 0.340950951096 0. 0.137440936288 0.346025987669 3.47636446237 0.278642779927 0.470025718811 0.112692964798 0.619099122427 0.00242780561576 0.173907015881 0.201742176005 0.999189599873 0.219477527941 0.921815929995 0.131841137033 0.676395318803 0. 0.194240135011 0.609370026677 9.57208990388 0.584905018757 0.898643131352 0.0236332695617 0.208932252302 0.217701165002 0.178589346395 0.0707708189865 0.75565077833 0. 0.0793080592395 0.179063482307 0.379112828132 0.176743685886 0.103537317554 0.461838184221 3.38109025265 0.227764370549 0.711382935742 0.33354958253 4.06165867022 0.524877361639 0.658211390383 0.735233306573 9.7497109579 0.731821772009 1.73956580152 0.265634075375 3.47770284375 0.463685252076 0.662645060954 2.65607159046
-0.0683387462584 0.0219629130994 0.277538132256 0.0218956105837 0.206201631706 0.0684822381157 0.407023501116 0.0451269026509 0.123393342911 0.072966956579 0.247768523847 0.0483266332068 0.606740463055 0.29820535935 2.6061321606 0.175109875588 0.144201033078 0.0824589690667 0.503437283862 0.0753138053082 0.392349366718 0.255603880722 1.52451708358 0.172409143922 0.189011576962 0.0325607363443 0.588467389971 0.0933720092444 1.2780171571 0.690762189525 7.24187169913 0.644942406325 0.0762203715741 0.045675693536 0.286183717598 0.0152119119626 0.180745081545 0.0659332293219 0.690175236215 0.126163675168 0.128302974079 0. 0.318741829473 0.0326199410537 0.498619723618 0.187967114517 2.82346513173 0.227608501656 0.505109007998 0.258054431799 3.92125357864 0.364902097321 1.24245726327 0.602397752765 8.63586700945 0.759728453173 0.583845430492 0.20994437703 3.64889395544 0.242635624424 4.90403632008 3.05311621448
-0.0306716260713 0.0814321197009 0.0263314010054 0.272678801329 0.106013680564 0.129532610405 0.0907157735716 0.532493488287 0.0109148306893 0. 0.162164771732 0.265180903915 0.392021613007 0.447741723488 0.282872330359 2.08107153488 0.0784322946977 0.148287907702 0.0731834628584 0.480938701331 0.194862987879 0.41943849415 0.136885175806 1.07543696247 0.0733045890116 0.170090519611 0.152154070687 0.575338518819 0.651042513614 0.990533484602 0.402752307023 5.51178277187 0.0423383577472 0.114394597746 0.0322564050447 0.290883488614 0.0176772594012 0.130997979349 0.0554591676 0.600771271188 0. 0.0290669346423 0.130598018554 0.373034762049 0.33093489787 0.412308156247 0.201480408382 2.63346193838 0.288284729936 0.743880049931 0.285467677785 2.4778577813 0.413816264532 1.08713768724 0.625062767287 5.87760116803 0.261761111281 0.472862376536 0.281657222631 2.33927651605 2.25924727523 6.49703836519 2.52893187835
-
-0.0436588705204 0.0180416592111 0.0172705049816 0.0313059619256 0.0204318574391 0.00866565654901 0.00855826696922 0.0141519128344 0.0142075650725 0.0143506931474 0.00948176289506 0.0144385885967 0.0225118414231 0.0129557312092 0.0174966181456 0.0312026568728 0.0239028750731 0.014100885263 0.0142807205131 0.0174958592717 0.0150062262476 0.00953963818715 0.00766268420971 0.00948917307515 0.0109028479501 0.00974640899548 0.00766468852951 0.00853983079827 0.00982133662971 0.0113346471791 0.0146598494319 0.0173023151885 0.0185232762774 0.00942946755785 0.0112331321758 0.0129178678673 0.0182808830371 0.0124702528141 0.00976065350432 0.0142632664142 0.0110575600113 0.0125490239213 0.00953313419174 0.00870953731425 0.0110807056641 0.00941450435082 0.014224693302 0.0178827153121 0.0237376950165 0.0107759910236 0.00965035342006 0.0224624342706 0.015863351958 0.0110733401237 0.0109487196432 0.0142092703067 0.0157160768607 0.0182943776 0.015043406603 0.0204114839078 0.0240554444316 0.0186483208344 0.0239797623875 0.0436191635614
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/21mosquitoes.nh b/PhyloCSF_Parameters/21mosquitoes.nh
deleted file mode 100644
index 7224695..0000000
--- a/PhyloCSF_Parameters/21mosquitoes.nh
+++ /dev/null
@@ -1,61 +0,0 @@
-(
- (
- (
- (
- (
- (
- (
- (
- (
- (
- (
- (
- AgamP3:0.0215614,
- AgamS1:0.024477
- ):0.0043965,
- AgamM1:0.024387
- ):0.0104818,
- AmerM1:0.0629455
- ):0.0030002,
- AaraD1:0.0345156
- ):0.00779665,
- AquaS1:0.0388612
- ):0.00756063,
- AmelC1:0.049445
- ):0.139682,
- AchrA1:0.289475
- ):0.0351051,
- AepiE1:0.352782
- ):0.131654,
- (
- (
- (
- AminM1:0.118983,
- AculA1:0.144847
- ):0.0740457,
- AfunF1:0.187614
- ):0.10651,
- (
- (
- AsteS1:0.0111593,
- AsteI2:0.010706
- ):0.142114,
- AmacM1:0.173187
- ):0.131043
- ):0.19121
- ):0.0834903,
- (
- AfarF1:0.233662,
- AdirW1:0.181989
- ):0.291437
- ):0.150112,
- (
- AsinS1:0.266825,
- AatrE1:0.244782
- ):0.29688
- ):0.261338,
- (
- AdarC2:0.163002,
- AalbS1:0.152404
- ):0.261338
-);
\ No newline at end of file
diff --git a/PhyloCSF_Parameters/21mosquitoes_coding.ECM b/PhyloCSF_Parameters/21mosquitoes_coding.ECM
deleted file mode 100644
index 13c9a37..0000000
--- a/PhyloCSF_Parameters/21mosquitoes_coding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-0.856979977161
-21.3799807399 0.243048702626
-1.07282632554 23.2891199352 0.417014024371
-1.70189173492 0.188155975062 0. 0.179377976204
-0.0606628059885 1.25594389172 0.0229550444473 0.00328435713687 18.1364766697
-0. 0. 0.566942262009 0.137821071867 31.7666032929 13.2859098957
-0.363302169127 0.3216200572 0.0779713622622 2.07370722097 27.2607785838 28.7642437906 21.1732174575
-11.2727606341 0.582021939541 0.450519061187 0.520525692578 2.87314674986 0.160184415377 0.0417616105268 0.392943810626
-0.197373806562 3.66356232072 0.129128041228 0.379280117156 0.326199666848 2.74555693992 0.150499848254 0.667770340927 1.87830419013
-1.86834815872 0.345363208373 7.04665342055 0.577755480658 0.355521388131 0.0612681556016 1.5212484594 0.479173384021 91.0051457762 1.3573969268
-0.568971981177 0.457370202419 0.104759904219 3.91042274811 0.352600386489 0.20108530169 0.150446124992 5.47395727586 2.78281874049 33.1384407846 1.6359111141
-0.796825184123 0. 0.0403648471502 0.101591604765 2.6530525349 0.199481018682 0. 0. 1.47135196603 0. 0.224999116277 0.0620080781057
-0. 0.416451433015 0.0365778147437 0.024970392227 0.100800143598 0.874204165608 0.130583286588 0. 0.141999370164 0.485936631223 0.110543922695 0.0881051473082 16.2840553339
-0.12641874075 0.065507193128 0.253613039853 0.0876476849427 0.354732481143 0.0224235730108 1.13456690845 0.205922054122 0.256670135609 0.0609082999619 0.993578689887 0.102531431492 2.2112993571 0.489455389074
-0.142167147587 0.0841528499849 0.00545185023752 0.468645974403 0. 0. 0.0245735447417 2.73514077321 0.0321517883643 0.0681718672235 0.190961252265 0.564971900021 24.1383229355 25.0045526655 0.960565154999
-2.61068586388 0.212857299965 0.0161926638881 0.436376510995 0.488945589229 0.0490126748638 0.0436777528509 0.118779224993 0.825672501796 0.248397282773 0.124449316407 0. 0.189414008686 0.0401485471222 0.0881524691569 0.
-0.101975766087 1.1738270611 0.127110430158 0.28355571795 0.014758840992 0.189405643318 0. 0.108577951241 0.15192674656 0.262657678883 0.186613378152 0.243660589481 0. 0.103957104833 0.0352873054316 0.00482802362259 1.79658789534
-0.0314277315691 0.169819246298 0.71866826475 0.165419543032 0.0377534774895 0.0241395904101 0.254563562124 0.0674618895841 0.0993905843497 0.0137652380848 0.619525928607 0.195521335534 0.026722114036 0.0130894039763 0.151205759774 0.0269324846295 24.088796861 0.961987674941
-0.344940619174 0.305455398829 0.0709676514016 1.60031795914 0.0704789063483 0.0159279589167 0.0877851061075 0.250696459521 0.0910258661535 0.17314633403 0.0620955543552 0.22104611078 0.0349971452587 0. 0.0470746037141 0.110016087229 2.54181455243 40.8651006557 1.46068774674
-0.306136639675 0.0365068756611 0. 0.0217224466725 2.73433734021 0.110586423354 0. 0.0381219899006 0.151571445904 0.0326945160705 0.267764377037 0. 0.441539418948 0. 0.0665640592016 0. 2.58642595246 0.109367108497 0.14611246525 0.118659911293
-0.000573614519137 0.104253395908 0.0250383204733 0.0533636462092 0.073014643704 0.473103940343 0.257984331274 0. 0.00615865469376 0.150482492584 0.00442777476089 0.0945035122737 0. 0.251993614389 0.00524930812503 0. 0. 0.603166504243 0. 0. 19.5110085343
-0. 0.0326516117459 0.105921316773 0. 0. 0.218109844754 0.880892812609 0.0206567660033 0.135717490267 0.0100217453445 0.0691830645025 0. 0.265895553088 0. 0.131840210044 0.0385783794127 0.0903101309711 0.0618145555718 1.02475793811 0.0557339105725 35.1407733276 15.6280698007
-0.114378433963 0.0755380229992 0.0334696841663 0.234076002893 0.109622016168 0. 0.043579809404 4.14976553074 0.124020445748 0.0276682901455 0. 0.420860301583 0. 0.0337486778241 0.0482465610908 0.384833201848 0.259016000851 0.0333608744166 0.0967913002381 1.77059360242 32.5414384022 37.4249875733 23.6322118109
-0.76872051314 0.0518496635313 0.206790445458 0.0103357986514 0. 0.0648947518157 0.155573814444 0. 41.6367496355 0.00897871779297 8.10178576716 0.0463408459908 0.010090972335 0.0200177545988 0.0153924623022 0. 4.03988737059 0.223383788962 0. 0.346561611784 1.15593423028 0. 0.0565558183642 0.0376120984804
-0.176940860673 0.0966444861601 0. 0.0785592690521 0. 0.0772313331586 0. 0. 4.89241326509 0.483964741726 5.93138982216 0. 0.0179416028768 0.059548694535 0. 0. 0.101310940279 1.40994629437 0.043866333123 0. 0. 0.309580947376 0. 0.0507115815889 21.2902489182
-0.0629795298351 0.0473604696912 0.688318325575 0.0412159006215 0.168097795855 0.0101942613411 0.0337230410753 0. 6.16756316069 0.0735969582839 42.0857806752 0. 0. 0. 0.0832000654832 0.0846535128153 0.379681833159 0.263413123194 2.16045669637 0.351469470996 0.0788557433647 0. 0.826518430639 0.128090672973 58.0453855015 20.923641997
-0.076094298316 0.135288219525 0.091294048816 0.0922485327941 0.0209863103834 0. 0. 0.226369136758 6.18143228454 0. 5.15573649415 1.07125192286 0. 0. 0.00125691002419 0.0937402627757 0.189747523371 0. 0.0665289703423 2.24488710932 0.0379550972204 0.0159773467171 0. 1.01770296266 37.3377363307 36.4584471667 29.0745428077
-0.158160420516 0.0120556276078 0.0238578426229 0.0160045795938 0.492716547477 0.0131875041541 0. 0.0403949866778 0.453580964347 0.00926804861436 0. 0. 3.34467930183 0.162615843816 0.670668819393 0.285564105445 1.96192533786 0.0700417989899 0.0707320089966 0.121981173462 2.44581946984 0. 0. 0.0576424452148 1.16342540608 0.011075412755 0.158559659269 0.
-0.0193224380447 0.0923148288235 0.00365268936531 0.0102066825968 0. 0.316452253978 0. 0.0163413226077 0. 0.0900658323965 0.0912448768615 0.00658190908684 0.689809618606 1.64922141668 0.179746039009 0. 0.115396665688 0.717152347661 0.0138497664298 0.0176041997189 0. 0.667969566413 0.0655661331862 0. 0. 0.418688777634 0.0945356085407 0.053164878132 20.4544469922
-0.00863512879095 0. 0.0369467829568 0.0019694946879 0.0365641334362 0. 0.13284384295 0.0243929829242 0.0517560523386 0.0189830161506 0.0335419847401 0. 0.137834606237 0.135640691099 1.08284486544 0.26921951135 0.0109947403896 0.0402028321664 0.514219812106 0.0267652516336 0.0695645290054 0. 0.494204070935 0. 0.04564276207 0. 0.466875712102 0. 24.3036054086 11.1181661776
-0.0665448209559 0.0548921830946 0.0255372736646 0.1507258224 0.0917147710424 0.108998077057 0. 0.714672482528 0. 0.0329706332436 0.143626874104 0.24454328392 0.454910519719 0.19417661262 0.486820556809 3.68990164995 0.330541181565 0.0645236037793 0.0890425798061 1.62529759913 0.0855851253897 0. 0. 4.55168880801 0.408631955389 0.0763223679712 0. 0.997577985124 33.009352379 41.648977566 14.3264529944
-2.36523488606 0.149863093615 0. 0.388052184684 0.52351318356 0.0445107931652 0.0361304571772 0.146675648637 0.99510305123 0.252054393805 0.140935161049 0. 0.18178207578 0. 0.0469925022234 0.0740502996711 2.51861283466 0.0877276849259 0.01053357318 0.170037651281 0.332126116503 0.0147257337575 0. 0.114800469765 0.249414968805 0.0054522238743 0.0234992906199 0.0284634729163 0.161617184985 0.0132888628625 0. 0.0387208308101
-0.101044364903 1.12349591734 0.0964056709973 0.2949678621 0.0362440735034 0.209698409121 0. 0.115482498535 0.138591958729 0.347197050615 0.153933364371 0.186391760757 0. 0.0478883109412 0.0165935750516 0.0401249768569 0.114390244071 0.49073782611 0.102735060828 0. 0.0353325854985 0.0724307861011 0.0317606016453 0.0186358072982 0.00708915904149 0.0667930926635 0.0365349171106 0. 0. 0.0491828806638 0.000975790213379 0.0211275510994 2.2053619905
-0. 0.125850443125 0.469382098904 0.107088504706 0.0211899645054 0.012870331311 0.184537424832 0.0724449792169 0.0673464126781 0.00496543008336 0.444779446067 0.185963125037 0.0352736521034 0.0262935981441 0.0696281314347 0.00380919013691 0. 0.0789108992446 0.80195467336 0.073867922517 0.00129773029579 0.0152333914511 0.123120315853 0.0284519012919 0. 0.0107614194593 0.150140280137 0.00385025472898 0. 0.00301557967663 0.0454687658394 0.0154784915455 19.7948511659 1.21145935309
-0.232011173528 0.189044125172 0.0671282746214 1.4109043465 0.0604442877758 0.00258249629862 0.0744724196011 0.297633359298 0.121744849668 0.0995804707507 0.0631436303072 0.346908534413 0.0238862732448 0.0141354459264 0.0184355860263 0.0442828901294 0.161643875125 0. 0.10663812361 0.54656952131 0.0150492508722 0.0294819232815 0.00857969312713 0.178824935467 0.0273276064468 0.01153190045 0.00718248290439 0.0860298814355 0.0105820559511 0.00157089298236 0. 0.0834596470596 2.70870019447 22.1270471209 1.31422399551
-0.50529296361 0.133370235344 0.0498469357135 0.0867569048185 8.82982471481 0. 0.106854987591 0.315354807755 0.937948880112 0.100630138883 0.0469600368516 0.108537395112 0.609587756716 0.107449051201 0.202699480512 0. 0.464926806749 0.0274366896291 0.0685629106518 0.0267324573674 3.59299923769 0.130531963383 0.0440063078142 0.395885476632 0.338260573182 0.0014435613204 0. 0. 0.436574638249 0.0363221474819 0.0508433777347 0. 1.75460515603 0.158313429179 0.10276476705 0.0621464281103
-0.0284461790952 0.212253431123 0.0262704624699 0.119807369257 0. 1.69439137847 0. 0.0238200232328 0.0499311140125 0.42812763174 0.0433483934406 0.0779343651887 0.124238771678 0.21961026491 0.0394061124296 0.00784799084073 0.0370027169509 0.0818947112047 0.0252533899205 0.021747647579 0.0113094179791 0.724512682025 0.134472285662 0.0310957722831 0.0167745448161 0.057197304014 0.0272889977886 0. 0. 0.204127343375 0. 0.0576450975873 0.0922046679477 0.353390774491 0.041312983612 0.042153189286 12.3630468079
-0.0608058541496 0.148482722226 0.207943699078 0.027915342068 0.208619559066 0. 3.91408287845 0.0952994427658 0.0239980660381 0.103208669958 0.542149892427 0. 0.00398056690156 0.180172992896 0.396999764442 0. 0.101691932539 0.0381385297924 0.286539177894 0.0133204803183 0.101634701266 0.219858353351 1.59519726774 0.231309758435 0. 0.0118070853546 0.270096461369 0. 0. 0. 0.125163131058 0.0331786840056 0.209190222596 0.181921325117 0.779148128217 0. 29.3362421982 10.5727352608
-0.104224724824 0.149896543597 0.0408462440613 0.351541033243 0. 0.0470545780751 0. 6.29767077478 0.0638605912434 0.0203328796665 0.17882849221 0.863911458009 0. 0. 0.0945005781775 0.716896467078 0.0594344511385 0.0112326757614 0.0486622115963 0.155235197328 0.170785316863 0.0397408684506 0. 3.70884461498 0. 0. 0. 0.198998766469 0.187561459576 0. 0.0383346884399 0.655329719253 0.204713395657 0.0710634862878 0.0957111473389 0.724858046892 21.5035212342 20.2117021205 17.0975384559
-0.243814221546 0. 0.108824678522 0.264420182206 0.364793101017 0.108006155671 0.0205920780887 0.170326493076 4.50859744421 0.269800396052 0. 0.173323615768 0.225395739418 0. 0.0520477021147 0. 0.284281705356 0.0953344886278 0.0515911206625 0. 0.234186592483 0.0289777763915 0. 0.161158840873 0.796843962108 0. 0.115827793356 0. 0.0987136739611 0.00029047619079 0.0112748855466 0.0121835662905 1.77155307137 0.0169763500914 0. 0.18823403339 3.31343536517 0. 0.101946039966 0.368466135555
-0.105733514394 0.55778792064 0. 0.0456698894765 0. 0.152841815427 0.0976274621557 0.114331444121 0.138690469977 2.07292580293 0. 0.0995490839043 0. 0.11553472201 0.00936734365735 0. 0.0639926611674 0.0711496517083 0. 0.072945462527 0.0165240972727 0.0563383181792 0.0301863217865 0.072033684696 0.0895041669733 0.234873522908 0. 0. 0.00334416438512 0.0658256490442 0. 0.0201119425472 0.0142221784569 0.796802944169 0.00644729862263 0. 0. 0.969675795578 0. 0.259312270938 16.7988341937
-0.123747011131 0.148762152389 0.448086643454 0.341823632575 0.34476022895 0.110877804612 0.468103639003 0.0517409316386 0. 0.472120665461 6.98729985985 0.569550979079 0.129146686061 0.0224600289171 0.282942379039 0.0547809756015 0.0529083010131 0.126121884865 0.464817592539 0.0563535784111 0.157848239294 0.0690716512742 0.284621038424 0. 1.26223251509 0. 0.425919459795 0. 0.021314959391 0.040206047527 0.10390150134 0. 0.474503890347 0.253280616196 1.80381788864 0.35821099567 0.457002815235 0.154061170371 4.27766696355 0.386090358293 47.9325619303 19.6808295645
-0.0940392483601 0.156428897336 0. 0.555747149715 0.265719451989 0.0591439377268 0. 0.388837541416 0. 0.092604306386 0.707672059766 4.16244419308 0. 0. 0.017844959855 0.191326971468 0.0214867140775 0.038793811958 0.0231011617586 0.178575314934 0.0264742042909 0.0665555390941 0.00974038240155 0.233148293816 0. 0. 0.312691113373 0.796448296354 0.0276668298469 0. 0.00576986511196 0.161257921724 0.0740679232858 0.0435058827918 0.0146785759452 0.935073559881 0.130985969118 0.150459907519 0.104142974561 2.2937251156 25.9167566891 27.9672543534 30.3671736585
-0.434058116582 0.0243009357809 0.0664865836138 0.0549805741932 1.85695152847 0.145837441361 0.119526026661 0.451736279288 0.93810077143 0.0667330549159 0. 0.0784036993055 9.77530236961 0.436725089765 0.58316203681 0.977490399744 0.341726863473 0.0390561119246 0.0380593521652 0.0286543721396 0.781823693643 0.00218133774376 0.0685003177396 0. 0.271085249245 0.0104602785429 0. 0. 3.47120842402 0. 0. 2.30786650813 1.50791862083 0.0483963919454 0.0300621606704 0.0735252786412 5.61717661886 0. 0.634793867133 0.742661472684 1.55918666263 0. 0.841314002074 0.
-0.0113667677619 0.139097021802 0.0266279055959 0.0649110059928 0.271165225002 0.356374200249 0.462447049335 0.0812554110799 0. 0.261906579666 0.214962406813 0.150876194512 0. 4.85246662164 0.112885739127 0.128479081658 0.00382441531228 0.0963471511583 0.0288968160516 0.0380575513004 0. 0.460646796364 0. 0.0526747725656 0. 0.0635182874082 0.0624795281108 0.0496585258215 0.249922297538 0.880126512364 0.104923430442 0.0475178691005 0.0469942044593 0.377726315 0.02396015719 0.0058029211923 0.400818155317 1.88399437755 0.0249683518635 0.276514482787 0.0333431132158 0.479895695338 0.0844193920514 0.0624254941258 21.7592101953
-0.0331799427383 0. 0.0666993209566 0. 0.0659147301184 0.256960995461 0.286462654957 0.0701466885296 0. 0.0107854883592 0.295165736711 0. 1.21447464954 0.180018476203 1.01556150887 0.426925008475 0.0425154209715 0.0198069960443 0.0949639914014 0.00626698048332 0.10953938333 0. 0.300853421045 0. 0. 0. 0.0831189682586 0.00455574777414 0.229147001649 0.243060751563 0.659201322877 0.00153006753369 0.0140756082878 0.0077442567221 0.264077928925 0.00835488167252 0.342760335106 0. 1.80433636682 0. 0. 0. 1.1713441614 0. 31.8153346162 13.500934857
-0.0753651521978 0.0829572682127 0.0469876926104 0.213057044827 0.276108755483 0. 0.205795926871 2.07448463232 0.414603494325 0.108654113555 0. 0.42829121982 0.438401644702 0.326753757929 0.233179693471 7.21268221952 0.0721202274211 0.0136132175223 0.0214700972484 0.181444564043 0.0226930454947 0.0998250535633 0. 1.02344251681 0.27821255631 0.0066081187679 0. 0.0411768797912 0. 0.18792017758 0.056173201874 2.58754316069 0.240544111649 0.0391893694734 0.0120639862744 0.591089276474 0.41302815344 0.0800084271644 0.145503183728 5.00734758378 0.188951138852 0.0153168225304 0.00275019000738 1.24518227851 30.5503637373 34.0462233841 18.6930893112
-3.5612805718 0.185576667155 0. 0.261882000557 0.552498356896 0. 0. 0.0454188913343 2.18033142306 0. 0.913055260815 0.148167561548 0.979499033508 0. 0.0276967036387 0.0462666186648 6.87550522201 0.409269139199 0. 0.385739048816 1.2307998883 0. 0.175887843684 0.0906161829493 0.735716867884 0. 0.600993186416 0. 0.729833033914 0. 0. 0.026483433212 2.74504384982 0.155811527469 0. 0.123461266078 0.427731161393 0.0289604446028 0. 0.0303196385124 0.493373112815 0. 0.222411828762 0. 0.699369865327 0. 0.00201358602267 0.0716169942232
-0.104325456084 0.463481189267 0. 0. 0.0326564812186 0.0193838763331 0.0364109108089 0.0460004723167 0. 0.098968148224 0. 0.0447017063462 0. 0. 0.0257930407901 0.263414933857 0.206483480307 1.24027101417 0.00160980668212 0.258419493927 0.0376900584074 0.045732253611 0. 0.0414234180165 0.064309867278 0.0667778675875 0.0394817700222 0.0782429690108 0.0462470882557 0.145607151232 0. 0.124089860161 0.120025598718 0.113313102447 0. 0.0293429859405 0. 0.0944873791495 0. 0.0538686904815 0.237650500843 0. 0.145663879182 0.0422859300375 0.0328957650127 0.0011783331156 0.0268609220906 0.109848171138 0.708962533642
-0.0440826539721 0.183543317224 1.31985453104 0.29760797105 0.0134450303614 0.0627229514106 0.31279883249 0.0806111169421 0. 0.157442294141 0.297999910948 0.109689823 0. 0.282760962173 0.218720526434 0.0560052611502 0.251959973649 0.420273990731 3.41918753696 0.491882578276 0.0896406707367 0.186494631066 0.439708062254 0.197947369192 0. 0.497223431254 1.2424461357 0.258879085594 0. 0.00808306260146 0.0470148067102 0.17542811997 0.0509391703359 0.148001904375 1.04860067906 0.194814679614 0.115927749447 0. 0.449370327984 0.0200324395713 0. 0.0892899979766 1.23078140878 0.079658732789 0. 0.0477979550569 0.168444216083 0.0449592501719 352.932298864 0.757542891626
-0.0260133112348 0. 0.0533392790958 0.709830630177 0. 0.0772589390514 0. 0.102456250928 0.164849778116 0.0404640512768 0.190001520841 0.135220074865 0.314847205215 0.153220567324 0.0365803390517 0. 0.060206598525 0.364682449198 0.133569747889 1.93244338701 0. 0.0246104772359 0.0254103916945 0.227563058626 0.0076539393152 0.0631550795105 0.0293457012601 0.108828143742 0.0226945449551 0.0322923760681 0.0514989763176 0.297520720886 0. 0.0872796679636 0.0728170451125 0.210120628582 0.0723105238391 0. 0.187833239399 0.0353299664323 0. 0.176256670958 0. 0.0721598798001 0.0450225348449 0.13074927379 0. 0.0585416392465 1.78059816087 39.161107698 1.08904133074
-0.32285906089 0.0859967474225 0.0561149741506 0.0997333958055 6.22297209977 0.0880669876225 0.726694491183 1.01646558779 1.08531977553 0.28612993001 0. 0.315673439399 0.410167922953 0.131920417886 0.104283886065 0. 0.778552681658 0.0466109104441 0.0770193625443 0.0954793310376 5.88489430467 0. 0.189290015679 1.20033163478 1.04257180512 0.0240800875658 0. 0. 0. 0.258693504552 0. 0. 0.410407385613 0.0417471510459 0.0229055164516 0.0633805100821 6.20291445659 0.268643999351 1.00503843064 0.172686305629 0.447784867539 0. 0.134286796325 0.220374931404 0.988209249538 0.132976168404 0. 0.323609598337 4.25915133684 0.0849966076834 0.374585594363 0.00669084346932
-0.0592120190495 0.317137404498 0.00996511224837 0.024970726587 0.184469819546 2.22580329794 0. 0.361810497613 0. 0.982607661126 0.136268953756 0.2043280624 0.45640423584 0. 0.0106817429255 0.0328444321006 0.0648093172502 0.237096986804 0.0178648037634 0.0197756543926 0.0919299997176 1.2554947586 0.164755867238 0.454088869701 0. 0.112459471987 0.0808505600423 0.0371170702525 0.169759857654 0.2913277705 0. 0.237002712084 0.0475003073893 0.184783472255 0.0192972493559 0.00777830381048 0.314901795686 2.11204235155 0.159218972699 0.385608776687 0.0617656827024 0.219401023947 0.0421932203634 0.0692095788129 0.0936204368 0. 0.21065062495 0. 0.146933837691 0.28561463973 0. 0.0412013552127 21.1669501142
-0.0214242844445 0. 0.0890509476222 0.106347387581 0.50477863564 0. 3.09784136779 0.0459525854663 0. 0.165204710987 0.445843862583 0.278213722528 0. 0.210736910449 0.177706552924 0.0380595760919 0.058570696183 0.0201420132449 0.258429258273 0.0560705901873 0.0251972854114 0.140893674403 1.42610603808 0. 0. 0. 0.317799605587 0.0506989312525 0.255831368443 0. 0.0806293001956 0.0168824151148 0.00475962470686 0. 0.0971995733402 0.0437031245498 0.500973292004 0.0774839884335 2.90438537811 0.202071520986 0.0937165711889 0.0216420775447 0.46085520615 0. 0. 0.386212730776 0. 0.0439111871227 0. 0.00142019617832 1.72372488346 0.00353564686792 39.2916179068 18.2449713723
-0.12772333616 0.202937477234 0.0456262887699 0.384240827481 0.750471298595 0.566716666735 0.329482300209 7.9730276104 0.348733256117 0.416616268506 0. 1.60604961709 0.153626160452 0. 0.051816532713 0.517553659832 0.191648788308 0.0783717598123 0.0620273916294 0.517147043007 0.757054829915 0.271320901834 0.0610169937309 7.83805440567 0.26049598552 0.0116099054579 0. 0.271192109703 0. 0.269401620363 0. 0.869217204478 0.173886539068 0.101559401417 0.0513360463705 0.25313978055 0.814021622311 0.542152688427 0.661009268928 6.26229632635 0.0789158873422 0.140136062493 0.459696135584 0.449218526527 0.242718586153 0. 0.036411591094 1.15509068397 0.3893585454 0.0424108621429 0.560890848122 1.09144238728 32.8955493322 38.4940460748 24.077551687
-0.892146421339 0.105792977881 0. 0.203727471191 0.937054097698 0. 0.11392298206 0.0306223345718 9.42292304392 0.368889170803 1.66077364659 0.579325085445 0.114146365789 0.149157964404 0.0775871861269 0.0452777917467 1.87236487125 0.253819545628 0.136018977537 0.389932585883 1.67509605282 0.0552503571781 0. 0.161064385475 15.4813846104 0. 0.20972813964 0. 0.675574459504 0. 0. 0. 0.942992935462 0.141984025502 0.0271301662091 0.0830153582675 0.959015469118 0. 0.279990642381 0. 5.26272896639 0. 1.3089471879 0. 0.932609036265 0.0129723246839 0.0293439782823 0.0631589397541 280.629762483 0.33921123514 61.6326568199 0.574254177642 6.51206780811 0. 0.154805300534 0.571105398762
-0.0543459569035 0. 0. 0.175082894371 0.0300029311488 0.152289336153 0.0213642624993 0.0474803694279 0.272378780882 1.11185426229 0.195192906777 0. 0. 0.0422434128828 0.0236417440157 0.153894931667 0. 0.159478557231 0.0581249296853 0.0888637596587 0.00774711463909 0.0797019570098 0.0220358018891 0. 0. 0.788772412095 0. 0. 0.0125193864137 0.157865057283 0. 0.053199968005 0. 0.103059554852 0.0214087156837 0. 0.036253294775 0.171112602984 0.0185506897953 0.0201440173115 0.180508780553 0.379647848599 0.165082219653 0. 0.0387162959041 0.17589011491 0.0166076794048 0.0888466997722 0.278144013414 0.516232169639 0.134276520095 0.0356284139123 0.110707261879 0.765365154596 0.0484784571802 0.105517140489 1.956996971
-0.0426453273696 0.0191205668943 0.0368964641593 0.0195993734266 0.020426687841 0.0071332799582 0.052440437308 0.0188225003564 0.137720655499 0.050220433979 0.791577703309 0.0569744636126 0.0490397005783 0.0154243449821 0.0854117057841 0.0247958613472 0.0837332655223 0.0474247246812 0.120026567666 0.0690972261089 0.0520473599944 0. 0.0770543128608 0.0275746063381 0.105528767172 0. 1.05765165507 0. 0.0503584622369 0.00540933675393 0.0512677354683 0.0567514547181 0.0241550573068 0.00713138366743 0.0322524761285 0.00510242031931 0.0275438433454 0.00454715835838 0.0660427342198 0.010682243118 0.066443063198 0. 1.06220346525 0. 0.0369033385963 0.0104664832187 0.053823143186 0.0247144334391 0.396443415435 0.162886463316 2.81533142291 0.303786834202 0.122329738726 0.0197654206404 0.301045311419 0.0927439142057 4.07574873867 0.297231398254
-0. 0.387694492842 0.0566264290759 0. 0.0420389430627 0.0372263203947 0.0284009571392 0.391280067504 0. 0. 0. 2.62120940939 0.235208821229 0.174126629446 0.0377333685393 0. 0.266507634665 0.140780997735 0. 0.274461791044 0.024251685869 0.0123437067252 0. 0.42174418179 0.386142599092 0. 0.280878402933 2.26656277487 0.0668300289241 0.00484107193822 0.0120421621438 0.467512964536 0.140861595319 0. 0. 0.152886951063 0.0726618429342 0.00881337066215 0.0765283799663 0.323564236667 0. 0.104293437079 0.0656777320123 1.27568533433 0.0936900727309 0.114534588299 0.0388409803721 0.261207870269 0.539598476857 0.057248937284 0.709959826108 1.31873341905 0.149748324813 0.0137692137083 0.021682240931 2.67377221412 3.34744003832 63.6215057037 0.552099970733
-0.262658101564 0.0330856130484 0.0318435467419 0.06434557919 0.956294914676 0. 0.0362010379979 0.210563484821 0.649823236136 0. 0. 0.178067726788 6.14046266775 0.484508818038 0.969822459383 0.0908273537571 0.569261086804 0.0475523632477 0. 0.0356114691876 1.12898507341 0.0473037858179 0. 0. 0.60621623873 0.00374427661168 0. 0. 49.6159095859 4.68022066218 5.91403524205 12.128423537 0.343023643831 0.0170291972708 0. 0.0286948987936 1.10355826045 0. 0. 0.247628287953 0.256927506886 0.00389918558072 0.0386987944657 0.0462994870786 4.38167122112 0.749142928044 0.326128125834 0.155704509341 6.93877030376 0.243950655216 0.795264519656 0.219296014971 6.28903338562 0.253404687172 0.350852805934 0.514188082347 7.10336662893 0.17185837391 0.250117723726 0.310340196655
-0.0836251079889 0. 0. 0.0759521765583 0.025061096046 0.128763746911 0.0365471490099 0. 0.0513270168229 0.115390559489 0.0136726811189 0. 0.494123395556 0.738187904377 0.113320681627 0. 0. 0.172946985827 0.0634101240401 0.0303155000782 0. 0.113804414616 0.0536675968956 0. 0. 0.0934146779956 0. 0. 0.157608968678 1.11946201469 0.163383148328 0. 0. 0.0151230114653 0.0171489957776 0.0145945353819 0.015584347954 0.11246152727 0.0672202658176 0. 0.102939183862 0. 0.0860115508942 0. 0.0968596103594 0.564102323427 0.0442859710728 0. 0.114886652857 1.58908101447 0.0640408949033 0.904737091043 0.0464952209978 0.55079298779 0.0350352055003 0. 0.223792473206 0.138240250676 0.128815431027 0.47979472309 1.00317623422
-0.0291577441272 0.00710949998472 0.0678309421565 0.0296178528991 0.0382507639617 0. 0.440552472665 0. 0. 0. 0.41775879454 0.0882600115553 0.481363126311 0.40262892409 2.18167671879 0.22263115552 0.0849711406145 0. 0.121560618927 0.0125624650954 0. 0.0428371422818 0.191018400085 0.137560451816 0. 0. 0.250171892144 0.0477011893207 9.6100077808 4.83686618095 20.5612112307 6.14952831179 0.0434614128121 0.00814219912045 0.0536473772114 0.00722447169821 0.0567220784066 0.0346109731334 0.477257172205 0. 0.0159230494094 0.00672775637493 0.312424461243 0. 0.926206563236 0.170008698136 1.00901362295 0.595253476155 0. 0.0829218608049 1.88426764212 0.0861787526896 0.826858434307 0. 1.08578916825 0.406345336454 0.693518216334 0.0723512495772 0.686787071396 0.139318568235 37.7467182911 0.407872757386
-0. 0.118017675903 0.0516491740649 0. 0.0245749501147 0. 0. 0.515743121688 0.00349160199675 0. 0.0461156753177 0.227277037273 0. 0. 0.195669278198 1.81813346514 0.222473192805 0.0396850438219 0. 0.267936923992 0.111696900826 0. 0. 0.551653259568 0.081951854164 0. 0.082737441961 0.133720495134 0.299280716335 0. 0. 3.68142435956 0.070474856968 0.0253494371084 0. 0.0186977483264 0.0484115177612 0. 0. 0.364949634323 0. 0.0637057162944 0. 0.118085161486 0.136351224149 0. 0.0098593477854 1.37279032042 0.347644700635 1.0187663532 0.267201375923 2.77745201989 0.207254836317 0. 0. 2.06876811139 0.505268712448 0.346609972923 0.303669059181 0.251430422297 3.04304016233 34.0403102714 1.13479757826
-
-0.0181562543195 0.0237541470812 0.0374678167352 0.0229356112767 0.0128689037304 0.0198976366858 0.0146655632375 0.00919594319685 0.00472893318106 0.0211913632303 0.0055799304347 0.0110186011298 0.011298864648 0.0212572494848 0.0236085461411 0.0174040193786 0.0162290051584 0.0148443207067 0.0353528716219 0.0119611294267 0.0135951768286 0.0180305546134 0.0153945069058 0.0065457378099 0.0078695600931 0.0191529378739 0.0083646520671 0.0103291428757 0.00819577204868 0.0151009637038 0.0395263872133 0.00821847799094 0.0207915459753 0.0230931017409 0.0422829154308 0.0282726539789 0.0135792875468 0.0329056051667 0.0141017924951 0.0139740807157 0.0140824034252 0.0275383935595 0.00496476036542 0.0118834390088 0.00615824907675 0.0144300896903 0.0275466491572 0.0105317037816 0.000922468535899 0.0174195794121 0.000696348080875 0.01351829124 0.0078555121632 0.0176405660316 0.016049381888 0.00653336051055 0.000634022586315 0.0136299552106 0.0103827981635 0.0061971613548 0.00498147886533 0.021300710268 0.0173922639928 0.014968849752
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/21mosquitoes_noncoding.ECM b/PhyloCSF_Parameters/21mosquitoes_noncoding.ECM
deleted file mode 100644
index 6b40287..0000000
--- a/PhyloCSF_Parameters/21mosquitoes_noncoding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-2.60522165174
-5.52510067718 3.46892355586
-2.06752205896 4.87084817478 2.21791845944
-2.3195381658 0.29942855373 0.528228212208 0.26648971101
-0.330068073364 4.34832138922 0.432834075405 0.566200533823 4.59841842144
-0.552416252538 0.261795105 3.90539440681 0.215698594141 8.6764671226 4.28639980545
-0.295548791599 0.827336939107 0.393001102173 2.30234170923 3.81729458011 9.33029881664 4.31982049419
-5.82573631847 0.801834999525 1.86182286498 0.602393752325 3.81311102277 0.474788400945 0.721304810831 0.329054451704
-0.595892512437 9.69926539657 0.842946055917 0.971814913776 0.399337020469 5.15799117581 0.236792300614 0.73713375116 5.37263336106
-1.05273301983 0.621797096011 10.3561262134 0.615594998571 0.720352431384 0.636012240368 4.08598201643 0.288342417197 12.6654887488 4.68843038831
-0.511007461668 1.27482190234 0.770931708347 5.14006094873 0.263064404428 0.72057905066 0.31199670561 4.78418938995 4.77782550368 8.79650954363 4.02459238797
-2.45614751139 0.368323546282 0.896011440009 0.345330822663 6.38445607882 0.812447241133 1.22688836396 0.89846227661 3.86123785872 0.054624957844 0.807672411047 0.284218649159
-0.297071771517 3.3301080317 0.294244712813 0.594387565738 0.630325090791 8.22791956827 0.60941585104 1.39405066498 0.518559738627 3.74891441167 0.432486622264 0.886834747439 3.57278649553
-0.491952797003 0.211319243882 3.22926300477 0.288114933896 1.46193024122 0.664041941702 8.73877116939 0.711829787348 0.610050659555 0.26177882384 3.52009446056 0.282194809626 6.51970381022 2.46888502102
-0.270311769619 0.53701253113 0.253466034556 2.07899632569 0.389073083667 1.18867330633 0.366846269651 5.2275473054 0.266988648959 0.45562665342 0.293347630878 2.23924111386 2.99584349371 5.01115562509 2.53862842844
-2.54429183679 0.208897902088 0.690631250814 0.202027264705 0.244791690551 0. 0.102010744231 0.068623129321 0.718867473979 0.0861791543005 0.200678256294 0.0277198677359 0.358710455289 0.0198590262246 0.0727513233457 0.0181667907683
-0.205741251989 3.54878426463 0.282535784093 0.442820226573 0.0371097332821 0.472702213865 0.00924159247056 0.0270547897495 0.217166271741 0.809157527615 0.0731064332526 0.167555106759 0.0823809711156 0.233703673635 0.0507150524041 0.0118325287932 2.79594212608
-0.454462784752 0.221619695452 3.94980098948 0.192503544533 0.20057130093 0.110679640482 0.366954674621 0. 0.294065885262 0.0422692166612 1.19442307203 0.136885521587 0. 0.00705222137801 0.38732889744 0.0336198621798 7.61431848979 4.1790760497
-0.250017930855 0.600751819008 0.2532882811 2.48072248044 0. 0.096910416293 0.033071836568 0.3330380543 0.106896588224 0.221471925649 0.184154952423 0.71515124614 0.0787027589041 0.197544782653 0.00291609470126 0.293131845465 2.57577732798 6.94208324896 3.27585074853
-0.267538861181 0.0782973620584 0.140990405947 0.0415135512486 3.26788735517 0.391466887355 0.584485074743 0.223924105786 0.53967272806 0.030939550127 0.104490034188 0.0907393878631 0.706815630064 0.118344611019 0.181283524607 0.00908489560399 3.65214779623 0.43161700393 0.963510202506 0.268388623877
-0.122528796445 0.403492967439 0. 0.0753976110614 0.345763756346 7.95722267283 0.351981375839 0.660662480024 0. 0.519980399021 0.311961640455 0.087688748179 0. 0.665982021083 0.153361405173 0.157150510133 0.289733588913 4.91280159829 0.597746315167 0.783123601521 6.85421562286
-0.157896529141 0.125849840503 0.258837222819 0.0262407555021 0.546585213019 0.250136220871 6.1023022464 0.27858435627 0.0965962927904 0.0837203126736 0.41309497354 0.0651975505063 0.167610924662 0.0863019690749 0.523540972714 0.0356231133228 0.524246028168 0.427565464426 5.77089638668 0.309151292801 14.7964854058 6.03102821436
-0.170436883784 0.101171673737 0. 0.235477601463 0.290761451767 0.986145223945 0.298849243214 4.18240167889 0.0838301866341 0.217688815126 0. 0.367784454716 0. 0.171407551321 0.172665624586 0.622087066397 0.206350807788 0.679113628723 0.477771364745 3.59103421041 5.56204335797 17.2297122913 6.90886230132
-0.637707469457 0.0980845253209 0. 0.0386222159964 0.23291610923 0. 0.133387182059 0.140114698057 6.19099261505 0.286769228317 0.917424235416 0.222350439907 0.196014430766 0.0438704080348 0.171320870319 0.029495951056 8.61610724776 0.740338142792 1.897591966 0.504461228772 3.89883392169 0.303737900124 0.940750518231 0.582602259878
-0.0552030861191 0.406515753038 0.126757954568 0.17902632355 0.0429018761926 0.167792025667 0.088308826142 0. 0.397029203581 4.18595899237 0.361569523204 0.629291039745 0.012095057946 0.218555477593 0.0338811067771 0. 0.714975070526 9.88809944498 0.73947683568 1.01131929346 0.212139146705 4.47739869358 0.282032128892 0.788958556228 5.0147010624
-0.142317397722 0. 0.858132236596 0.0524028347981 0.0845413370276 0.223285798859 0.477504820704 0.0313574645896 0.741621629651 0.381515213112 6.79910727345 0.185605422378 0. 0. 0.307194239723 0.0334611209093 1.51778663185 0.633300960636 12.5139215776 0.52321566535 0.907058407988 0.803636621863 5.54890362758 0.353466300082 11.6791489514 5.62326450239
-0.0632604351817 0.293940871922 0.120172031706 0.408175611648 0. 0.168880218778 0. 0.226461793393 0.424688374337 0.644519008495 0.35940974446 4.21139730687 0.0533289483047 0.179151278901 0.0389341139928 0.233983621214 0.450540732963 1.44704264599 0.891610313991 8.79731335796 0.453587541817 0.501626596963 0.419745943993 4.04719461146 5.37510573152 11.5732278696 5.93235816792
-0.271934817808 0.0220389805083 0.360919166698 0.0306140044835 0.752318321992 0.463319481404 0.0237920653271 0.0472648305889 0.410951022594 0. 0.206617433612 0.0490180837447 4.19715565416 0.331859055831 0.636355522299 0.327688640142 3.84097030894 0.240503800507 0.665107401131 0.398453372736 9.89885147868 0.797924695707 1.41658091675 0.962105284807 4.14390656934 0.185723871788 0.927757405015 0.447505455533
-0.0441422651003 0.351697700152 0.0540161434958 0.0395732774663 0.203771372951 0.550631712994 0.174017431879 0.41203269941 0. 0.58734824068 0.119062840479 0.144323912746 0.232310518672 4.00520653295 0.346972105194 0.468054735393 0.25509398801 5.26566329901 0.623159418873 0.565609802428 0.854434133855 14.9117484413 0.845802974661 1.85608265587 0.403055949032 6.4442609397 0.519341640143 0.848589689817 5.39834773416
-0.0732180070149 0.0968521775348 0.228828756215 0.0184219094418 0.135688516825 0.0237881831167 0.859989660933 0.163967324751 0.0963793084962 0.050979981086 0.468537052022 0.0523032717653 0.495209908214 0.192641952809 3.0982481819 0.17865921222 0.416996695586 0.345414736546 5.03705465074 0.330159736313 1.67298903994 0.841108082877 11.9450323105 1.20722675626 0.740920305434 0.26598753344 5.3213295419 0.35148359416 11.7501313957 4.96184490401
-0.0221615561397 0. 0.18053780639 0.232847292427 0.0886419985582 0.311519768132 0.0782740903323 0.768657876222 0.20478676049 0.104330422709 0.0149957938401 0.355174837782 0.401325655323 0.669743397933 0.240594251687 2.21617894499 0.239479204102 0.463301114039 0.257639362336 3.21848934944 0.614917578254 1.24161518748 0.753701089267 10.3962486969 0.4724551404 0.72561003943 0.346683864076 3.8853095069 4.48167836817 11.5738315211 3.84920008886
-6.46152443068 0.688877807506 0.907244785869 0.467331091131 0.611857479133 0.38000697963 0.274957472129 0.0417115243384 1.78039895393 0.0931120924274 0.92558963629 0.11139615157 0.719672704195 0.108813780714 0.14630642316 0.108187658319 3.08393052516 0.224878585989 0.620023085921 0.308954907803 0.492547578464 0.174234124077 0.0130567187595 0. 0.675106424614 0. 0.254520863205 0.206575237598 0.501861233193 0.157443454569 0.0158713688637 0.0253774110209
-0.383814344165 6.97508651301 0.535744016959 0.869608553356 0.125634803092 1.1992165745 0.0482168945747 0.166215809035 0.385867165096 1.79183536119 0.134729159035 0.42852869417 0.0405646931802 0.896198342106 0.110650667529 0.062369015921 0.167364953657 3.41846809715 0.263196922934 0.481586151241 0.062064983602 0.31960756476 0.056698891866 0.0686419515445 0.163067764246 0.637468886748 0.0931119682843 0.152959353192 0.103874145219 0.320755915959 0.0585407497123 0.159114390453 3.3705044899
-1.05022340326 0.581026804078 11.2240678679 0.470465861776 0.317218721951 0.0630525248766 0.778161858589 0.181788766574 0.277449520997 0.361212044249 2.08515796396 0.43619236315 0.452696901317 0.173696696033 0.642502390054 0.0404014311909 0.682778351182 0.544672566316 5.21922208324 0.355151721135 0.107162523901 0.062248643198 0.663306402484 0.19162270899 0.522764714146 0.0335688758657 0.782763482094 0.163106673887 0. 0.0465122608892 0.585116516325 0.0171956340661 9.69575537066 5.40056188954
-0.463555302185 1.36885645104 0.629145708589 5.01894573147 0.116251331227 0.0907081671292 0.202939025922 0.905680697885 0.304403966397 0.432168130854 0.187380395451 1.35467307484 0.114572366551 0.0821882529413 0.176377339242 0.592215505168 0.305818323259 0.543871427782 0.216286614077 2.53109375099 0. 0.153558117059 0. 0.542581004971 0.20674612679 0.192504536483 0.0298525823301 0.547588985676 0.0805929436176 0.128518226387 0.0298694150466 0.255215461869 3.37416853428 8.46230911018 4.07152778919
-0.480383982717 0.113564278539 0.255623640736 0.00307653945662 7.39516897953 0.599690149253 1.27957922996 0.551895856538 0.710140444653 0.11711866548 0.203456778477 0.0768765888675 1.03022447997 0.13889393181 0.360875415287 0.143429116955 0.192790074292 0.0229978012169 0.0474128199143 0. 4.07431891567 0.348455094593 0.615092758097 0.2789288752 0.231998468985 0.16665458539 0.0999114485727 0. 0.545458431919 0.140425511194 0.252964601793 0.0641235109003 3.45150022822 0.25341181581 0.85537272809 0.336373802126
-0.0498994970469 0.659298255503 0.120756811598 0.110625856911 0.499397078742 13.156694884 0.527902627276 1.17450655751 0.0979999890977 0.783058133349 0. 0.234245741379 0.242028577174 1.27297503647 0.198144716023 0.226456646017 0.0392688783335 0.310112026688 0. 0.0478714335742 0.362254930416 5.85652628067 0.393384006798 0.85767141986 0.189282416135 0.204461461925 0. 0.249713282975 0.063213200208 0.772616833904 0.0880407062257 0.0621511474181 0.267377413205 4.93887836005 0.75208565002 0.499218431241 3.95581023001
-0.178490254361 0.113243779052 0.680601416525 0.0123851259926 1.07307674091 0.663960519495 11.4793867882 0.595067811349 0.255354019327 0.112138018559 0.72108127423 0. 0.2947402588 0.171527002844 1.04678252153 0.166942144533 0.0207482608192 0.0515545866334 0.294103848407 0.00675470149663 0.722558600771 0.21081306386 5.61878406624 0.353707057708 0.143153986138 0.0295066441118 0.27082080531 0.036527617573 0.392923461837 0.0543021739285 0.73796041319 0.111898158653 0.607469043142 0.42658669437 6.48078550527 0.214897870972 8.25817958502 3.64643404483
-0. 0.208975293263 0.113922477378 0.454907336945 0.527947416158 1.52290075472 0.499491662628 8.81867782892 0.162144537939 0.176899300708 0.339150496892 0.68155736895 0.243904893911 0.392613238257 0.235077576555 0.989929641162 0.0598904480749 0.0274939063586 0.0573185360404 0.220558213277 0.421217145809 0.469155144997 0.277763898137 4.77918871671 0. 0.0794382166745 0.130631183539 0.276353468502 0.158423765967 0.375150759131 0.0250784177391 0.818554705267 0.423651854092 0.932897423151 0.511556304679 3.77771578835 3.94974067907 10.060749705 4.3142715615
-1.06919091118 0.176544118626 0.62815843859 0.106929919545 0.625172320518 0.0983476708752 0.321057017741 0.0707726923527 13.0461448409 0.740214098892 0.5323200039 0.662033161825 0.555671637344 0.167882921301 0.254232048068 0.100907764286 0.612709770406 0.242146767217 0.324412275851 0.0715175841763 0.541526056137 0. 0.0203467517845 0.128916507747 4.65809384137 0.181788404383 1.09871502383 0.370878527838 0.517539462064 0.00597018697316 0.027004886244 0.130423699596 9.71419503953 0.996475979239 2.30362027852 0.771326354775 3.68110740354 0.574069449478 0.667747864717 0.357518830067
-0.124255890974 1.29327498652 0.049216033785 0.222982127914 0.0604731034924 0.80299117925 0.336520079351 0.239465907053 0.668765775192 10.0008088688 0.89905029628 1.10329562756 0.0812623827644 0.521666447963 0.020478509012 0.0788716826363 0.0723017837057 0.627028740646 0.0793409847722 0.183569879309 0. 0.535168096864 0. 0.154780680418 0.339970756151 3.70808312049 0.271651366993 0.458888099002 0.0631968307521 0.60855138889 0.000969590450287 0.129408342384 0.74578001827 10.9642335764 0.809321015463 1.26043846525 0.443541303106 6.32079872143 0.187046545446 0.779603904702 5.78656154224
-0.430633667495 0.216900752581 1.22423556589 0.1379606532 0.423782004361 0. 0.465596630589 0.125839128325 1.57018052588 0.499595707407 17.1424388709 0.630510821719 0.0770546407886 0.184781829392 0.80194232831 0.0778331486629 0.272675568284 0.154344824097 0.816164640218 0.181261351779 0. 0.289203423792 0.724311118449 0.430547822512 0.640397034316 0.185400847809 6.06769299227 0.336957380147 0. 0.0785717850552 0.563809365013 0. 0.879107248925 0.570402654692 15.1934005002 0.692558665128 0.543186719362 0.656469474346 4.55015113356 0.455496393966 14.8406602979 5.87378021279
-0.10782961655 0.397922832562 0.303043906275 1.15134235508 0.204418853685 0.371359365018 0.0922161117302 0.671905577877 0.407876429368 1.49131224744 1.22316074924 9.31364010052 0.0659344552593 0.144574201112 0.0925735408299 0.582475702388 0.0363355228639 0.297656428736 0.138440193879 0.659881107176 0.131631371164 0.0386775112254 0.149568084225 0.15703864353 0.245809837971 0.604325605926 0.462539132915 4.32018874731 0. 0.241384207368 0.00943776558503 0.474622377065 0.930923295825 1.57505991892 0.448160445025 8.27984902319 0.212526985917 0.662027832874 0.271951734254 5.3932152289 7.01796079889 13.2819260064 7.73152824174
-0.785114366281 0. 0.190582516962 0.0437245001644 1.60902617329 0.267703675237 0.172723544963 0.203174364247 0.24840311051 0.23889140142 0.287781434575 0.029901601348 8.72032227161 0.809949936009 1.27012921147 0.646006066362 0.263858017466 0.0911580000312 0. 0.0649890857122 0.588978777883 0.0593159278304 0.11311914885 0.127673720151 0.547537065571 0.00890813618702 0. 0.0160219806526 5.36614341439 0.321823878762 0.433766701507 0.153232412137 3.70023837835 0.451404912321 0.667859184893 0.381159496482 7.15133975759 0.765693663643 1.16326409239 0.756193823975 3.97556787065 0.0739449366022 1.30928853238 0.487292257318
-0.0932330048649 0.626458702051 0.147020840639 0.0783894286927 0.261572302761 1.54108436263 0.0203356376929 0.435931519232 0.163874623407 0.857984858575 0.215844705736 0.132020661072 0.581596595914 8.440142681 0.489582070011 0.887531645778 0.0330134663461 0.273150370312 0.142226319085 0.0929907118425 0.046271815886 0.616275281387 0.029319930779 0.139365079455 0. 0.44593197596 0.16281235461 0.131885848282 0.137662554377 5.38384064088 0.231910649926 0.405129195554 0.249998695284 4.60624374682 0.259025590052 0.940729844945 0.70354790234 10.809106611 0.673222830015 1.76599423259 0.383056109368 4.94461024512 0.324289399806 1.27641294791 3.64226215594
-0.115671087631 0.11099052262 0.523966729459 0.00825619242947 0.355096190579 0.273626760734 1.42924086577 0.190326900145 0.383735854706 0. 0.652083379392 0.0276221627974 1.28837929594 0.522186746577 6.74328786096 0.446545887313 0.109097648858 0.0210803305946 0.363099787521 0.0189067390323 0.207581570135 0.160645760092 0.651889079029 0.075801742214 0. 0.0473877911129 0.468659407859 0. 0.462535958607 0.518887856133 4.02344182321 0.297666753421 0.682490917891 0.251494236206 5.17276559213 0.229920577423 1.30998499607 0.620950341384 9.80097842168 0.792641443266 0.716049028897 0.340371268778 4.75383838917 0.398584556613 10.8895201843 3.39222524377
-0.0848119993015 0.0497111753355 0. 0.529676147046 0.218063169303 0.393785170806 0.389534896176 1.37035309167 0.181035586425 0.20545759066 0. 0.856323451482 0.631963013807 1.3992801786 0.563353589371 4.87278695277 0.0211020424287 0.0819252907359 0.0456965121717 0.197177035324 0.051473249901 0.188027970631 0.0844195663027 0.611932893809 0.0856434000193 0.161610141343 0.0593737882724 0.270441938039 0.169490119886 0.559077869937 0.245904264031 3.55100653969 0.328551756953 0.604424375658 0.392278042947 3.38035008941 0.520756692006 1.35443032822 0.371276014057 9.72265927134 0.398852401405 0.681732161833 0.397171209847 4.22304365899 4.28169336076 7.01100597142 3.51268072128
-2.2963661213 0.163164534263 0.572357770823 0.268914073677 0.329726654283 0. 0. 0. 0.618819652738 0.0340760214334 0.15660069592 0.137629051393 0.464863762542 0.0482339350431 0.0765141331328 0.0223618722052 4.93641399381 0.53919507183 0.778870379206 0.469274391055 0.529410506384 0.0102089226755 0.22936863473 0.00911296317807 0.951615777102 0.152092158452 0.195633518988 0.299143403733 0.792403150648 0.136536824369 0.292380158659 0.0634072465286 2.67929976566 0.111090266371 0.397993600546 0.273477085143 0.20004454144 0. 0. 0. 0.772323580557 0.0460467490792 0.274422295287 0.180438769889 0.345031512095 0.1169411809 0. 0.0862887154545
-0.36221886721 4.43749633365 0.198705602053 0.648323746956 0.068704432249 0.279665861526 0.00260402382336 0.141985679692 0.0423421376083 0.801368750052 0.223824905685 0.277391236847 0.0381087967915 0.497983733464 0.0469589556908 0.0268327207866 0.551348074861 10.1600786946 0.532862806093 1.2972973744 0. 1.35996071209 0. 0.457780412711 0.390328433347 1.35639448115 0.0821727427381 0.153319290359 0.407256454251 0.513142352844 0.0111661994826 0.336157828438 0.527409566821 3.84832736431 0.239717899947 0.829973779517 0.0644161274506 0.182748240199 0.0127517474922 0.174565348311 0.013411761878 0.849321327846 0.114319422746 0.116665223506 0.0177312509882 0.353509116466 0.108648716676 0.0492162804168 3.55997377287
-0.662844734956 0.24718672961 4.44643944812 0.312155165897 0.125249804856 0. 0.452865252824 0.0902557562959 0.780092420005 0. 1.08300931948 0.13064833238 0. 0.151981557649 0.403639021805 0.0102513824782 1.33684469853 0.5338563919 10.3812633396 0.691151745857 0.216592999189 0. 0.988823139793 0.297160088089 0.590577033043 0.412386887601 1.4165299385 0.0504868122996 0.308776833086 0. 0.765724055981 0.289704632468 0.598650479144 0.0352777339578 5.83174099423 0.37437356017 0.130108430271 0.114499334124 0.176488935715 0. 0. 0.281216744974 0.678643505586 0.216726769023 0.437232408654 0.0169010207316 0.193734873381 0.107114237976 7.62089842807 5.82215745173
-0.39718927436 0.582256314986 0.447372089267 3.00510556006 0.00523208328632 0.192717126765 0.0504732351332 0.271183148591 0.0739618424566 0.297135925765 0. 0.857837202389 0.0136678015112 0.112114970511 0.065541380167 0.354750352898 0.584297791039 1.24696119807 0.528300740757 6.53236720694 0.101472510413 0.110976638701 0. 0.70469406721 0.143001511783 0.292934968547 0.217703115206 1.18711697484 0.00759432390077 0.575520856236 0. 0.860908450835 0.326804098134 0.652075620805 0.265602198793 3.54052358699 0.0529274692445 0. 0. 0.13065909266 0.0921045261971 0.222944690332 0. 0.904397126722 0.0339390870035 0.0493798526259 0.077727243165 0.350455381219 3.06691219618 9.43091121002 4.23747456331
-0.266754024104 0.00650093716495 0.12800911926 0.0772980128718 2.86683009967 0.234582115115 0.445501850035 0.157126406069 0.290399172749 0.107595239865 0.108077202261 0.161561897413 0.699113848226 0.191697057858 0.162509316102 0. 0.607692951274 0.0469956221946 0.198918977485 0.0922159160776 7.58433037129 0.368490961564 1.08674774904 0.496812861248 0.666102043238 0.0990191396224 0.0920136908503 0.0821908436717 1.49081558785 0.154597741226 0.174755637165 0.146478461101 0.269216683997 0. 0.253567617568 0. 2.98327563942 0.233736190464 0.351757273558 0.139263081868 0.239430381403 0.0208928742124 0.222252319178 0.0175789101065 0.810861806823 0.279608431283 0.179458188958 0.195866758858 2.6854820791 0.398053984532 0.89809834227 0.247935202602
-0. 0.350679119366 0.171770055102 0.104925151245 0.27569187295 6.94829024374 0.334803148398 0.67706013313 0.193350480379 0.412581822479 0.0992653935902 0. 0.10635427699 0.699016591819 0.0539186926384 0.138446373546 0.153056250509 0.713312843099 0.0600509965939 0.255963010535 0.977892604151 14.4889648601 0.9706502979 0.881312161472 0.0346182115187 0.64545890404 0.134577713879 0.290715313336 0. 2.39103151387 0.273437271363 0.464611330894 0.246713626684 0.40332369024 0. 0.145163680564 0.372829638364 5.88638743233 0.226345198689 0.660313641705 0.190871514078 0.468824543611 0. 0.342786925459 0.0289876816848 0.926564298096 0.264713948349 0.168913634851 0.247713670257 4.30894205465 0.435130299606 0.538207204466 4.09158908846
-0.0852410654989 0.0511030057169 0.509274844394 0.0373529090687 0.702993747187 0.420627472897 5.42647743174 0.131536971718 0.0544918473889 0.0128070613042 0.524612151038 0.126370441821 0.153615064327 0.18902932533 0.51889155516 0.0343168562204 0.177500342967 0. 0.829123397045 0.142488350733 1.72654391503 0.629020310446 11.7406994673 0.890649274227 0.0675687379755 0.11742638392 1.01918916916 0.169065502496 0.563238316532 0.404080301794 1.757981046 0.033475292508 0.116203786627 0. 0.327480025776 0.0230249387485 0.594810129652 0.230254744366 5.0646899971 0.418798741428 0.104334665716 0.104697825563 0.407467483724 0.0406246231031 0.348189622419 0.21390374221 0.705834513063 0.0642328453938 0.553054947903 0.513442901514 4.26222018466 0.208573091283 10.5015585013 4.79812930239
-0.016450712606 0.216977814459 0.196903475283 0.251042590329 0.381360395441 0.413738227705 0.369887142101 4.88259977716 0.188049445316 0.176146965588 0.0503173213445 0.269668758345 0.0782349657847 0.280488056823 0.120251545162 0.618000796657 0.126134853645 0.401182869233 0.114756316467 0.597468154008 0.532005117974 1.72633341664 0.896161496941 12.3577660392 0.126652444404 0.183007805123 0.0120862345708 0.810724156403 0.546614503908 0.381149400912 0.262332528854 1.85559847553 0. 0.149062776866 0.0200114447219 0.530378592208 0.310737212864 0.615825997783 0.409391933973 5.39308092496 0.200657743084 0.0952515324537 0. 0.521862066811 0.0957681689554 0.441655874781 0.173274569629 0.711991153156 0.264993223104 0.150780925398 0.398721418433 3.85456065949 4.25450384849 13.2346289613 6.0736547061
-0.440603456097 0.175073392063 0.119622864329 0. 0.241873704132 0.0710770145015 0.0666045777945 0.13396754322 4.24467760612 0.219451207928 0.47068741368 0.159446593493 0.26107084768 0. 0.101681207607 0.0920335638825 1.24654760408 0.189595106863 0.221227691285 0.169635541932 0.565777108883 0.24512236772 0.122082481977 0.106034887959 10.4509269008 0.388387008742 1.12670684035 0.421873919179 0.887638019557 0.230073415723 0.215867259065 0.141579391234 0.747688670763 0.322956986932 0.151769782551 0.145090356887 0.19983239471 0. 0.138068910759 0.162894030212 4.12944027014 0.222269703418 0.334749332402 0.304982463476 0.380209684032 0. 0.0599817853084 0. 5.64715544394 0.843531318989 1.49518330985 0.696491513928 2.82691991286 0.272897891241 0.647969513561 0.270271138196
-0.0368326690502 0.516163584717 0.0402954019228 0.182113461448 0.0267329337356 0.295453650877 0. 0.0391106979068 0.346195590601 3.90722002563 0.251453752135 0.499977068872 0.0438768001794 0.3121885514 0. 0.0101561918638 0.194163815105 1.35154136626 0.256764960023 0.351956461653 0.170903537116 0.571102158636 0.106497372506 0.146134689188 0.650963876986 8.25974889116 0.620138351612 1.28022944042 0.122665881254 0.902940935388 0.0514628555172 0.223518006413 0.0584356644606 0.677203763896 0.159679451097 0.12007911109 0.00334815605962 0.3959196116 0.174551188289 0.159757167432 0.400908679613 3.8883577563 0.339738184481 0.655622431939 0.0665622505526 0.301088437109 0.0532895087776 0.074214780687 0.467362675757 7.53716823196 0.459313777385 0.972487425198 0.169797309845 3.67327701095 0.226350163374 0.743267916615 2.90494533079
-0.171217381999 0.0497713256843 0.703690916737 0.00377987735703 0.0210415170442 0.0860663292958 0.467325777053 0.128714715206 0.496303416213 0.423708568916 5.52927750422 0.209280636062 0.0873057422167 0. 0.259365039118 0.0275367980795 0.383471027046 0.204822857403 1.80740883282 0.200378182483 0.40275582395 0. 0.892186378848 0.0663342198387 1.69920321307 0.698565335305 14.5160708517 0.633401751827 0.234001345722 0.147947342925 0.935226991803 0.0778740557829 0.250771561241 0.0176325172834 0.747036852503 0.101064900471 0.139891600514 0.0267744784649 0.156853529895 0. 1.03113066727 0.393691514117 6.82845384705 0.361457674159 0. 0.0227540771818 0.432779186274 0.121581588911 1.00417952833 0.528467331925 10.1998063449 0.70292632121 0.575173027014 0.53026533446 3.85919571034 0.583793843694 7.55826014247 3.99957544825
-0.11046481743 0.259409163754 0.0640200209963 0.387824432047 0. 0.116530780141 0. 0.269206680089 0.396274595634 0.501678979087 0.285561984975 3.75701797435 0.0203002997396 0.117638129845 0. 0.276900338114 0.209721834182 0.425937609857 0.160289713534 1.42478289884 0.0133090770313 0.356482366509 0.0707080376994 0.809766978853 0.717499678142 1.05863963611 0.545701151656 8.66185832183 0.108602644392 0.230637865059 0.207292284638 0.538602837775 0.105996038363 0.180389920988 0.186551695414 0.654473921306 0.0307507719021 0.155170777697 0.0354792755932 0.326333864235 0.281965140344 0.534045303356 0.36860222882 4.52696158832 0.0512746128742 0.109908902216 0.031024119875 0.337401611895 0.399978877574 1.62914608647 0.776194566993 6.37590575281 0.26209124539 0.628104114236 0.229319936808 3.77378987738 2.82365702231 7.35426366874 3.24606543855
-0.28348427334 0.0699109092497 0.0115243665938 0.0247539692896 0.417015450631 0.135875392068 0.268295082193 0.145629497336 0.260780495373 0. 0. 0. 3.10401749226 0.233910519211 0.50550031745 0.274249624795 0.502928793045 0. 0.30256369977 0.102945787798 0.992034505912 0.241353238048 0.198457172634 0.154684893909 0.573358343749 0. 0.227077915261 0. 7.45434830156 0.424948012815 0.712630951997 0.524185596935 0.361367267025 0.0744190424464 0.112792427081 0.0734282242981 0.484091834767 0.111218952303 0.150743797934 0.0021339917222 0.293650150546 0. 0.02116599467 0. 3.38903656196 0.112898399837 0.478710281107 0.129217440647 3.21303018321 0.333544983719 0.784623002124 0.447344524196 5.70524160401 0.749006476972 0.94290384194 0.635394355901 2.6809463432 0.190350416362 0.506824958659 0.311522768636
-0.0441271017621 0.295578059389 0.00538296576352 0.110839307911 0.0967261383251 0.879962963336 0.239929977946 0.130401327035 0. 0.340950951096 0. 0.137440936288 0.346025987669 3.47636446237 0.278642779927 0.470025718811 0.112692964798 0.619099122427 0.00242780561576 0.173907015881 0.201742176005 0.999189599873 0.219477527941 0.921815929995 0.131841137033 0.676395318803 0. 0.194240135011 0.609370026677 9.57208990388 0.584905018757 0.898643131352 0.0236332695617 0.208932252302 0.217701165002 0.178589346395 0.0707708189865 0.75565077833 0. 0.0793080592395 0.179063482307 0.379112828132 0.176743685886 0.103537317554 0.461838184221 3.38109025265 0.227764370549 0.711382935742 0.33354958253 4.06165867022 0.524877361639 0.658211390383 0.735233306573 9.7497109579 0.731821772009 1.73956580152 0.265634075375 3.47770284375 0.463685252076 0.662645060954 2.65607159046
-0.0683387462584 0.0219629130994 0.277538132256 0.0218956105837 0.206201631706 0.0684822381157 0.407023501116 0.0451269026509 0.123393342911 0.072966956579 0.247768523847 0.0483266332068 0.606740463055 0.29820535935 2.6061321606 0.175109875588 0.144201033078 0.0824589690667 0.503437283862 0.0753138053082 0.392349366718 0.255603880722 1.52451708358 0.172409143922 0.189011576962 0.0325607363443 0.588467389971 0.0933720092444 1.2780171571 0.690762189525 7.24187169913 0.644942406325 0.0762203715741 0.045675693536 0.286183717598 0.0152119119626 0.180745081545 0.0659332293219 0.690175236215 0.126163675168 0.128302974079 0. 0.318741829473 0.0326199410537 0.498619723618 0.187967114517 2.82346513173 0.227608501656 0.505109007998 0.258054431799 3.92125357864 0.364902097321 1.24245726327 0.602397752765 8.63586700945 0.759728453173 0.583845430492 0.20994437703 3.64889395544 0.242635624424 4.90403632008 3.05311621448
-0.0306716260713 0.0814321197009 0.0263314010054 0.272678801329 0.106013680564 0.129532610405 0.0907157735716 0.532493488287 0.0109148306893 0. 0.162164771732 0.265180903915 0.392021613007 0.447741723488 0.282872330359 2.08107153488 0.0784322946977 0.148287907702 0.0731834628584 0.480938701331 0.194862987879 0.41943849415 0.136885175806 1.07543696247 0.0733045890116 0.170090519611 0.152154070687 0.575338518819 0.651042513614 0.990533484602 0.402752307023 5.51178277187 0.0423383577472 0.114394597746 0.0322564050447 0.290883488614 0.0176772594012 0.130997979349 0.0554591676 0.600771271188 0. 0.0290669346423 0.130598018554 0.373034762049 0.33093489787 0.412308156247 0.201480408382 2.63346193838 0.288284729936 0.743880049931 0.285467677785 2.4778577813 0.413816264532 1.08713768724 0.625062767287 5.87760116803 0.261761111281 0.472862376536 0.281657222631 2.33927651605 2.25924727523 6.49703836519 2.52893187835
-
-0.0436588705204 0.0180416592111 0.0172705049816 0.0313059619256 0.0204318574391 0.00866565654901 0.00855826696922 0.0141519128344 0.0142075650725 0.0143506931474 0.00948176289506 0.0144385885967 0.0225118414231 0.0129557312092 0.0174966181456 0.0312026568728 0.0239028750731 0.014100885263 0.0142807205131 0.0174958592717 0.0150062262476 0.00953963818715 0.00766268420971 0.00948917307515 0.0109028479501 0.00974640899548 0.00766468852951 0.00853983079827 0.00982133662971 0.0113346471791 0.0146598494319 0.0173023151885 0.0185232762774 0.00942946755785 0.0112331321758 0.0129178678673 0.0182808830371 0.0124702528141 0.00976065350432 0.0142632664142 0.0110575600113 0.0125490239213 0.00953313419174 0.00870953731425 0.0110807056641 0.00941450435082 0.014224693302 0.0178827153121 0.0237376950165 0.0107759910236 0.00965035342006 0.0224624342706 0.015863351958 0.0110733401237 0.0109487196432 0.0142092703067 0.0157160768607 0.0182943776 0.015043406603 0.0204114839078 0.0240554444316 0.0186483208344 0.0239797623875 0.0436191635614
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/23flies.nh b/PhyloCSF_Parameters/23flies.nh
deleted file mode 100644
index 31aa0bf..0000000
--- a/PhyloCSF_Parameters/23flies.nh
+++ /dev/null
@@ -1,67 +0,0 @@
-(
- (
- (
- (
- (
- (
- (
- (
- (
- (
- (
- (
- (
- dmel:0.0542029,
- (
- dsim:0.0213103,
- dsec:0.0227973
- ):0.0242621
- ):0.0585014,
- (
- dyak:0.0889658,
- dere:0.0771526
- ):0.0254381
- ):0.181996,
- (
- dbia:0.126739,
- dsuz:0.0934222
- ):0.0964756
- ):0.0125386,
- (
- dana:0.132676,
- dbip:0.134892
- ):0.531515
- ):0.00264138,
- deug:0.318569
- ):0.0369765,
- dele:0.207426
- ):0.0025605,
- dkik:0.485329
- ):0.00243957,
- dtak:0.226746
- ):0.0143511,
- drho:0.195624
- ):0.0495906,
- dfic:0.257704
- ):0.290027,
- (
- (
- dpse:0.0138526,
- dper:0.014979
- ):0.00969914,
- dmir:0.0172853
- ):0.398344
- ):0.150107,
- dwil:0.550935
- ):0.0418275,
- (
- (
- (
- dvir:0.242786,
- dmoj:0.321598
- ):0.090819,
- dalb:0.436249
- ):0.0143777,
- dgri:0.318782
- ):0.162991
-);
\ No newline at end of file
diff --git a/PhyloCSF_Parameters/23flies_coding.ECM b/PhyloCSF_Parameters/23flies_coding.ECM
deleted file mode 100644
index cecefde..0000000
--- a/PhyloCSF_Parameters/23flies_coding.ECM
+++ /dev/null
@@ -1,71 +0,0 @@
-0.704683
-21.246849 0.244381
-1.285623 24.077005 0.379462
-1.686611 0.202683 0.058649 0.202431
-0.082680 1.070070 0.000000 0.054512 17.776808
-0.022382 0.018864 0.493817 0.109334 33.264571 12.649106
-0.296153 0.284082 0.091160 1.987226 28.513525 28.550711 20.106160
-10.110351 0.203943 0.678176 0.704075 2.296469 0.170185 0.005570 0.403661
-0.250353 3.401392 0.072390 0.339075 0.312478 2.535100 0.079470 0.720947 1.718855
-1.957925 0.112645 6.051152 0.559190 0.182778 0.166356 1.106757 0.205481 81.876527 1.176596
-0.430880 0.326925 0.155502 4.087453 0.340486 0.238443 0.091285 4.708209 1.821642 33.026231 0.853084
-0.824682 0.000000 0.050266 0.143753 2.686747 0.222009 0.000000 0.170604 1.175220 0.000000 0.066678 0.188612
-0.038299 0.343243 0.000000 0.005077 0.110613 0.702038 0.136417 0.042543 0.072594 0.404052 0.077817 0.043019 16.344290
-0.110354 0.043260 0.226320 0.082963 0.321872 0.020644 1.037156 0.178174 0.206265 0.047891 0.734665 0.080387 2.288823 0.415881
-0.057554 0.064736 0.036226 0.500428 0.000000 0.033774 0.028629 2.361795 0.096649 0.082891 0.182564 0.481770 26.209477 26.031989 0.948770
-2.592045 0.315567 0.032405 0.267518 0.438032 0.065081 0.072433 0.125092 1.084512 0.001026 0.524214 0.331504 0.231756 0.012267 0.076370 0.022302
-0.129204 0.982385 0.068509 0.286913 0.016097 0.151188 0.000000 0.104314 0.253764 0.097968 0.214733 0.359898 0.000000 0.058085 0.023245 0.048257 1.600227
-0.047628 0.073308 0.650338 0.218750 0.073551 0.009380 0.204879 0.038744 0.000000 0.101242 0.271272 0.000000 0.018086 0.012080 0.130037 0.014327 24.074715 0.919928
-0.285461 0.364317 0.112988 1.623951 0.070481 0.006170 0.115755 0.183985 0.000000 0.343260 0.000000 0.000000 0.111756 0.021344 0.041850 0.065750 2.932725 42.733986 1.508892
-0.270938 0.039912 0.013938 0.032013 2.780905 0.058375 0.000000 0.000000 0.183091 0.010489 0.144223 0.058332 0.230893 0.031971 0.059047 0.005021 2.536950 0.087468 0.198532 0.169817
-0.019126 0.104872 0.006262 0.035012 0.036140 0.657644 0.080323 0.000000 0.052889 0.122373 0.056399 0.052429 0.053126 0.058255 0.004767 0.021207 0.055629 0.495392 0.000000 0.018111 18.674069
-0.006133 0.000000 0.090480 0.033084 0.000000 0.068378 1.038125 0.000000 0.000000 0.025462 0.010633 0.000000 0.000000 0.017659 0.100707 0.014347 0.153132 0.057720 0.931194 0.042816 34.894165 15.319585
-0.103278 0.064757 0.027371 0.212007 0.103688 0.000000 0.000000 4.012458 0.215859 0.051146 0.000000 0.258130 0.069157 0.026748 0.042132 0.290166 0.285958 0.037932 0.100554 1.567318 33.455540 39.586962 22.985732
-0.670331 0.230360 0.179345 0.000000 0.000000 0.014076 0.048084 0.149552 40.665320 0.000000 5.399983 0.426864 0.046003 0.035322 0.020282 0.000000 2.929298 0.000000 0.146174 0.549349 0.794139 0.013745 0.046290 0.042499
-0.107106 0.000000 0.000000 0.240088 0.000000 0.016538 0.016239 0.000000 3.654832 0.571052 4.775858 0.000000 0.016161 0.002643 0.000000 0.030126 0.481656 1.321280 0.000000 0.000000 0.036754 0.228096 0.000000 0.034038 22.455047
-0.217591 0.243264 0.479832 0.000000 0.065015 0.039285 0.016562 0.000000 3.020358 0.000000 44.235882 0.399701 0.005605 0.027004 0.054798 0.000000 0.000000 0.016626 1.930574 0.556805 0.005920 0.023351 0.602760 0.081580 57.679880 22.449621
-0.095245 0.203775 0.030416 0.000000 0.099590 0.000000 0.000000 0.088770 6.398701 0.000000 5.249641 1.040400 0.024524 0.014474 0.001228 0.026026 0.009788 0.000000 0.226711 2.449416 0.024233 0.005492 0.001568 1.018571 40.770596 43.442597 28.753059
-0.194598 0.014181 0.014679 0.017517 0.464018 0.000000 0.000000 0.094073 0.248226 0.000488 0.024767 0.029802 3.372305 0.144326 0.581090 0.267394 1.807368 0.072072 0.125911 0.157946 1.987202 0.000000 0.000000 0.269774 0.721419 0.011610 0.169076 0.040987
-0.041530 0.063324 0.000000 0.011465 0.000000 0.181868 0.000000 0.000000 0.058036 0.068771 0.061094 0.022512 0.384783 1.736442 0.132669 0.023532 0.011758 0.648055 0.066903 0.042106 0.006409 0.601218 0.000000 0.006766 0.093949 0.306244 0.061756 0.028850 20.388500
-0.000000 0.000000 0.057012 0.000050 0.000000 0.000000 0.128166 0.000000 0.000000 0.007620 0.079417 0.000000 0.287108 0.033420 1.034159 0.205855 0.196980 0.025359 0.383712 0.011921 0.015469 0.000000 0.414758 0.000000 0.006948 0.014377 0.330523 0.000000 25.600805 11.352211
-0.087719 0.037648 0.014926 0.151283 0.108849 0.031347 0.000000 0.583867 0.129665 0.033842 0.067070 0.149390 0.368587 0.256987 0.373825 3.469940 0.298492 0.090341 0.099415 1.508596 0.181871 0.044089 0.000000 2.939743 0.092710 0.067523 0.102786 0.980654 32.453450 46.488367 14.452792
-2.220475 0.206816 0.000000 0.306768 0.424399 0.059495 0.046092 0.168806 0.917116 0.045883 0.262000 0.237490 0.131218 0.000000 0.041658 0.219744 2.273189 0.020382 0.068293 0.226478 0.237688 0.028164 0.033532 0.091481 0.000000 0.163597 0.000000 0.000000 0.118703 0.000000 0.098005 0.010956
-0.134573 0.945698 0.045787 0.239222 0.046365 0.128494 0.019130 0.072626 0.121273 0.282269 0.112181 0.108509 0.000000 0.050305 0.008301 0.032545 0.086338 0.138431 0.068381 0.241153 0.023043 0.061316 0.009558 0.035812 0.000000 0.059719 0.000000 0.007459 0.000264 0.027863 0.000000 0.014933 2.104670
-0.000000 0.062002 0.389224 0.134380 0.061847 0.001571 0.142788 0.040878 0.000000 0.067368 0.214914 0.024713 0.050105 0.051619 0.054850 0.000000 0.009271 0.067315 0.695552 0.034531 0.032598 0.006761 0.076182 0.022477 0.090016 0.000000 0.200545 0.050623 0.016092 0.019950 0.000000 0.029435 19.494910 1.170712
-0.192727 0.128593 0.070927 1.485716 0.050393 0.024840 0.038926 0.260893 0.056113 0.080932 0.025865 0.334860 0.059904 0.006229 0.011429 0.043097 0.149364 0.135828 0.082484 0.262390 0.031524 0.019769 0.014847 0.125841 0.060782 0.000000 0.049055 0.071553 0.010314 0.001004 0.000000 0.064772 2.933105 22.652339 1.384367
-0.469875 0.107525 0.051468 0.098070 9.194789 0.080476 0.066506 0.264016 0.657393 0.087269 0.013012 0.130337 0.744951 0.000000 0.165162 0.054878 0.437168 0.031482 0.085032 0.023888 3.571811 0.114918 0.089254 0.279537 0.163468 0.051393 0.000000 0.000000 0.326801 0.073170 0.006912 0.000000 1.603015 0.118923 0.132484 0.107812
-0.019292 0.175173 0.013241 0.100593 0.000000 1.603038 0.046060 0.059925 0.031717 0.355865 0.117265 0.083129 0.000000 0.243049 0.029300 0.000000 0.033522 0.021505 0.016014 0.069034 0.000342 0.782419 0.085492 0.045462 0.000000 0.006461 0.045161 0.024729 0.000000 0.139720 0.005215 0.026429 0.095703 0.317319 0.039260 0.029366 12.576617
-0.091539 0.120620 0.155170 0.002362 0.000000 0.135595 4.055080 0.238262 0.000000 0.069614 0.278643 0.023336 0.363518 0.000000 0.326058 0.000000 0.149248 0.086708 0.217166 0.000000 0.073249 0.140854 1.699912 0.218157 0.000000 0.027685 0.108983 0.058702 0.032554 0.000000 0.133389 0.029813 0.233478 0.103428 0.690950 0.039666 31.441594 9.948192
-0.063615 0.110006 0.045285 0.330163 0.361179 0.000000 0.000000 5.789920 0.178264 0.112170 0.000000 0.625745 0.000000 0.000000 0.082603 0.531462 0.031583 0.040361 0.042601 0.086254 0.297269 0.000000 0.000000 3.559143 0.125367 0.018479 0.000000 0.035706 0.174922 0.000000 0.000000 0.531992 0.232086 0.081087 0.086226 0.623109 22.274226 21.166886 16.358880
-0.233107 0.000000 0.070302 0.444077 0.342175 0.138937 0.000000 0.181981 2.742144 0.067924 0.000000 0.316865 0.239106 0.000000 0.031947 0.055378 0.155724 0.000000 0.049867 0.465401 0.154256 0.036162 0.003766 0.123528 0.676685 0.010137 0.000000 0.000000 0.082238 0.005285 0.002813 0.024818 1.330657 0.000000 0.012196 0.203719 3.204597 0.000000 0.370033 0.216610
-0.062751 0.633127 0.000000 0.000000 0.089182 0.095239 0.132365 0.021210 0.340553 2.258760 0.000000 0.047059 0.000000 0.132867 0.007246 0.000000 0.046733 0.264003 0.001925 0.000000 0.038797 0.065982 0.031012 0.015676 0.193117 0.214336 0.000000 0.000000 0.000136 0.044270 0.005193 0.002390 0.080784 0.740933 0.000000 0.000000 0.000000 1.090606 0.000000 0.131509 16.355966
-0.177147 0.000000 0.372676 0.463084 0.347318 0.147341 0.358777 0.096225 0.000000 0.332847 4.828983 0.555991 0.229884 0.000000 0.227954 0.059194 0.148002 0.000000 0.352444 0.383594 0.135507 0.090852 0.230341 0.000000 0.245232 0.000000 0.986063 0.000000 0.041554 0.017631 0.076875 0.049689 0.516505 0.205064 1.725241 0.379256 0.208024 0.091212 4.640254 0.455890 48.461943 21.940299
-0.137940 0.146398 0.000000 0.545248 0.000000 0.063170 0.067905 0.469713 0.000000 0.113267 0.789388 3.945789 0.000260 0.000000 0.019907 0.107056 0.092126 0.073370 0.000000 0.089538 0.032421 0.023650 0.020328 0.293293 0.000000 0.000000 0.234129 1.084429 0.001631 0.008024 0.000000 0.107047 0.129782 0.066626 0.025694 0.896088 0.397240 0.046041 0.000000 2.574020 23.330898 29.938406 30.377789
-0.484279 0.022572 0.033412 0.079042 1.757453 0.122791 0.143024 0.355543 0.544421 0.049494 0.118079 0.104815 10.484896 0.322883 0.543932 0.974207 0.296487 0.025782 0.050101 0.057919 0.680284 0.056120 0.025735 0.045656 0.175262 0.017153 0.000000 0.000000 3.328981 0.000000 0.000000 1.662731 1.384547 0.055413 0.068152 0.089770 5.647599 0.000000 0.532778 0.732707 1.282864 0.000000 0.581676 0.100075
-0.042215 0.123904 0.001643 0.063633 0.097200 0.673142 0.018895 0.210397 0.077771 0.218275 0.067555 0.112123 0.836738 4.381956 0.079997 0.272743 0.037956 0.062051 0.000732 0.046146 0.033691 0.166194 0.047069 0.058309 0.007090 0.034249 0.022080 0.010480 0.193181 1.197265 0.049026 0.224340 0.067297 0.297595 0.005332 0.038379 0.383849 1.946621 0.275556 0.289375 0.123584 0.441522 0.148201 0.035246 21.262573
-0.000000 0.011278 0.061097 0.000000 0.123920 0.000000 0.465062 0.035154 0.011947 0.020248 0.152795 0.005040 0.669656 0.278413 0.981454 0.255805 0.025804 0.009769 0.084479 0.006607 0.029813 0.011802 0.138968 0.041149 0.003847 0.000000 0.052776 0.000000 0.142640 0.091682 0.637297 0.000000 0.022770 0.018267 0.249278 0.000042 0.269390 0.003167 1.786243 0.000000 0.000000 0.010239 1.090026 0.000000 32.810401 13.606975
-0.100789 0.052347 0.021978 0.252944 0.245654 0.141640 0.000000 1.708761 0.135939 0.091693 0.079072 0.338624 0.875229 0.153260 0.219435 7.372884 0.077527 0.028807 0.013221 0.131361 0.120042 0.017497 0.000000 0.697589 0.005673 0.005004 0.003311 0.098324 0.000000 0.224434 0.006010 2.528101 0.259394 0.034249 0.021170 0.515197 0.692663 0.063161 0.060058 4.904895 0.168292 0.000000 0.198919 1.100055 30.347230 35.111427 17.921575
-2.859059 0.134689 0.000000 0.259700 0.436002 0.000000 0.000000 0.052899 1.662989 0.045373 0.727256 0.057128 0.463000 0.000000 0.032161 0.063939 4.519148 0.270807 0.000000 0.401340 0.752023 0.000000 0.002277 0.140723 0.897880 0.000000 0.368486 0.000000 0.498935 0.000000 0.000000 0.061340 1.908136 0.106462 0.000000 0.165930 0.388644 0.000000 0.000000 0.004034 0.357271 0.017497 0.262317 0.010912 0.512636 0.042889 0.000000 0.071997
-0.058731 0.190380 0.007881 0.070698 0.009489 0.054984 0.000000 0.028056 0.006290 0.054618 0.000000 0.043591 0.000000 0.070675 0.014004 0.003798 0.098959 0.888731 0.023085 0.397500 0.014320 0.032681 0.000000 0.015270 0.052803 0.016365 0.056956 0.069776 0.027075 0.135569 0.000000 0.054656 0.000000 0.000000 0.037560 0.112678 0.014675 0.007542 0.033942 0.019395 0.000000 0.132405 0.000000 0.018492 0.021457 0.061452 0.009759 0.026933 0.534376
-0.292409 0.135199 0.761955 0.144129 0.089295 0.002520 0.188467 0.062967 0.000000 0.043743 0.150133 0.095202 0.072349 0.069024 0.117114 0.038547 0.370670 0.281397 1.981203 0.327188 0.173247 0.000000 0.352243 0.141961 0.006541 0.241639 0.652460 0.169076 0.046313 0.000000 0.066860 0.105993 0.189375 0.130901 0.591624 0.119817 0.080836 0.000000 0.246418 0.025046 0.022972 0.012897 0.770402 0.057972 0.085206 0.000000 0.103121 0.035498 347.458068 0.372023
-0.063294 0.130152 0.040262 0.472048 0.021568 0.007626 0.034463 0.128569 0.120281 0.050118 0.099176 0.122073 0.064992 0.000000 0.035590 0.169451 0.156755 0.527105 0.075861 1.863747 0.007656 0.009861 0.014984 0.190019 0.000000 0.086588 0.000000 0.107535 0.036482 0.000000 0.080036 0.334040 0.174902 0.220447 0.000000 0.090832 0.003732 0.034539 0.000000 0.060005 0.236962 0.000000 0.177069 0.071601 0.050255 0.044863 0.006514 0.154126 1.525730 42.329209 1.047081
-0.369397 0.074624 0.024092 0.078207 6.681391 0.168156 0.581769 1.190500 0.454593 0.234727 0.026094 0.221380 0.512749 0.056937 0.095297 0.000000 0.649482 0.040726 0.089689 0.102655 5.326834 0.000000 0.287479 1.296893 0.320151 0.020388 0.000000 0.000000 0.000000 0.353876 0.000000 0.000000 0.315342 0.056518 0.043658 0.053422 6.166184 0.314975 0.827853 0.316700 0.331875 0.048140 0.402466 0.070427 0.936756 0.000000 0.000000 0.351024 2.906935 0.053119 0.350418 0.060454
-0.028373 0.220302 0.005778 0.049372 0.261660 2.020079 0.098951 0.106332 0.042055 0.736011 0.074320 0.183924 0.021895 0.123166 0.008584 0.034243 0.052249 0.149697 0.010620 0.032827 0.082245 1.374991 0.015789 0.389454 0.000577 0.050391 0.037388 0.015066 0.128749 0.095160 0.000000 0.118050 0.044102 0.108573 0.009504 0.021825 0.370284 1.945901 0.220449 0.292645 0.084001 0.166172 0.069029 0.045738 0.041522 0.210436 0.007611 0.000000 0.124620 0.220369 0.005267 0.020198 18.950349
-0.008318 0.016298 0.077147 0.055879 0.494118 0.150502 3.024822 0.000000 0.000000 0.120866 0.154335 0.155165 0.002249 0.011156 0.147259 0.062931 0.094414 0.013077 0.179421 0.041454 0.170670 0.000000 1.485354 0.000000 0.000000 0.007951 0.125300 0.014506 0.232574 0.000000 0.088074 0.104030 0.038831 0.012324 0.066711 0.023157 0.497341 0.133397 2.898036 0.195153 0.014152 0.064431 0.301537 0.016176 0.007430 0.070364 0.106274 0.000000 0.000000 0.000000 0.938944 0.016739 38.933632 16.731807
-0.130055 0.148689 0.034097 0.398366 0.651783 0.348774 0.286709 8.459715 0.285617 0.380305 0.000000 1.217497 0.121462 0.037780 0.057141 0.337459 0.145853 0.089394 0.055501 0.380714 0.664995 0.379499 0.035124 7.126025 0.064679 0.018897 0.020877 0.253161 0.000000 0.179264 0.000000 0.619382 0.131765 0.072252 0.041487 0.228965 0.645519 0.501063 0.642293 6.085236 0.134379 0.045373 0.263552 0.527250 0.055180 0.039711 0.000000 0.849429 0.545823 0.030315 0.353142 0.970124 33.768017 38.728493 23.190402
-0.727363 0.109400 0.024683 0.098209 0.542926 0.000000 0.068441 0.057398 5.338506 0.242049 0.713601 0.373930 0.246841 0.036450 0.075766 0.093416 1.312131 0.221806 0.089761 0.186343 0.930333 0.000000 0.073225 0.139443 6.391422 0.000000 0.276197 0.000000 0.380180 0.000000 0.000000 0.075234 0.594581 0.106641 0.021648 0.086134 0.495116 0.000000 0.048479 0.010205 2.238835 0.000000 0.694438 0.149376 0.547589 0.000000 0.044953 0.049102 307.938100 0.238698 65.024561 0.461351 3.484450 0.000000 0.189228 0.444197
-0.000000 0.000000 0.005646 0.229902 0.023799 0.129363 0.022142 0.037768 0.114464 1.016550 0.110671 0.000000 0.016143 0.084965 0.011166 0.003837 0.007202 0.101959 0.015510 0.054105 0.011181 0.057794 0.008794 0.001388 0.001336 0.497595 0.000000 0.000000 0.015620 0.119917 0.000000 0.028796 0.000000 0.068854 0.004663 0.000000 0.031677 0.120479 0.036966 0.015746 0.052443 0.391626 0.114670 0.000000 0.034366 0.177083 0.012189 0.031733 0.212685 0.386708 0.118160 0.062207 0.128217 0.635647 0.039912 0.157119 1.242350
-0.033079 0.013743 0.023916 0.016385 0.022602 0.002116 0.038342 0.013321 0.122782 0.033580 0.644959 0.040582 0.045594 0.008429 0.069618 0.021172 0.067860 0.030530 0.074203 0.047872 0.034391 0.000000 0.054546 0.019230 0.106788 0.000000 0.739273 0.015430 0.054382 0.000000 0.036286 0.049613 0.022855 0.005969 0.021506 0.004436 0.026344 0.001445 0.047273 0.008809 0.040623 0.003882 0.745195 0.009885 0.034086 0.006438 0.044876 0.021321 0.397382 0.107600 1.928691 0.280394 0.103566 0.009490 0.250330 0.074413 2.862718 0.265466
-0.111417 0.467798 0.000000 0.000000 0.057461 0.031412 0.011231 0.338564 0.079952 0.000000 0.000000 2.438078 0.025277 0.000000 0.031744 0.191138 0.138381 0.075509 0.000000 0.230760 0.022280 0.003378 0.000000 0.287789 0.202719 0.000000 0.136991 1.427628 0.042769 0.013625 0.022037 0.361738 0.097921 0.000000 0.000000 0.147320 0.065418 0.022429 0.000000 0.305805 0.020906 0.016408 0.131390 1.097096 0.071178 0.055718 0.019322 0.354879 0.599622 0.075679 0.390486 1.187259 0.119489 0.043329 0.026499 2.334275 2.443146 67.971059 0.517326
-0.491329 0.033871 0.000000 0.057351 1.230314 0.000000 0.000000 0.335732 0.258455 0.011126 0.114284 0.098918 6.628141 0.418389 0.885928 0.278607 0.068902 0.041204 0.184731 0.053825 1.069373 0.002543 0.000000 0.146038 0.319851 0.000000 0.000000 0.087855 51.867318 4.002421 3.730938 11.967459 0.000130 0.009880 0.122766 0.044492 0.924246 0.000000 0.034304 0.321394 0.216424 0.005500 0.165891 0.012531 4.932338 0.493719 0.309700 0.299789 5.966049 0.282593 0.450167 0.162242 5.984462 0.270723 0.284164 0.639894 4.485779 0.144482 0.253797 0.274695
-0.000000 0.019356 0.016798 0.021995 0.000000 0.069745 0.016072 0.017431 0.000000 0.031154 0.035254 0.010345 0.070605 0.328560 0.082723 0.103825 0.006839 0.077265 0.008479 0.096511 0.003727 0.081266 0.025795 0.000000 0.003408 0.040081 0.029227 0.004186 0.102272 0.978333 0.225794 0.015924 0.251781 0.000000 0.000000 0.012760 0.013899 0.053653 0.025722 0.000953 0.000000 0.062419 0.000000 0.000000 0.052251 0.410263 0.018820 0.000000 0.038666 1.730986 0.046872 0.557497 0.040784 0.419973 0.039164 0.000000 0.111893 0.278697 0.089269 0.057809 0.716509
-0.101984 0.002697 0.040867 0.024331 0.044287 0.016535 0.306444 0.008147 0.039780 0.003442 0.073740 0.031667 0.623710 0.234408 2.262342 0.227478 0.000000 0.000000 0.192142 0.031680 0.061057 0.000000 0.169427 0.076306 0.034997 0.000000 0.144713 0.045551 9.171523 4.940184 21.212916 4.852324 0.000000 0.000845 0.089633 0.010326 0.160730 0.037983 0.303564 0.000000 0.005803 0.009027 0.233859 0.027310 0.873936 0.000000 1.160209 0.449760 0.076063 0.097200 1.100709 0.023047 0.846809 0.000000 0.879353 0.458354 0.374045 0.065264 0.647484 0.104813 42.531854 0.272450
-0.122962 0.036196 0.000000 0.056697 0.073584 0.005514 0.000000 0.235927 0.075866 0.019073 0.000000 0.071920 0.161836 0.118851 0.163445 0.866550 0.079848 0.110451 0.007895 0.155610 0.065113 0.000301 0.000000 0.355667 0.035350 0.011198 0.000000 0.105067 0.356677 0.136367 0.000000 3.304619 0.000000 0.044129 0.170136 0.029021 0.043727 0.015468 0.000000 0.172355 0.070593 0.000000 0.093994 0.082345 0.189117 0.020373 0.023266 1.005651 0.375382 0.551574 0.177836 3.735614 0.216399 0.005424 0.000000 1.602872 0.288834 0.068437 0.291196 0.879621 3.707395 37.967642 1.416108
-
-0.017705 0.025102 0.038323 0.021820 0.011736 0.021070 0.014321 0.010200 0.005516 0.020228 0.006702 0.012128 0.010150 0.022067 0.023461 0.017042 0.016296 0.015657 0.035566 0.010788 0.014202 0.017815 0.015752 0.007369 0.008745 0.017101 0.008331 0.008579 0.008684 0.013803 0.037665 0.009446 0.022330 0.023558 0.041574 0.027731 0.012963 0.032064 0.013706 0.014380 0.017590 0.024788 0.004681 0.012785 0.006619 0.013421 0.027337 0.011342 0.000849 0.018348 0.000712 0.011525 0.008305 0.019496 0.016278 0.007339 0.000540 0.013259 0.009921 0.005825 0.004952 0.021466 0.016774 0.014173
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
diff --git a/PhyloCSF_Parameters/23flies_noncoding.ECM b/PhyloCSF_Parameters/23flies_noncoding.ECM
deleted file mode 100644
index 113490e..0000000
--- a/PhyloCSF_Parameters/23flies_noncoding.ECM
+++ /dev/null
@@ -1,71 +0,0 @@
-2.601764
-5.371564 3.543195
-2.228525 4.751887 2.144120
-2.259368 0.446709 0.528969 0.305919
-0.425539 4.203755 0.315885 0.472428 4.294746
-0.539515 0.087689 3.683795 0.204184 8.409182 3.794250
-0.300953 0.724468 0.360016 2.232992 3.839126 8.919614 3.859389
-5.608456 0.723982 1.815124 0.562503 3.551939 0.453143 0.680907 0.395174
-0.519681 9.969147 0.722491 0.874669 0.297591 5.360563 0.200132 0.698375 5.361866
-1.038558 0.540463 10.533255 0.554739 0.736603 0.309096 3.939220 0.384434 12.203109 5.007271
-0.569012 1.349498 0.778173 4.833659 0.259741 0.721588 0.452134 4.812171 4.809548 8.754198 3.919616
-2.475545 0.407883 0.920713 0.450421 6.018192 0.731251 1.055057 1.016812 3.559324 0.201102 0.572845 0.227164
-0.332400 3.315542 0.272940 0.538351 0.508442 6.994964 0.481002 1.251291 0.371448 3.543863 0.330819 0.620549 2.999636
-0.465798 0.212207 3.019417 0.315170 1.291523 0.475720 8.356594 0.495020 0.629332 0.256428 3.307970 0.396199 6.091033 2.294281
-0.395290 0.530621 0.300509 2.159400 0.444752 0.989907 0.299532 4.833089 0.301792 0.384792 0.274214 2.233042 2.952070 4.567582 2.371345
-2.537838 0.265364 0.619250 0.228247 0.333262 0.019182 0.028284 0.048082 0.761782 0.147941 0.237332 0.101637 0.405712 0.064682 0.136610 0.038210
-0.180853 3.395579 0.240751 0.420291 0.000000 0.550213 0.116313 0.000000 0.255209 0.686030 0.030800 0.309738 0.084052 0.205627 0.125073 0.059029 2.835389
-0.418163 0.257527 3.796286 0.212701 0.250088 0.051044 0.288369 0.032087 0.355297 0.083461 1.251203 0.080906 0.000000 0.052421 0.302709 0.032390 7.520830 4.533323
-0.323260 0.625461 0.200982 2.375716 0.038590 0.145281 0.000000 0.397393 0.138558 0.287319 0.229586 0.518443 0.089044 0.161537 0.051860 0.316217 2.598327 6.720047 3.203515
-0.298643 0.144420 0.090080 0.030805 3.143189 0.419743 0.686280 0.257317 0.549064 0.027381 0.014863 0.089086 0.633826 0.038900 0.249634 0.061265 3.570739 0.538877 1.126035 0.246850
-0.150898 0.327010 0.000000 0.077290 0.435934 7.715268 0.252689 0.618272 0.000000 0.568054 0.339822 0.096548 0.000000 0.644953 0.191054 0.184063 0.269722 5.001129 0.592423 0.822916 6.905759
-0.166798 0.105621 0.238045 0.000000 0.376857 0.411835 5.824799 0.161156 0.055213 0.015132 0.157083 0.161035 0.250717 0.022639 0.482721 0.047397 0.502488 0.548443 5.350243 0.208878 15.760407 6.222900
-0.156969 0.105274 0.000000 0.274437 0.457231 1.041763 0.123402 3.910557 0.036560 0.156766 0.078551 0.393534 0.000000 0.274165 0.235918 0.555029 0.203042 0.545134 0.467007 3.294009 5.388919 19.523039 6.551734
-0.619827 0.008405 0.000000 0.026078 0.200716 0.180761 0.137833 0.090334 5.478498 0.332423 0.801353 0.236696 0.256294 0.039021 0.168804 0.009535 8.846311 0.663707 1.813567 0.468653 3.768640 0.364336 0.679333 0.531909
-0.030355 0.363879 0.093984 0.159208 0.072346 0.133369 0.000000 0.000000 0.194957 4.201457 0.314183 0.496070 0.004906 0.210483 0.000000 0.081339 0.597165 10.436439 0.887898 0.915306 0.023824 4.709414 0.376669 0.818878 4.849630
-0.081763 0.021776 0.845303 0.049470 0.159582 0.033683 0.408199 0.162264 0.741804 0.277220 6.558430 0.160911 0.000000 0.073730 0.208241 0.000000 1.305791 0.552696 13.862535 0.479726 0.726611 0.623501 5.502429 0.141505 12.161083 6.169591
-0.089828 0.179816 0.202436 0.298585 0.063021 0.301649 0.000000 0.448382 0.107339 0.493931 0.125674 3.865954 0.081707 0.192678 0.000000 0.205618 0.322922 1.335129 0.843032 8.353419 0.460001 0.480086 0.416980 3.940683 5.115753 11.949063 5.823031
-0.376337 0.017277 0.351610 0.084528 0.795067 0.254141 0.269713 0.178817 0.348072 0.000000 0.421144 0.054545 3.768430 0.369239 0.556171 0.374934 3.468226 0.240114 0.710215 0.389895 9.449287 1.059654 1.588288 1.112749 3.280203 0.119310 1.020226 0.396886
-0.026712 0.334533 0.152899 0.068203 0.126086 0.521896 0.285383 0.449907 0.058720 0.483207 0.296040 0.108356 0.197247 3.635456 0.240431 0.433202 0.228583 5.503828 0.592082 0.540483 0.921313 16.880444 0.749070 1.828049 0.365739 6.589636 0.573144 0.758322 5.226270
-0.133797 0.023152 0.293286 0.032464 0.155817 0.122195 0.846251 0.079564 0.013570 0.073967 0.467264 0.028818 0.501867 0.197761 3.206049 0.211305 0.527745 0.322195 5.486183 0.304329 1.700719 0.891706 13.835580 1.249022 0.564950 0.467363 5.345337 0.289211 10.098627 5.577783
-0.000176 0.121670 0.268158 0.301608 0.075802 0.416462 0.207420 0.772697 0.221044 0.025585 0.000000 0.364748 0.541893 0.555350 0.208302 2.142846 0.262543 0.483365 0.296216 3.011180 0.700939 1.208349 0.831779 10.503339 0.438770 0.604402 0.240417 3.691809 4.135103 12.330823 3.796772
-6.611485 0.649387 1.056040 0.500083 0.706847 0.065476 0.051755 0.149975 1.728769 0.197157 1.005486 0.181808 0.631623 0.205861 0.210231 0.147443 3.098716 0.301548 0.554122 0.263890 0.507405 0.169642 0.006798 0.000000 0.610121 0.000000 0.279869 0.188102 0.475964 0.106994 0.019875 0.000000
-0.415143 6.799075 0.419090 0.691917 0.174198 1.002565 0.195976 0.481467 0.347364 1.679722 0.185943 0.246229 0.034017 0.536292 0.000000 0.115921 0.157467 2.942636 0.218084 0.521503 0.000000 0.502702 0.000000 0.187815 0.156793 0.623639 0.149539 0.000000 0.123432 0.515201 0.129910 0.119820 2.955831
-1.025821 0.533429 12.322458 0.432603 0.341524 0.228573 0.762858 0.111933 0.383740 0.447694 1.816522 0.466690 0.575339 0.079632 0.530693 0.069011 0.612797 0.460474 5.575999 0.238608 0.076378 0.067289 0.568361 0.300319 0.318170 0.120105 0.738358 0.278907 0.000000 0.000000 0.597858 0.144006 9.086880 5.224291
-0.450964 1.101401 0.553875 4.568749 0.141115 0.342361 0.194934 0.615139 0.369330 0.422756 0.273304 1.259092 0.183814 0.170317 0.169329 0.537619 0.209342 0.451539 0.197240 2.285531 0.019773 0.149005 0.076151 0.331914 0.170005 0.107837 0.018809 0.481246 0.087187 0.082929 0.054869 0.272052 3.148738 7.167925 3.637783
-0.465640 0.068101 0.277043 0.083582 7.582138 0.550515 1.357393 0.436401 0.730666 0.180385 0.187217 0.120669 0.915349 0.187823 0.426599 0.136359 0.232855 0.116062 0.000000 0.000000 4.416962 0.278988 0.638519 0.143258 0.251600 0.182628 0.044545 0.000000 0.468944 0.176863 0.270775 0.061454 3.264091 0.247321 0.821773 0.229908
-0.035466 0.646976 0.135296 0.047784 0.530250 13.673219 0.617684 1.078816 0.147630 0.940462 0.112286 0.121187 0.281210 0.954679 0.112468 0.234466 0.000000 0.279482 0.061965 0.069113 0.386477 6.447309 0.375529 0.835813 0.112045 0.252097 0.022056 0.273154 0.178765 0.752277 0.092479 0.193351 0.414566 4.764226 0.480976 0.603083 4.062558
-0.095979 0.149978 0.603155 0.082649 1.082918 0.454140 11.941643 0.499631 0.261288 0.114020 0.825272 0.000000 0.277972 0.104824 0.908298 0.162585 0.000000 0.051826 0.462169 0.000000 0.674227 0.286072 6.169792 0.312947 0.069275 0.128378 0.380077 0.000000 0.413247 0.120746 0.894357 0.090301 0.640244 0.369630 6.581180 0.203613 8.726236 3.685595
-0.077156 0.313010 0.027292 0.386508 0.526307 1.241210 0.499045 8.741992 0.169379 0.122133 0.159614 0.709891 0.253673 0.423451 0.293366 0.874117 0.062160 0.048808 0.072648 0.239746 0.350734 0.460539 0.272908 4.997475 0.022032 0.121911 0.019492 0.195206 0.142674 0.459924 0.083387 0.718093 0.289053 0.719384 0.481258 3.537789 4.064001 11.017069 4.188293
-1.076127 0.265404 0.465049 0.137081 0.539963 0.156196 0.135150 0.103502 13.430271 0.582730 1.138367 0.597763 0.566578 0.190008 0.374294 0.079201 0.609867 0.389308 0.304154 0.051893 0.571627 0.000000 0.229765 0.003016 4.551240 0.074387 1.027400 0.172478 0.224739 0.030170 0.000000 0.234570 10.155599 0.771612 2.623992 0.694069 3.601918 0.490717 0.747230 0.476901
-0.156884 1.235087 0.193290 0.232039 0.075719 1.024212 0.278858 0.114512 0.540461 11.016911 0.834320 1.081525 0.025680 0.606111 0.074592 0.045898 0.064851 0.640352 0.090033 0.115144 0.006349 0.392555 0.031757 0.116298 0.316063 3.687805 0.372391 0.620580 0.052731 0.479054 0.062138 0.140789 0.609534 11.753022 0.759866 0.957306 0.355935 7.316049 0.248728 0.940240 5.689819
-0.522198 0.254479 1.199653 0.185293 0.394990 0.185667 0.479915 0.109370 1.621623 0.462885 19.575018 0.605486 0.054925 0.148097 0.815098 0.076164 0.290931 0.153021 0.894128 0.195593 0.000000 0.256035 0.611042 0.360177 0.666899 0.285130 6.217471 0.250806 0.018460 0.062926 0.595156 0.000000 0.981781 0.554080 16.899756 0.642442 0.540401 0.406559 4.711341 0.554389 15.091587 6.442054
-0.173494 0.401790 0.435215 0.991164 0.094521 0.000000 0.295235 0.720753 0.449916 1.272335 1.053914 8.932368 0.234371 0.348855 0.155685 0.472388 0.054565 0.312400 0.125422 0.493248 0.158014 0.196232 0.029566 0.293040 0.234852 0.452256 0.418576 3.812129 0.066599 0.231259 0.046371 0.323169 0.895056 1.410351 0.495426 7.024087 0.317954 1.021352 0.149826 5.391906 6.227780 13.709101 7.749267
-0.853776 0.044229 0.360815 0.103119 1.603678 0.445582 0.267440 0.326604 0.153674 0.060092 0.721206 0.259240 8.208100 0.746590 1.207732 0.690180 0.290566 0.022551 0.108170 0.096963 0.545196 0.115187 0.000000 0.361166 0.514650 0.044496 0.000000 0.000000 5.625716 0.191011 0.501467 0.185422 3.504580 0.352445 0.409781 0.512891 7.315077 0.716469 1.134478 0.925868 3.689554 0.361277 1.325239 0.047692
-0.005487 0.470064 0.128175 0.111230 0.199433 1.406214 0.000000 0.247649 0.202561 0.730440 0.188152 0.460706 0.584902 7.175388 0.522271 0.691185 0.043219 0.388635 0.133604 0.000000 0.145190 0.552231 0.145715 0.187300 0.000000 0.360258 0.000000 0.206983 0.182787 5.223962 0.217647 0.425020 0.265980 5.176814 0.518345 0.543111 0.560152 11.758804 0.634359 1.691027 0.448878 4.761480 0.495490 0.993264 3.206563
-0.136975 0.186709 0.478224 0.059781 0.487610 0.331209 1.327943 0.331577 0.374182 0.034796 0.536180 0.000000 1.170161 0.443854 6.686821 0.424422 0.167999 0.000000 0.330142 0.133627 0.201446 0.158244 0.553848 0.023400 0.109193 0.033778 0.549391 0.118313 0.453725 0.454081 4.522434 0.235607 0.605810 0.416895 5.517017 0.199498 1.215568 0.640599 10.445044 0.686735 0.721257 0.274042 5.009584 0.533602 9.876693 2.935051
-0.178316 0.075301 0.122401 0.530359 0.141678 0.406224 0.181390 1.339669 0.203777 0.316394 0.108137 0.727697 0.573415 1.104183 0.642300 4.749388 0.094225 0.184601 0.019942 0.210711 0.092785 0.252538 0.029726 0.538076 0.050348 0.159703 0.099774 0.084542 0.247592 0.532108 0.260429 3.551170 0.325130 0.455521 0.332409 3.322482 0.634289 1.229934 0.360066 9.967450 0.287033 0.651555 0.331618 4.216152 4.069400 6.804351 3.379383
-2.475841 0.310433 0.631872 0.359105 0.358896 0.001176 0.031718 0.042795 0.645646 0.082260 0.167501 0.172331 0.567244 0.054305 0.175336 0.117180 4.726855 0.379925 0.772357 0.366767 0.559374 0.070985 0.183265 0.050180 0.712362 0.348194 0.189306 0.443699 0.911353 0.229171 0.328185 0.197628 2.527485 0.182446 0.346001 0.343805 0.265084 0.000000 0.040819 0.000000 0.642922 0.163816 0.182220 0.207681 0.404642 0.170075 0.000000 0.024553
-0.467183 4.069269 0.198474 0.688881 0.073166 0.022970 0.000403 0.269012 0.020373 0.944348 0.330450 0.312406 0.000000 0.519477 0.098676 0.101300 0.532887 9.860917 0.504782 1.215923 0.000000 1.334416 0.000000 0.709365 0.542846 1.129542 0.000000 0.274510 0.473217 0.418468 0.102600 0.357130 0.462404 3.210854 0.197268 0.751442 0.090844 0.375616 0.050091 0.058417 0.000000 0.700537 0.121769 0.446433 0.303567 0.341734 0.017067 0.046468 3.284045
-0.767942 0.255276 4.125593 0.373608 0.143074 0.057616 0.407827 0.050396 0.494385 0.144263 1.124658 0.175846 0.127435 0.090233 0.394920 0.081724 1.101286 0.452228 10.106357 0.558821 0.097143 0.003582 1.020170 0.438022 0.516214 0.416602 1.544490 0.273957 0.478723 0.000000 0.714934 0.349008 0.549864 0.173705 5.237141 0.372293 0.188142 0.062490 0.111336 0.000000 0.000000 0.180037 1.066639 0.257235 0.447464 0.116632 0.235056 0.028104 7.113417 5.597014
-0.473112 0.578220 0.544089 2.951036 0.027721 0.242602 0.081942 0.218979 0.267939 0.251698 0.000000 1.012319 0.167001 0.185923 0.091123 0.450424 0.544232 1.158001 0.499127 6.099253 0.135862 0.047611 0.000000 0.574312 0.202936 0.281335 0.247911 1.056986 0.120597 0.569310 0.000137 0.927174 0.301344 0.582254 0.191682 3.003401 0.081737 0.022475 0.010857 0.212390 0.163801 0.284411 0.000000 0.727635 0.000000 0.028621 0.077194 0.406960 3.156958 8.208296 3.774758
-0.309661 0.049007 0.133385 0.091362 2.755696 0.302741 0.312715 0.173483 0.308585 0.099407 0.179866 0.022343 0.653558 0.165648 0.235040 0.053440 0.586031 0.013153 0.203553 0.179613 7.588948 0.439620 0.963759 0.560670 0.547479 0.069668 0.135861 0.069560 1.431799 0.121765 0.083360 0.133101 0.286516 0.000000 0.201802 0.000000 2.850572 0.217626 0.255306 0.234034 0.294456 0.041952 0.267161 0.012711 0.795716 0.224302 0.277029 0.210832 2.387409 0.472709 0.874536 0.361853
-0.029261 0.287987 0.237502 0.079464 0.285453 6.205070 0.169673 0.611736 0.159718 0.477366 0.004748 0.097031 0.173503 0.692083 0.042684 0.136517 0.240863 0.721124 0.000000 0.375262 1.049409 15.096871 1.010045 1.140460 0.000000 0.744953 0.241932 0.130242 0.000000 2.613270 0.300906 0.466220 0.111303 0.453737 0.027777 0.187780 0.383153 5.695618 0.076418 0.574590 0.139786 0.484303 0.000000 0.165394 0.000000 0.772638 0.403996 0.263550 0.188979 3.693512 0.209611 0.565563 3.562260
-0.097211 0.051183 0.441628 0.008171 0.513421 0.235820 5.117930 0.235499 0.070306 0.031957 0.521432 0.082371 0.197312 0.172738 0.475343 0.026569 0.193239 0.098269 0.559770 0.177330 1.560608 0.661727 12.152351 0.795908 0.106566 0.071232 0.682414 0.141641 0.497342 0.312506 1.819394 0.000000 0.133686 0.000000 0.366764 0.043015 0.626554 0.317121 4.856776 0.337778 0.000000 0.107514 0.369197 0.178869 0.558013 0.149704 0.649928 0.008353 0.391040 0.524673 3.280242 0.249585 10.295043 4.555461
-0.020045 0.205435 0.217245 0.301692 0.426481 0.478619 0.103046 4.800339 0.155993 0.160516 0.043241 0.397869 0.268960 0.363964 0.134832 0.563882 0.206984 0.375368 0.012559 0.630731 0.568268 1.608418 0.744192 12.175507 0.074512 0.257717 0.054367 0.681996 0.492646 0.384357 0.353597 1.815422 0.101884 0.204837 0.057981 0.370971 0.293241 0.532753 0.197967 5.366890 0.155427 0.152522 0.000000 0.443356 0.019514 0.346667 0.260514 0.720482 0.312306 0.152334 0.352924 3.555941 3.923479 13.411564 5.467898
-0.452256 0.206865 0.133409 0.053800 0.309607 0.013382 0.068926 0.024207 3.922763 0.231168 0.559275 0.176878 0.358375 0.000000 0.177712 0.092559 1.220271 0.281882 0.084022 0.231489 0.483739 0.265890 0.136849 0.176715 10.288818 0.257275 0.960286 0.314541 0.872735 0.200592 0.202326 0.131606 0.733168 0.228237 0.118611 0.164725 0.195676 0.043394 0.070039 0.096837 3.560857 0.215779 0.437414 0.309641 0.474794 0.000000 0.017567 0.044485 5.427917 0.797076 1.424635 0.652427 2.447342 0.293912 0.545920 0.307262
-0.044245 0.619117 0.053195 0.141686 0.014937 0.319049 0.000000 0.119072 0.298004 4.056319 0.149644 0.455791 0.080113 0.220718 0.000000 0.084651 0.230774 1.245942 0.270442 0.396449 0.195181 0.543332 0.053672 0.185784 0.625666 8.727710 0.630593 1.349462 0.173700 0.825699 0.000000 0.272748 0.137963 0.557985 0.170833 0.179833 0.000000 0.346076 0.170917 0.168602 0.385726 4.067515 0.280119 0.562507 0.091162 0.271720 0.125340 0.066231 0.332908 7.325217 0.478010 0.921739 0.198779 3.601640 0.253466 0.732345 2.845043
-0.178881 0.093322 0.699548 0.062185 0.081196 0.155751 0.462067 0.087997 0.565895 0.345463 5.396309 0.263785 0.139528 0.018192 0.243818 0.030588 0.371072 0.202450 1.698770 0.248557 0.310900 0.000000 0.726337 0.011974 1.553810 0.675185 15.773670 0.684844 0.098120 0.078217 1.123305 0.084511 0.274645 0.146030 0.925165 0.035489 0.194232 0.001406 0.019483 0.028565 1.050409 0.390054 6.907826 0.417634 0.000000 0.000000 0.541805 0.145072 1.010631 0.544363 9.463188 0.632776 0.481165 0.577055 3.772050 0.550469 7.592797 4.413703
-0.160193 0.151178 0.076731 0.442325 0.000000 0.097576 0.063933 0.270416 0.425640 0.525532 0.449104 3.827531 0.031662 0.142824 0.027593 0.306584 0.192121 0.472240 0.158885 1.310323 0.079608 0.395180 0.151512 0.736482 0.519828 1.073672 0.382793 8.412434 0.154417 0.336653 0.246102 0.526592 0.081189 0.210083 0.135201 0.510685 0.004573 0.084876 0.081531 0.298596 0.285357 0.522613 0.438062 4.298715 0.076127 0.156612 0.000000 0.443800 0.554995 1.594286 0.784444 6.013321 0.306408 0.542734 0.198707 3.550842 2.758071 7.598315 3.146937
-0.412435 0.015231 0.187409 0.120300 0.567347 0.210729 0.440478 0.181399 0.317807 0.000000 0.050741 0.057232 3.160728 0.334488 0.354212 0.360271 0.508498 0.011257 0.330649 0.156356 1.013338 0.189070 0.183363 0.165266 0.389625 0.034616 0.181013 0.025816 7.108493 0.349994 0.774400 0.622327 0.336767 0.175377 0.229579 0.045691 0.323095 0.159209 0.338763 0.069403 0.193390 0.000000 0.075213 0.006311 3.286063 0.198551 0.399383 0.306299 3.516208 0.408732 0.913046 0.572741 5.429028 0.644483 0.714877 0.648722 2.384371 0.250045 0.558689 0.372519
-0.098069 0.332712 0.000000 0.144720 0.083426 0.887236 0.186255 0.180659 0.095963 0.281346 0.000000 0.157633 0.296128 3.149026 0.264908 0.501043 0.164447 0.606566 0.020498 0.211121 0.275024 0.977583 0.279703 1.001596 0.140037 0.640242 0.000000 0.047092 0.551324 9.096144 0.554377 1.054314 0.000000 0.263226 0.109142 0.207882 0.134602 0.611970 0.000000 0.201130 0.101080 0.420257 0.178073 0.054108 0.482487 2.953057 0.297405 0.644937 0.334328 3.490527 0.490048 0.634879 0.732207 10.150242 0.610477 1.733431 0.287374 3.267094 0.507470 0.705478 2.527529
-0.116809 0.095621 0.266191 0.036779 0.189954 0.055923 0.322421 0.099934 0.206787 0.063055 0.205228 0.044019 0.542407 0.212310 2.599162 0.229251 0.148294 0.162361 0.525809 0.141745 0.368773 0.289755 1.307732 0.237778 0.193107 0.000000 0.506109 0.032377 1.106088 0.610683 7.513910 0.620563 0.165645 0.045802 0.224782 0.067127 0.232263 0.066361 0.600482 0.150483 0.239247 0.000000 0.264738 0.019006 0.529099 0.152228 2.834036 0.263711 0.508716 0.289136 3.462465 0.403499 1.219309 0.608277 8.844769 0.760817 0.587408 0.236371 3.570274 0.330510 4.727667 3.096371
-0.048239 0.176725 0.003618 0.395369 0.158604 0.171050 0.089168 0.569434 0.020305 0.082772 0.150083 0.298184 0.474740 0.451725 0.324546 2.228059 0.116178 0.135524 0.134483 0.467172 0.179658 0.524966 0.084806 1.039384 0.093799 0.095190 0.169115 0.539303 0.766168 1.022562 0.417858 5.372551 0.095812 0.005762 0.028258 0.331755 0.046415 0.156690 0.029201 0.519322 0.032630 0.033342 0.149510 0.430416 0.464808 0.413177 0.180027 2.604676 0.413948 0.857642 0.373916 2.474743 0.451283 1.077532 0.618891 5.603282 0.310993 0.464848 0.299034 2.260628 2.476569 6.611571 2.538459
-
-0.043674 0.017847 0.017784 0.031140 0.019247 0.009435 0.008616 0.014681 0.014523 0.013609 0.009686 0.014671 0.023828 0.013718 0.017289 0.031140 0.022797 0.013406 0.013476 0.017287 0.015125 0.009514 0.007840 0.009700 0.011412 0.009188 0.007837 0.008615 0.010497 0.010951 0.013480 0.017787 0.019404 0.009325 0.010950 0.013715 0.016772 0.011612 0.009187 0.013612 0.011624 0.011611 0.009512 0.009416 0.011590 0.009325 0.013406 0.017844 0.024548 0.011593 0.010498 0.023830 0.015826 0.011627 0.011414 0.014532 0.015830 0.016777 0.015127 0.019247 0.024553 0.019413 0.022809 0.043672
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
diff --git a/PhyloCSF_Parameters/29mammals.nh b/PhyloCSF_Parameters/29mammals.nh
deleted file mode 100644
index 80f2a3a..0000000
--- a/PhyloCSF_Parameters/29mammals.nh
+++ /dev/null
@@ -1 +0,0 @@
-((((((((Human:0.007501,Chimp:0.009168):0.026355,Rhesus:0.039953):0.092142,Tarsier:0.186455):0.015362,(Mouse_lemur:0.118027,Bushbaby:0.171308):0.043456):0.019193,TreeShrew:0.250427):0.006240,(((((Mouse:0.098457,Rat:0.111030):0.247365,Kangaroo_rat:0.271094):0.034620,Guinea_Pig:0.299247):0.017940,Squirrel:0.208252):0.031664,(Rabbit:0.150144,Pika:0.255659):0.127617):0.021154):0.027966,(((Alpaca:0.146727,(Dolphin:0.089788,Cow:0.155595):0.032184):0.049589,((Horse:0.129807,(Cat:0.120914,Dog:0.123597):0.060107):0.009135,(Microbat:0.195231,Megabat:0.144425):0.044396):0.004221):0.010954,(Hedgehog:0.303926,Shrew:0.340893):0.081125):0.026906):0.026437,(((Elephant:0.113492,Rock_hyrax:0.197960):0.037505,Tenrec:0.317493):0.066035,(Armadillo:0.160225,Sloth:0.142974):0.068741):0.007515)
diff --git a/PhyloCSF_Parameters/29mammals_coding.ECM b/PhyloCSF_Parameters/29mammals_coding.ECM
deleted file mode 100644
index f894011..0000000
--- a/PhyloCSF_Parameters/29mammals_coding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-0.771493279396
-14.5180982851 0.547433994462
-0.829799770357 31.1892114825 0.7020007509
-1.2357249048 0.0591436724948 0.143021129459 0.0723670336788
-0.0491379655094 1.68015082454 0.0198294354489 0.039540785463 10.4536837099
-0.0705620171551 0.0966709944264 1.69743422922 0.142387839362 91.937054195 27.5243026465
-0.0429527042192 0.105163194816 0.0172649210373 2.25040676661 10.8921310832 29.7216988175 32.0319353336
-7.4338524426 0.17080527673 0.354723692547 0.186750900063 1.57462078709 0.053744234112 0.0267286337571 0.0670392311205
-0.15475952294 7.04751773186 0.133727701692 0.272371840933 0.0995168546074 2.91545126347 0.241247972617 0.30307911252 1.14819950914
-0.523684400979 0.193336177917 7.27785844907 0.248082744588 0.28292064082 0.0737402201706 2.22444630107 0.0911973524823 39.1328554206 1.20406413448
-0.173018086183 0.206353768518 0.171683630752 10.768130388 0.0919414494248 0.0323218254172 0.205978125948 4.34740100489 1.16358434945 33.6941468224 1.7233728365
-0.72844506036 0.0408900267574 0.0984268008214 0.0606490247723 6.27625068709 0.108522818556 0.732902667282 0.156984045956 1.27333682927 0.0371320946863 0.190371215329 0.0649658426497
-0.0107338084319 0.332629598166 0.0135926658879 0.022093725551 0. 2.18866127674 0.143671679617 0.121521316476 0.0119565599453 0.549500917257 0.0356995023641 0.0243544304587 12.7843674905
-0.0520823421344 0.0350655628839 0.405289748819 0.067795684311 1.27336050355 0.160287788944 6.57922720905 0.299427412867 0.0786854813099 0.0488940935773 0.960805451861 0.0665927661081 5.34516996652 0.736796631636
-0.0216049508162 0.0160718839072 0.0223163001706 0.605907271879 0.0245681166778 0.0205049564898 0.158269973844 3.87244486996 0.0304252144396 0.0317223740088 0.0589426989831 0.873730975438 9.99938453006 25.8255751638 1.22569015347
-2.18663674868 0.111696040966 0.0634197481102 0.154784667253 0.211944334747 0.0142851196137 0.0249872010961 0.0178329430869 0.632866998477 0.0456544602052 0.155643358185 0.0852409113534 0.114188793132 0.00538347477404 0.0172684858959 0.00982443430665
-0.0806194749382 1.82202603689 0.0700874839516 0.139029576933 0.0180592441769 0.131956497224 0.0167764425897 0.0204819995985 0.0337369858375 0.495354204564 0.0430768582 0.0598964584571 0.00958027358921 0.0336402412939 0.0100876385187 0. 2.33982994684
-0.0813812527058 0.072537901315 0.967025850778 0.0745340778643 0.0311639252932 0.00984056819269 0.180306689601 0.00854548443289 0.0545028256988 0.042940471875 0.398138428286 0.0395461759513 0.0155719958588 0.00453736963474 0.0574916836341 0.00557974117017 23.6795913232 1.61299074838
-0.0890303815424 0.0309711104056 0.075284329732 2.72022205635 0.0173828570078 0.00889347376972 0.0250244061361 0.189896560082 0.0470550538246 0.0369691647928 0.0517741235211 0.814461875725 0.0113513697564 7.49810654027e-05 0.0161305091349 0.0857488913528 2.52155138217 51.8301587085 1.73431675231
-0.0831502869336 0.00623291475441 0.0140485960681 0.00222815351908 1.85271487285 0.0142595343747 0. 0.0240393018298 0.100035548941 0.00744094731676 0.0208705373804 0.00714801356087 0.202643068745 0.00840395811706 0.0485674719118 0. 2.58108992655 0.0610588913053 0.288098926224 0.0640178651307
-0.0121507251646 0.0924520030781 0.00836826924209 0.0186151696838 0.0836537312744 1.54107027962 0.0440270652618 0.131930258067 0.00717636251265 0.120684206891 0.0125595231276 0.0212153052835 0.000324249078674 0.075269096427 0.0148448619927 0.0162954435488 0.135980978245 1.38509214833 0.0582990476554 0.097001138788 10.3565106085
-0.0327561377247 0.0194019854761 0.151645046369 0.0216308024113 0.16219698802 0.0736088846667 3.56703356477 0.0906683018246 0.0211444376486 0.0293098893392 0.213048465069 0.030853222824 0.105229675827 0.0117895396449 0.238615514744 0.00758025850283 0.383949439837 0.217940094945 3.42317049457 0.151800096828 80.196430788 26.5641853165
-0.00712174354816 0.00723985090453 0.00595505344662 0.0975294587912 0.0438607458733 0.0573004108171 0. 2.03540765518 0.0049271871924 0.0089011742123 0.00755042591788 0.131884297209 0.0101448079456 0.00832642054426 0.0156458916585 0.109023373526 0.0378815314904 0.0463207771448 0.0165605454301 1.6138138067 9.1542408524 28.6750081769 21.9548306605
-0.342652952354 0. 0.00831817472204 0.0019578776316 0.0256561801987 0.00396518185496 0. 0.00828598360004 24.819368396 0. 0.692289530387 0.00221688308001 0.0423207748289 0. 0.00421964524011 0.0102462249253 9.72150853477 0.287135700558 0.111035024588 0.161520784401 0.987246541018 0.0268612351287 0.14984953371 0.0013382555295
-0.0274952800589 0.239907400328 0.130619934855 0.0199908101654 0.00651256013327 0.0940574219685 0.0188049255523 0.0154651516836 0.731121345902 1.44205827826 1.47351708949 0.0159273184405 0. 0.0478071542405 0.00524987299297 0. 0.337092192699 7.2223642138 0.298762023217 0. 0.0197476073108 0.971106449371 0.23665637847 0.000783759865199 22.6147561126
-0.126747246284 0.00525348090503 0.431201251443 0.00871397252545 0.00260008330902 0.00505104531015 0.154413324232 0. 1.38751553761 0.0069785180879 24.2115845119 0. 0.0154314907887 0. 0.026146215906 0.00674642096354 0.249262272475 0.264254321875 5.15802336393 0.282622534951 0.100276942636 0.0464677107833 2.8678028547 0.0103939496336 58.2624766604 19.1638370992
-0.0407572307445 0.0541760472627 0.0408884489312 0.594154801521 0.00637997251286 0.0198824741158 0.0398930112025 0.199496998649 0.131755897653 0.18449888875 0.326574404736 2.81319866554 0.014151320102 0.0153460674176 0.00990532258908 0.0946255220831 0.573596562106 0.632515608499 0.283840725565 16.0063596615 0.075905929081 0.0826477869133 0.145510045956 1.80628209641 29.347029641 79.0811920949 24.1343195351
-0.0670321669475 0.000563067043618 0.00709263218583 0.0160730475881 0.397475218922 0.0108774166451 0.0224531700364 0.0117432492443 0.110217799898 0.00741770540948 0.0106037107321 0.00421212203971 6.34377872097 0. 0.30644392794 0.0507575748744 1.9736613358 0.0556021195246 0.102283849299 0.0480436043823 4.00887120044 0.0417641609514 0.653798644135 0.0359958557139 1.53421130077 0.0163428855889 0.117515458291 0.0242819224677
-0.00643748166518 0.0295649828891 0.000637970407505 0.019754645672 0.0030508665228 0.178930335275 0. 0.00883618689765 0.0253554586766 0.0635021784113 0.0114766272275 0.0282686114778 0.159188805299 2.05296843661 0.0831033972167 0.158454009429 0.0790863053832 0.843181005219 0.0366298173461 0.107941366273 0.0245725600104 1.92780227841 0.103817357813 0.139569513175 0.0230997188178 0.954192866331 0.0226992195858 0.144293124685 11.6702094631
-0. 0.000741264056699 0.0321762732716 0.00876551202277 0.0409627203061 0.0066341456828 0.289776596366 0.0104730362024 0.00188148859201 0.00415933999863 0.0531027228242 0.00397499828712 0.277347255409 0.081204120774 1.47530308516 0.0831617109488 0.0348369494271 0.0330910542007 0.514722517892 0.0315293996595 0.448937601962 0.0560895061976 3.50959324007 0.0672410028933 0.000363858402076 0.0325302162526 0.698509928297 0.0222160316559 31.3936914479 7.82675950727
-0.0103057326894 0.0209560410928 0. 0.0432390313139 0. 0.000598674783837 0. 0.331194702356 0.0159021216996 0.0263734927337 0.0229446661305 0.0793998208566 0.0655491795789 0.0771818086854 0.0755945133111 2.56835350509 0.0801848672594 0.0780599264085 0.0459870926371 1.38822655563 0.0245587112418 0.105445060089 0.157688337733 2.56327777985 0.00606283188176 0.0292401665627 0.0516866860149 1.68499310101 9.08011950879 26.1164046404 6.89513673659
-1.52942036217 0.0973183013281 0.0388353247448 0.117166119514 0.201990514263 0.015333596402 0.0128796043445 0.0124927834828 0.391532889031 0.0313292278453 0.0213395537798 0.046335054843 0.111001960231 0.00549068726692 0.0162640654866 0.00404973027084 1.6718235251 0.0500267310822 0.0517100980774 0.0537247281374 0.0619851968551 0.00546186911396 0.00987533716152 0.00386417990485 0.0791417803087 0.0355024148452 0. 0.0324557541248 0.0530512896758 0.0027411404153 0.003400456723 0.00422901561025
-0.0827672478108 2.45968541101 0.0634654669355 0.173632559347 0.0131604282059 0.164795491269 0.0131791154447 0.0351360772548 0.0335412538099 0.474036367211 0.03667071173 0.0671758266016 0.0124420599637 0.0313192578121 0.00897011881742 0.0123210571936 0.0862780006103 0.62622938248 0.0460793037594 0.0418612404259 0.00488689931062 0.0558122415879 0.0175672823754 0.00628262205823 0.00715550696459 0.0910460725338 0.00443029935197 0.0287613924571 0.00313419211364 0.0319575833704 0.00226776365132 0. 1.70115845114
-0.0522505604502 0.0898926251941 1.06240549924 0.112920569564 0.0463514147993 0.0149556757989 0.290216053777 0.0126916204037 0.0444314578346 0.0425138927353 0.346736063384 0.0532746125015 0.0239887410771 0.00428625042153 0.0806840702641 0.00726198943985 0.0617898168537 0.0606229656609 0.929748659037 0.0607814405512 0.0130660362186 0.00815276835162 0.144015583909 0.00475002529722 0.0297003498473 0. 0.132271963252 0.0101996218813 0.00843968014492 0.00444182503798 0.0259434869283 0.00418488182163 13.9895365789 1.74259584965
-0.069879625366 0.0502569650608 0.0601726449853 3.10841773214 0.0194174772813 0.00880592559668 0.026064139331 0.183837737792 0.0384232333402 0.0386598563856 0.028491177004 0.66561597344 0.0178802430678 0.0106144479446 0.010721316501 0.0584953860606 0.0488555874011 0.0240956518334 0.0447701807091 0.81606944054 0.00601727190495 0.00644546124483 0.00707166378557 0.0505635979412 0. 0.00103456844645 0.00427279006237 0.187146494621 0.00269164053833 0. 0.00100987468273 0.047653345948 1.4140884143 23.7236399779 1.55601401505
-0.181158453397 0.0260123477086 0.0397790253368 0.0100844740285 8.86889734423 0.0461483266391 0. 0.107929568028 0.256807798045 0.0320388886734 0.0695661905816 0.0188244726856 0.942228107881 0. 0.280430428925 0. 0.177260190745 0.0103616000988 0.0309089068449 0.00733443583341 2.08534651761 0.0619419333752 0.0385046664547 0.040395753471 0.063159608537 0.00541444268653 0.00590389620526 0.00982289064588 0.298133346746 0.00680478222793 0.0432921772456 0.00757149486997 1.03013073458 0.0486682637201 0.188686676483 0.0246949247744
-0.0122577305366 0.191980971044 0.0161067868229 0.0275695037423 0.14003002796 5.91146468912 0.134860570052 0.387425224734 0.0209047479093 0.400275840087 0.021321233877 0.0329212682449 0.00736037530406 0.286707031154 0.0674343529579 0.0311016087688 0.01510330413 0.0812436776202 0.00951252481602 0.0089036753564 0.0500637131568 1.53342839158 0.129298933272 0.11420040671 0.00657888694428 0.0901221706124 0.00747913674455 0.0199622847226 0.0126688373082 0.175994119126 0.0118295798482 0.00036469247377 0.0486596453358 0.628137800632 0.0473421611494 0.0308176979667 8.69450787125
-0.0555064568149 0.0480629442424 0.276262166032 0.0331518765262 0.562775127606 0.281398177498 15.7085436131 0.333136469932 0.0406317413376 0.107810107191 0.523491550083 0.0915018349276 0.234333738224 0.0552067621755 1.18046200077 0.0590812702434 0.043050916247 0.0231734472692 0.204509977331 0.0233882916335 0. 0.16346581468 6.09067753677 0.0888615500043 0.0279377722441 0.0701278427092 0.269656981301 0.0300336306608 0.0285534734776 0.0334291528371 0.323865691396 0.0205253370633 0.126702292889 0.134698271566 1.9279992831 0.0830503615842 68.895319709 18.1269451688
-0.0105930094914 0.0197467947894 0.00672572148301 0.219652037737 0.0569481631527 0.192199885757 0.0770026769259 8.2030334245 0.00992272063324 0.0406733489963 0.0200757655693 0.465563570471 0.00648442428788 0.0322131056713 0.0652316603109 0.434810615786 0.00266089608895 0.00461778904828 0.00596362923912 0.0916196214411 0.0124266748599 0.0905298871638 0.0352078645817 1.75296746263 0. 0.011915518628 0.0064691624691 0.117966135277 0. 0. 0.00641417426938 0.263264203083 0.0294620633383 0.0517569597285 0.0297106128632 0.775854199415 9.25329006582 21.8046714515 21.0184122059
-0.254177076964 0.0466163962153 0.013775505342 0.0165752917716 0.2541994313 0. 0.0234895802647 0. 3.51441514201 0.0628800416072 0.126836526076 0.113077846139 0.202105100057 0.00982962599455 0.00967118786199 0.0052933427804 0.301915015348 0.0209447385129 0.0262482055616 0.021515034263 0.0805828810913 0.00282008757285 0.0242510782787 0. 0.874922102518 0.0133118469457 0.0278638597687 0.0256982967577 0.0830735772627 0.0140431178472 0.00152631760016 0.00512338828271 2.14076248522 0.109913868096 0.127066667315 0.0860586763677 1.85126960484 0.0189655004627 0.22577819126 0.02214203147
-0.0187961223364 0.536260801381 0.0187201885281 0.0570722129956 0. 0.249122534002 0.0247618945167 0.0347282919429 0.119844529013 5.89713390113 0.135529295696 0.37862421452 0. 0.0716822297298 0.0139552063489 0.0090504051125 0.0143990351069 0.218599982006 0.0201367961938 0.0288787666884 0. 0.0953004938169 0.0184742524512 0.0163365894936 0.0148614517249 0.91696743349 0.010473158236 0.102230161422 0.00781085519074 0.0411893350182 0.00772386312203 7.845967971e-05 0.0513084582793 1.83647544751 0.0711026312034 0.0484847347439 0.0136165169786 1.40745470677 0.258157562514 0.135820730719 8.13762983681
-0.0328636713303 0.0187769783312 0.235179486576 0.0733364272614 0.0926161334728 0.00838022497616 0.408607171412 0.0113896740303 0.230797267043 0.166509619107 4.62098300244 0.355598938915 0.0707469720138 0.00499944094366 0.1819732433 0.0220544026913 0.0721575489303 0.0276836910024 0.222982276164 0.0331777831189 0.0244250690124 0.00613550182328 0.289795200046 0.00732929200673 0.0844588490175 0.0304535572718 1.0957917311 0.0567580546743 0.0173063494738 0.00490556988502 0.0661130308739 0.0183619577456 0.0948448651991 0.101343657162 1.83229308595 0.0912091468367 0.433113687149 0.0715023194908 4.13594806656 0.0258080154165 30.5908569921 10.0811942943
-0.0243094808513 0.0577216517943 0.0200297769648 0.877392683846 0.00616672142884 0.0133710129811 0.0101473425531 0.425742741255 0.141560490571 0.443900074406 0.191187943803 9.36899545687 0. 0.018888775476 0.0149073518673 0.13913130704 0.0462748737881 0.0379647006055 0.0137169525908 0.459494094526 0. 0.0190014624053 0.00446871333479 0.110939295873 0. 0.0330973044641 0.020129035622 1.80187002398 0. 0.00776890685305 0.000484586777783 0.0693812551183 0.0801448777091 0.218228314494 0.10116895754 3.17665838205 0.0223213571149 0.107982033724 0.190590547393 2.20919088952 7.91138478576 34.3882055135 12.7244322854
-0.15434282613 0.00935208126288 0.0151733883381 0.013729475622 1.71785898184 0.0271358624608 0.146655133895 0.0177553776853 0.30178866371 0.0182577297541 0.0375645028041 0.0274235268157 26.8094991811 0. 0.612478351302 0. 0.142234190974 0.0114076697294 0.011520354398 0.0142505051056 0.280313823039 0.00876817134547 0.0630840357167 0.0103192072714 0.0826066155485 0.0047477806076 0.00469973766013 0.00628193768667 4.58278302533 0.0291050999455 0.0296673134073 0.0479828667289 0.725647477002 0.0270877926263 0.0588757234687 0.0273951850099 6.40325605509 0.0438568294629 0.732225073977 0.00651736008295 1.44810954129 0.0184942984015 0.172245324759 0.0349897269167
-0.00969533647635 0.0999488616985 0.0052454488918 0.0131800710292 0.0337929099917 1.0749439893 0.0326869238681 0.111456192054 0.0264268584625 0.224134039428 0.0199444908588 0.0290530701962 0.562736693539 10.7237952641 0.118229726105 0.506770835596 0.0102800806728 0.0606173209593 0.00751054512132 0.0133113286074 0.0105443090872 0.183782605146 0.0204709347631 0.0276985652596 0.00129705656982 0.0754620175889 0. 0.025804891967 0.030298070793 2.03508410924 0.0447055642363 0.132059900606 0.0301183881127 0.37615525312 0.015908228653 0.0213106603965 0.0431287073534 3.93391823581 0.275853026894 0.265254577006 0. 0.929017326538 0.0360346586025 0.121805115134 12.2774917757
-0.00781203656183 0.00305032194564 0.0716340021864 0.00950419017431 0.290444381626 0.0363585294956 1.48832591097 0.0531160643028 0.00529187417067 0.0181792465187 0.1898146219 0.0202367292531 1.25814605694 0.340506545072 3.55342590032 0.340626708068 0.00543938441184 0.00876335637772 0.0465035840453 0.00925919109869 0.0557620647879 0.0126977754034 0.284454447223 0.0133494203904 0. 0.00517806534409 0.0414239861961 0.0147777238638 0.0411492373521 0.0355017967194 1.07082122249 0.0287025328326 0.0124956170788 0.0109304744587 0.34347636804 0.0163556298762 1.02652889428 0.14159544335 6.96484884785 0.145598748684 0.0100539151045 0.00261004468069 1.03235017399 0.0320664273316 34.9286691378 8.23239114357
-0.0114083420209 0.0199984874197 0.00840313920552 0.139176400973 0.0135290119007 0.0655614948349 0.0271933719352 1.45516931 0.0142193129151 0.0186767358189 0.0235742444493 0.348139821213 0.292921217267 0.0772705614775 0.146955588856 13.0029095601 0.0128252811737 0.0160174998411 0.00344783997877 0.0854516604554 0. 0.0306215484952 0.00135298295599 0.197945344879 0.00398803702332 0. 0.0112408821513 0.130903293586 0.0345087851993 0.0350951206775 0.024019772453 2.51762209502 0.0236558879595 0.033012214447 0.0321554878851 0.53405164739 0.0272060510773 0.175337751612 0.294680297433 5.21552771342 0.0246904606628 0.0948001199036 0.0427269667822 1.71316918042 10.4885072326 28.6013786797 8.76793221684
-2.77594356032 0.0993047870626 0.258987813235 0.196747240033 0.159727053992 0.0201599544009 0.0456494718309 0.014416684875 0.453919642655 0.0552728098673 0.176877082092 0.105471229855 0.386772302504 0.00718586592846 0.0321231644917 0.025169217975 6.78299214328 0.375237957265 0.480908376528 0.294621559134 0.387630790093 0.0702904544528 0.169324529386 0.0583382719292 0.390108022986 0.150928696164 0.18405706465 0.0963763242996 0.894999246158 0.0063632664085 0.0562162829768 0.0486748216443 2.62332950228 0.20035925212 0.35459689191 0.134554657987 0.228256251997 0.0429382995137 0.0430277011087 0. 0.499835267232 0.0872802166146 0. 0.00901740735283 0.289857331321 0.0270375266701 0.04838186141 0.0374696887996
-0.0121894520849 0.410790063033 0.011133598533 0.00165056619402 0.0051843131731 0.0431018327577 0.00539237299706 0.0150623598867 0.0170708870198 0.0840406186667 0. 0.0242935664732 0.0080513219032 0.0398494896751 0.00545725560213 0. 0.0790745463878 3.2078145507 0.0532472065717 0.010043455522 0.00635188554487 0.0880596706435 0.013721224767 0.00651922284968 0.025457891714 0.304325536564 0.00707279853229 0.0675357009414 0.0172192049667 0.106767001377 0.00573203678181 0.0136987547062 0.013655212029 0.297543754748 0.0119723251101 0.00318746283208 0.00162010996025 0.0299444434255 0.0108699938489 0.0166143146908 0.00169048351502 0.0635594253576 0.00467473667675 0.0232766714606 0.00173091362045 0.0456155333578 0.00257003829396 0.00549671428511 3.59183812996
-0.0128603903345 0.155272434481 2.90473676882 0.0921884295404 0.018003235893 0.0088919464121 0.332278027108 0.029517979277 0.0950845378976 0.0814115848686 1.02293237377 0.0782302611672 0.124932670117 0.0147696168081 0.209777697594 0.0191860423374 1.17481497084 0.422005627993 7.16881310532 0.519389046385 0.138828982528 0.0537440354805 1.18848446499 0.053710043866 0.258890930878 0.191467019998 2.4094721595 0.233810974308 0.141415434357 0.0802249814486 0.478853644692 0.0570549680101 0.186570124039 0.158525054764 3.30106333889 0.127155955145 0.070267211767 0. 0.703384400913 0.0418228555285 0. 0. 0.981935304195 0.0968146005396 0.0783266440087 0.00763974452017 0.23785171402 0.0201171111811 507.765111884 2.44158816723
-0.0298412769399 0.0122551089064 0.0159708172401 0.662041901317 0.00734282838376 0.0100875430507 0.00631171792731 0.0627729308325 0.00317881402807 0.0217712378384 0.0380502109864 0.181154195019 0.0147807967765 0.000693398311567 0.0108043597623 0.083547251776 0.124351036848 0.181987183493 0.0659530747008 4.28844853026 0.00751655604012 0.0154663468996 0.00513218639619 0.101949747019 0. 0.00997028720563 0.0172390346722 0.836591636433 0.0182342555086 0.019835677565 0.0069782151758 0.16156444993 0.022796908347 0.0389716219568 0.0269186753463 0.441801768503 0.00596547916974 0.014701676295 0.00739562555348 0.0342721533618 0.00495950613705 0.0217814491004 0.00623597741371 0.141948440236 0.0124771328796 0.0118889570172 0.00259482001219 0.0781727135773 2.98967538063 49.2839591139 3.316675155
-0.0722278190998 0.00500866092764 0.0173192942569 0.023154035384 3.4470883287 0.0171508279517 0.0554954011444 0.091309482244 0.0662760011389 0.00829980119382 0.022354058005 0.0338946495945 0.235314951058 0. 0.0763098378531 0.0332331474469 0.286505793562 0.01505939157 0.0464968416988 0.0254099705532 6.29714726079 0.0976069040919 0.476439604983 0.0361553588411 0.122280514014 0. 0.040880462884 0.0107976740267 0.516163749196 0.011360889129 0.0121972794524 0.0203193196188 0.0695019404399 0.00472048511553 0.0113007052678 0.0118761160785 4.26073713503 0.0861649940812 0.310162417427 0.051843758979 0.103507527036 0. 0.0457793711362 0. 0.430028495412 0. 0.0801999766326 0.0205470075237 2.81788640408 0.00323540880644 0.44167841641 0.0268487689328
-0.0109315724616 0.144616714606 0.00821707597789 0.000456726857907 0.0764913882054 2.45357074876 0.0661435744316 0.176744922702 0.00819456481366 0.266597495417 0.0182759357264 0.00846119421793 0.0313617134389 0.0966495049223 0.0162790413192 0.00163711843708 0.0369439154618 0.234872736279 0.0123576787921 0.0265123221939 0.036042397569 4.81163765756 0.150265642397 0.164785582551 0. 0.180317458513 0.00458491922496 0.0367902105118 0. 0.389255850299 0.00174760112765 0. 0.00257753728933 0.0635580300716 0.0084535343221 0.00282624864339 0.0447019415675 2.88017138187 0.289532320254 0.123735336689 0.00324188461583 0.118078308966 0.0100812848724 0.0198277053741 0.0116340464762 0.243292793662 0.0120482062486 0.0176763288885 0.263693820924 0.709176626674 0.248550219855 0.0328825526141 12.6242878278
-0.0135254471713 0.0224138900757 0.096798546819 0.0154444374282 0.469113896116 0.22743490158 7.79328364964 0.213279371798 0.0161344840406 0.0784909371759 0.179648483473 0.0628751158954 0.0423341383387 0.00630178455457 0.312339853289 0.0234883695029 0.0322889750944 0.0291162192912 0.247846604119 0.0201655279496 0.0518907117023 0.0661747311717 12.1031163415 0.0342292472337 0.0670292507246 0.0263262931891 0.406923875717 0.00490776541097 0. 0.0160598832211 0.353791691237 0.026544047596 0.0118193968718 0.00791022068661 0.109843293866 0.0158225402976 0.333300299142 0.31958909408 12.0613669426 0.0616488096615 0.0107388318896 0.0148583295769 0.233395457926 0.0229189251464 0.0725987489501 0.0224009938245 0.366753524194 0.0033444418443 0.435154262392 0. 5.18531608176 0.0337930801197 103.370411838 30.2187145757
-0.00889801311401 0.014314272414 0.00733263507062 0.139923321215 0.0599475336812 0.151241438878 0.0626266723432 3.26792392121 0.0168047793112 0.0355345341123 0.00841349152452 0.279741113857 0.0269058261891 0.0203136714086 0.0172489856388 0.100526472268 0.00951741783187 0.0365100909268 0.0188076923165 0.311852144931 0.0234901851248 0.406481108084 0.118585605774 5.59567167405 0. 0.0209633844747 0.0017276477389 0.386993411551 0.0356811825554 0.00753007889328 0.0256322285828 0.467310381695 0.00386274806443 0.01299145289 0.00713480561887 0.0563915408293 0.0270058369068 0.251044072283 0.255733515669 3.20974363638 0.00242786317209 0.0191998396281 0.0137316622378 0.150868053414 0.0179523093513 0.0494934567133 0.0152084857496 0.22043068467 0.265435129553 0.0233293793875 0.240040834453 1.01421579934 10.035477583 28.3055731705 29.0099153961
-0.161412798087 0.00424480446191 0. 0. 0.0906916476566 0.00563968805371 0.0321857317281 0.00625169793881 2.32459802666 0.18028353771 0.402169481502 0.146021735821 0.180738849749 0.0152470119891 0.0594309552204 0. 1.59918269474 0.0878914404839 0.151488329592 0.0644464394055 0.433227437698 0.0415119312985 0.134563380307 0.0308938272344 12.8269080058 0.586851670675 1.37028858456 0.768958451975 0.504903662999 0.0401830542296 0.179516483383 0.0260615738593 0.320069615284 0.0514874328311 0.0730906239858 0.0500704875043 0.126989204283 0.0185452770624 0.120931812654 0.0233211166859 2.57821698158 0.137637074862 0.52477780815 0.185823198291 0.14069243508 0.0436555868557 0.0759002609233 0.0304916977712 351.484733517 0.0751625144229 26.381564856 0.10755263699 1.62508488908 0.117164738243 0.443351098266 0.125852859682
-0.00540817019885 0.109532143682 0.00466186168276 0.0119570850765 0.0158619374367 0.0807774228921 0.0133696167272 0.00519688621966 0.029392784273 1.27871496477 0.063722905148 0.04128067384 0.00632884583531 0.0453137431349 0.00843806244594 0.0123184356638 0.0549166610956 0.828580129577 0.0498266614372 0.0502292974892 0.0199171150784 0.185872475093 0.0251441786984 0.010719019886 0.089127529091 3.4296456957 0.103967035845 0.239907865574 0.00468334570237 0.206251061571 0.0138674587778 0.0283270941681 0.00773883894314 0.0717966354105 0.0039461417809 0.00130873744795 0.00796058746493 0.112416234141 0.0258843362023 0.0102273571283 0.0143618403641 1.09404680854 0.0371145501871 0.0742827896751 0.00597837009967 0.0989926626628 0.00732532644804 0.0141200991997 0.297694270758 1.90815280778 0.448236037837 0.0662766472026 0.0370265810511 1.47916590967 0.115943259122 0.102962006329 2.53689270085
-0.0102444412948 0.00509286785591 0.0526826133572 0.00865174390146 0.0167207453137 0.0078067338281 0.0680018616885 0.00652270728479 0.0529708932914 0.0317393901905 0.953237491747 0.0460080390141 0.0202225963419 0.00647460880487 0.0627457859646 0.00621514632303 0.0849084781118 0.0605758785434 0.430500146762 0.0760617630848 0.0368909715192 0.0130987377349 0.289812358407 0.0111800529475 0.15870666689 0.105782269501 3.01587355888 0.129715864077 0.0292980098652 0.0140236078572 0.161233068931 0.013554679652 0.00638065202681 0.00383023188484 0.0462524279848 0.00467115363075 0.0143634062062 0.00687250339689 0.106692653386 0.00553305812419 0.0427454939109 0.0298804720595 0.989563854742 0.0360911542865 0.0145669991601 0.00652825936214 0.0693258497758 0.00506439035447 0. 0.0616959880557 9.95680242469 0.105688196253 0.162332902184 0.0468444399235 1.27307344663 0.0459595842087 8.27606578348 0.715389857412
-0.00789939435885 0.01212501017 0.00773363835482 0.175301373497 0. 0.0143690209499 0.00126452851364 0.132117818087 0.0582018868707 0.0711103982248 0.0578686515489 1.756951756 0.00998972583202 0.0120449704688 0.0114545328219 0.0634532707085 0.0744891940437 0.0686263990691 0.0484135563166 1.44153871334 0.00450888748208 0.0272210780702 0.0240257116739 0.208900041641 0.0398056574747 0. 0.113109727358 5.32058987453 0.0150482576711 0.0314730538069 0.0119754249663 0.256988726401 0.00098902044467 0.0131515986558 0.0105575625281 0.10786533181 0.00903471281231 0.0072515426398 0.0277375045236 0.110148076992 0.0208083242687 0.0755742185728 0.0905113037895 1.71936164198 0.00966856631646 0.0179622299535 0.0146245333127 0.12178135613 0.294662757949 0.0974744910442 0.572307858294 3.67660894718 0.0571583781106 0.0395596260121 0.107882138908 2.20567784646 1.91713540938 48.0143648972 0.853169465851
-0.0531643487552 0.00046790400605 0.000838453691686 0.01812896729 0.208420547857 0.0343787330744 0. 0.0231920471902 0.043685055595 0.00732004830476 0. 0. 4.11106061846 0.048722096716 0.146088640727 0.0560625049253 0.0474926500595 0.00475721733224 0.00484972824452 0. 0.197182079712 0.0457824201776 0. 0. 0.058950641239 0.0289413524406 0.0136873269902 0.0229852647113 41.3472328531 1.0528307594 1.29285877772 0.306280922598 0.0345768065397 0.00451575537032 0.00714407574213 0.00383630480052 0.231578282487 0.027634098434 0.0463528990383 0. 0.0637039348201 0.0184746799941 0.00875762872995 0. 4.32985621739 0.117782272716 0.022019255005 0.0681679785543 3.64445607755 0.0592877548457 0.525086277223 0.0756449030113 4.56261330482 0.110131050888 0.0439052051569 0.0797889683874 2.06518561996 0.0666683510558 0.0762726044496 0.0517838499854
-0.0055199762485 0.0334289719786 0.00390763608714 0.00102384267646 0. 0.106196580492 0.00818508580281 0.0136642809574 0.00357284653328 0.0457468056207 0.00694679633975 0. 0.0911050824201 0.599678869518 0.0489300439061 0.0108088282083 0.0105832559291 0.145765335695 0.00690974052474 0.0114920430125 0.0175529106988 0.175936238339 0.0413270786918 0.00872752794066 0.00466216314537 0.0913950125537 0.00860719686636 0.0243677507458 0.0585882757321 2.80334749919 0.0872701701452 0.111401177662 0.00200006153919 0.0217250647562 0.00433905371471 0. 0. 0.110447906903 0.0173404257969 0.00995287043434 0.00388615508611 0.0438806416399 0.00902124309974 0.00312743519908 0.0425164571122 0.955534749424 0.0288747192586 0.0248716875581 0.206472713399 1.77357320853 0.123522093577 0.193297452822 0.0928470465172 1.53245881476 0.111006305099 0.117335749811 0.105553436644 0.742828630094 0.0622235265575 0.0423426485008 1.43526430491
-0.00783695049608 0.0250727545388 0.0365535857915 0. 0.104520783638 0.0175266123984 0.423097003684 0.0372719485901 0. 0.00118601758413 0.0980061451082 0.0165691637301 0.398423196665 0.0736727127086 1.87900199944 0.0923264680767 0.0174427982474 0. 0.0558435587249 0.0325636812093 0.0600891313087 0. 0.53367919355 0.0668040000349 0. 0.0149063765247 0.118853989326 0.0549025463859 2.14712512855 0.312763441889 20.1875336549 0.347860470677 0.0066552531376 0.00307323366926 0.0412644723982 0.00610625387445 0.0831499855006 0.0075476627928 0.537235020729 0.0317779628223 0. 0.0021195066801 0.103937315422 0.0444811941521 0.209725175735 0.0477753255181 1.65952099137 0.0698039587929 0.0802054038476 0.0387196706916 2.78319794878 0.061028317299 1.47838527252 0.204511470784 7.10912954036 0.256877041263 0.549142746907 0.0751592976177 1.26735185125 0.109280267489 34.4959393706 1.05085922221
-0.00746472259056 0.00204899373295 0.00581141364371 0.0491987450047 0.0279931733762 0. 0.0187164230282 0.139287436956 0.00599351063267 0. 0.00799680673582 0.0650958058285 0.0344787803875 0.0123348960029 0.0622609147898 0.851318265478 0.0137965285149 0.0171589122973 0.00792908114731 0.177351717033 0.0066528572533 0.0210605579391 0.0315464539473 0.18248378446 0.00953680519322 0.00890950686499 0.00910725738233 0.174716153118 0.0532132015906 0.106932799171 0.0628787450617 3.22751790841 0.00644393995935 0.002174043541 0.00377513820975 0.0273030924407 0.0338199259892 0.00125051939221 0.0390614305644 0.10632141054 0.00310445049144 0.00717703221063 0.00848650791657 0.0783047449268 0.0456723888635 0.0516488993956 0.0415544937568 1.15249307403 0.265892650003 0.126252301003 0.188030143058 2.21350162545 0.0711131598547 0.0498530038432 0.14039933692 1.62206226821 0.0927215536591 0.0268076213023 0.0997798597602 0.992253660267 1.28408120875 24.4950942036 1.65934183601
-
-0.0255410031621 0.0196994410272 0.0329436805941 0.0171683371063 0.0149396985614 0.0183708104275 0.00645076614979 0.0131771277358 0.0119329780996 0.019404291813 0.0110661479582 0.0126066351598 0.00767281125434 0.0211476929741 0.0217199500715 0.0162144992548 0.0125788049362 0.0153824193819 0.0351900543795 0.0107925691178 0.016594963679 0.0192878934182 0.0069342750228 0.0174443586684 0.00639363526807 0.00974852461103 0.0111678900222 0.00443298791246 0.00723674640067 0.0193993823623 0.0394721937175 0.0134712866574 0.0308697977783 0.0261955025614 0.0398854098195 0.0222118074114 0.0157269211794 0.0271424443752 0.00716582944527 0.018409347815 0.015995194452 0.0210047367317 0.0151538538426 0.00983855721495 0.00727530179348 0.0147630423609 0.0279360948926 0.0111035450087 0.000586877417582 0.0155362448361 0.000536216447671 0.0120197877511 0.0121507344448 0.0176708896065 0.00473584340384 0.0155784373036 0.0010210997268 0.0121177246907 0.0119605502469 0.0104896896194 0.00812470878645 0.0202026177119 0.0134871493447 0.0175201850745
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/29mammals_noncoding.ECM b/PhyloCSF_Parameters/29mammals_noncoding.ECM
deleted file mode 100644
index 2e3e718..0000000
--- a/PhyloCSF_Parameters/29mammals_noncoding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-2.78592743423
-6.58600444004 3.19341169223
-1.63519457982 12.1399355041 2.45567860959
-2.43476285124 0.137196047767 0.462787891603 0.0687994720539
-0.0828676812999 4.64297827314 0.0583439047427 0.114333277922 4.54770228198
-0.569910594763 0.269905137878 10.0658717921 0.227536068622 36.0992488386 10.3039899411
-0.0485017841297 0.412819154555 0.0211222634573 2.74491138612 2.97356015436 14.4767642696 13.8730044691
-4.91172089731 0.155166943916 0.607308551579 0.0926673262207 2.93090865811 0.0568018331327 0.563736806771 0.0419502454502
-0.110594870229 14.1973016288 0.227814935065 0.348821740023 0.0698012930426 4.35673029912 0.320289189969 0.205259373689 3.19849897319
-0.200634258787 0.0561388860069 9.29335938844 0.0929695932917 0.395913544434 0.0764056737434 8.35592589299 0.0734485882052 10.2333897454 3.31735868963
-0.13798910766 1.0340072599 0.318823468155 10.7213291459 0.0794339571607 0.150236344311 0.308812958798 4.11390908902 2.34629268324 13.7678588818 3.75348569698
-1.61163899145 0.0903822534676 0.0978724405796 0.103846672592 13.0480744395 0.227582308607 2.33026717206 0.158960500271 2.75288101677 0.0415967285977 0.155011835538 0.0774147142431
-0.0539412039354 2.7175215174 0.0197134073579 0.160319614896 0.188046082887 17.3910431275 0.852712504949 0.990756643627 0.0714613184066 4.0085387173 0.0637586828172 0.239230657001 3.72498943433
-0.115504297981 0.0554316110801 2.62956148456 0.108596913546 3.44821535373 0.624122455894 46.1826203189 0.819390424217 0.144340307998 0.0767389836681 3.45253752203 0.0918946223283 11.0581166867 2.78890551354
-0.0686425149198 0.126358582519 0.0353234891621 1.62786654769 0.112834294186 0.366312347819 0.910925474064 10.8159929664 0.0420270072454 0.121652373835 0.041021549888 2.70393912639 1.97744280002 8.57968016608 3.32159829656
-2.7544269435 0.0893651329767 0.147541427462 0.045588254393 0.13118461025 3.18524470568e-05 0.00511362108266 0.00177951014407 0.415950418678 0.00274376193493 0.00295069255731 0. 0.0490110518677 0.0109095971916 0. 0.
-0.0792482672501 3.8269663053 0.0600975342331 0.169229443099 0.0235434410828 0.20555593481 0.0187169473997 0.027489303549 0.00704240140764 0.842055408475 0.0204804845935 0.00228597224206 0.011244526864 0.0757896416031 0. 0. 3.49147912066
-0.140350659206 0.0519225842332 2.88395589756 0.0273793218983 0.0160717268365 0.00476194914635 0.256665151464 0.000945031287224 0.0457491179596 0.0221450577789 0.598936842192 0.0157356154024 0.000732141038617 0. 0.0653627423271 0.0024299228541 10.7164632866 3.57233983814
-0.0420703782816 0.245254684763 0.0661881569729 3.31052265197 0.00921779748141 0. 0.0187176169492 0.0941345819645 0.00889233349389 0. 0.00988308290204 0.825507301736 0.0116464934505 0.0265891275072 0.0121580600248 0.105930373584 2.27706263405 16.0355075221 2.99806680412
-0.0835624220006 0.00882220161046 0. 0. 3.08974563007 0.122047945762 0.580194800746 0.0527490707359 0.0735023766671 0.00433095387463 0.0343457304593 0.00511087269641 0.0846597799348 0. 0.0288920646816 0.00160328304007 3.89374822857 0.145724186109 0.859411475778 0.0977710846653
-0.0154152275448 0.104820298736 0. 0.0105463060181 0.115102782565 5.17009625533 0.237854650192 0.172608828294 0.00557693962982 0.118368017498 0.00724878346524 0. 0. 0.182319021431 0. 0. 0.138898774156 5.03284649814 0.138658093089 0.165678358789 4.79323321106
-0.00482910140346 0. 0.20777458312 0. 0.532995768631 0.254053586795 16.2610321 0.173403286842 0. 0. 0.157481114874 0. 0. 0. 0.394080739918 0. 0.69328323564 0.320689384456 9.88649042287 0.167025974959 34.8139406207 10.1133870094
-0. 0.00961312458577 0.00777720146138 0.0421416632552 0.0668430982448 0.316055827456 0.310161085324 3.80578081572 0. 0. 0.00286341134589 0.0655755234675 0. 0. 0.0111015655273 0.0940823246107 0.0501235340082 0.388529007176 0.100853422779 3.47803826662 3.01358288946 13.5549050105 9.5786073322
-0.468309814243 0. 0.00422239547645 0. 0.26830641753 0.00846178333649 0.154305577789 0. 11.2231238988 0.279262732154 0.668330937867 0.193652679992 0.219677620446 7.2077574577e-05 0.00604055276834 0. 33.2452989031 0.811222421625 2.55659342609 0.452160447674 7.64549509172 0.263216471122 4.7802784332 0.143871982185
-0.000860877233951 0.834462206337 0. 0. 0.00360228322614 0.414239512028 0.197936924501 0.00823935352163 0.11774285457 11.2493424316 0.201884259842 0.497799451235 0. 0.266084682123 0. 0. 0.266110848103 34.7258580282 0.547536957554 1.46118924155 0.160338489022 9.08023328703 2.77572496514 0.635232621196 20.7884238597
-0.00982618500386 0. 0.591865235112 0. 0. 0.00218531337504 1.27017090395 0. 0.339648545761 0.16161338633 9.56757283704 0.183239415868 0. 0. 0.190549769126 0. 0.939489900239 0.401541837309 30.6896731945 0.378631582678 0.49544403824 0.338076522141 40.5444710727 0.154867530415 51.5670070065 18.1748961464
-0. 0.00305450479455 0.0135564060988 0.917987071428 0.0121496291976 0.00940515686116 0.119119559264 0.323445066476 0.137627082052 0.973331878132 0.317403241123 13.7268039631 0. 0.00385237606388 0.0129442098625 0.2243721539 0.436381800076 4.66762939214 0.890960051922 46.0687746218 0.159821879484 0.606560651364 1.3124413836 8.44478548018 12.4665171004 49.6206423643 16.2525872954
-0.0480997542122 0. 0.0120069171917 0.00705871640247 0.365898539349 0.00331565177772 0.00828798187583 0.0190617177772 0.0566983820258 0.00206195136388 0. 0.000851243591405 4.13290256325 0.0778480013042 0.257064930071 0.0532942502359 2.58623674767 0.0627896589555 0.130295452685 0.0607415410117 12.6708354607 0.127040124001 2.19987609742 0.174617163404 12.8946521218 0.0747252598411 0.446429410446 0.0977030126566
-0.00562265261444 0.0764307547465 0. 0. 0.0063414974605 0.380861788353 0.00753424639752 0.0220559286448 0.00980976134525 0.101156083167 0. 0.0138619086514 0.072833456771 3.75912497016 0.0471465843163 0.106431837705 0.0803441627835 3.285182125 0.0552749886049 0.164538257304 0.2503607233 12.1799982117 0.873441856704 0.770053907325 0.397759952713 10.5237799774 0.22377862705 0.742945113248 4.04528522945
-0. 0. 0.0539015946056 0.00278364992127 0.0377957707833 0.0135963635668 0.89440013158 0.0147550321805 0. 0.000295662566089 0.101859214026 0.000945192222413 0.107777801947 0.0455856315413 2.95431984048 0.0299580499308 0.0692407005928 0.0777213018462 2.8342950611 0.0597295499215 3.20392772547 0.525791072418 30.2914067842 0.591091345872 0.778259117844 0.196799800294 9.7436291249 0.250287033284 14.0153836355 3.34075289278
-0.0029775553938 0.000481714381558 0.00995582674459 0.0354561987446 0. 0.00988402515618 0.00175895315694 0.319479264747 0. 0. 0.00856538884321 0.0181925584499 0.038841902373 0.144236561331 0.0680763995227 2.45864879147 0.0532891365325 0.207694885915 0.0544091024245 2.62133140043 0.124628865738 0.386482949994 0.605612447182 9.29643383867 0.193490205147 0.508707708341 0.224730774419 9.95732384776 2.2284772758 9.79481604528 2.83331650296
-6.56858255082 0.157040779976 0.412175038103 0.0941892466145 0.22602139234 0. 0. 0.000432028561943 0.578215659146 0. 0.0122850462384 0.0100014809361 0.11167679813 0.00640756227736 0. 0.00161147255275 2.46904674823 0.0456773806562 0.15229360324 0.0314539380676 0.0534554009708 0. 0. 0.00927397630364 0.447179203281 0. 0. 0. 0.0367299291555 0. 0. 0.00903617543561
-0.154254426169 12.0194888817 0.188385564082 0.404976306527 0.0330397145777 0.450121271064 0.0489176001655 0.0370399636967 0.05094694887 0.990991883141 0.0180840722072 0.00384380211183 0. 0.169457512386 0.00819708281146 0.00870799638103 0.0573145148162 3.61306377769 0.0855272437255 0.154782328737 0.00748232676517 0.0881927464735 0.0049964336753 0.012854379142 0.0301713814632 0.72400213014 0.00648062632878 0.0198374976478 0. 0.0571707574935 0. 0.00247035561626 4.34813916207
-0.227788108235 0.0799299082191 9.79896923451 0.103053796284 0. 0. 0.78255650198 0.015579837746 0.128340355924 0.046279605209 0.779068029741 0.0225234611853 0.00602103326625 0.00493313737968 0.161693747513 0. 0.0772646124819 0.0784651311818 3.39842393239 0.0430785142297 0.00319153334055 0.0200545515437 0.226232620884 0. 0.0820883049329 0.0265643135942 0.866371736819 0.0183432125543 0. 0.0250462788848 0.0482691177232 0. 10.1583124061 4.45404934624
-0.107881419785 0.624537506527 0.143524792543 8.57913984856 0. 0. 0. 0.243607905648 0.0376568369585 0. 0.0123913692603 0.977051019802 0.0286899775315 0.0401590208837 0.0222659759274 0.159355783736 0.0382060716859 0.180359387973 0.0471829513688 2.82761809762 0.00499074984672 0.00488669031459 0. 0.053752763036 0.00691320221159 0. 0. 0.829310276526 0.00323386746488 0.00593988613076 0. 0.021522244845 2.40542589088 19.5417991861 3.75671940857
-0.12834113079 0.000631024810323 0. 0.00370534372453 12.9755000578 0.249546857178 2.2428079352 0.16858926865 0.167087689576 0.02383686429 0.0439490546363 0. 0.655221811919 0. 0.0906015436812 0. 0.0942550375717 0.0144616778276 0.0351737751326 0.0112630245205 3.31439870246 0.0682789714328 0.43347001132 0.0516315018829 0.281101289081 0. 0.00916726942431 0. 0.230196247012 0. 0.0403187341028 0. 3.34331662861 0.0971515456628 0.781046975592 0.0872172134872
-0.00147272373388 0.231637836881 0.00034595435521 0. 0.239177344728 19.0321903198 0.682121242987 0.58023907979 0. 0.362869697142 0.00491708358301 0. 0. 0.711707470265 0. 0. 0. 0.117504471461 0.0121911148736 0. 0.111229457943 4.4199412059 0.306313105926 0.250843260075 0.0151977356619 0.530844103954 0.0200689115308 0.0183915886966 0. 0.240685558284 0.00716322812369 0.0025539038592 0.0720097295311 5.06653931434 0.0792452953844 0.173890272432 5.19879437497
-0.00584157821457 0.00981900567978 0.501161696619 0. 1.70123466465 0.457547343541 50.4645366614 0.516148327511 0. 0.0476676401932 0.633934534495 0.0154289667092 0. 0. 1.41536414927 0. 0. 0. 0.204730338169 0. 0.317299779043 0.262826758155 18.4505803511 0.196113664614 0.541248280455 0.708760121856 2.67512354266 0.181899268955 0. 0.0231037960197 0.546155668327 0.000709150651529 0.690762503945 0.31210703086 10.5525498701 0.251830847873 35.1062120167 9.24273876406
-0. 0. 0. 0.121219395501 0.173500127538 0.732707640921 0.967955772341 13.9456042856 0.0142592910443 0.0661696110665 0. 0.204245055816 0. 0. 0. 0.335284741585 0.00120828759341 0.000770045425943 0. 0.0762604530737 0.0474049343197 0.13927094387 0.17189083881 3.32796677053 0.00836207794708 0.0417538220573 0. 0.302116718197 0.0100602962328 0.0446388722815 0.0203652287305 0.233869284809 0.0606199672857 0.338796931585 0.101822437413 4.01419582769 3.59460760499 14.1246349223 11.2167674822
-0.305915296181 0.00387290678178 0.0283900521037 0.000168284862403 0.103145819992 0.00682213703837 0. 0.0069105622856 10.8506353065 0.143162318594 0.606240184459 0.101575092269 0.174857843309 0. 0. 0. 0.379874892195 0.0135188840515 0.0283892888726 0. 0.0866224362335 0.00680603807226 0.00423745111466 0.00363287262812 9.81027429037 0.148538407691 0.484853262019 0.110578511 0.0796243853214 0. 0. 0.00845303045711 10.3935417311 0.412884043486 0.946160277011 0.227669238572 3.3309009611 0.119274560321 0.88047907047 0.0227475613468
-0. 0.464728116785 0.00308746578916 0. 0. 0.199886815768 0.0125122178155 0. 0.180705625194 14.0947925672 0.252641224242 0.547186742156 0.00366396625264 0.171718229624 0. 0. 0.00256090204409 0.636746675067 0.00960274978496 0. 0. 0.146270560184 0.017249053838 0.000316098567487 0.285378211168 9.24014013085 0.305949089687 0.718193549725 0.00312219292709 0.0773155035163 0.00955123407451 0.00198881136206 0.144809836717 19.3056982127 0.243438772992 0.717540645624 0.151265661762 4.92211351063 0.504292174964 0.361202903197 4.49006892216
-0.087451981084 0.00842338129519 0.392290124716 0.00139847334073 0.027044155128 0.0139774661244 0.638507439152 0. 0.556961222423 0.13882239836 13.5150909923 0.166561693382 0. 0.000756205239141 0.188613940486 0.0144571766857 0. 0.0167131216833 0.532700702004 0. 0.0320969284915 0.02326036368 0.33353910299 0.0105399567991 0.600959423559 0.261734253996 10.1713107581 0.238032618109 0. 0.0199740705072 0.139539542607 0. 0.57217221198 0.216745519905 12.1940990023 0.178514589947 0.592929555019 0.137803794033 9.00742699427 0.129076334826 15.0682981859 4.38093295403
-0.00986884400482 0. 0.00714910857349 0.367847444687 0.0166385250797 0. 0.0210436940204 0.155361065995 0.170480142873 0.717744368709 0.312410321473 14.2913544055 0. 0. 0. 0.120387628276 0.000292448770617 0.0183996746206 0.0118009941572 0.612374176547 0. 0.00880187636181 0. 0.0810806480573 0.211302552782 0.467407092312 0.246211628106 10.2837358385 0.000671732121191 0. 0.00544000385484 0.0566344860084 0.152106508386 1.52277218051 0.373232827818 17.3834665486 0.088560075074 0.196177361201 0.380258104422 4.36085934855 3.18437134081 18.8510841125 5.14520276184
-0.140188964873 0. 0.0151920530983 0.0153098032383 1.21840798939 0.0200771021955 0.013828583721 0. 0.298711554809 0.013282000644 0. 0.0167204186218 17.9923373684 0.232696535903 0.984057841766 0.142431651545 0.0594158796265 0. 0. 0.0137989912116 0.12040947048 0. 0. 0. 0.311981750261 0. 0. 0.0153840209357 5.10599693577 0.060058085426 0.192867675621 0.0439372706467 2.29950758326 0.107264463125 0.122983893731 0.0764090093826 14.9222894425 0.206524497422 2.86780466508 0.159494635211 3.80306505617 0.0334445588107 0.325190963647 0.151947105188
-0. 0.207669384822 0.00189721251573 0.00553485636554 0. 1.52235490048 0.0214143749539 0. 0.0145960413034 0.32793862831 0.00705339082687 0.0457414280331 0.268825669828 19.5855144187 0.172589090786 0.409132980287 0.00554476834153 0.1076229582 0. 0.00240622379516 0.00804850693051 0.206710892449 0.00818525905021 0.0258785461201 0.000760289922815 0.311325590969 0.0118866698369 0.0359508735092 0.0658382096549 4.45507109341 0.0857620092788 0.184552789051 0.0797894222264 3.9481700794 0.0581303052042 0.16676938791 0.269272847366 19.2295897427 0.73594417452 0.978955856639 0.125122027026 5.05506631457 0.0973955577781 0.428928296452 4.82612419107
-0. 0.0187625080249 0.20621297091 0. 0.215475351118 0.00846225603838 4.56136559967 0.013451185552 0. 0. 0.397015828795 0.0315660915039 0.710900933484 0.189198512858 15.8999065484 0.160971621735 0.00628354924211 0.0161321594066 0.0723294391078 0. 0.0117968393571 0.0236982978919 0.433978791462 0.0143668477172 0.00817272892114 0. 0.316429262812 0.0198151164693 0.153450120451 0.0773647680014 3.50455393025 0.0618333636644 0.166520883576 0.0976239406896 3.24864400372 0.0837585483462 4.31483949393 0.648545185882 34.2984034321 0.819405183509 0.266907960006 0.122705495208 4.9548758249 0.199588957896 16.6777618142 3.57079368656
-0.0124471120403 0.0272087327615 0.00155187404069 0.125233490839 0. 0. 0.00895158073499 1.06491980832 0. 0. 0.00715827430729 0.414147587417 0.180211554628 0.623836427105 0.241870122255 12.2059095361 0.00658301673438 0.0125565086887 0. 0.058709761226 0. 0.0151374969764 0. 0.0571779694018 0. 0. 0. 0.285486228445 0.0388450921219 0.0813947228349 0.0513523513133 3.2140738289 0.0593540209486 0.20347229722 0.0794482293815 2.69456850247 0.178836946955 0.472832758926 0.844501463372 14.1545062979 0.111742476081 0.237178456371 0.101985554242 4.60324813954 2.89376135367 11.9743180489 3.79180138166
-1.85192230366 0.0693790157141 0.106402926385 0.0608024713276 0.0436329895839 0.00107179024991 0. 0.00390362798834 0.0808916951667 0. 0.00433532953897 0.00866563775885 0.115681448961 0.00244887631965 0.0122927075949 0.00307380568859 8.32999782753 0.126029974553 0.460073198431 0.120793949772 0.115673876081 0.00271733825314 0. 0.0047754974823 1.70598507161 0. 0. 0. 0.178363763058 0. 0. 0. 3.00967295837 0.0788741164722 0.103306012195 0.0385900978126 0.0418440750087 0.000122216607141 0. 0. 0.136527075723 0. 0.00566931440696 0.00251708868497 0.105111201226 0.00419097275684 0. 0.00485924133915
-0.0549154541207 3.03224643496 0.0428847156108 0.133703532383 0.0202336985508 0.140949578231 0.00900894226931 0.0250639669303 0.0048425257738 0.128268392937 0. 0.0115912491402 0. 0.0827492946191 0.0160830178931 0.0111482505672 0.24141129768 17.0668338244 0.206414807432 1.00003095748 0. 0.311079374201 0. 0. 0.0145169454496 3.04001941638 0. 0. 0.0331464951668 0.127673716292 0. 0.00965378489659 0.0589629693926 4.9678210571 0.0571303284523 0.248965454673 0. 0.0493384833039 0. 0.00239893485768 0. 0.230692698695 0. 0. 0.0422766872909 0.0920739167052 0. 0.00133058864128 4.29048773271
-0.101517404125 0.0343491447041 2.27313430775 0.0554319415663 0.0210799624769 0. 0.0821407508018 0. 0.0329140841083 0.0175891419447 0.184042580709 0.0134375573067 0.0238409003486 0.0035029716646 0.0557026739775 0.0110516944291 0.449722568316 0.159306400865 14.0744663646 0.253068276327 0.0121885022963 0. 0.46176793784 0. 0. 0. 2.26889710649 0.0224957316916 0.0300941303173 0. 0.127312288213 0.0124284578828 0.147104057547 0.0639672848033 4.10550614777 0.0825088546667 0. 0.00813367565483 0.0729990890482 0.00689730236854 0.00599463654984 0.00116099561615 0.127372168082 0. 0.0374612069485 0. 0.0641437950891 0. 8.9067174944 5.26727004749
-0.0634587178075 0.164446070886 0.0389132563161 1.99737117863 0.00282180434061 0. 0. 0.0774665806316 0.00868272364467 0. 0. 0.14300480576 0.0283602289446 0.023588473164 0.0105163231084 0.108103678501 0.14614846102 0.666021762766 0.113838834063 11.0648283984 0.00197426866049 0. 0. 0.151913570895 0. 0. 0. 2.32294437496 0.0235773309743 0.00278112713673 0. 0.0949326087762 0.0380151845809 0.268793047678 0.0730886004517 3.71246743415 0.00918507483228 0. 0. 0.046609892172 0.000579927622744 0. 0. 0.246691875092 0. 0. 0.0121177322723 0.0858990441967 2.11327446775 18.4850191794 4.13292946501
-0.0454886898633 0. 0.00608734618322 0.0016151106611 1.98767482394 0.0527684920215 0.210535924194 0.0536827040618 0.0420252303951 0.00588687958894 0. 0.00066928368527 0.154395852194 0.0186920369151 0.0166574139067 0.00359586340379 0.217447880351 0.0227868287022 0.0421451566115 0.0208986894064 9.79650280147 0.141230586854 0.926171845582 0.120065761888 0.483172002247 0. 0. 0.00519099356137 0.715526565594 0.0222416221031 0.134580169449 0.00972160824641 0.0897851212753 0.00130881885851 0.0166280705267 0.00142630838426 3.27162515516 0.0628333601292 0.197931476966 0.048359439559 0.0588224129141 0.00505944834557 0.00615546676895 0.00148701250206 0.266009222204 0.0152178532484 0.0375628245831 0.0051968742038 3.10505375421 0.0921325112832 0.494869259187 0.057954196026
-0. 0.10375058827 0.00895116015077 0. 0.0488589220103 3.23100578316 0.102852989537 0.0992758415717 0.00335181630037 0.0273009328923 0.00169258214181 0.0021720572221 0. 0.232980339437 0.00106980475086 0.00264157628508 0. 0.26583153922 0.000454703033684 0. 0.257433667291 15.0764556279 0.475982048683 0.612573787407 0.00127451046421 0.854042044641 0.010430565389 0. 0.00892929688638 0.951084070718 0.0305638428038 0.0291998661887 0.0103191984664 0.128858289569 0. 0. 0.065182747413 4.50215646981 0.141527513151 0.149054910944 0.00381937078567 0.113453281622 0.001544157525 0.0163706083748 0.00216907007472 0.425752972949 0.015172048448 0. 0.090884506002 3.94010288909 0.0822907479248 0.143448913247 3.94613664994
-0. 0. 0.17631552808 0. 0.541360468027 0.191544494061 12.9177085683 0.19141559287 0. 0.0077944473201 0.150455878283 0.00425317702852 0. 0.0157869881978 0.441933004077 0. 0. 0.0027451427081 0.813018154846 0.00629319249643 1.82975513433 0.614583853488 51.1610794325 0.680185321452 0.680808083455 0.482636692887 4.63806009414 0.190710087212 0.0255917056117 0.0788586973079 2.51305147376 0.0223075594435 0.00821325826844 0.0118380563154 0.387025791712 0. 0.731484041325 0.285688609037 20.8451309518 0.274016052876 0.00281011791009 0.00386208802479 0.271546419145 0.00882315670346 0.00814020975936 0.0353938170827 0.810935235854 0. 0.719888232788 0.317147489876 13.0266914958 0.209522978429 42.3850162604 9.79461368788
-0.0087248402762 0. 0. 0.0388028267706 0.0544601295802 0.167312785248 0.128592356538 2.38092749378 0. 0.0136994402801 0.00208139452493 0.0426199782934 0.00783642738883 0.0384048442744 0.00683574723219 0.0935666624087 0. 0. 0. 0.143036392756 0.145858915325 0.559774631266 0.33719131026 10.2273191348 0. 0.0102269689265 0. 0.517426541896 0.0328635291206 0.129812799345 0.0471040742776 0.610397195218 0.000429440743348 0.011649854694 0.00926334868987 0.0765859221309 0.0363917814826 0.183338074344 0.124125168139 3.20750017235 0.00108884405549 0. 0.00709815195924 0.0494190173154 0.00181848086765 0.0479824177173 0.0093094534245 0.152251675425 0.0411876400152 0.292750010335 0.0548809377424 2.76386105945 2.22257855879 10.8628930542 11.1413927804
-0.0760250538715 0.00700421836525 0.00866648194089 0.00435986152497 0.0540827397947 0. 0.00391636097676 0. 2.23283740478 0.0477354909763 0.119722467157 0.0512077291182 0.0582828087579 1.84450841094e-05 0.0212705156613 0.00347637118437 2.3444294707 0.0387767742541 0.13871448845 0.0161289290258 0.404228283439 0.00670727864772 0. 0. 42.6257611554 0.196792049636 0.929369177618 0.221868715408 0.489384967201 0.0168388452585 0.0398846300782 0.00512133729322 0.141547888798 0.01482634149 0.0254244831056 0.0210919924281 0.052656552978 0.0045449028405 0. 0.00716446340832 3.97333759429 0.0632861016144 0.142570150692 0.0496143346137 0.0894119344944 0.00143211187454 0.0202383137864 0. 7.73808578168 0.269236099363 0.714173337151 0.148482271426 2.27460367338 0.0612555216636 0.506093630745 0.0397805658951
-0.00335948534388 0.166811362037 0. 0. 0.00163245648269 0.0869115764053 0.00145131831787 0. 0.0366620864637 3.60332218814 0.0569434943281 0.162544597515 0.0101552271511 0.0862933628427 0.00997209836899 0.00614153543388 0.0143543479853 4.36503411421 0.0404557851182 0.0829539975305 0.0279204536382 0.591301367783 0.00185763764181 0.0353923010908 0.707502598715 35.0815245817 0.426555047875 2.24727598232 0. 0.78485920919 0.0292031839397 0. 0.00180239766365 0.267951329933 0. 0. 0.022120304753 0.153353668133 0.000864485448678 0.0247743262171 0.0575696359221 5.18508259902 0.0736462414271 0.260305286917 0. 0.0968691355895 0.0138850315085 0. 0.138838219983 15.4052198753 0.211229746893 0.59906033101 0.0515508895799 3.32129727819 0.27694555062 0.169235739566 3.26958964513
-0.00315205571841 0. 0.119858587196 0. 0.00965168066826 0.0035616261757 0.172854630017 0.0111622195472 0.148179057638 0.0410147698761 3.03403380457 0.0541614715481 0.000563097911286 0.00489601991308 0.0940862857026 0. 0.0217924575442 0.0129881466992 3.25778010704 0.028965386855 0.140292613723 0.0293657555445 0.484832092218 0.0345007483117 1.88077579645 0.325730094754 34.7467555829 0.561059668728 0.0149027296968 0.004157980621 0.846966791909 0. 0.00260535739846 0.00911471818673 0.243798651713 0.00180356314893 0.0271269185037 0. 0.165004321262 0. 0.256825819514 0.106302800681 4.81357755061 0.126885076615 0. 0.00848265494272 0.154125731765 0.00945871747585 0.250541358334 0.119835918567 12.7448935237 0.0835390299321 0.403266783084 0.0841562495728 7.56357418722 0.074228113326 9.80967504055 3.27871254942
-0.0103556018408 0. 0.0011816109884 0.113633952737 0.0118785975884 0.0125379387686 0.0104722121626 0.0788538391735 0.0533571273803 0.168525336551 0.0621319164848 2.95416541639 0.00242580625115 0.00146091373886 0.0100088353982 0.0663269954569 0.025369860271 0.22434540866 0.0343720715155 3.46956439231 0.0131447148201 0.0215679445196 0. 0.405073060412 0.556475593543 1.67817531836 0.545977564286 35.7061721804 0.0116939219962 0. 0.0183565441501 0.460092201302 0.00074238992399 0. 0.00579123310552 0.191431140758 0.00108942651377 0. 0.00297715155179 0.0726203290199 0.0534914770371 0.244946229554 0.115786843235 4.52310415665 0.0183960883988 0.0315494387759 0.0220921785763 0.138487740821 0.1498026314 1.20488541655 0.374457402337 13.0091599938 0.0516036232577 0.0991638339044 0.272220445341 2.92620666289 1.97016748469 12.8367518412 3.06689854949
-0.125733907422 0.00436972047946 0. 0.00353647416495 0.154469830792 0.00266701849446 0. 0.00747470692383 0.0428772107152 0. 0.00651486169726 0.0038758756817 2.12423784206 0.0396390768058 0.119676126216 0.0613113344595 0.0934530446047 0.00100486685685 0. 0.0099634245887 0.255867138922 0.00432278305936 0. 0.0033608119693 0.709920584226 0. 0. 0. 8.76488154869 0.108747954622 0.443139983406 0.108862992226 0.0592114869062 0.0021774332275 0. 0.00310486942886 0.146282632535 0. 0. 0. 0.0932659832328 0. 0.00226265698012 0.000437508156089 4.17379919929 0.0813437704349 0.132209517747 0.0702854009238 2.40862742376 0.105698824568 0.178043076253 0.112608616225 7.73500464643 0.139203650826 1.69519019403 0.0810436611991 3.09662064828 0.0385681117838 0.111269521996 0.0489347359831
-0. 0.0609872263047 0.00933842716192 0.000948328196705 0.00374889004249 0.15253027804 0. 0.00952953880298 0. 0.0572009319937 0.00837445788167 0. 0.039770266434 2.41207882465 0.0293270824384 0.0921186610183 0.0023267112147 0.166351748457 0. 0. 0.00216144889003 0.575616954777 0. 0.0148745203406 0.0015650455934 0.679423704369 0. 0.00801061566315 0.145315119018 10.0943879764 0.149402556355 0.412657654327 0.0098602040256 0.0757051733271 0. 0.00455281594064 0. 0.147595745939 0. 0. 0.0110837912317 0.0745131511445 0. 0. 0.0561028712269 4.3424873055 0.0450383438033 0.159410591003 0.0585146883274 2.37207001639 0.0359509499726 0.111435198427 0.139595758963 10.3724187684 0.454590596885 0.57005580893 0.0887282266365 3.33992114556 0.0553897405699 0.22588766036 2.97958638551
-0.00884501661763 0.00822019802007 0.0567978754604 0.00153576505523 0.0229617810989 0. 0.413469077511 0. 0. 0.00113601739474 0.044920740573 0. 0.149636695726 0.0400778032714 2.29007985767 0.0437062887372 0.00940439830966 0.00173005848216 0.0763644279553 0.00198872511095 0.0318057542977 0. 0.959001128734 0.00686764151641 0. 0. 0.69893106591 0.00227248143697 0.431545896385 0.0834627522463 10.4903910182 0.146065626468 0.000137938557632 0.00373652129917 0.0823752461755 0.00739167528714 0.0129600361132 0.00022436885351 0.262261843382 0.00530115881603 0. 0. 0.140415389848 0. 0.238536586546 0.0597236814982 3.45822422879 0.0896154132005 0.0942643358202 0.0515910631369 2.61062231714 0.0494450785923 2.33496905686 0.373558427272 32.9662411021 0.412373005557 0.212265840597 0.0992654681453 3.89618387928 0.130112261982 8.22472527244 2.42902491323
-0.0340591581891 0.012593100295 0.00323337401409 0.0685872694336 0.0105214233326 0.0112649491742 0. 0.139366554692 0.00843066624747 0. 0. 0.04777707531 0.0625981591408 0.106881090187 0.0405634111512 1.64631472157 0.00949918338782 0. 0.000604291454891 0.114526662756 0.00372564611188 0.0921689564017 0.00746205552917 0.200492727878 0. 0.000282518921569 0.00466192088992 0.57052517656 0.101107481918 0.229025687261 0.137716530929 6.54507791785 0. 0. 0.00460225123511 0.0532545275311 0.00269316586069 0. 0. 0.107055482973 0. 0.000186005327605 0.0156408180693 0.0835639144202 0.0562034194714 0.152712853513 0.0782557471793 2.78045654664 0.124962081181 0.143982562493 0.0473902723691 1.60216771614 0.0746132290942 0.308205816866 0.464655090752 4.89934528676 0.0455440791486 0.127170079697 0.0816795449481 2.41190068084 1.8126811407 6.5182404037 2.72920933193
-
-0.0357983654718 0.0146634321466 0.0209916853044 0.0241608300459 0.0196605104347 0.0113786862615 0.0029009138093 0.0163015785126 0.0225609755057 0.0145991965297 0.0181825729424 0.0164781957079 0.0186856678405 0.0130405682814 0.0179309987722 0.0240968720195 0.0181775551111 0.0146957289426 0.0210180199751 0.0178777837456 0.0179375335248 0.014026410045 0.00304930001685 0.0181980546371 0.00237235102112 0.00247910724881 0.00304553476624 0.00292174613484 0.0129216428963 0.016886060241 0.0212194293029 0.021001239545 0.0207025677211 0.0101079314077 0.0168739180256 0.0130368421188 0.0145312058205 0.0117191223335 0.00248094305692 0.0145761834505 0.0160538354021 0.0117605522361 0.0140380390381 0.0114567437712 0.0112780796487 0.0101486396189 0.0148519084459 0.0147005486842 0.0206773071958 0.0111337585868 0.012890738691 0.0187059909187 0.0197741432688 0.0160489156219 0.00237751747496 0.0226108300737 0.0197730187728 0.0145713864549 0.0179588059761 0.0198394530312 0.0208205335746 0.0208303362555 0.0183984258157 0.0360132307673
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/49birds.nh b/PhyloCSF_Parameters/49birds.nh
deleted file mode 100644
index 86e15d2..0000000
--- a/PhyloCSF_Parameters/49birds.nh
+++ /dev/null
@@ -1,145 +0,0 @@
-(
- (
- (
- white_throated_tinamou:0.14713848271634652,
- ostrich:0.0669049215898666
- ):0.0456207,
- (
- (
- mallard:0.10028745513816674,
- (
- red_junglefowl:0.03905575798189643,
- turkey:0.04493722486181307
- ):0.11314680730786908
- ):0.039436008777786025,
- (
- (
- (
- american_flamingo:0.031174620859996834,
- great_crested_grebe:0.058417896636777364
- ):0.01296753085832649,
- (
- rock_pigeon:0.09633671022177494,
- (
- yellow_throated_sandgrouse:0.07165064326126222,
- brown_mesite:0.08712456250758675
- ):0.002719488343977022
- ):0.001410999566142196
- ):0.0009273225223553452,
- (
- (
- (
- (
- red_crested_turaco:0.07078577990315871,
- houbara_bustard:0.0731475442885532
- ):0.0014445948503099305,
- common_cuckoo:0.11149034290960456
- ):0.0010580846929490806,
- (
- (
- chimney_swift:0.09078444347276869,
- annas_hummingbird:0.11256371899621678
- ):0.020355877022882312,
- chuck_wills_widow:0.06966131682334
- ):0.0037924287513986035
- ):0.0011276894283190548,
- (
- (
- hoatzin:0.07556944687975468,
- (
- killdeer:0.06016638160099794,
- grey_crowned_crane:0.05705645035504941
- ):0.0015091427770182256
- ):0.0009224455197761668,
- (
- (
- (
- white_tailed_tropicbird:0.059061515479716734,
- sunbittern:0.09470289401860604
- ):0.0031780841974596956,
- (
- red_throated_loon:0.04446615576907132,
- (
- (
- cormorant:0.06390072121783605,
- (
- (
- little_egret:0.0561921453883497,
- dalmatian_pelican:0.04165214732285272
- ):0.001331123705788551,
- crested_ibis:0.03983191693545154
- ):0.0009704851624009051
- ):0.0016067246418978304,
- (
- (
- adelie_penguin:0.013529809074939583,
- emperor_penguin:0.010909750342265476
- ):0.02141598523903805,
- northern_fulmar:0.034160583031281784
- ):0.0011916471746770939
- ):0.0018991936576422622
- ):0.002086441791048191
- ):0.0011932377882976901,
- (
- (
- (
- turkey_vulture:0.030069867646272997,
- (
- white_tailed_eagle:0.0011420478190177913,
- bald_eagle:0.0010021438096430545
- ):0.042651569203343
- ):0.001976623642640992,
- (
- barn_owl:0.06754049962740655,
- (
- (
- cuckoo_roller:0.0669564258176255,
- (
- (
- rhinoceros_hornbill:0.09978173141421996,
- (
- downy_woodpecker:0.14337011012642253,
- carmine_bee_eater:0.10295692038068512
- ):0.003899638626102539
- ):0.0025293333293138287,
- bar_tailed_trogon:0.10483156204618177
- ):0.0012225438504183434
- ):0.0013579825674525498,
- speckled_mousebird:0.12047156157154118
- ):0.0006216626324594806
- ):0.0005988663497087942
- ):0.000803038200607886,
- (
- red_legged_seriema:0.05500194156181956,
- (
- peregrine_falcon:0.07623456175620913,
- (
- (
- (
- (
- (
- medium_ground_finch:0.03719930529721754,
- zebra_finch:0.041967682103530725
- ):0.024465779960146403,
- american_crow:0.03847367084047499
- ):0.04403125726463492,
- golden_collared_manakin:0.0693007102024994
- ):0.009023297418129851,
- rifleman:0.08356784367257653
- ):0.03887899266813369,
- (
- kea:0.04202072919051133,
- budgerigar:0.058486107104773866
- ):0.052799582285419054
- ):0.0021026337964740738
- ):0.0012887706973270813
- ):0.0015010215404783966
- ):0.004147680965927658
- ):0.0011153877017478781
- ):0.0010103618732958555
- ):0.0010719451106151227
- ):0.0319547592447372
- ):0.0456207
- ):0.055951154,
- green_anole:0.297064
-);
\ No newline at end of file
diff --git a/PhyloCSF_Parameters/49birds_coding.ECM b/PhyloCSF_Parameters/49birds_coding.ECM
deleted file mode 100644
index f894011..0000000
--- a/PhyloCSF_Parameters/49birds_coding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-0.771493279396
-14.5180982851 0.547433994462
-0.829799770357 31.1892114825 0.7020007509
-1.2357249048 0.0591436724948 0.143021129459 0.0723670336788
-0.0491379655094 1.68015082454 0.0198294354489 0.039540785463 10.4536837099
-0.0705620171551 0.0966709944264 1.69743422922 0.142387839362 91.937054195 27.5243026465
-0.0429527042192 0.105163194816 0.0172649210373 2.25040676661 10.8921310832 29.7216988175 32.0319353336
-7.4338524426 0.17080527673 0.354723692547 0.186750900063 1.57462078709 0.053744234112 0.0267286337571 0.0670392311205
-0.15475952294 7.04751773186 0.133727701692 0.272371840933 0.0995168546074 2.91545126347 0.241247972617 0.30307911252 1.14819950914
-0.523684400979 0.193336177917 7.27785844907 0.248082744588 0.28292064082 0.0737402201706 2.22444630107 0.0911973524823 39.1328554206 1.20406413448
-0.173018086183 0.206353768518 0.171683630752 10.768130388 0.0919414494248 0.0323218254172 0.205978125948 4.34740100489 1.16358434945 33.6941468224 1.7233728365
-0.72844506036 0.0408900267574 0.0984268008214 0.0606490247723 6.27625068709 0.108522818556 0.732902667282 0.156984045956 1.27333682927 0.0371320946863 0.190371215329 0.0649658426497
-0.0107338084319 0.332629598166 0.0135926658879 0.022093725551 0. 2.18866127674 0.143671679617 0.121521316476 0.0119565599453 0.549500917257 0.0356995023641 0.0243544304587 12.7843674905
-0.0520823421344 0.0350655628839 0.405289748819 0.067795684311 1.27336050355 0.160287788944 6.57922720905 0.299427412867 0.0786854813099 0.0488940935773 0.960805451861 0.0665927661081 5.34516996652 0.736796631636
-0.0216049508162 0.0160718839072 0.0223163001706 0.605907271879 0.0245681166778 0.0205049564898 0.158269973844 3.87244486996 0.0304252144396 0.0317223740088 0.0589426989831 0.873730975438 9.99938453006 25.8255751638 1.22569015347
-2.18663674868 0.111696040966 0.0634197481102 0.154784667253 0.211944334747 0.0142851196137 0.0249872010961 0.0178329430869 0.632866998477 0.0456544602052 0.155643358185 0.0852409113534 0.114188793132 0.00538347477404 0.0172684858959 0.00982443430665
-0.0806194749382 1.82202603689 0.0700874839516 0.139029576933 0.0180592441769 0.131956497224 0.0167764425897 0.0204819995985 0.0337369858375 0.495354204564 0.0430768582 0.0598964584571 0.00958027358921 0.0336402412939 0.0100876385187 0. 2.33982994684
-0.0813812527058 0.072537901315 0.967025850778 0.0745340778643 0.0311639252932 0.00984056819269 0.180306689601 0.00854548443289 0.0545028256988 0.042940471875 0.398138428286 0.0395461759513 0.0155719958588 0.00453736963474 0.0574916836341 0.00557974117017 23.6795913232 1.61299074838
-0.0890303815424 0.0309711104056 0.075284329732 2.72022205635 0.0173828570078 0.00889347376972 0.0250244061361 0.189896560082 0.0470550538246 0.0369691647928 0.0517741235211 0.814461875725 0.0113513697564 7.49810654027e-05 0.0161305091349 0.0857488913528 2.52155138217 51.8301587085 1.73431675231
-0.0831502869336 0.00623291475441 0.0140485960681 0.00222815351908 1.85271487285 0.0142595343747 0. 0.0240393018298 0.100035548941 0.00744094731676 0.0208705373804 0.00714801356087 0.202643068745 0.00840395811706 0.0485674719118 0. 2.58108992655 0.0610588913053 0.288098926224 0.0640178651307
-0.0121507251646 0.0924520030781 0.00836826924209 0.0186151696838 0.0836537312744 1.54107027962 0.0440270652618 0.131930258067 0.00717636251265 0.120684206891 0.0125595231276 0.0212153052835 0.000324249078674 0.075269096427 0.0148448619927 0.0162954435488 0.135980978245 1.38509214833 0.0582990476554 0.097001138788 10.3565106085
-0.0327561377247 0.0194019854761 0.151645046369 0.0216308024113 0.16219698802 0.0736088846667 3.56703356477 0.0906683018246 0.0211444376486 0.0293098893392 0.213048465069 0.030853222824 0.105229675827 0.0117895396449 0.238615514744 0.00758025850283 0.383949439837 0.217940094945 3.42317049457 0.151800096828 80.196430788 26.5641853165
-0.00712174354816 0.00723985090453 0.00595505344662 0.0975294587912 0.0438607458733 0.0573004108171 0. 2.03540765518 0.0049271871924 0.0089011742123 0.00755042591788 0.131884297209 0.0101448079456 0.00832642054426 0.0156458916585 0.109023373526 0.0378815314904 0.0463207771448 0.0165605454301 1.6138138067 9.1542408524 28.6750081769 21.9548306605
-0.342652952354 0. 0.00831817472204 0.0019578776316 0.0256561801987 0.00396518185496 0. 0.00828598360004 24.819368396 0. 0.692289530387 0.00221688308001 0.0423207748289 0. 0.00421964524011 0.0102462249253 9.72150853477 0.287135700558 0.111035024588 0.161520784401 0.987246541018 0.0268612351287 0.14984953371 0.0013382555295
-0.0274952800589 0.239907400328 0.130619934855 0.0199908101654 0.00651256013327 0.0940574219685 0.0188049255523 0.0154651516836 0.731121345902 1.44205827826 1.47351708949 0.0159273184405 0. 0.0478071542405 0.00524987299297 0. 0.337092192699 7.2223642138 0.298762023217 0. 0.0197476073108 0.971106449371 0.23665637847 0.000783759865199 22.6147561126
-0.126747246284 0.00525348090503 0.431201251443 0.00871397252545 0.00260008330902 0.00505104531015 0.154413324232 0. 1.38751553761 0.0069785180879 24.2115845119 0. 0.0154314907887 0. 0.026146215906 0.00674642096354 0.249262272475 0.264254321875 5.15802336393 0.282622534951 0.100276942636 0.0464677107833 2.8678028547 0.0103939496336 58.2624766604 19.1638370992
-0.0407572307445 0.0541760472627 0.0408884489312 0.594154801521 0.00637997251286 0.0198824741158 0.0398930112025 0.199496998649 0.131755897653 0.18449888875 0.326574404736 2.81319866554 0.014151320102 0.0153460674176 0.00990532258908 0.0946255220831 0.573596562106 0.632515608499 0.283840725565 16.0063596615 0.075905929081 0.0826477869133 0.145510045956 1.80628209641 29.347029641 79.0811920949 24.1343195351
-0.0670321669475 0.000563067043618 0.00709263218583 0.0160730475881 0.397475218922 0.0108774166451 0.0224531700364 0.0117432492443 0.110217799898 0.00741770540948 0.0106037107321 0.00421212203971 6.34377872097 0. 0.30644392794 0.0507575748744 1.9736613358 0.0556021195246 0.102283849299 0.0480436043823 4.00887120044 0.0417641609514 0.653798644135 0.0359958557139 1.53421130077 0.0163428855889 0.117515458291 0.0242819224677
-0.00643748166518 0.0295649828891 0.000637970407505 0.019754645672 0.0030508665228 0.178930335275 0. 0.00883618689765 0.0253554586766 0.0635021784113 0.0114766272275 0.0282686114778 0.159188805299 2.05296843661 0.0831033972167 0.158454009429 0.0790863053832 0.843181005219 0.0366298173461 0.107941366273 0.0245725600104 1.92780227841 0.103817357813 0.139569513175 0.0230997188178 0.954192866331 0.0226992195858 0.144293124685 11.6702094631
-0. 0.000741264056699 0.0321762732716 0.00876551202277 0.0409627203061 0.0066341456828 0.289776596366 0.0104730362024 0.00188148859201 0.00415933999863 0.0531027228242 0.00397499828712 0.277347255409 0.081204120774 1.47530308516 0.0831617109488 0.0348369494271 0.0330910542007 0.514722517892 0.0315293996595 0.448937601962 0.0560895061976 3.50959324007 0.0672410028933 0.000363858402076 0.0325302162526 0.698509928297 0.0222160316559 31.3936914479 7.82675950727
-0.0103057326894 0.0209560410928 0. 0.0432390313139 0. 0.000598674783837 0. 0.331194702356 0.0159021216996 0.0263734927337 0.0229446661305 0.0793998208566 0.0655491795789 0.0771818086854 0.0755945133111 2.56835350509 0.0801848672594 0.0780599264085 0.0459870926371 1.38822655563 0.0245587112418 0.105445060089 0.157688337733 2.56327777985 0.00606283188176 0.0292401665627 0.0516866860149 1.68499310101 9.08011950879 26.1164046404 6.89513673659
-1.52942036217 0.0973183013281 0.0388353247448 0.117166119514 0.201990514263 0.015333596402 0.0128796043445 0.0124927834828 0.391532889031 0.0313292278453 0.0213395537798 0.046335054843 0.111001960231 0.00549068726692 0.0162640654866 0.00404973027084 1.6718235251 0.0500267310822 0.0517100980774 0.0537247281374 0.0619851968551 0.00546186911396 0.00987533716152 0.00386417990485 0.0791417803087 0.0355024148452 0. 0.0324557541248 0.0530512896758 0.0027411404153 0.003400456723 0.00422901561025
-0.0827672478108 2.45968541101 0.0634654669355 0.173632559347 0.0131604282059 0.164795491269 0.0131791154447 0.0351360772548 0.0335412538099 0.474036367211 0.03667071173 0.0671758266016 0.0124420599637 0.0313192578121 0.00897011881742 0.0123210571936 0.0862780006103 0.62622938248 0.0460793037594 0.0418612404259 0.00488689931062 0.0558122415879 0.0175672823754 0.00628262205823 0.00715550696459 0.0910460725338 0.00443029935197 0.0287613924571 0.00313419211364 0.0319575833704 0.00226776365132 0. 1.70115845114
-0.0522505604502 0.0898926251941 1.06240549924 0.112920569564 0.0463514147993 0.0149556757989 0.290216053777 0.0126916204037 0.0444314578346 0.0425138927353 0.346736063384 0.0532746125015 0.0239887410771 0.00428625042153 0.0806840702641 0.00726198943985 0.0617898168537 0.0606229656609 0.929748659037 0.0607814405512 0.0130660362186 0.00815276835162 0.144015583909 0.00475002529722 0.0297003498473 0. 0.132271963252 0.0101996218813 0.00843968014492 0.00444182503798 0.0259434869283 0.00418488182163 13.9895365789 1.74259584965
-0.069879625366 0.0502569650608 0.0601726449853 3.10841773214 0.0194174772813 0.00880592559668 0.026064139331 0.183837737792 0.0384232333402 0.0386598563856 0.028491177004 0.66561597344 0.0178802430678 0.0106144479446 0.010721316501 0.0584953860606 0.0488555874011 0.0240956518334 0.0447701807091 0.81606944054 0.00601727190495 0.00644546124483 0.00707166378557 0.0505635979412 0. 0.00103456844645 0.00427279006237 0.187146494621 0.00269164053833 0. 0.00100987468273 0.047653345948 1.4140884143 23.7236399779 1.55601401505
-0.181158453397 0.0260123477086 0.0397790253368 0.0100844740285 8.86889734423 0.0461483266391 0. 0.107929568028 0.256807798045 0.0320388886734 0.0695661905816 0.0188244726856 0.942228107881 0. 0.280430428925 0. 0.177260190745 0.0103616000988 0.0309089068449 0.00733443583341 2.08534651761 0.0619419333752 0.0385046664547 0.040395753471 0.063159608537 0.00541444268653 0.00590389620526 0.00982289064588 0.298133346746 0.00680478222793 0.0432921772456 0.00757149486997 1.03013073458 0.0486682637201 0.188686676483 0.0246949247744
-0.0122577305366 0.191980971044 0.0161067868229 0.0275695037423 0.14003002796 5.91146468912 0.134860570052 0.387425224734 0.0209047479093 0.400275840087 0.021321233877 0.0329212682449 0.00736037530406 0.286707031154 0.0674343529579 0.0311016087688 0.01510330413 0.0812436776202 0.00951252481602 0.0089036753564 0.0500637131568 1.53342839158 0.129298933272 0.11420040671 0.00657888694428 0.0901221706124 0.00747913674455 0.0199622847226 0.0126688373082 0.175994119126 0.0118295798482 0.00036469247377 0.0486596453358 0.628137800632 0.0473421611494 0.0308176979667 8.69450787125
-0.0555064568149 0.0480629442424 0.276262166032 0.0331518765262 0.562775127606 0.281398177498 15.7085436131 0.333136469932 0.0406317413376 0.107810107191 0.523491550083 0.0915018349276 0.234333738224 0.0552067621755 1.18046200077 0.0590812702434 0.043050916247 0.0231734472692 0.204509977331 0.0233882916335 0. 0.16346581468 6.09067753677 0.0888615500043 0.0279377722441 0.0701278427092 0.269656981301 0.0300336306608 0.0285534734776 0.0334291528371 0.323865691396 0.0205253370633 0.126702292889 0.134698271566 1.9279992831 0.0830503615842 68.895319709 18.1269451688
-0.0105930094914 0.0197467947894 0.00672572148301 0.219652037737 0.0569481631527 0.192199885757 0.0770026769259 8.2030334245 0.00992272063324 0.0406733489963 0.0200757655693 0.465563570471 0.00648442428788 0.0322131056713 0.0652316603109 0.434810615786 0.00266089608895 0.00461778904828 0.00596362923912 0.0916196214411 0.0124266748599 0.0905298871638 0.0352078645817 1.75296746263 0. 0.011915518628 0.0064691624691 0.117966135277 0. 0. 0.00641417426938 0.263264203083 0.0294620633383 0.0517569597285 0.0297106128632 0.775854199415 9.25329006582 21.8046714515 21.0184122059
-0.254177076964 0.0466163962153 0.013775505342 0.0165752917716 0.2541994313 0. 0.0234895802647 0. 3.51441514201 0.0628800416072 0.126836526076 0.113077846139 0.202105100057 0.00982962599455 0.00967118786199 0.0052933427804 0.301915015348 0.0209447385129 0.0262482055616 0.021515034263 0.0805828810913 0.00282008757285 0.0242510782787 0. 0.874922102518 0.0133118469457 0.0278638597687 0.0256982967577 0.0830735772627 0.0140431178472 0.00152631760016 0.00512338828271 2.14076248522 0.109913868096 0.127066667315 0.0860586763677 1.85126960484 0.0189655004627 0.22577819126 0.02214203147
-0.0187961223364 0.536260801381 0.0187201885281 0.0570722129956 0. 0.249122534002 0.0247618945167 0.0347282919429 0.119844529013 5.89713390113 0.135529295696 0.37862421452 0. 0.0716822297298 0.0139552063489 0.0090504051125 0.0143990351069 0.218599982006 0.0201367961938 0.0288787666884 0. 0.0953004938169 0.0184742524512 0.0163365894936 0.0148614517249 0.91696743349 0.010473158236 0.102230161422 0.00781085519074 0.0411893350182 0.00772386312203 7.845967971e-05 0.0513084582793 1.83647544751 0.0711026312034 0.0484847347439 0.0136165169786 1.40745470677 0.258157562514 0.135820730719 8.13762983681
-0.0328636713303 0.0187769783312 0.235179486576 0.0733364272614 0.0926161334728 0.00838022497616 0.408607171412 0.0113896740303 0.230797267043 0.166509619107 4.62098300244 0.355598938915 0.0707469720138 0.00499944094366 0.1819732433 0.0220544026913 0.0721575489303 0.0276836910024 0.222982276164 0.0331777831189 0.0244250690124 0.00613550182328 0.289795200046 0.00732929200673 0.0844588490175 0.0304535572718 1.0957917311 0.0567580546743 0.0173063494738 0.00490556988502 0.0661130308739 0.0183619577456 0.0948448651991 0.101343657162 1.83229308595 0.0912091468367 0.433113687149 0.0715023194908 4.13594806656 0.0258080154165 30.5908569921 10.0811942943
-0.0243094808513 0.0577216517943 0.0200297769648 0.877392683846 0.00616672142884 0.0133710129811 0.0101473425531 0.425742741255 0.141560490571 0.443900074406 0.191187943803 9.36899545687 0. 0.018888775476 0.0149073518673 0.13913130704 0.0462748737881 0.0379647006055 0.0137169525908 0.459494094526 0. 0.0190014624053 0.00446871333479 0.110939295873 0. 0.0330973044641 0.020129035622 1.80187002398 0. 0.00776890685305 0.000484586777783 0.0693812551183 0.0801448777091 0.218228314494 0.10116895754 3.17665838205 0.0223213571149 0.107982033724 0.190590547393 2.20919088952 7.91138478576 34.3882055135 12.7244322854
-0.15434282613 0.00935208126288 0.0151733883381 0.013729475622 1.71785898184 0.0271358624608 0.146655133895 0.0177553776853 0.30178866371 0.0182577297541 0.0375645028041 0.0274235268157 26.8094991811 0. 0.612478351302 0. 0.142234190974 0.0114076697294 0.011520354398 0.0142505051056 0.280313823039 0.00876817134547 0.0630840357167 0.0103192072714 0.0826066155485 0.0047477806076 0.00469973766013 0.00628193768667 4.58278302533 0.0291050999455 0.0296673134073 0.0479828667289 0.725647477002 0.0270877926263 0.0588757234687 0.0273951850099 6.40325605509 0.0438568294629 0.732225073977 0.00651736008295 1.44810954129 0.0184942984015 0.172245324759 0.0349897269167
-0.00969533647635 0.0999488616985 0.0052454488918 0.0131800710292 0.0337929099917 1.0749439893 0.0326869238681 0.111456192054 0.0264268584625 0.224134039428 0.0199444908588 0.0290530701962 0.562736693539 10.7237952641 0.118229726105 0.506770835596 0.0102800806728 0.0606173209593 0.00751054512132 0.0133113286074 0.0105443090872 0.183782605146 0.0204709347631 0.0276985652596 0.00129705656982 0.0754620175889 0. 0.025804891967 0.030298070793 2.03508410924 0.0447055642363 0.132059900606 0.0301183881127 0.37615525312 0.015908228653 0.0213106603965 0.0431287073534 3.93391823581 0.275853026894 0.265254577006 0. 0.929017326538 0.0360346586025 0.121805115134 12.2774917757
-0.00781203656183 0.00305032194564 0.0716340021864 0.00950419017431 0.290444381626 0.0363585294956 1.48832591097 0.0531160643028 0.00529187417067 0.0181792465187 0.1898146219 0.0202367292531 1.25814605694 0.340506545072 3.55342590032 0.340626708068 0.00543938441184 0.00876335637772 0.0465035840453 0.00925919109869 0.0557620647879 0.0126977754034 0.284454447223 0.0133494203904 0. 0.00517806534409 0.0414239861961 0.0147777238638 0.0411492373521 0.0355017967194 1.07082122249 0.0287025328326 0.0124956170788 0.0109304744587 0.34347636804 0.0163556298762 1.02652889428 0.14159544335 6.96484884785 0.145598748684 0.0100539151045 0.00261004468069 1.03235017399 0.0320664273316 34.9286691378 8.23239114357
-0.0114083420209 0.0199984874197 0.00840313920552 0.139176400973 0.0135290119007 0.0655614948349 0.0271933719352 1.45516931 0.0142193129151 0.0186767358189 0.0235742444493 0.348139821213 0.292921217267 0.0772705614775 0.146955588856 13.0029095601 0.0128252811737 0.0160174998411 0.00344783997877 0.0854516604554 0. 0.0306215484952 0.00135298295599 0.197945344879 0.00398803702332 0. 0.0112408821513 0.130903293586 0.0345087851993 0.0350951206775 0.024019772453 2.51762209502 0.0236558879595 0.033012214447 0.0321554878851 0.53405164739 0.0272060510773 0.175337751612 0.294680297433 5.21552771342 0.0246904606628 0.0948001199036 0.0427269667822 1.71316918042 10.4885072326 28.6013786797 8.76793221684
-2.77594356032 0.0993047870626 0.258987813235 0.196747240033 0.159727053992 0.0201599544009 0.0456494718309 0.014416684875 0.453919642655 0.0552728098673 0.176877082092 0.105471229855 0.386772302504 0.00718586592846 0.0321231644917 0.025169217975 6.78299214328 0.375237957265 0.480908376528 0.294621559134 0.387630790093 0.0702904544528 0.169324529386 0.0583382719292 0.390108022986 0.150928696164 0.18405706465 0.0963763242996 0.894999246158 0.0063632664085 0.0562162829768 0.0486748216443 2.62332950228 0.20035925212 0.35459689191 0.134554657987 0.228256251997 0.0429382995137 0.0430277011087 0. 0.499835267232 0.0872802166146 0. 0.00901740735283 0.289857331321 0.0270375266701 0.04838186141 0.0374696887996
-0.0121894520849 0.410790063033 0.011133598533 0.00165056619402 0.0051843131731 0.0431018327577 0.00539237299706 0.0150623598867 0.0170708870198 0.0840406186667 0. 0.0242935664732 0.0080513219032 0.0398494896751 0.00545725560213 0. 0.0790745463878 3.2078145507 0.0532472065717 0.010043455522 0.00635188554487 0.0880596706435 0.013721224767 0.00651922284968 0.025457891714 0.304325536564 0.00707279853229 0.0675357009414 0.0172192049667 0.106767001377 0.00573203678181 0.0136987547062 0.013655212029 0.297543754748 0.0119723251101 0.00318746283208 0.00162010996025 0.0299444434255 0.0108699938489 0.0166143146908 0.00169048351502 0.0635594253576 0.00467473667675 0.0232766714606 0.00173091362045 0.0456155333578 0.00257003829396 0.00549671428511 3.59183812996
-0.0128603903345 0.155272434481 2.90473676882 0.0921884295404 0.018003235893 0.0088919464121 0.332278027108 0.029517979277 0.0950845378976 0.0814115848686 1.02293237377 0.0782302611672 0.124932670117 0.0147696168081 0.209777697594 0.0191860423374 1.17481497084 0.422005627993 7.16881310532 0.519389046385 0.138828982528 0.0537440354805 1.18848446499 0.053710043866 0.258890930878 0.191467019998 2.4094721595 0.233810974308 0.141415434357 0.0802249814486 0.478853644692 0.0570549680101 0.186570124039 0.158525054764 3.30106333889 0.127155955145 0.070267211767 0. 0.703384400913 0.0418228555285 0. 0. 0.981935304195 0.0968146005396 0.0783266440087 0.00763974452017 0.23785171402 0.0201171111811 507.765111884 2.44158816723
-0.0298412769399 0.0122551089064 0.0159708172401 0.662041901317 0.00734282838376 0.0100875430507 0.00631171792731 0.0627729308325 0.00317881402807 0.0217712378384 0.0380502109864 0.181154195019 0.0147807967765 0.000693398311567 0.0108043597623 0.083547251776 0.124351036848 0.181987183493 0.0659530747008 4.28844853026 0.00751655604012 0.0154663468996 0.00513218639619 0.101949747019 0. 0.00997028720563 0.0172390346722 0.836591636433 0.0182342555086 0.019835677565 0.0069782151758 0.16156444993 0.022796908347 0.0389716219568 0.0269186753463 0.441801768503 0.00596547916974 0.014701676295 0.00739562555348 0.0342721533618 0.00495950613705 0.0217814491004 0.00623597741371 0.141948440236 0.0124771328796 0.0118889570172 0.00259482001219 0.0781727135773 2.98967538063 49.2839591139 3.316675155
-0.0722278190998 0.00500866092764 0.0173192942569 0.023154035384 3.4470883287 0.0171508279517 0.0554954011444 0.091309482244 0.0662760011389 0.00829980119382 0.022354058005 0.0338946495945 0.235314951058 0. 0.0763098378531 0.0332331474469 0.286505793562 0.01505939157 0.0464968416988 0.0254099705532 6.29714726079 0.0976069040919 0.476439604983 0.0361553588411 0.122280514014 0. 0.040880462884 0.0107976740267 0.516163749196 0.011360889129 0.0121972794524 0.0203193196188 0.0695019404399 0.00472048511553 0.0113007052678 0.0118761160785 4.26073713503 0.0861649940812 0.310162417427 0.051843758979 0.103507527036 0. 0.0457793711362 0. 0.430028495412 0. 0.0801999766326 0.0205470075237 2.81788640408 0.00323540880644 0.44167841641 0.0268487689328
-0.0109315724616 0.144616714606 0.00821707597789 0.000456726857907 0.0764913882054 2.45357074876 0.0661435744316 0.176744922702 0.00819456481366 0.266597495417 0.0182759357264 0.00846119421793 0.0313617134389 0.0966495049223 0.0162790413192 0.00163711843708 0.0369439154618 0.234872736279 0.0123576787921 0.0265123221939 0.036042397569 4.81163765756 0.150265642397 0.164785582551 0. 0.180317458513 0.00458491922496 0.0367902105118 0. 0.389255850299 0.00174760112765 0. 0.00257753728933 0.0635580300716 0.0084535343221 0.00282624864339 0.0447019415675 2.88017138187 0.289532320254 0.123735336689 0.00324188461583 0.118078308966 0.0100812848724 0.0198277053741 0.0116340464762 0.243292793662 0.0120482062486 0.0176763288885 0.263693820924 0.709176626674 0.248550219855 0.0328825526141 12.6242878278
-0.0135254471713 0.0224138900757 0.096798546819 0.0154444374282 0.469113896116 0.22743490158 7.79328364964 0.213279371798 0.0161344840406 0.0784909371759 0.179648483473 0.0628751158954 0.0423341383387 0.00630178455457 0.312339853289 0.0234883695029 0.0322889750944 0.0291162192912 0.247846604119 0.0201655279496 0.0518907117023 0.0661747311717 12.1031163415 0.0342292472337 0.0670292507246 0.0263262931891 0.406923875717 0.00490776541097 0. 0.0160598832211 0.353791691237 0.026544047596 0.0118193968718 0.00791022068661 0.109843293866 0.0158225402976 0.333300299142 0.31958909408 12.0613669426 0.0616488096615 0.0107388318896 0.0148583295769 0.233395457926 0.0229189251464 0.0725987489501 0.0224009938245 0.366753524194 0.0033444418443 0.435154262392 0. 5.18531608176 0.0337930801197 103.370411838 30.2187145757
-0.00889801311401 0.014314272414 0.00733263507062 0.139923321215 0.0599475336812 0.151241438878 0.0626266723432 3.26792392121 0.0168047793112 0.0355345341123 0.00841349152452 0.279741113857 0.0269058261891 0.0203136714086 0.0172489856388 0.100526472268 0.00951741783187 0.0365100909268 0.0188076923165 0.311852144931 0.0234901851248 0.406481108084 0.118585605774 5.59567167405 0. 0.0209633844747 0.0017276477389 0.386993411551 0.0356811825554 0.00753007889328 0.0256322285828 0.467310381695 0.00386274806443 0.01299145289 0.00713480561887 0.0563915408293 0.0270058369068 0.251044072283 0.255733515669 3.20974363638 0.00242786317209 0.0191998396281 0.0137316622378 0.150868053414 0.0179523093513 0.0494934567133 0.0152084857496 0.22043068467 0.265435129553 0.0233293793875 0.240040834453 1.01421579934 10.035477583 28.3055731705 29.0099153961
-0.161412798087 0.00424480446191 0. 0. 0.0906916476566 0.00563968805371 0.0321857317281 0.00625169793881 2.32459802666 0.18028353771 0.402169481502 0.146021735821 0.180738849749 0.0152470119891 0.0594309552204 0. 1.59918269474 0.0878914404839 0.151488329592 0.0644464394055 0.433227437698 0.0415119312985 0.134563380307 0.0308938272344 12.8269080058 0.586851670675 1.37028858456 0.768958451975 0.504903662999 0.0401830542296 0.179516483383 0.0260615738593 0.320069615284 0.0514874328311 0.0730906239858 0.0500704875043 0.126989204283 0.0185452770624 0.120931812654 0.0233211166859 2.57821698158 0.137637074862 0.52477780815 0.185823198291 0.14069243508 0.0436555868557 0.0759002609233 0.0304916977712 351.484733517 0.0751625144229 26.381564856 0.10755263699 1.62508488908 0.117164738243 0.443351098266 0.125852859682
-0.00540817019885 0.109532143682 0.00466186168276 0.0119570850765 0.0158619374367 0.0807774228921 0.0133696167272 0.00519688621966 0.029392784273 1.27871496477 0.063722905148 0.04128067384 0.00632884583531 0.0453137431349 0.00843806244594 0.0123184356638 0.0549166610956 0.828580129577 0.0498266614372 0.0502292974892 0.0199171150784 0.185872475093 0.0251441786984 0.010719019886 0.089127529091 3.4296456957 0.103967035845 0.239907865574 0.00468334570237 0.206251061571 0.0138674587778 0.0283270941681 0.00773883894314 0.0717966354105 0.0039461417809 0.00130873744795 0.00796058746493 0.112416234141 0.0258843362023 0.0102273571283 0.0143618403641 1.09404680854 0.0371145501871 0.0742827896751 0.00597837009967 0.0989926626628 0.00732532644804 0.0141200991997 0.297694270758 1.90815280778 0.448236037837 0.0662766472026 0.0370265810511 1.47916590967 0.115943259122 0.102962006329 2.53689270085
-0.0102444412948 0.00509286785591 0.0526826133572 0.00865174390146 0.0167207453137 0.0078067338281 0.0680018616885 0.00652270728479 0.0529708932914 0.0317393901905 0.953237491747 0.0460080390141 0.0202225963419 0.00647460880487 0.0627457859646 0.00621514632303 0.0849084781118 0.0605758785434 0.430500146762 0.0760617630848 0.0368909715192 0.0130987377349 0.289812358407 0.0111800529475 0.15870666689 0.105782269501 3.01587355888 0.129715864077 0.0292980098652 0.0140236078572 0.161233068931 0.013554679652 0.00638065202681 0.00383023188484 0.0462524279848 0.00467115363075 0.0143634062062 0.00687250339689 0.106692653386 0.00553305812419 0.0427454939109 0.0298804720595 0.989563854742 0.0360911542865 0.0145669991601 0.00652825936214 0.0693258497758 0.00506439035447 0. 0.0616959880557 9.95680242469 0.105688196253 0.162332902184 0.0468444399235 1.27307344663 0.0459595842087 8.27606578348 0.715389857412
-0.00789939435885 0.01212501017 0.00773363835482 0.175301373497 0. 0.0143690209499 0.00126452851364 0.132117818087 0.0582018868707 0.0711103982248 0.0578686515489 1.756951756 0.00998972583202 0.0120449704688 0.0114545328219 0.0634532707085 0.0744891940437 0.0686263990691 0.0484135563166 1.44153871334 0.00450888748208 0.0272210780702 0.0240257116739 0.208900041641 0.0398056574747 0. 0.113109727358 5.32058987453 0.0150482576711 0.0314730538069 0.0119754249663 0.256988726401 0.00098902044467 0.0131515986558 0.0105575625281 0.10786533181 0.00903471281231 0.0072515426398 0.0277375045236 0.110148076992 0.0208083242687 0.0755742185728 0.0905113037895 1.71936164198 0.00966856631646 0.0179622299535 0.0146245333127 0.12178135613 0.294662757949 0.0974744910442 0.572307858294 3.67660894718 0.0571583781106 0.0395596260121 0.107882138908 2.20567784646 1.91713540938 48.0143648972 0.853169465851
-0.0531643487552 0.00046790400605 0.000838453691686 0.01812896729 0.208420547857 0.0343787330744 0. 0.0231920471902 0.043685055595 0.00732004830476 0. 0. 4.11106061846 0.048722096716 0.146088640727 0.0560625049253 0.0474926500595 0.00475721733224 0.00484972824452 0. 0.197182079712 0.0457824201776 0. 0. 0.058950641239 0.0289413524406 0.0136873269902 0.0229852647113 41.3472328531 1.0528307594 1.29285877772 0.306280922598 0.0345768065397 0.00451575537032 0.00714407574213 0.00383630480052 0.231578282487 0.027634098434 0.0463528990383 0. 0.0637039348201 0.0184746799941 0.00875762872995 0. 4.32985621739 0.117782272716 0.022019255005 0.0681679785543 3.64445607755 0.0592877548457 0.525086277223 0.0756449030113 4.56261330482 0.110131050888 0.0439052051569 0.0797889683874 2.06518561996 0.0666683510558 0.0762726044496 0.0517838499854
-0.0055199762485 0.0334289719786 0.00390763608714 0.00102384267646 0. 0.106196580492 0.00818508580281 0.0136642809574 0.00357284653328 0.0457468056207 0.00694679633975 0. 0.0911050824201 0.599678869518 0.0489300439061 0.0108088282083 0.0105832559291 0.145765335695 0.00690974052474 0.0114920430125 0.0175529106988 0.175936238339 0.0413270786918 0.00872752794066 0.00466216314537 0.0913950125537 0.00860719686636 0.0243677507458 0.0585882757321 2.80334749919 0.0872701701452 0.111401177662 0.00200006153919 0.0217250647562 0.00433905371471 0. 0. 0.110447906903 0.0173404257969 0.00995287043434 0.00388615508611 0.0438806416399 0.00902124309974 0.00312743519908 0.0425164571122 0.955534749424 0.0288747192586 0.0248716875581 0.206472713399 1.77357320853 0.123522093577 0.193297452822 0.0928470465172 1.53245881476 0.111006305099 0.117335749811 0.105553436644 0.742828630094 0.0622235265575 0.0423426485008 1.43526430491
-0.00783695049608 0.0250727545388 0.0365535857915 0. 0.104520783638 0.0175266123984 0.423097003684 0.0372719485901 0. 0.00118601758413 0.0980061451082 0.0165691637301 0.398423196665 0.0736727127086 1.87900199944 0.0923264680767 0.0174427982474 0. 0.0558435587249 0.0325636812093 0.0600891313087 0. 0.53367919355 0.0668040000349 0. 0.0149063765247 0.118853989326 0.0549025463859 2.14712512855 0.312763441889 20.1875336549 0.347860470677 0.0066552531376 0.00307323366926 0.0412644723982 0.00610625387445 0.0831499855006 0.0075476627928 0.537235020729 0.0317779628223 0. 0.0021195066801 0.103937315422 0.0444811941521 0.209725175735 0.0477753255181 1.65952099137 0.0698039587929 0.0802054038476 0.0387196706916 2.78319794878 0.061028317299 1.47838527252 0.204511470784 7.10912954036 0.256877041263 0.549142746907 0.0751592976177 1.26735185125 0.109280267489 34.4959393706 1.05085922221
-0.00746472259056 0.00204899373295 0.00581141364371 0.0491987450047 0.0279931733762 0. 0.0187164230282 0.139287436956 0.00599351063267 0. 0.00799680673582 0.0650958058285 0.0344787803875 0.0123348960029 0.0622609147898 0.851318265478 0.0137965285149 0.0171589122973 0.00792908114731 0.177351717033 0.0066528572533 0.0210605579391 0.0315464539473 0.18248378446 0.00953680519322 0.00890950686499 0.00910725738233 0.174716153118 0.0532132015906 0.106932799171 0.0628787450617 3.22751790841 0.00644393995935 0.002174043541 0.00377513820975 0.0273030924407 0.0338199259892 0.00125051939221 0.0390614305644 0.10632141054 0.00310445049144 0.00717703221063 0.00848650791657 0.0783047449268 0.0456723888635 0.0516488993956 0.0415544937568 1.15249307403 0.265892650003 0.126252301003 0.188030143058 2.21350162545 0.0711131598547 0.0498530038432 0.14039933692 1.62206226821 0.0927215536591 0.0268076213023 0.0997798597602 0.992253660267 1.28408120875 24.4950942036 1.65934183601
-
-0.0255410031621 0.0196994410272 0.0329436805941 0.0171683371063 0.0149396985614 0.0183708104275 0.00645076614979 0.0131771277358 0.0119329780996 0.019404291813 0.0110661479582 0.0126066351598 0.00767281125434 0.0211476929741 0.0217199500715 0.0162144992548 0.0125788049362 0.0153824193819 0.0351900543795 0.0107925691178 0.016594963679 0.0192878934182 0.0069342750228 0.0174443586684 0.00639363526807 0.00974852461103 0.0111678900222 0.00443298791246 0.00723674640067 0.0193993823623 0.0394721937175 0.0134712866574 0.0308697977783 0.0261955025614 0.0398854098195 0.0222118074114 0.0157269211794 0.0271424443752 0.00716582944527 0.018409347815 0.015995194452 0.0210047367317 0.0151538538426 0.00983855721495 0.00727530179348 0.0147630423609 0.0279360948926 0.0111035450087 0.000586877417582 0.0155362448361 0.000536216447671 0.0120197877511 0.0121507344448 0.0176708896065 0.00473584340384 0.0155784373036 0.0010210997268 0.0121177246907 0.0119605502469 0.0104896896194 0.00812470878645 0.0202026177119 0.0134871493447 0.0175201850745
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/49birds_noncoding.ECM b/PhyloCSF_Parameters/49birds_noncoding.ECM
deleted file mode 100644
index 2e3e718..0000000
--- a/PhyloCSF_Parameters/49birds_noncoding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-2.78592743423
-6.58600444004 3.19341169223
-1.63519457982 12.1399355041 2.45567860959
-2.43476285124 0.137196047767 0.462787891603 0.0687994720539
-0.0828676812999 4.64297827314 0.0583439047427 0.114333277922 4.54770228198
-0.569910594763 0.269905137878 10.0658717921 0.227536068622 36.0992488386 10.3039899411
-0.0485017841297 0.412819154555 0.0211222634573 2.74491138612 2.97356015436 14.4767642696 13.8730044691
-4.91172089731 0.155166943916 0.607308551579 0.0926673262207 2.93090865811 0.0568018331327 0.563736806771 0.0419502454502
-0.110594870229 14.1973016288 0.227814935065 0.348821740023 0.0698012930426 4.35673029912 0.320289189969 0.205259373689 3.19849897319
-0.200634258787 0.0561388860069 9.29335938844 0.0929695932917 0.395913544434 0.0764056737434 8.35592589299 0.0734485882052 10.2333897454 3.31735868963
-0.13798910766 1.0340072599 0.318823468155 10.7213291459 0.0794339571607 0.150236344311 0.308812958798 4.11390908902 2.34629268324 13.7678588818 3.75348569698
-1.61163899145 0.0903822534676 0.0978724405796 0.103846672592 13.0480744395 0.227582308607 2.33026717206 0.158960500271 2.75288101677 0.0415967285977 0.155011835538 0.0774147142431
-0.0539412039354 2.7175215174 0.0197134073579 0.160319614896 0.188046082887 17.3910431275 0.852712504949 0.990756643627 0.0714613184066 4.0085387173 0.0637586828172 0.239230657001 3.72498943433
-0.115504297981 0.0554316110801 2.62956148456 0.108596913546 3.44821535373 0.624122455894 46.1826203189 0.819390424217 0.144340307998 0.0767389836681 3.45253752203 0.0918946223283 11.0581166867 2.78890551354
-0.0686425149198 0.126358582519 0.0353234891621 1.62786654769 0.112834294186 0.366312347819 0.910925474064 10.8159929664 0.0420270072454 0.121652373835 0.041021549888 2.70393912639 1.97744280002 8.57968016608 3.32159829656
-2.7544269435 0.0893651329767 0.147541427462 0.045588254393 0.13118461025 3.18524470568e-05 0.00511362108266 0.00177951014407 0.415950418678 0.00274376193493 0.00295069255731 0. 0.0490110518677 0.0109095971916 0. 0.
-0.0792482672501 3.8269663053 0.0600975342331 0.169229443099 0.0235434410828 0.20555593481 0.0187169473997 0.027489303549 0.00704240140764 0.842055408475 0.0204804845935 0.00228597224206 0.011244526864 0.0757896416031 0. 0. 3.49147912066
-0.140350659206 0.0519225842332 2.88395589756 0.0273793218983 0.0160717268365 0.00476194914635 0.256665151464 0.000945031287224 0.0457491179596 0.0221450577789 0.598936842192 0.0157356154024 0.000732141038617 0. 0.0653627423271 0.0024299228541 10.7164632866 3.57233983814
-0.0420703782816 0.245254684763 0.0661881569729 3.31052265197 0.00921779748141 0. 0.0187176169492 0.0941345819645 0.00889233349389 0. 0.00988308290204 0.825507301736 0.0116464934505 0.0265891275072 0.0121580600248 0.105930373584 2.27706263405 16.0355075221 2.99806680412
-0.0835624220006 0.00882220161046 0. 0. 3.08974563007 0.122047945762 0.580194800746 0.0527490707359 0.0735023766671 0.00433095387463 0.0343457304593 0.00511087269641 0.0846597799348 0. 0.0288920646816 0.00160328304007 3.89374822857 0.145724186109 0.859411475778 0.0977710846653
-0.0154152275448 0.104820298736 0. 0.0105463060181 0.115102782565 5.17009625533 0.237854650192 0.172608828294 0.00557693962982 0.118368017498 0.00724878346524 0. 0. 0.182319021431 0. 0. 0.138898774156 5.03284649814 0.138658093089 0.165678358789 4.79323321106
-0.00482910140346 0. 0.20777458312 0. 0.532995768631 0.254053586795 16.2610321 0.173403286842 0. 0. 0.157481114874 0. 0. 0. 0.394080739918 0. 0.69328323564 0.320689384456 9.88649042287 0.167025974959 34.8139406207 10.1133870094
-0. 0.00961312458577 0.00777720146138 0.0421416632552 0.0668430982448 0.316055827456 0.310161085324 3.80578081572 0. 0. 0.00286341134589 0.0655755234675 0. 0. 0.0111015655273 0.0940823246107 0.0501235340082 0.388529007176 0.100853422779 3.47803826662 3.01358288946 13.5549050105 9.5786073322
-0.468309814243 0. 0.00422239547645 0. 0.26830641753 0.00846178333649 0.154305577789 0. 11.2231238988 0.279262732154 0.668330937867 0.193652679992 0.219677620446 7.2077574577e-05 0.00604055276834 0. 33.2452989031 0.811222421625 2.55659342609 0.452160447674 7.64549509172 0.263216471122 4.7802784332 0.143871982185
-0.000860877233951 0.834462206337 0. 0. 0.00360228322614 0.414239512028 0.197936924501 0.00823935352163 0.11774285457 11.2493424316 0.201884259842 0.497799451235 0. 0.266084682123 0. 0. 0.266110848103 34.7258580282 0.547536957554 1.46118924155 0.160338489022 9.08023328703 2.77572496514 0.635232621196 20.7884238597
-0.00982618500386 0. 0.591865235112 0. 0. 0.00218531337504 1.27017090395 0. 0.339648545761 0.16161338633 9.56757283704 0.183239415868 0. 0. 0.190549769126 0. 0.939489900239 0.401541837309 30.6896731945 0.378631582678 0.49544403824 0.338076522141 40.5444710727 0.154867530415 51.5670070065 18.1748961464
-0. 0.00305450479455 0.0135564060988 0.917987071428 0.0121496291976 0.00940515686116 0.119119559264 0.323445066476 0.137627082052 0.973331878132 0.317403241123 13.7268039631 0. 0.00385237606388 0.0129442098625 0.2243721539 0.436381800076 4.66762939214 0.890960051922 46.0687746218 0.159821879484 0.606560651364 1.3124413836 8.44478548018 12.4665171004 49.6206423643 16.2525872954
-0.0480997542122 0. 0.0120069171917 0.00705871640247 0.365898539349 0.00331565177772 0.00828798187583 0.0190617177772 0.0566983820258 0.00206195136388 0. 0.000851243591405 4.13290256325 0.0778480013042 0.257064930071 0.0532942502359 2.58623674767 0.0627896589555 0.130295452685 0.0607415410117 12.6708354607 0.127040124001 2.19987609742 0.174617163404 12.8946521218 0.0747252598411 0.446429410446 0.0977030126566
-0.00562265261444 0.0764307547465 0. 0. 0.0063414974605 0.380861788353 0.00753424639752 0.0220559286448 0.00980976134525 0.101156083167 0. 0.0138619086514 0.072833456771 3.75912497016 0.0471465843163 0.106431837705 0.0803441627835 3.285182125 0.0552749886049 0.164538257304 0.2503607233 12.1799982117 0.873441856704 0.770053907325 0.397759952713 10.5237799774 0.22377862705 0.742945113248 4.04528522945
-0. 0. 0.0539015946056 0.00278364992127 0.0377957707833 0.0135963635668 0.89440013158 0.0147550321805 0. 0.000295662566089 0.101859214026 0.000945192222413 0.107777801947 0.0455856315413 2.95431984048 0.0299580499308 0.0692407005928 0.0777213018462 2.8342950611 0.0597295499215 3.20392772547 0.525791072418 30.2914067842 0.591091345872 0.778259117844 0.196799800294 9.7436291249 0.250287033284 14.0153836355 3.34075289278
-0.0029775553938 0.000481714381558 0.00995582674459 0.0354561987446 0. 0.00988402515618 0.00175895315694 0.319479264747 0. 0. 0.00856538884321 0.0181925584499 0.038841902373 0.144236561331 0.0680763995227 2.45864879147 0.0532891365325 0.207694885915 0.0544091024245 2.62133140043 0.124628865738 0.386482949994 0.605612447182 9.29643383867 0.193490205147 0.508707708341 0.224730774419 9.95732384776 2.2284772758 9.79481604528 2.83331650296
-6.56858255082 0.157040779976 0.412175038103 0.0941892466145 0.22602139234 0. 0. 0.000432028561943 0.578215659146 0. 0.0122850462384 0.0100014809361 0.11167679813 0.00640756227736 0. 0.00161147255275 2.46904674823 0.0456773806562 0.15229360324 0.0314539380676 0.0534554009708 0. 0. 0.00927397630364 0.447179203281 0. 0. 0. 0.0367299291555 0. 0. 0.00903617543561
-0.154254426169 12.0194888817 0.188385564082 0.404976306527 0.0330397145777 0.450121271064 0.0489176001655 0.0370399636967 0.05094694887 0.990991883141 0.0180840722072 0.00384380211183 0. 0.169457512386 0.00819708281146 0.00870799638103 0.0573145148162 3.61306377769 0.0855272437255 0.154782328737 0.00748232676517 0.0881927464735 0.0049964336753 0.012854379142 0.0301713814632 0.72400213014 0.00648062632878 0.0198374976478 0. 0.0571707574935 0. 0.00247035561626 4.34813916207
-0.227788108235 0.0799299082191 9.79896923451 0.103053796284 0. 0. 0.78255650198 0.015579837746 0.128340355924 0.046279605209 0.779068029741 0.0225234611853 0.00602103326625 0.00493313737968 0.161693747513 0. 0.0772646124819 0.0784651311818 3.39842393239 0.0430785142297 0.00319153334055 0.0200545515437 0.226232620884 0. 0.0820883049329 0.0265643135942 0.866371736819 0.0183432125543 0. 0.0250462788848 0.0482691177232 0. 10.1583124061 4.45404934624
-0.107881419785 0.624537506527 0.143524792543 8.57913984856 0. 0. 0. 0.243607905648 0.0376568369585 0. 0.0123913692603 0.977051019802 0.0286899775315 0.0401590208837 0.0222659759274 0.159355783736 0.0382060716859 0.180359387973 0.0471829513688 2.82761809762 0.00499074984672 0.00488669031459 0. 0.053752763036 0.00691320221159 0. 0. 0.829310276526 0.00323386746488 0.00593988613076 0. 0.021522244845 2.40542589088 19.5417991861 3.75671940857
-0.12834113079 0.000631024810323 0. 0.00370534372453 12.9755000578 0.249546857178 2.2428079352 0.16858926865 0.167087689576 0.02383686429 0.0439490546363 0. 0.655221811919 0. 0.0906015436812 0. 0.0942550375717 0.0144616778276 0.0351737751326 0.0112630245205 3.31439870246 0.0682789714328 0.43347001132 0.0516315018829 0.281101289081 0. 0.00916726942431 0. 0.230196247012 0. 0.0403187341028 0. 3.34331662861 0.0971515456628 0.781046975592 0.0872172134872
-0.00147272373388 0.231637836881 0.00034595435521 0. 0.239177344728 19.0321903198 0.682121242987 0.58023907979 0. 0.362869697142 0.00491708358301 0. 0. 0.711707470265 0. 0. 0. 0.117504471461 0.0121911148736 0. 0.111229457943 4.4199412059 0.306313105926 0.250843260075 0.0151977356619 0.530844103954 0.0200689115308 0.0183915886966 0. 0.240685558284 0.00716322812369 0.0025539038592 0.0720097295311 5.06653931434 0.0792452953844 0.173890272432 5.19879437497
-0.00584157821457 0.00981900567978 0.501161696619 0. 1.70123466465 0.457547343541 50.4645366614 0.516148327511 0. 0.0476676401932 0.633934534495 0.0154289667092 0. 0. 1.41536414927 0. 0. 0. 0.204730338169 0. 0.317299779043 0.262826758155 18.4505803511 0.196113664614 0.541248280455 0.708760121856 2.67512354266 0.181899268955 0. 0.0231037960197 0.546155668327 0.000709150651529 0.690762503945 0.31210703086 10.5525498701 0.251830847873 35.1062120167 9.24273876406
-0. 0. 0. 0.121219395501 0.173500127538 0.732707640921 0.967955772341 13.9456042856 0.0142592910443 0.0661696110665 0. 0.204245055816 0. 0. 0. 0.335284741585 0.00120828759341 0.000770045425943 0. 0.0762604530737 0.0474049343197 0.13927094387 0.17189083881 3.32796677053 0.00836207794708 0.0417538220573 0. 0.302116718197 0.0100602962328 0.0446388722815 0.0203652287305 0.233869284809 0.0606199672857 0.338796931585 0.101822437413 4.01419582769 3.59460760499 14.1246349223 11.2167674822
-0.305915296181 0.00387290678178 0.0283900521037 0.000168284862403 0.103145819992 0.00682213703837 0. 0.0069105622856 10.8506353065 0.143162318594 0.606240184459 0.101575092269 0.174857843309 0. 0. 0. 0.379874892195 0.0135188840515 0.0283892888726 0. 0.0866224362335 0.00680603807226 0.00423745111466 0.00363287262812 9.81027429037 0.148538407691 0.484853262019 0.110578511 0.0796243853214 0. 0. 0.00845303045711 10.3935417311 0.412884043486 0.946160277011 0.227669238572 3.3309009611 0.119274560321 0.88047907047 0.0227475613468
-0. 0.464728116785 0.00308746578916 0. 0. 0.199886815768 0.0125122178155 0. 0.180705625194 14.0947925672 0.252641224242 0.547186742156 0.00366396625264 0.171718229624 0. 0. 0.00256090204409 0.636746675067 0.00960274978496 0. 0. 0.146270560184 0.017249053838 0.000316098567487 0.285378211168 9.24014013085 0.305949089687 0.718193549725 0.00312219292709 0.0773155035163 0.00955123407451 0.00198881136206 0.144809836717 19.3056982127 0.243438772992 0.717540645624 0.151265661762 4.92211351063 0.504292174964 0.361202903197 4.49006892216
-0.087451981084 0.00842338129519 0.392290124716 0.00139847334073 0.027044155128 0.0139774661244 0.638507439152 0. 0.556961222423 0.13882239836 13.5150909923 0.166561693382 0. 0.000756205239141 0.188613940486 0.0144571766857 0. 0.0167131216833 0.532700702004 0. 0.0320969284915 0.02326036368 0.33353910299 0.0105399567991 0.600959423559 0.261734253996 10.1713107581 0.238032618109 0. 0.0199740705072 0.139539542607 0. 0.57217221198 0.216745519905 12.1940990023 0.178514589947 0.592929555019 0.137803794033 9.00742699427 0.129076334826 15.0682981859 4.38093295403
-0.00986884400482 0. 0.00714910857349 0.367847444687 0.0166385250797 0. 0.0210436940204 0.155361065995 0.170480142873 0.717744368709 0.312410321473 14.2913544055 0. 0. 0. 0.120387628276 0.000292448770617 0.0183996746206 0.0118009941572 0.612374176547 0. 0.00880187636181 0. 0.0810806480573 0.211302552782 0.467407092312 0.246211628106 10.2837358385 0.000671732121191 0. 0.00544000385484 0.0566344860084 0.152106508386 1.52277218051 0.373232827818 17.3834665486 0.088560075074 0.196177361201 0.380258104422 4.36085934855 3.18437134081 18.8510841125 5.14520276184
-0.140188964873 0. 0.0151920530983 0.0153098032383 1.21840798939 0.0200771021955 0.013828583721 0. 0.298711554809 0.013282000644 0. 0.0167204186218 17.9923373684 0.232696535903 0.984057841766 0.142431651545 0.0594158796265 0. 0. 0.0137989912116 0.12040947048 0. 0. 0. 0.311981750261 0. 0. 0.0153840209357 5.10599693577 0.060058085426 0.192867675621 0.0439372706467 2.29950758326 0.107264463125 0.122983893731 0.0764090093826 14.9222894425 0.206524497422 2.86780466508 0.159494635211 3.80306505617 0.0334445588107 0.325190963647 0.151947105188
-0. 0.207669384822 0.00189721251573 0.00553485636554 0. 1.52235490048 0.0214143749539 0. 0.0145960413034 0.32793862831 0.00705339082687 0.0457414280331 0.268825669828 19.5855144187 0.172589090786 0.409132980287 0.00554476834153 0.1076229582 0. 0.00240622379516 0.00804850693051 0.206710892449 0.00818525905021 0.0258785461201 0.000760289922815 0.311325590969 0.0118866698369 0.0359508735092 0.0658382096549 4.45507109341 0.0857620092788 0.184552789051 0.0797894222264 3.9481700794 0.0581303052042 0.16676938791 0.269272847366 19.2295897427 0.73594417452 0.978955856639 0.125122027026 5.05506631457 0.0973955577781 0.428928296452 4.82612419107
-0. 0.0187625080249 0.20621297091 0. 0.215475351118 0.00846225603838 4.56136559967 0.013451185552 0. 0. 0.397015828795 0.0315660915039 0.710900933484 0.189198512858 15.8999065484 0.160971621735 0.00628354924211 0.0161321594066 0.0723294391078 0. 0.0117968393571 0.0236982978919 0.433978791462 0.0143668477172 0.00817272892114 0. 0.316429262812 0.0198151164693 0.153450120451 0.0773647680014 3.50455393025 0.0618333636644 0.166520883576 0.0976239406896 3.24864400372 0.0837585483462 4.31483949393 0.648545185882 34.2984034321 0.819405183509 0.266907960006 0.122705495208 4.9548758249 0.199588957896 16.6777618142 3.57079368656
-0.0124471120403 0.0272087327615 0.00155187404069 0.125233490839 0. 0. 0.00895158073499 1.06491980832 0. 0. 0.00715827430729 0.414147587417 0.180211554628 0.623836427105 0.241870122255 12.2059095361 0.00658301673438 0.0125565086887 0. 0.058709761226 0. 0.0151374969764 0. 0.0571779694018 0. 0. 0. 0.285486228445 0.0388450921219 0.0813947228349 0.0513523513133 3.2140738289 0.0593540209486 0.20347229722 0.0794482293815 2.69456850247 0.178836946955 0.472832758926 0.844501463372 14.1545062979 0.111742476081 0.237178456371 0.101985554242 4.60324813954 2.89376135367 11.9743180489 3.79180138166
-1.85192230366 0.0693790157141 0.106402926385 0.0608024713276 0.0436329895839 0.00107179024991 0. 0.00390362798834 0.0808916951667 0. 0.00433532953897 0.00866563775885 0.115681448961 0.00244887631965 0.0122927075949 0.00307380568859 8.32999782753 0.126029974553 0.460073198431 0.120793949772 0.115673876081 0.00271733825314 0. 0.0047754974823 1.70598507161 0. 0. 0. 0.178363763058 0. 0. 0. 3.00967295837 0.0788741164722 0.103306012195 0.0385900978126 0.0418440750087 0.000122216607141 0. 0. 0.136527075723 0. 0.00566931440696 0.00251708868497 0.105111201226 0.00419097275684 0. 0.00485924133915
-0.0549154541207 3.03224643496 0.0428847156108 0.133703532383 0.0202336985508 0.140949578231 0.00900894226931 0.0250639669303 0.0048425257738 0.128268392937 0. 0.0115912491402 0. 0.0827492946191 0.0160830178931 0.0111482505672 0.24141129768 17.0668338244 0.206414807432 1.00003095748 0. 0.311079374201 0. 0. 0.0145169454496 3.04001941638 0. 0. 0.0331464951668 0.127673716292 0. 0.00965378489659 0.0589629693926 4.9678210571 0.0571303284523 0.248965454673 0. 0.0493384833039 0. 0.00239893485768 0. 0.230692698695 0. 0. 0.0422766872909 0.0920739167052 0. 0.00133058864128 4.29048773271
-0.101517404125 0.0343491447041 2.27313430775 0.0554319415663 0.0210799624769 0. 0.0821407508018 0. 0.0329140841083 0.0175891419447 0.184042580709 0.0134375573067 0.0238409003486 0.0035029716646 0.0557026739775 0.0110516944291 0.449722568316 0.159306400865 14.0744663646 0.253068276327 0.0121885022963 0. 0.46176793784 0. 0. 0. 2.26889710649 0.0224957316916 0.0300941303173 0. 0.127312288213 0.0124284578828 0.147104057547 0.0639672848033 4.10550614777 0.0825088546667 0. 0.00813367565483 0.0729990890482 0.00689730236854 0.00599463654984 0.00116099561615 0.127372168082 0. 0.0374612069485 0. 0.0641437950891 0. 8.9067174944 5.26727004749
-0.0634587178075 0.164446070886 0.0389132563161 1.99737117863 0.00282180434061 0. 0. 0.0774665806316 0.00868272364467 0. 0. 0.14300480576 0.0283602289446 0.023588473164 0.0105163231084 0.108103678501 0.14614846102 0.666021762766 0.113838834063 11.0648283984 0.00197426866049 0. 0. 0.151913570895 0. 0. 0. 2.32294437496 0.0235773309743 0.00278112713673 0. 0.0949326087762 0.0380151845809 0.268793047678 0.0730886004517 3.71246743415 0.00918507483228 0. 0. 0.046609892172 0.000579927622744 0. 0. 0.246691875092 0. 0. 0.0121177322723 0.0858990441967 2.11327446775 18.4850191794 4.13292946501
-0.0454886898633 0. 0.00608734618322 0.0016151106611 1.98767482394 0.0527684920215 0.210535924194 0.0536827040618 0.0420252303951 0.00588687958894 0. 0.00066928368527 0.154395852194 0.0186920369151 0.0166574139067 0.00359586340379 0.217447880351 0.0227868287022 0.0421451566115 0.0208986894064 9.79650280147 0.141230586854 0.926171845582 0.120065761888 0.483172002247 0. 0. 0.00519099356137 0.715526565594 0.0222416221031 0.134580169449 0.00972160824641 0.0897851212753 0.00130881885851 0.0166280705267 0.00142630838426 3.27162515516 0.0628333601292 0.197931476966 0.048359439559 0.0588224129141 0.00505944834557 0.00615546676895 0.00148701250206 0.266009222204 0.0152178532484 0.0375628245831 0.0051968742038 3.10505375421 0.0921325112832 0.494869259187 0.057954196026
-0. 0.10375058827 0.00895116015077 0. 0.0488589220103 3.23100578316 0.102852989537 0.0992758415717 0.00335181630037 0.0273009328923 0.00169258214181 0.0021720572221 0. 0.232980339437 0.00106980475086 0.00264157628508 0. 0.26583153922 0.000454703033684 0. 0.257433667291 15.0764556279 0.475982048683 0.612573787407 0.00127451046421 0.854042044641 0.010430565389 0. 0.00892929688638 0.951084070718 0.0305638428038 0.0291998661887 0.0103191984664 0.128858289569 0. 0. 0.065182747413 4.50215646981 0.141527513151 0.149054910944 0.00381937078567 0.113453281622 0.001544157525 0.0163706083748 0.00216907007472 0.425752972949 0.015172048448 0. 0.090884506002 3.94010288909 0.0822907479248 0.143448913247 3.94613664994
-0. 0. 0.17631552808 0. 0.541360468027 0.191544494061 12.9177085683 0.19141559287 0. 0.0077944473201 0.150455878283 0.00425317702852 0. 0.0157869881978 0.441933004077 0. 0. 0.0027451427081 0.813018154846 0.00629319249643 1.82975513433 0.614583853488 51.1610794325 0.680185321452 0.680808083455 0.482636692887 4.63806009414 0.190710087212 0.0255917056117 0.0788586973079 2.51305147376 0.0223075594435 0.00821325826844 0.0118380563154 0.387025791712 0. 0.731484041325 0.285688609037 20.8451309518 0.274016052876 0.00281011791009 0.00386208802479 0.271546419145 0.00882315670346 0.00814020975936 0.0353938170827 0.810935235854 0. 0.719888232788 0.317147489876 13.0266914958 0.209522978429 42.3850162604 9.79461368788
-0.0087248402762 0. 0. 0.0388028267706 0.0544601295802 0.167312785248 0.128592356538 2.38092749378 0. 0.0136994402801 0.00208139452493 0.0426199782934 0.00783642738883 0.0384048442744 0.00683574723219 0.0935666624087 0. 0. 0. 0.143036392756 0.145858915325 0.559774631266 0.33719131026 10.2273191348 0. 0.0102269689265 0. 0.517426541896 0.0328635291206 0.129812799345 0.0471040742776 0.610397195218 0.000429440743348 0.011649854694 0.00926334868987 0.0765859221309 0.0363917814826 0.183338074344 0.124125168139 3.20750017235 0.00108884405549 0. 0.00709815195924 0.0494190173154 0.00181848086765 0.0479824177173 0.0093094534245 0.152251675425 0.0411876400152 0.292750010335 0.0548809377424 2.76386105945 2.22257855879 10.8628930542 11.1413927804
-0.0760250538715 0.00700421836525 0.00866648194089 0.00435986152497 0.0540827397947 0. 0.00391636097676 0. 2.23283740478 0.0477354909763 0.119722467157 0.0512077291182 0.0582828087579 1.84450841094e-05 0.0212705156613 0.00347637118437 2.3444294707 0.0387767742541 0.13871448845 0.0161289290258 0.404228283439 0.00670727864772 0. 0. 42.6257611554 0.196792049636 0.929369177618 0.221868715408 0.489384967201 0.0168388452585 0.0398846300782 0.00512133729322 0.141547888798 0.01482634149 0.0254244831056 0.0210919924281 0.052656552978 0.0045449028405 0. 0.00716446340832 3.97333759429 0.0632861016144 0.142570150692 0.0496143346137 0.0894119344944 0.00143211187454 0.0202383137864 0. 7.73808578168 0.269236099363 0.714173337151 0.148482271426 2.27460367338 0.0612555216636 0.506093630745 0.0397805658951
-0.00335948534388 0.166811362037 0. 0. 0.00163245648269 0.0869115764053 0.00145131831787 0. 0.0366620864637 3.60332218814 0.0569434943281 0.162544597515 0.0101552271511 0.0862933628427 0.00997209836899 0.00614153543388 0.0143543479853 4.36503411421 0.0404557851182 0.0829539975305 0.0279204536382 0.591301367783 0.00185763764181 0.0353923010908 0.707502598715 35.0815245817 0.426555047875 2.24727598232 0. 0.78485920919 0.0292031839397 0. 0.00180239766365 0.267951329933 0. 0. 0.022120304753 0.153353668133 0.000864485448678 0.0247743262171 0.0575696359221 5.18508259902 0.0736462414271 0.260305286917 0. 0.0968691355895 0.0138850315085 0. 0.138838219983 15.4052198753 0.211229746893 0.59906033101 0.0515508895799 3.32129727819 0.27694555062 0.169235739566 3.26958964513
-0.00315205571841 0. 0.119858587196 0. 0.00965168066826 0.0035616261757 0.172854630017 0.0111622195472 0.148179057638 0.0410147698761 3.03403380457 0.0541614715481 0.000563097911286 0.00489601991308 0.0940862857026 0. 0.0217924575442 0.0129881466992 3.25778010704 0.028965386855 0.140292613723 0.0293657555445 0.484832092218 0.0345007483117 1.88077579645 0.325730094754 34.7467555829 0.561059668728 0.0149027296968 0.004157980621 0.846966791909 0. 0.00260535739846 0.00911471818673 0.243798651713 0.00180356314893 0.0271269185037 0. 0.165004321262 0. 0.256825819514 0.106302800681 4.81357755061 0.126885076615 0. 0.00848265494272 0.154125731765 0.00945871747585 0.250541358334 0.119835918567 12.7448935237 0.0835390299321 0.403266783084 0.0841562495728 7.56357418722 0.074228113326 9.80967504055 3.27871254942
-0.0103556018408 0. 0.0011816109884 0.113633952737 0.0118785975884 0.0125379387686 0.0104722121626 0.0788538391735 0.0533571273803 0.168525336551 0.0621319164848 2.95416541639 0.00242580625115 0.00146091373886 0.0100088353982 0.0663269954569 0.025369860271 0.22434540866 0.0343720715155 3.46956439231 0.0131447148201 0.0215679445196 0. 0.405073060412 0.556475593543 1.67817531836 0.545977564286 35.7061721804 0.0116939219962 0. 0.0183565441501 0.460092201302 0.00074238992399 0. 0.00579123310552 0.191431140758 0.00108942651377 0. 0.00297715155179 0.0726203290199 0.0534914770371 0.244946229554 0.115786843235 4.52310415665 0.0183960883988 0.0315494387759 0.0220921785763 0.138487740821 0.1498026314 1.20488541655 0.374457402337 13.0091599938 0.0516036232577 0.0991638339044 0.272220445341 2.92620666289 1.97016748469 12.8367518412 3.06689854949
-0.125733907422 0.00436972047946 0. 0.00353647416495 0.154469830792 0.00266701849446 0. 0.00747470692383 0.0428772107152 0. 0.00651486169726 0.0038758756817 2.12423784206 0.0396390768058 0.119676126216 0.0613113344595 0.0934530446047 0.00100486685685 0. 0.0099634245887 0.255867138922 0.00432278305936 0. 0.0033608119693 0.709920584226 0. 0. 0. 8.76488154869 0.108747954622 0.443139983406 0.108862992226 0.0592114869062 0.0021774332275 0. 0.00310486942886 0.146282632535 0. 0. 0. 0.0932659832328 0. 0.00226265698012 0.000437508156089 4.17379919929 0.0813437704349 0.132209517747 0.0702854009238 2.40862742376 0.105698824568 0.178043076253 0.112608616225 7.73500464643 0.139203650826 1.69519019403 0.0810436611991 3.09662064828 0.0385681117838 0.111269521996 0.0489347359831
-0. 0.0609872263047 0.00933842716192 0.000948328196705 0.00374889004249 0.15253027804 0. 0.00952953880298 0. 0.0572009319937 0.00837445788167 0. 0.039770266434 2.41207882465 0.0293270824384 0.0921186610183 0.0023267112147 0.166351748457 0. 0. 0.00216144889003 0.575616954777 0. 0.0148745203406 0.0015650455934 0.679423704369 0. 0.00801061566315 0.145315119018 10.0943879764 0.149402556355 0.412657654327 0.0098602040256 0.0757051733271 0. 0.00455281594064 0. 0.147595745939 0. 0. 0.0110837912317 0.0745131511445 0. 0. 0.0561028712269 4.3424873055 0.0450383438033 0.159410591003 0.0585146883274 2.37207001639 0.0359509499726 0.111435198427 0.139595758963 10.3724187684 0.454590596885 0.57005580893 0.0887282266365 3.33992114556 0.0553897405699 0.22588766036 2.97958638551
-0.00884501661763 0.00822019802007 0.0567978754604 0.00153576505523 0.0229617810989 0. 0.413469077511 0. 0. 0.00113601739474 0.044920740573 0. 0.149636695726 0.0400778032714 2.29007985767 0.0437062887372 0.00940439830966 0.00173005848216 0.0763644279553 0.00198872511095 0.0318057542977 0. 0.959001128734 0.00686764151641 0. 0. 0.69893106591 0.00227248143697 0.431545896385 0.0834627522463 10.4903910182 0.146065626468 0.000137938557632 0.00373652129917 0.0823752461755 0.00739167528714 0.0129600361132 0.00022436885351 0.262261843382 0.00530115881603 0. 0. 0.140415389848 0. 0.238536586546 0.0597236814982 3.45822422879 0.0896154132005 0.0942643358202 0.0515910631369 2.61062231714 0.0494450785923 2.33496905686 0.373558427272 32.9662411021 0.412373005557 0.212265840597 0.0992654681453 3.89618387928 0.130112261982 8.22472527244 2.42902491323
-0.0340591581891 0.012593100295 0.00323337401409 0.0685872694336 0.0105214233326 0.0112649491742 0. 0.139366554692 0.00843066624747 0. 0. 0.04777707531 0.0625981591408 0.106881090187 0.0405634111512 1.64631472157 0.00949918338782 0. 0.000604291454891 0.114526662756 0.00372564611188 0.0921689564017 0.00746205552917 0.200492727878 0. 0.000282518921569 0.00466192088992 0.57052517656 0.101107481918 0.229025687261 0.137716530929 6.54507791785 0. 0. 0.00460225123511 0.0532545275311 0.00269316586069 0. 0. 0.107055482973 0. 0.000186005327605 0.0156408180693 0.0835639144202 0.0562034194714 0.152712853513 0.0782557471793 2.78045654664 0.124962081181 0.143982562493 0.0473902723691 1.60216771614 0.0746132290942 0.308205816866 0.464655090752 4.89934528676 0.0455440791486 0.127170079697 0.0816795449481 2.41190068084 1.8126811407 6.5182404037 2.72920933193
-
-0.0357983654718 0.0146634321466 0.0209916853044 0.0241608300459 0.0196605104347 0.0113786862615 0.0029009138093 0.0163015785126 0.0225609755057 0.0145991965297 0.0181825729424 0.0164781957079 0.0186856678405 0.0130405682814 0.0179309987722 0.0240968720195 0.0181775551111 0.0146957289426 0.0210180199751 0.0178777837456 0.0179375335248 0.014026410045 0.00304930001685 0.0181980546371 0.00237235102112 0.00247910724881 0.00304553476624 0.00292174613484 0.0129216428963 0.016886060241 0.0212194293029 0.021001239545 0.0207025677211 0.0101079314077 0.0168739180256 0.0130368421188 0.0145312058205 0.0117191223335 0.00248094305692 0.0145761834505 0.0160538354021 0.0117605522361 0.0140380390381 0.0114567437712 0.0112780796487 0.0101486396189 0.0148519084459 0.0147005486842 0.0206773071958 0.0111337585868 0.012890738691 0.0187059909187 0.0197741432688 0.0160489156219 0.00237751747496 0.0226108300737 0.0197730187728 0.0145713864549 0.0179588059761 0.0198394530312 0.0208205335746 0.0208303362555 0.0183984258157 0.0360132307673
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/58mammals.nh b/PhyloCSF_Parameters/58mammals.nh
deleted file mode 100644
index d3e6676..0000000
--- a/PhyloCSF_Parameters/58mammals.nh
+++ /dev/null
@@ -1,172 +0,0 @@
-(
- (
- (
- (
- (
- (
- (
- (
- (
- (
- (
- Human:0.00655,
- Chimp:0.00684
- ):0.00422,
- Gorilla:0.008964
- ):0.009693,
- Orangutan:0.01894
- ):0.003471,
- Gibbon:0.02227
- ):0.01204,
- (
- (
- (
- Rhesus:0.004991,
- Crab_eating_macaque:0.004991
- ):0.003,
- Baboon:0.008042
- ):0.01061,
- Green_monkey:0.027
- ):0.025
- ):0.02183,
- (
- Marmoset:0.03,
- Squirrel_monkey:0.01035
- ):0.01965
- ):0.07261,
- Bushbaby:0.13992
- ):0.013494,
- Chinese_tree_shrew:0.174937
- ):0.002,
- (
- (
- (
- Squirrel:0.125468,
- (
- Lesser_Egyptian_jerboa:0.1,
- (
- (
- Prairie_vole:0.08,
- (
- Chinese_hamster:0.04,
- Golden_hamster:0.04
- ):0.04
- ):0.06,
- (
- Mouse:0.084509,
- Rat:0.091589
- ):0.047773
- ):0.06015
- ):0.1
- ):0.022992,
- (
- Naked_mole_rat:0.1,
- (
- Guinea_pig:0.065629,
- (
- Chinchilla:0.06,
- Brush_tailed_rat:0.1
- ):0.06
- ):0.05
- ):0.06015
- ):0.025746,
- (
- Rabbit:0.114227,
- Pika:0.201069
- ):0.101463
- ):0.015313
- ):0.020593,
- (
- (
- (
- Pig:0.12,
- (
- (
- Alpaca:0.047275,
- Wild_bactrian_camel:0.04
- ):0.04,
- (
- (
- Dolphin:0.034688,
- Killer_whale:0.039688
- ):0.03,
- (
- Tibetan_antelope:0.1,
- (
- Cow:0.1,
- (
- Sheep:0.05,
- Domestic_goat:0.05
- ):0.05
- ):0.01
- ):0.013592
- ):0.025153
- ):0.020335
- ):0.02,
- (
- (
- (
- Horse:0.059397,
- White_rhinoceros:0.025
- ):0.05,
- (
- Cat:0.098612,
- (
- Dog:0.052458,
- (
- Ferret:0.05,
- (
- Panda:0.02,
- (
- Pacific_walrus:0.02,
- Weddell_seal:0.02
- ):0.02
- ):0.03
- ):0.03
- ):0.02
- ):0.049845
- ):0.006219,
- (
- (
- Black_flying_fox:0.05,
- Megabat:0.063399
- ):0.05,
- (
- Big_brown_bat:0.02,
- (
- Davids_myotis:0.04,
- Microbat:0.04254
- ):0.05
- ):0.06
- ):0.033706
- ):0.004508
- ):0.011671,
- (
- Hedgehog:0.221785,
- (
- Shrew:0.169562,
- Star_nosed_mole:0.1
- ):0.1
- ):0.056393
- ):0.021227
- ):0.023664,
- (
- (
- (
- (
- (
- Elephant:0.002242,
- Cape_elephant_shrew:0.05
- ):0.04699,
- Manatee:0.1
- ):0.049697,
- (
- Cape_golden_mole:0.03,
- Tenrec:0.235936
- ):0.01
- ):0.03,
- Aardvark:0.03
- ):0.02,
- Armadillo:0.169809
- ):0.006717
-);
\ No newline at end of file
diff --git a/PhyloCSF_Parameters/58mammals_coding.ECM b/PhyloCSF_Parameters/58mammals_coding.ECM
deleted file mode 100644
index f894011..0000000
--- a/PhyloCSF_Parameters/58mammals_coding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-0.771493279396
-14.5180982851 0.547433994462
-0.829799770357 31.1892114825 0.7020007509
-1.2357249048 0.0591436724948 0.143021129459 0.0723670336788
-0.0491379655094 1.68015082454 0.0198294354489 0.039540785463 10.4536837099
-0.0705620171551 0.0966709944264 1.69743422922 0.142387839362 91.937054195 27.5243026465
-0.0429527042192 0.105163194816 0.0172649210373 2.25040676661 10.8921310832 29.7216988175 32.0319353336
-7.4338524426 0.17080527673 0.354723692547 0.186750900063 1.57462078709 0.053744234112 0.0267286337571 0.0670392311205
-0.15475952294 7.04751773186 0.133727701692 0.272371840933 0.0995168546074 2.91545126347 0.241247972617 0.30307911252 1.14819950914
-0.523684400979 0.193336177917 7.27785844907 0.248082744588 0.28292064082 0.0737402201706 2.22444630107 0.0911973524823 39.1328554206 1.20406413448
-0.173018086183 0.206353768518 0.171683630752 10.768130388 0.0919414494248 0.0323218254172 0.205978125948 4.34740100489 1.16358434945 33.6941468224 1.7233728365
-0.72844506036 0.0408900267574 0.0984268008214 0.0606490247723 6.27625068709 0.108522818556 0.732902667282 0.156984045956 1.27333682927 0.0371320946863 0.190371215329 0.0649658426497
-0.0107338084319 0.332629598166 0.0135926658879 0.022093725551 0. 2.18866127674 0.143671679617 0.121521316476 0.0119565599453 0.549500917257 0.0356995023641 0.0243544304587 12.7843674905
-0.0520823421344 0.0350655628839 0.405289748819 0.067795684311 1.27336050355 0.160287788944 6.57922720905 0.299427412867 0.0786854813099 0.0488940935773 0.960805451861 0.0665927661081 5.34516996652 0.736796631636
-0.0216049508162 0.0160718839072 0.0223163001706 0.605907271879 0.0245681166778 0.0205049564898 0.158269973844 3.87244486996 0.0304252144396 0.0317223740088 0.0589426989831 0.873730975438 9.99938453006 25.8255751638 1.22569015347
-2.18663674868 0.111696040966 0.0634197481102 0.154784667253 0.211944334747 0.0142851196137 0.0249872010961 0.0178329430869 0.632866998477 0.0456544602052 0.155643358185 0.0852409113534 0.114188793132 0.00538347477404 0.0172684858959 0.00982443430665
-0.0806194749382 1.82202603689 0.0700874839516 0.139029576933 0.0180592441769 0.131956497224 0.0167764425897 0.0204819995985 0.0337369858375 0.495354204564 0.0430768582 0.0598964584571 0.00958027358921 0.0336402412939 0.0100876385187 0. 2.33982994684
-0.0813812527058 0.072537901315 0.967025850778 0.0745340778643 0.0311639252932 0.00984056819269 0.180306689601 0.00854548443289 0.0545028256988 0.042940471875 0.398138428286 0.0395461759513 0.0155719958588 0.00453736963474 0.0574916836341 0.00557974117017 23.6795913232 1.61299074838
-0.0890303815424 0.0309711104056 0.075284329732 2.72022205635 0.0173828570078 0.00889347376972 0.0250244061361 0.189896560082 0.0470550538246 0.0369691647928 0.0517741235211 0.814461875725 0.0113513697564 7.49810654027e-05 0.0161305091349 0.0857488913528 2.52155138217 51.8301587085 1.73431675231
-0.0831502869336 0.00623291475441 0.0140485960681 0.00222815351908 1.85271487285 0.0142595343747 0. 0.0240393018298 0.100035548941 0.00744094731676 0.0208705373804 0.00714801356087 0.202643068745 0.00840395811706 0.0485674719118 0. 2.58108992655 0.0610588913053 0.288098926224 0.0640178651307
-0.0121507251646 0.0924520030781 0.00836826924209 0.0186151696838 0.0836537312744 1.54107027962 0.0440270652618 0.131930258067 0.00717636251265 0.120684206891 0.0125595231276 0.0212153052835 0.000324249078674 0.075269096427 0.0148448619927 0.0162954435488 0.135980978245 1.38509214833 0.0582990476554 0.097001138788 10.3565106085
-0.0327561377247 0.0194019854761 0.151645046369 0.0216308024113 0.16219698802 0.0736088846667 3.56703356477 0.0906683018246 0.0211444376486 0.0293098893392 0.213048465069 0.030853222824 0.105229675827 0.0117895396449 0.238615514744 0.00758025850283 0.383949439837 0.217940094945 3.42317049457 0.151800096828 80.196430788 26.5641853165
-0.00712174354816 0.00723985090453 0.00595505344662 0.0975294587912 0.0438607458733 0.0573004108171 0. 2.03540765518 0.0049271871924 0.0089011742123 0.00755042591788 0.131884297209 0.0101448079456 0.00832642054426 0.0156458916585 0.109023373526 0.0378815314904 0.0463207771448 0.0165605454301 1.6138138067 9.1542408524 28.6750081769 21.9548306605
-0.342652952354 0. 0.00831817472204 0.0019578776316 0.0256561801987 0.00396518185496 0. 0.00828598360004 24.819368396 0. 0.692289530387 0.00221688308001 0.0423207748289 0. 0.00421964524011 0.0102462249253 9.72150853477 0.287135700558 0.111035024588 0.161520784401 0.987246541018 0.0268612351287 0.14984953371 0.0013382555295
-0.0274952800589 0.239907400328 0.130619934855 0.0199908101654 0.00651256013327 0.0940574219685 0.0188049255523 0.0154651516836 0.731121345902 1.44205827826 1.47351708949 0.0159273184405 0. 0.0478071542405 0.00524987299297 0. 0.337092192699 7.2223642138 0.298762023217 0. 0.0197476073108 0.971106449371 0.23665637847 0.000783759865199 22.6147561126
-0.126747246284 0.00525348090503 0.431201251443 0.00871397252545 0.00260008330902 0.00505104531015 0.154413324232 0. 1.38751553761 0.0069785180879 24.2115845119 0. 0.0154314907887 0. 0.026146215906 0.00674642096354 0.249262272475 0.264254321875 5.15802336393 0.282622534951 0.100276942636 0.0464677107833 2.8678028547 0.0103939496336 58.2624766604 19.1638370992
-0.0407572307445 0.0541760472627 0.0408884489312 0.594154801521 0.00637997251286 0.0198824741158 0.0398930112025 0.199496998649 0.131755897653 0.18449888875 0.326574404736 2.81319866554 0.014151320102 0.0153460674176 0.00990532258908 0.0946255220831 0.573596562106 0.632515608499 0.283840725565 16.0063596615 0.075905929081 0.0826477869133 0.145510045956 1.80628209641 29.347029641 79.0811920949 24.1343195351
-0.0670321669475 0.000563067043618 0.00709263218583 0.0160730475881 0.397475218922 0.0108774166451 0.0224531700364 0.0117432492443 0.110217799898 0.00741770540948 0.0106037107321 0.00421212203971 6.34377872097 0. 0.30644392794 0.0507575748744 1.9736613358 0.0556021195246 0.102283849299 0.0480436043823 4.00887120044 0.0417641609514 0.653798644135 0.0359958557139 1.53421130077 0.0163428855889 0.117515458291 0.0242819224677
-0.00643748166518 0.0295649828891 0.000637970407505 0.019754645672 0.0030508665228 0.178930335275 0. 0.00883618689765 0.0253554586766 0.0635021784113 0.0114766272275 0.0282686114778 0.159188805299 2.05296843661 0.0831033972167 0.158454009429 0.0790863053832 0.843181005219 0.0366298173461 0.107941366273 0.0245725600104 1.92780227841 0.103817357813 0.139569513175 0.0230997188178 0.954192866331 0.0226992195858 0.144293124685 11.6702094631
-0. 0.000741264056699 0.0321762732716 0.00876551202277 0.0409627203061 0.0066341456828 0.289776596366 0.0104730362024 0.00188148859201 0.00415933999863 0.0531027228242 0.00397499828712 0.277347255409 0.081204120774 1.47530308516 0.0831617109488 0.0348369494271 0.0330910542007 0.514722517892 0.0315293996595 0.448937601962 0.0560895061976 3.50959324007 0.0672410028933 0.000363858402076 0.0325302162526 0.698509928297 0.0222160316559 31.3936914479 7.82675950727
-0.0103057326894 0.0209560410928 0. 0.0432390313139 0. 0.000598674783837 0. 0.331194702356 0.0159021216996 0.0263734927337 0.0229446661305 0.0793998208566 0.0655491795789 0.0771818086854 0.0755945133111 2.56835350509 0.0801848672594 0.0780599264085 0.0459870926371 1.38822655563 0.0245587112418 0.105445060089 0.157688337733 2.56327777985 0.00606283188176 0.0292401665627 0.0516866860149 1.68499310101 9.08011950879 26.1164046404 6.89513673659
-1.52942036217 0.0973183013281 0.0388353247448 0.117166119514 0.201990514263 0.015333596402 0.0128796043445 0.0124927834828 0.391532889031 0.0313292278453 0.0213395537798 0.046335054843 0.111001960231 0.00549068726692 0.0162640654866 0.00404973027084 1.6718235251 0.0500267310822 0.0517100980774 0.0537247281374 0.0619851968551 0.00546186911396 0.00987533716152 0.00386417990485 0.0791417803087 0.0355024148452 0. 0.0324557541248 0.0530512896758 0.0027411404153 0.003400456723 0.00422901561025
-0.0827672478108 2.45968541101 0.0634654669355 0.173632559347 0.0131604282059 0.164795491269 0.0131791154447 0.0351360772548 0.0335412538099 0.474036367211 0.03667071173 0.0671758266016 0.0124420599637 0.0313192578121 0.00897011881742 0.0123210571936 0.0862780006103 0.62622938248 0.0460793037594 0.0418612404259 0.00488689931062 0.0558122415879 0.0175672823754 0.00628262205823 0.00715550696459 0.0910460725338 0.00443029935197 0.0287613924571 0.00313419211364 0.0319575833704 0.00226776365132 0. 1.70115845114
-0.0522505604502 0.0898926251941 1.06240549924 0.112920569564 0.0463514147993 0.0149556757989 0.290216053777 0.0126916204037 0.0444314578346 0.0425138927353 0.346736063384 0.0532746125015 0.0239887410771 0.00428625042153 0.0806840702641 0.00726198943985 0.0617898168537 0.0606229656609 0.929748659037 0.0607814405512 0.0130660362186 0.00815276835162 0.144015583909 0.00475002529722 0.0297003498473 0. 0.132271963252 0.0101996218813 0.00843968014492 0.00444182503798 0.0259434869283 0.00418488182163 13.9895365789 1.74259584965
-0.069879625366 0.0502569650608 0.0601726449853 3.10841773214 0.0194174772813 0.00880592559668 0.026064139331 0.183837737792 0.0384232333402 0.0386598563856 0.028491177004 0.66561597344 0.0178802430678 0.0106144479446 0.010721316501 0.0584953860606 0.0488555874011 0.0240956518334 0.0447701807091 0.81606944054 0.00601727190495 0.00644546124483 0.00707166378557 0.0505635979412 0. 0.00103456844645 0.00427279006237 0.187146494621 0.00269164053833 0. 0.00100987468273 0.047653345948 1.4140884143 23.7236399779 1.55601401505
-0.181158453397 0.0260123477086 0.0397790253368 0.0100844740285 8.86889734423 0.0461483266391 0. 0.107929568028 0.256807798045 0.0320388886734 0.0695661905816 0.0188244726856 0.942228107881 0. 0.280430428925 0. 0.177260190745 0.0103616000988 0.0309089068449 0.00733443583341 2.08534651761 0.0619419333752 0.0385046664547 0.040395753471 0.063159608537 0.00541444268653 0.00590389620526 0.00982289064588 0.298133346746 0.00680478222793 0.0432921772456 0.00757149486997 1.03013073458 0.0486682637201 0.188686676483 0.0246949247744
-0.0122577305366 0.191980971044 0.0161067868229 0.0275695037423 0.14003002796 5.91146468912 0.134860570052 0.387425224734 0.0209047479093 0.400275840087 0.021321233877 0.0329212682449 0.00736037530406 0.286707031154 0.0674343529579 0.0311016087688 0.01510330413 0.0812436776202 0.00951252481602 0.0089036753564 0.0500637131568 1.53342839158 0.129298933272 0.11420040671 0.00657888694428 0.0901221706124 0.00747913674455 0.0199622847226 0.0126688373082 0.175994119126 0.0118295798482 0.00036469247377 0.0486596453358 0.628137800632 0.0473421611494 0.0308176979667 8.69450787125
-0.0555064568149 0.0480629442424 0.276262166032 0.0331518765262 0.562775127606 0.281398177498 15.7085436131 0.333136469932 0.0406317413376 0.107810107191 0.523491550083 0.0915018349276 0.234333738224 0.0552067621755 1.18046200077 0.0590812702434 0.043050916247 0.0231734472692 0.204509977331 0.0233882916335 0. 0.16346581468 6.09067753677 0.0888615500043 0.0279377722441 0.0701278427092 0.269656981301 0.0300336306608 0.0285534734776 0.0334291528371 0.323865691396 0.0205253370633 0.126702292889 0.134698271566 1.9279992831 0.0830503615842 68.895319709 18.1269451688
-0.0105930094914 0.0197467947894 0.00672572148301 0.219652037737 0.0569481631527 0.192199885757 0.0770026769259 8.2030334245 0.00992272063324 0.0406733489963 0.0200757655693 0.465563570471 0.00648442428788 0.0322131056713 0.0652316603109 0.434810615786 0.00266089608895 0.00461778904828 0.00596362923912 0.0916196214411 0.0124266748599 0.0905298871638 0.0352078645817 1.75296746263 0. 0.011915518628 0.0064691624691 0.117966135277 0. 0. 0.00641417426938 0.263264203083 0.0294620633383 0.0517569597285 0.0297106128632 0.775854199415 9.25329006582 21.8046714515 21.0184122059
-0.254177076964 0.0466163962153 0.013775505342 0.0165752917716 0.2541994313 0. 0.0234895802647 0. 3.51441514201 0.0628800416072 0.126836526076 0.113077846139 0.202105100057 0.00982962599455 0.00967118786199 0.0052933427804 0.301915015348 0.0209447385129 0.0262482055616 0.021515034263 0.0805828810913 0.00282008757285 0.0242510782787 0. 0.874922102518 0.0133118469457 0.0278638597687 0.0256982967577 0.0830735772627 0.0140431178472 0.00152631760016 0.00512338828271 2.14076248522 0.109913868096 0.127066667315 0.0860586763677 1.85126960484 0.0189655004627 0.22577819126 0.02214203147
-0.0187961223364 0.536260801381 0.0187201885281 0.0570722129956 0. 0.249122534002 0.0247618945167 0.0347282919429 0.119844529013 5.89713390113 0.135529295696 0.37862421452 0. 0.0716822297298 0.0139552063489 0.0090504051125 0.0143990351069 0.218599982006 0.0201367961938 0.0288787666884 0. 0.0953004938169 0.0184742524512 0.0163365894936 0.0148614517249 0.91696743349 0.010473158236 0.102230161422 0.00781085519074 0.0411893350182 0.00772386312203 7.845967971e-05 0.0513084582793 1.83647544751 0.0711026312034 0.0484847347439 0.0136165169786 1.40745470677 0.258157562514 0.135820730719 8.13762983681
-0.0328636713303 0.0187769783312 0.235179486576 0.0733364272614 0.0926161334728 0.00838022497616 0.408607171412 0.0113896740303 0.230797267043 0.166509619107 4.62098300244 0.355598938915 0.0707469720138 0.00499944094366 0.1819732433 0.0220544026913 0.0721575489303 0.0276836910024 0.222982276164 0.0331777831189 0.0244250690124 0.00613550182328 0.289795200046 0.00732929200673 0.0844588490175 0.0304535572718 1.0957917311 0.0567580546743 0.0173063494738 0.00490556988502 0.0661130308739 0.0183619577456 0.0948448651991 0.101343657162 1.83229308595 0.0912091468367 0.433113687149 0.0715023194908 4.13594806656 0.0258080154165 30.5908569921 10.0811942943
-0.0243094808513 0.0577216517943 0.0200297769648 0.877392683846 0.00616672142884 0.0133710129811 0.0101473425531 0.425742741255 0.141560490571 0.443900074406 0.191187943803 9.36899545687 0. 0.018888775476 0.0149073518673 0.13913130704 0.0462748737881 0.0379647006055 0.0137169525908 0.459494094526 0. 0.0190014624053 0.00446871333479 0.110939295873 0. 0.0330973044641 0.020129035622 1.80187002398 0. 0.00776890685305 0.000484586777783 0.0693812551183 0.0801448777091 0.218228314494 0.10116895754 3.17665838205 0.0223213571149 0.107982033724 0.190590547393 2.20919088952 7.91138478576 34.3882055135 12.7244322854
-0.15434282613 0.00935208126288 0.0151733883381 0.013729475622 1.71785898184 0.0271358624608 0.146655133895 0.0177553776853 0.30178866371 0.0182577297541 0.0375645028041 0.0274235268157 26.8094991811 0. 0.612478351302 0. 0.142234190974 0.0114076697294 0.011520354398 0.0142505051056 0.280313823039 0.00876817134547 0.0630840357167 0.0103192072714 0.0826066155485 0.0047477806076 0.00469973766013 0.00628193768667 4.58278302533 0.0291050999455 0.0296673134073 0.0479828667289 0.725647477002 0.0270877926263 0.0588757234687 0.0273951850099 6.40325605509 0.0438568294629 0.732225073977 0.00651736008295 1.44810954129 0.0184942984015 0.172245324759 0.0349897269167
-0.00969533647635 0.0999488616985 0.0052454488918 0.0131800710292 0.0337929099917 1.0749439893 0.0326869238681 0.111456192054 0.0264268584625 0.224134039428 0.0199444908588 0.0290530701962 0.562736693539 10.7237952641 0.118229726105 0.506770835596 0.0102800806728 0.0606173209593 0.00751054512132 0.0133113286074 0.0105443090872 0.183782605146 0.0204709347631 0.0276985652596 0.00129705656982 0.0754620175889 0. 0.025804891967 0.030298070793 2.03508410924 0.0447055642363 0.132059900606 0.0301183881127 0.37615525312 0.015908228653 0.0213106603965 0.0431287073534 3.93391823581 0.275853026894 0.265254577006 0. 0.929017326538 0.0360346586025 0.121805115134 12.2774917757
-0.00781203656183 0.00305032194564 0.0716340021864 0.00950419017431 0.290444381626 0.0363585294956 1.48832591097 0.0531160643028 0.00529187417067 0.0181792465187 0.1898146219 0.0202367292531 1.25814605694 0.340506545072 3.55342590032 0.340626708068 0.00543938441184 0.00876335637772 0.0465035840453 0.00925919109869 0.0557620647879 0.0126977754034 0.284454447223 0.0133494203904 0. 0.00517806534409 0.0414239861961 0.0147777238638 0.0411492373521 0.0355017967194 1.07082122249 0.0287025328326 0.0124956170788 0.0109304744587 0.34347636804 0.0163556298762 1.02652889428 0.14159544335 6.96484884785 0.145598748684 0.0100539151045 0.00261004468069 1.03235017399 0.0320664273316 34.9286691378 8.23239114357
-0.0114083420209 0.0199984874197 0.00840313920552 0.139176400973 0.0135290119007 0.0655614948349 0.0271933719352 1.45516931 0.0142193129151 0.0186767358189 0.0235742444493 0.348139821213 0.292921217267 0.0772705614775 0.146955588856 13.0029095601 0.0128252811737 0.0160174998411 0.00344783997877 0.0854516604554 0. 0.0306215484952 0.00135298295599 0.197945344879 0.00398803702332 0. 0.0112408821513 0.130903293586 0.0345087851993 0.0350951206775 0.024019772453 2.51762209502 0.0236558879595 0.033012214447 0.0321554878851 0.53405164739 0.0272060510773 0.175337751612 0.294680297433 5.21552771342 0.0246904606628 0.0948001199036 0.0427269667822 1.71316918042 10.4885072326 28.6013786797 8.76793221684
-2.77594356032 0.0993047870626 0.258987813235 0.196747240033 0.159727053992 0.0201599544009 0.0456494718309 0.014416684875 0.453919642655 0.0552728098673 0.176877082092 0.105471229855 0.386772302504 0.00718586592846 0.0321231644917 0.025169217975 6.78299214328 0.375237957265 0.480908376528 0.294621559134 0.387630790093 0.0702904544528 0.169324529386 0.0583382719292 0.390108022986 0.150928696164 0.18405706465 0.0963763242996 0.894999246158 0.0063632664085 0.0562162829768 0.0486748216443 2.62332950228 0.20035925212 0.35459689191 0.134554657987 0.228256251997 0.0429382995137 0.0430277011087 0. 0.499835267232 0.0872802166146 0. 0.00901740735283 0.289857331321 0.0270375266701 0.04838186141 0.0374696887996
-0.0121894520849 0.410790063033 0.011133598533 0.00165056619402 0.0051843131731 0.0431018327577 0.00539237299706 0.0150623598867 0.0170708870198 0.0840406186667 0. 0.0242935664732 0.0080513219032 0.0398494896751 0.00545725560213 0. 0.0790745463878 3.2078145507 0.0532472065717 0.010043455522 0.00635188554487 0.0880596706435 0.013721224767 0.00651922284968 0.025457891714 0.304325536564 0.00707279853229 0.0675357009414 0.0172192049667 0.106767001377 0.00573203678181 0.0136987547062 0.013655212029 0.297543754748 0.0119723251101 0.00318746283208 0.00162010996025 0.0299444434255 0.0108699938489 0.0166143146908 0.00169048351502 0.0635594253576 0.00467473667675 0.0232766714606 0.00173091362045 0.0456155333578 0.00257003829396 0.00549671428511 3.59183812996
-0.0128603903345 0.155272434481 2.90473676882 0.0921884295404 0.018003235893 0.0088919464121 0.332278027108 0.029517979277 0.0950845378976 0.0814115848686 1.02293237377 0.0782302611672 0.124932670117 0.0147696168081 0.209777697594 0.0191860423374 1.17481497084 0.422005627993 7.16881310532 0.519389046385 0.138828982528 0.0537440354805 1.18848446499 0.053710043866 0.258890930878 0.191467019998 2.4094721595 0.233810974308 0.141415434357 0.0802249814486 0.478853644692 0.0570549680101 0.186570124039 0.158525054764 3.30106333889 0.127155955145 0.070267211767 0. 0.703384400913 0.0418228555285 0. 0. 0.981935304195 0.0968146005396 0.0783266440087 0.00763974452017 0.23785171402 0.0201171111811 507.765111884 2.44158816723
-0.0298412769399 0.0122551089064 0.0159708172401 0.662041901317 0.00734282838376 0.0100875430507 0.00631171792731 0.0627729308325 0.00317881402807 0.0217712378384 0.0380502109864 0.181154195019 0.0147807967765 0.000693398311567 0.0108043597623 0.083547251776 0.124351036848 0.181987183493 0.0659530747008 4.28844853026 0.00751655604012 0.0154663468996 0.00513218639619 0.101949747019 0. 0.00997028720563 0.0172390346722 0.836591636433 0.0182342555086 0.019835677565 0.0069782151758 0.16156444993 0.022796908347 0.0389716219568 0.0269186753463 0.441801768503 0.00596547916974 0.014701676295 0.00739562555348 0.0342721533618 0.00495950613705 0.0217814491004 0.00623597741371 0.141948440236 0.0124771328796 0.0118889570172 0.00259482001219 0.0781727135773 2.98967538063 49.2839591139 3.316675155
-0.0722278190998 0.00500866092764 0.0173192942569 0.023154035384 3.4470883287 0.0171508279517 0.0554954011444 0.091309482244 0.0662760011389 0.00829980119382 0.022354058005 0.0338946495945 0.235314951058 0. 0.0763098378531 0.0332331474469 0.286505793562 0.01505939157 0.0464968416988 0.0254099705532 6.29714726079 0.0976069040919 0.476439604983 0.0361553588411 0.122280514014 0. 0.040880462884 0.0107976740267 0.516163749196 0.011360889129 0.0121972794524 0.0203193196188 0.0695019404399 0.00472048511553 0.0113007052678 0.0118761160785 4.26073713503 0.0861649940812 0.310162417427 0.051843758979 0.103507527036 0. 0.0457793711362 0. 0.430028495412 0. 0.0801999766326 0.0205470075237 2.81788640408 0.00323540880644 0.44167841641 0.0268487689328
-0.0109315724616 0.144616714606 0.00821707597789 0.000456726857907 0.0764913882054 2.45357074876 0.0661435744316 0.176744922702 0.00819456481366 0.266597495417 0.0182759357264 0.00846119421793 0.0313617134389 0.0966495049223 0.0162790413192 0.00163711843708 0.0369439154618 0.234872736279 0.0123576787921 0.0265123221939 0.036042397569 4.81163765756 0.150265642397 0.164785582551 0. 0.180317458513 0.00458491922496 0.0367902105118 0. 0.389255850299 0.00174760112765 0. 0.00257753728933 0.0635580300716 0.0084535343221 0.00282624864339 0.0447019415675 2.88017138187 0.289532320254 0.123735336689 0.00324188461583 0.118078308966 0.0100812848724 0.0198277053741 0.0116340464762 0.243292793662 0.0120482062486 0.0176763288885 0.263693820924 0.709176626674 0.248550219855 0.0328825526141 12.6242878278
-0.0135254471713 0.0224138900757 0.096798546819 0.0154444374282 0.469113896116 0.22743490158 7.79328364964 0.213279371798 0.0161344840406 0.0784909371759 0.179648483473 0.0628751158954 0.0423341383387 0.00630178455457 0.312339853289 0.0234883695029 0.0322889750944 0.0291162192912 0.247846604119 0.0201655279496 0.0518907117023 0.0661747311717 12.1031163415 0.0342292472337 0.0670292507246 0.0263262931891 0.406923875717 0.00490776541097 0. 0.0160598832211 0.353791691237 0.026544047596 0.0118193968718 0.00791022068661 0.109843293866 0.0158225402976 0.333300299142 0.31958909408 12.0613669426 0.0616488096615 0.0107388318896 0.0148583295769 0.233395457926 0.0229189251464 0.0725987489501 0.0224009938245 0.366753524194 0.0033444418443 0.435154262392 0. 5.18531608176 0.0337930801197 103.370411838 30.2187145757
-0.00889801311401 0.014314272414 0.00733263507062 0.139923321215 0.0599475336812 0.151241438878 0.0626266723432 3.26792392121 0.0168047793112 0.0355345341123 0.00841349152452 0.279741113857 0.0269058261891 0.0203136714086 0.0172489856388 0.100526472268 0.00951741783187 0.0365100909268 0.0188076923165 0.311852144931 0.0234901851248 0.406481108084 0.118585605774 5.59567167405 0. 0.0209633844747 0.0017276477389 0.386993411551 0.0356811825554 0.00753007889328 0.0256322285828 0.467310381695 0.00386274806443 0.01299145289 0.00713480561887 0.0563915408293 0.0270058369068 0.251044072283 0.255733515669 3.20974363638 0.00242786317209 0.0191998396281 0.0137316622378 0.150868053414 0.0179523093513 0.0494934567133 0.0152084857496 0.22043068467 0.265435129553 0.0233293793875 0.240040834453 1.01421579934 10.035477583 28.3055731705 29.0099153961
-0.161412798087 0.00424480446191 0. 0. 0.0906916476566 0.00563968805371 0.0321857317281 0.00625169793881 2.32459802666 0.18028353771 0.402169481502 0.146021735821 0.180738849749 0.0152470119891 0.0594309552204 0. 1.59918269474 0.0878914404839 0.151488329592 0.0644464394055 0.433227437698 0.0415119312985 0.134563380307 0.0308938272344 12.8269080058 0.586851670675 1.37028858456 0.768958451975 0.504903662999 0.0401830542296 0.179516483383 0.0260615738593 0.320069615284 0.0514874328311 0.0730906239858 0.0500704875043 0.126989204283 0.0185452770624 0.120931812654 0.0233211166859 2.57821698158 0.137637074862 0.52477780815 0.185823198291 0.14069243508 0.0436555868557 0.0759002609233 0.0304916977712 351.484733517 0.0751625144229 26.381564856 0.10755263699 1.62508488908 0.117164738243 0.443351098266 0.125852859682
-0.00540817019885 0.109532143682 0.00466186168276 0.0119570850765 0.0158619374367 0.0807774228921 0.0133696167272 0.00519688621966 0.029392784273 1.27871496477 0.063722905148 0.04128067384 0.00632884583531 0.0453137431349 0.00843806244594 0.0123184356638 0.0549166610956 0.828580129577 0.0498266614372 0.0502292974892 0.0199171150784 0.185872475093 0.0251441786984 0.010719019886 0.089127529091 3.4296456957 0.103967035845 0.239907865574 0.00468334570237 0.206251061571 0.0138674587778 0.0283270941681 0.00773883894314 0.0717966354105 0.0039461417809 0.00130873744795 0.00796058746493 0.112416234141 0.0258843362023 0.0102273571283 0.0143618403641 1.09404680854 0.0371145501871 0.0742827896751 0.00597837009967 0.0989926626628 0.00732532644804 0.0141200991997 0.297694270758 1.90815280778 0.448236037837 0.0662766472026 0.0370265810511 1.47916590967 0.115943259122 0.102962006329 2.53689270085
-0.0102444412948 0.00509286785591 0.0526826133572 0.00865174390146 0.0167207453137 0.0078067338281 0.0680018616885 0.00652270728479 0.0529708932914 0.0317393901905 0.953237491747 0.0460080390141 0.0202225963419 0.00647460880487 0.0627457859646 0.00621514632303 0.0849084781118 0.0605758785434 0.430500146762 0.0760617630848 0.0368909715192 0.0130987377349 0.289812358407 0.0111800529475 0.15870666689 0.105782269501 3.01587355888 0.129715864077 0.0292980098652 0.0140236078572 0.161233068931 0.013554679652 0.00638065202681 0.00383023188484 0.0462524279848 0.00467115363075 0.0143634062062 0.00687250339689 0.106692653386 0.00553305812419 0.0427454939109 0.0298804720595 0.989563854742 0.0360911542865 0.0145669991601 0.00652825936214 0.0693258497758 0.00506439035447 0. 0.0616959880557 9.95680242469 0.105688196253 0.162332902184 0.0468444399235 1.27307344663 0.0459595842087 8.27606578348 0.715389857412
-0.00789939435885 0.01212501017 0.00773363835482 0.175301373497 0. 0.0143690209499 0.00126452851364 0.132117818087 0.0582018868707 0.0711103982248 0.0578686515489 1.756951756 0.00998972583202 0.0120449704688 0.0114545328219 0.0634532707085 0.0744891940437 0.0686263990691 0.0484135563166 1.44153871334 0.00450888748208 0.0272210780702 0.0240257116739 0.208900041641 0.0398056574747 0. 0.113109727358 5.32058987453 0.0150482576711 0.0314730538069 0.0119754249663 0.256988726401 0.00098902044467 0.0131515986558 0.0105575625281 0.10786533181 0.00903471281231 0.0072515426398 0.0277375045236 0.110148076992 0.0208083242687 0.0755742185728 0.0905113037895 1.71936164198 0.00966856631646 0.0179622299535 0.0146245333127 0.12178135613 0.294662757949 0.0974744910442 0.572307858294 3.67660894718 0.0571583781106 0.0395596260121 0.107882138908 2.20567784646 1.91713540938 48.0143648972 0.853169465851
-0.0531643487552 0.00046790400605 0.000838453691686 0.01812896729 0.208420547857 0.0343787330744 0. 0.0231920471902 0.043685055595 0.00732004830476 0. 0. 4.11106061846 0.048722096716 0.146088640727 0.0560625049253 0.0474926500595 0.00475721733224 0.00484972824452 0. 0.197182079712 0.0457824201776 0. 0. 0.058950641239 0.0289413524406 0.0136873269902 0.0229852647113 41.3472328531 1.0528307594 1.29285877772 0.306280922598 0.0345768065397 0.00451575537032 0.00714407574213 0.00383630480052 0.231578282487 0.027634098434 0.0463528990383 0. 0.0637039348201 0.0184746799941 0.00875762872995 0. 4.32985621739 0.117782272716 0.022019255005 0.0681679785543 3.64445607755 0.0592877548457 0.525086277223 0.0756449030113 4.56261330482 0.110131050888 0.0439052051569 0.0797889683874 2.06518561996 0.0666683510558 0.0762726044496 0.0517838499854
-0.0055199762485 0.0334289719786 0.00390763608714 0.00102384267646 0. 0.106196580492 0.00818508580281 0.0136642809574 0.00357284653328 0.0457468056207 0.00694679633975 0. 0.0911050824201 0.599678869518 0.0489300439061 0.0108088282083 0.0105832559291 0.145765335695 0.00690974052474 0.0114920430125 0.0175529106988 0.175936238339 0.0413270786918 0.00872752794066 0.00466216314537 0.0913950125537 0.00860719686636 0.0243677507458 0.0585882757321 2.80334749919 0.0872701701452 0.111401177662 0.00200006153919 0.0217250647562 0.00433905371471 0. 0. 0.110447906903 0.0173404257969 0.00995287043434 0.00388615508611 0.0438806416399 0.00902124309974 0.00312743519908 0.0425164571122 0.955534749424 0.0288747192586 0.0248716875581 0.206472713399 1.77357320853 0.123522093577 0.193297452822 0.0928470465172 1.53245881476 0.111006305099 0.117335749811 0.105553436644 0.742828630094 0.0622235265575 0.0423426485008 1.43526430491
-0.00783695049608 0.0250727545388 0.0365535857915 0. 0.104520783638 0.0175266123984 0.423097003684 0.0372719485901 0. 0.00118601758413 0.0980061451082 0.0165691637301 0.398423196665 0.0736727127086 1.87900199944 0.0923264680767 0.0174427982474 0. 0.0558435587249 0.0325636812093 0.0600891313087 0. 0.53367919355 0.0668040000349 0. 0.0149063765247 0.118853989326 0.0549025463859 2.14712512855 0.312763441889 20.1875336549 0.347860470677 0.0066552531376 0.00307323366926 0.0412644723982 0.00610625387445 0.0831499855006 0.0075476627928 0.537235020729 0.0317779628223 0. 0.0021195066801 0.103937315422 0.0444811941521 0.209725175735 0.0477753255181 1.65952099137 0.0698039587929 0.0802054038476 0.0387196706916 2.78319794878 0.061028317299 1.47838527252 0.204511470784 7.10912954036 0.256877041263 0.549142746907 0.0751592976177 1.26735185125 0.109280267489 34.4959393706 1.05085922221
-0.00746472259056 0.00204899373295 0.00581141364371 0.0491987450047 0.0279931733762 0. 0.0187164230282 0.139287436956 0.00599351063267 0. 0.00799680673582 0.0650958058285 0.0344787803875 0.0123348960029 0.0622609147898 0.851318265478 0.0137965285149 0.0171589122973 0.00792908114731 0.177351717033 0.0066528572533 0.0210605579391 0.0315464539473 0.18248378446 0.00953680519322 0.00890950686499 0.00910725738233 0.174716153118 0.0532132015906 0.106932799171 0.0628787450617 3.22751790841 0.00644393995935 0.002174043541 0.00377513820975 0.0273030924407 0.0338199259892 0.00125051939221 0.0390614305644 0.10632141054 0.00310445049144 0.00717703221063 0.00848650791657 0.0783047449268 0.0456723888635 0.0516488993956 0.0415544937568 1.15249307403 0.265892650003 0.126252301003 0.188030143058 2.21350162545 0.0711131598547 0.0498530038432 0.14039933692 1.62206226821 0.0927215536591 0.0268076213023 0.0997798597602 0.992253660267 1.28408120875 24.4950942036 1.65934183601
-
-0.0255410031621 0.0196994410272 0.0329436805941 0.0171683371063 0.0149396985614 0.0183708104275 0.00645076614979 0.0131771277358 0.0119329780996 0.019404291813 0.0110661479582 0.0126066351598 0.00767281125434 0.0211476929741 0.0217199500715 0.0162144992548 0.0125788049362 0.0153824193819 0.0351900543795 0.0107925691178 0.016594963679 0.0192878934182 0.0069342750228 0.0174443586684 0.00639363526807 0.00974852461103 0.0111678900222 0.00443298791246 0.00723674640067 0.0193993823623 0.0394721937175 0.0134712866574 0.0308697977783 0.0261955025614 0.0398854098195 0.0222118074114 0.0157269211794 0.0271424443752 0.00716582944527 0.018409347815 0.015995194452 0.0210047367317 0.0151538538426 0.00983855721495 0.00727530179348 0.0147630423609 0.0279360948926 0.0111035450087 0.000586877417582 0.0155362448361 0.000536216447671 0.0120197877511 0.0121507344448 0.0176708896065 0.00473584340384 0.0155784373036 0.0010210997268 0.0121177246907 0.0119605502469 0.0104896896194 0.00812470878645 0.0202026177119 0.0134871493447 0.0175201850745
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/58mammals_noncoding.ECM b/PhyloCSF_Parameters/58mammals_noncoding.ECM
deleted file mode 100644
index 2e3e718..0000000
--- a/PhyloCSF_Parameters/58mammals_noncoding.ECM
+++ /dev/null
@@ -1,72 +0,0 @@
-2.78592743423
-6.58600444004 3.19341169223
-1.63519457982 12.1399355041 2.45567860959
-2.43476285124 0.137196047767 0.462787891603 0.0687994720539
-0.0828676812999 4.64297827314 0.0583439047427 0.114333277922 4.54770228198
-0.569910594763 0.269905137878 10.0658717921 0.227536068622 36.0992488386 10.3039899411
-0.0485017841297 0.412819154555 0.0211222634573 2.74491138612 2.97356015436 14.4767642696 13.8730044691
-4.91172089731 0.155166943916 0.607308551579 0.0926673262207 2.93090865811 0.0568018331327 0.563736806771 0.0419502454502
-0.110594870229 14.1973016288 0.227814935065 0.348821740023 0.0698012930426 4.35673029912 0.320289189969 0.205259373689 3.19849897319
-0.200634258787 0.0561388860069 9.29335938844 0.0929695932917 0.395913544434 0.0764056737434 8.35592589299 0.0734485882052 10.2333897454 3.31735868963
-0.13798910766 1.0340072599 0.318823468155 10.7213291459 0.0794339571607 0.150236344311 0.308812958798 4.11390908902 2.34629268324 13.7678588818 3.75348569698
-1.61163899145 0.0903822534676 0.0978724405796 0.103846672592 13.0480744395 0.227582308607 2.33026717206 0.158960500271 2.75288101677 0.0415967285977 0.155011835538 0.0774147142431
-0.0539412039354 2.7175215174 0.0197134073579 0.160319614896 0.188046082887 17.3910431275 0.852712504949 0.990756643627 0.0714613184066 4.0085387173 0.0637586828172 0.239230657001 3.72498943433
-0.115504297981 0.0554316110801 2.62956148456 0.108596913546 3.44821535373 0.624122455894 46.1826203189 0.819390424217 0.144340307998 0.0767389836681 3.45253752203 0.0918946223283 11.0581166867 2.78890551354
-0.0686425149198 0.126358582519 0.0353234891621 1.62786654769 0.112834294186 0.366312347819 0.910925474064 10.8159929664 0.0420270072454 0.121652373835 0.041021549888 2.70393912639 1.97744280002 8.57968016608 3.32159829656
-2.7544269435 0.0893651329767 0.147541427462 0.045588254393 0.13118461025 3.18524470568e-05 0.00511362108266 0.00177951014407 0.415950418678 0.00274376193493 0.00295069255731 0. 0.0490110518677 0.0109095971916 0. 0.
-0.0792482672501 3.8269663053 0.0600975342331 0.169229443099 0.0235434410828 0.20555593481 0.0187169473997 0.027489303549 0.00704240140764 0.842055408475 0.0204804845935 0.00228597224206 0.011244526864 0.0757896416031 0. 0. 3.49147912066
-0.140350659206 0.0519225842332 2.88395589756 0.0273793218983 0.0160717268365 0.00476194914635 0.256665151464 0.000945031287224 0.0457491179596 0.0221450577789 0.598936842192 0.0157356154024 0.000732141038617 0. 0.0653627423271 0.0024299228541 10.7164632866 3.57233983814
-0.0420703782816 0.245254684763 0.0661881569729 3.31052265197 0.00921779748141 0. 0.0187176169492 0.0941345819645 0.00889233349389 0. 0.00988308290204 0.825507301736 0.0116464934505 0.0265891275072 0.0121580600248 0.105930373584 2.27706263405 16.0355075221 2.99806680412
-0.0835624220006 0.00882220161046 0. 0. 3.08974563007 0.122047945762 0.580194800746 0.0527490707359 0.0735023766671 0.00433095387463 0.0343457304593 0.00511087269641 0.0846597799348 0. 0.0288920646816 0.00160328304007 3.89374822857 0.145724186109 0.859411475778 0.0977710846653
-0.0154152275448 0.104820298736 0. 0.0105463060181 0.115102782565 5.17009625533 0.237854650192 0.172608828294 0.00557693962982 0.118368017498 0.00724878346524 0. 0. 0.182319021431 0. 0. 0.138898774156 5.03284649814 0.138658093089 0.165678358789 4.79323321106
-0.00482910140346 0. 0.20777458312 0. 0.532995768631 0.254053586795 16.2610321 0.173403286842 0. 0. 0.157481114874 0. 0. 0. 0.394080739918 0. 0.69328323564 0.320689384456 9.88649042287 0.167025974959 34.8139406207 10.1133870094
-0. 0.00961312458577 0.00777720146138 0.0421416632552 0.0668430982448 0.316055827456 0.310161085324 3.80578081572 0. 0. 0.00286341134589 0.0655755234675 0. 0. 0.0111015655273 0.0940823246107 0.0501235340082 0.388529007176 0.100853422779 3.47803826662 3.01358288946 13.5549050105 9.5786073322
-0.468309814243 0. 0.00422239547645 0. 0.26830641753 0.00846178333649 0.154305577789 0. 11.2231238988 0.279262732154 0.668330937867 0.193652679992 0.219677620446 7.2077574577e-05 0.00604055276834 0. 33.2452989031 0.811222421625 2.55659342609 0.452160447674 7.64549509172 0.263216471122 4.7802784332 0.143871982185
-0.000860877233951 0.834462206337 0. 0. 0.00360228322614 0.414239512028 0.197936924501 0.00823935352163 0.11774285457 11.2493424316 0.201884259842 0.497799451235 0. 0.266084682123 0. 0. 0.266110848103 34.7258580282 0.547536957554 1.46118924155 0.160338489022 9.08023328703 2.77572496514 0.635232621196 20.7884238597
-0.00982618500386 0. 0.591865235112 0. 0. 0.00218531337504 1.27017090395 0. 0.339648545761 0.16161338633 9.56757283704 0.183239415868 0. 0. 0.190549769126 0. 0.939489900239 0.401541837309 30.6896731945 0.378631582678 0.49544403824 0.338076522141 40.5444710727 0.154867530415 51.5670070065 18.1748961464
-0. 0.00305450479455 0.0135564060988 0.917987071428 0.0121496291976 0.00940515686116 0.119119559264 0.323445066476 0.137627082052 0.973331878132 0.317403241123 13.7268039631 0. 0.00385237606388 0.0129442098625 0.2243721539 0.436381800076 4.66762939214 0.890960051922 46.0687746218 0.159821879484 0.606560651364 1.3124413836 8.44478548018 12.4665171004 49.6206423643 16.2525872954
-0.0480997542122 0. 0.0120069171917 0.00705871640247 0.365898539349 0.00331565177772 0.00828798187583 0.0190617177772 0.0566983820258 0.00206195136388 0. 0.000851243591405 4.13290256325 0.0778480013042 0.257064930071 0.0532942502359 2.58623674767 0.0627896589555 0.130295452685 0.0607415410117 12.6708354607 0.127040124001 2.19987609742 0.174617163404 12.8946521218 0.0747252598411 0.446429410446 0.0977030126566
-0.00562265261444 0.0764307547465 0. 0. 0.0063414974605 0.380861788353 0.00753424639752 0.0220559286448 0.00980976134525 0.101156083167 0. 0.0138619086514 0.072833456771 3.75912497016 0.0471465843163 0.106431837705 0.0803441627835 3.285182125 0.0552749886049 0.164538257304 0.2503607233 12.1799982117 0.873441856704 0.770053907325 0.397759952713 10.5237799774 0.22377862705 0.742945113248 4.04528522945
-0. 0. 0.0539015946056 0.00278364992127 0.0377957707833 0.0135963635668 0.89440013158 0.0147550321805 0. 0.000295662566089 0.101859214026 0.000945192222413 0.107777801947 0.0455856315413 2.95431984048 0.0299580499308 0.0692407005928 0.0777213018462 2.8342950611 0.0597295499215 3.20392772547 0.525791072418 30.2914067842 0.591091345872 0.778259117844 0.196799800294 9.7436291249 0.250287033284 14.0153836355 3.34075289278
-0.0029775553938 0.000481714381558 0.00995582674459 0.0354561987446 0. 0.00988402515618 0.00175895315694 0.319479264747 0. 0. 0.00856538884321 0.0181925584499 0.038841902373 0.144236561331 0.0680763995227 2.45864879147 0.0532891365325 0.207694885915 0.0544091024245 2.62133140043 0.124628865738 0.386482949994 0.605612447182 9.29643383867 0.193490205147 0.508707708341 0.224730774419 9.95732384776 2.2284772758 9.79481604528 2.83331650296
-6.56858255082 0.157040779976 0.412175038103 0.0941892466145 0.22602139234 0. 0. 0.000432028561943 0.578215659146 0. 0.0122850462384 0.0100014809361 0.11167679813 0.00640756227736 0. 0.00161147255275 2.46904674823 0.0456773806562 0.15229360324 0.0314539380676 0.0534554009708 0. 0. 0.00927397630364 0.447179203281 0. 0. 0. 0.0367299291555 0. 0. 0.00903617543561
-0.154254426169 12.0194888817 0.188385564082 0.404976306527 0.0330397145777 0.450121271064 0.0489176001655 0.0370399636967 0.05094694887 0.990991883141 0.0180840722072 0.00384380211183 0. 0.169457512386 0.00819708281146 0.00870799638103 0.0573145148162 3.61306377769 0.0855272437255 0.154782328737 0.00748232676517 0.0881927464735 0.0049964336753 0.012854379142 0.0301713814632 0.72400213014 0.00648062632878 0.0198374976478 0. 0.0571707574935 0. 0.00247035561626 4.34813916207
-0.227788108235 0.0799299082191 9.79896923451 0.103053796284 0. 0. 0.78255650198 0.015579837746 0.128340355924 0.046279605209 0.779068029741 0.0225234611853 0.00602103326625 0.00493313737968 0.161693747513 0. 0.0772646124819 0.0784651311818 3.39842393239 0.0430785142297 0.00319153334055 0.0200545515437 0.226232620884 0. 0.0820883049329 0.0265643135942 0.866371736819 0.0183432125543 0. 0.0250462788848 0.0482691177232 0. 10.1583124061 4.45404934624
-0.107881419785 0.624537506527 0.143524792543 8.57913984856 0. 0. 0. 0.243607905648 0.0376568369585 0. 0.0123913692603 0.977051019802 0.0286899775315 0.0401590208837 0.0222659759274 0.159355783736 0.0382060716859 0.180359387973 0.0471829513688 2.82761809762 0.00499074984672 0.00488669031459 0. 0.053752763036 0.00691320221159 0. 0. 0.829310276526 0.00323386746488 0.00593988613076 0. 0.021522244845 2.40542589088 19.5417991861 3.75671940857
-0.12834113079 0.000631024810323 0. 0.00370534372453 12.9755000578 0.249546857178 2.2428079352 0.16858926865 0.167087689576 0.02383686429 0.0439490546363 0. 0.655221811919 0. 0.0906015436812 0. 0.0942550375717 0.0144616778276 0.0351737751326 0.0112630245205 3.31439870246 0.0682789714328 0.43347001132 0.0516315018829 0.281101289081 0. 0.00916726942431 0. 0.230196247012 0. 0.0403187341028 0. 3.34331662861 0.0971515456628 0.781046975592 0.0872172134872
-0.00147272373388 0.231637836881 0.00034595435521 0. 0.239177344728 19.0321903198 0.682121242987 0.58023907979 0. 0.362869697142 0.00491708358301 0. 0. 0.711707470265 0. 0. 0. 0.117504471461 0.0121911148736 0. 0.111229457943 4.4199412059 0.306313105926 0.250843260075 0.0151977356619 0.530844103954 0.0200689115308 0.0183915886966 0. 0.240685558284 0.00716322812369 0.0025539038592 0.0720097295311 5.06653931434 0.0792452953844 0.173890272432 5.19879437497
-0.00584157821457 0.00981900567978 0.501161696619 0. 1.70123466465 0.457547343541 50.4645366614 0.516148327511 0. 0.0476676401932 0.633934534495 0.0154289667092 0. 0. 1.41536414927 0. 0. 0. 0.204730338169 0. 0.317299779043 0.262826758155 18.4505803511 0.196113664614 0.541248280455 0.708760121856 2.67512354266 0.181899268955 0. 0.0231037960197 0.546155668327 0.000709150651529 0.690762503945 0.31210703086 10.5525498701 0.251830847873 35.1062120167 9.24273876406
-0. 0. 0. 0.121219395501 0.173500127538 0.732707640921 0.967955772341 13.9456042856 0.0142592910443 0.0661696110665 0. 0.204245055816 0. 0. 0. 0.335284741585 0.00120828759341 0.000770045425943 0. 0.0762604530737 0.0474049343197 0.13927094387 0.17189083881 3.32796677053 0.00836207794708 0.0417538220573 0. 0.302116718197 0.0100602962328 0.0446388722815 0.0203652287305 0.233869284809 0.0606199672857 0.338796931585 0.101822437413 4.01419582769 3.59460760499 14.1246349223 11.2167674822
-0.305915296181 0.00387290678178 0.0283900521037 0.000168284862403 0.103145819992 0.00682213703837 0. 0.0069105622856 10.8506353065 0.143162318594 0.606240184459 0.101575092269 0.174857843309 0. 0. 0. 0.379874892195 0.0135188840515 0.0283892888726 0. 0.0866224362335 0.00680603807226 0.00423745111466 0.00363287262812 9.81027429037 0.148538407691 0.484853262019 0.110578511 0.0796243853214 0. 0. 0.00845303045711 10.3935417311 0.412884043486 0.946160277011 0.227669238572 3.3309009611 0.119274560321 0.88047907047 0.0227475613468
-0. 0.464728116785 0.00308746578916 0. 0. 0.199886815768 0.0125122178155 0. 0.180705625194 14.0947925672 0.252641224242 0.547186742156 0.00366396625264 0.171718229624 0. 0. 0.00256090204409 0.636746675067 0.00960274978496 0. 0. 0.146270560184 0.017249053838 0.000316098567487 0.285378211168 9.24014013085 0.305949089687 0.718193549725 0.00312219292709 0.0773155035163 0.00955123407451 0.00198881136206 0.144809836717 19.3056982127 0.243438772992 0.717540645624 0.151265661762 4.92211351063 0.504292174964 0.361202903197 4.49006892216
-0.087451981084 0.00842338129519 0.392290124716 0.00139847334073 0.027044155128 0.0139774661244 0.638507439152 0. 0.556961222423 0.13882239836 13.5150909923 0.166561693382 0. 0.000756205239141 0.188613940486 0.0144571766857 0. 0.0167131216833 0.532700702004 0. 0.0320969284915 0.02326036368 0.33353910299 0.0105399567991 0.600959423559 0.261734253996 10.1713107581 0.238032618109 0. 0.0199740705072 0.139539542607 0. 0.57217221198 0.216745519905 12.1940990023 0.178514589947 0.592929555019 0.137803794033 9.00742699427 0.129076334826 15.0682981859 4.38093295403
-0.00986884400482 0. 0.00714910857349 0.367847444687 0.0166385250797 0. 0.0210436940204 0.155361065995 0.170480142873 0.717744368709 0.312410321473 14.2913544055 0. 0. 0. 0.120387628276 0.000292448770617 0.0183996746206 0.0118009941572 0.612374176547 0. 0.00880187636181 0. 0.0810806480573 0.211302552782 0.467407092312 0.246211628106 10.2837358385 0.000671732121191 0. 0.00544000385484 0.0566344860084 0.152106508386 1.52277218051 0.373232827818 17.3834665486 0.088560075074 0.196177361201 0.380258104422 4.36085934855 3.18437134081 18.8510841125 5.14520276184
-0.140188964873 0. 0.0151920530983 0.0153098032383 1.21840798939 0.0200771021955 0.013828583721 0. 0.298711554809 0.013282000644 0. 0.0167204186218 17.9923373684 0.232696535903 0.984057841766 0.142431651545 0.0594158796265 0. 0. 0.0137989912116 0.12040947048 0. 0. 0. 0.311981750261 0. 0. 0.0153840209357 5.10599693577 0.060058085426 0.192867675621 0.0439372706467 2.29950758326 0.107264463125 0.122983893731 0.0764090093826 14.9222894425 0.206524497422 2.86780466508 0.159494635211 3.80306505617 0.0334445588107 0.325190963647 0.151947105188
-0. 0.207669384822 0.00189721251573 0.00553485636554 0. 1.52235490048 0.0214143749539 0. 0.0145960413034 0.32793862831 0.00705339082687 0.0457414280331 0.268825669828 19.5855144187 0.172589090786 0.409132980287 0.00554476834153 0.1076229582 0. 0.00240622379516 0.00804850693051 0.206710892449 0.00818525905021 0.0258785461201 0.000760289922815 0.311325590969 0.0118866698369 0.0359508735092 0.0658382096549 4.45507109341 0.0857620092788 0.184552789051 0.0797894222264 3.9481700794 0.0581303052042 0.16676938791 0.269272847366 19.2295897427 0.73594417452 0.978955856639 0.125122027026 5.05506631457 0.0973955577781 0.428928296452 4.82612419107
-0. 0.0187625080249 0.20621297091 0. 0.215475351118 0.00846225603838 4.56136559967 0.013451185552 0. 0. 0.397015828795 0.0315660915039 0.710900933484 0.189198512858 15.8999065484 0.160971621735 0.00628354924211 0.0161321594066 0.0723294391078 0. 0.0117968393571 0.0236982978919 0.433978791462 0.0143668477172 0.00817272892114 0. 0.316429262812 0.0198151164693 0.153450120451 0.0773647680014 3.50455393025 0.0618333636644 0.166520883576 0.0976239406896 3.24864400372 0.0837585483462 4.31483949393 0.648545185882 34.2984034321 0.819405183509 0.266907960006 0.122705495208 4.9548758249 0.199588957896 16.6777618142 3.57079368656
-0.0124471120403 0.0272087327615 0.00155187404069 0.125233490839 0. 0. 0.00895158073499 1.06491980832 0. 0. 0.00715827430729 0.414147587417 0.180211554628 0.623836427105 0.241870122255 12.2059095361 0.00658301673438 0.0125565086887 0. 0.058709761226 0. 0.0151374969764 0. 0.0571779694018 0. 0. 0. 0.285486228445 0.0388450921219 0.0813947228349 0.0513523513133 3.2140738289 0.0593540209486 0.20347229722 0.0794482293815 2.69456850247 0.178836946955 0.472832758926 0.844501463372 14.1545062979 0.111742476081 0.237178456371 0.101985554242 4.60324813954 2.89376135367 11.9743180489 3.79180138166
-1.85192230366 0.0693790157141 0.106402926385 0.0608024713276 0.0436329895839 0.00107179024991 0. 0.00390362798834 0.0808916951667 0. 0.00433532953897 0.00866563775885 0.115681448961 0.00244887631965 0.0122927075949 0.00307380568859 8.32999782753 0.126029974553 0.460073198431 0.120793949772 0.115673876081 0.00271733825314 0. 0.0047754974823 1.70598507161 0. 0. 0. 0.178363763058 0. 0. 0. 3.00967295837 0.0788741164722 0.103306012195 0.0385900978126 0.0418440750087 0.000122216607141 0. 0. 0.136527075723 0. 0.00566931440696 0.00251708868497 0.105111201226 0.00419097275684 0. 0.00485924133915
-0.0549154541207 3.03224643496 0.0428847156108 0.133703532383 0.0202336985508 0.140949578231 0.00900894226931 0.0250639669303 0.0048425257738 0.128268392937 0. 0.0115912491402 0. 0.0827492946191 0.0160830178931 0.0111482505672 0.24141129768 17.0668338244 0.206414807432 1.00003095748 0. 0.311079374201 0. 0. 0.0145169454496 3.04001941638 0. 0. 0.0331464951668 0.127673716292 0. 0.00965378489659 0.0589629693926 4.9678210571 0.0571303284523 0.248965454673 0. 0.0493384833039 0. 0.00239893485768 0. 0.230692698695 0. 0. 0.0422766872909 0.0920739167052 0. 0.00133058864128 4.29048773271
-0.101517404125 0.0343491447041 2.27313430775 0.0554319415663 0.0210799624769 0. 0.0821407508018 0. 0.0329140841083 0.0175891419447 0.184042580709 0.0134375573067 0.0238409003486 0.0035029716646 0.0557026739775 0.0110516944291 0.449722568316 0.159306400865 14.0744663646 0.253068276327 0.0121885022963 0. 0.46176793784 0. 0. 0. 2.26889710649 0.0224957316916 0.0300941303173 0. 0.127312288213 0.0124284578828 0.147104057547 0.0639672848033 4.10550614777 0.0825088546667 0. 0.00813367565483 0.0729990890482 0.00689730236854 0.00599463654984 0.00116099561615 0.127372168082 0. 0.0374612069485 0. 0.0641437950891 0. 8.9067174944 5.26727004749
-0.0634587178075 0.164446070886 0.0389132563161 1.99737117863 0.00282180434061 0. 0. 0.0774665806316 0.00868272364467 0. 0. 0.14300480576 0.0283602289446 0.023588473164 0.0105163231084 0.108103678501 0.14614846102 0.666021762766 0.113838834063 11.0648283984 0.00197426866049 0. 0. 0.151913570895 0. 0. 0. 2.32294437496 0.0235773309743 0.00278112713673 0. 0.0949326087762 0.0380151845809 0.268793047678 0.0730886004517 3.71246743415 0.00918507483228 0. 0. 0.046609892172 0.000579927622744 0. 0. 0.246691875092 0. 0. 0.0121177322723 0.0858990441967 2.11327446775 18.4850191794 4.13292946501
-0.0454886898633 0. 0.00608734618322 0.0016151106611 1.98767482394 0.0527684920215 0.210535924194 0.0536827040618 0.0420252303951 0.00588687958894 0. 0.00066928368527 0.154395852194 0.0186920369151 0.0166574139067 0.00359586340379 0.217447880351 0.0227868287022 0.0421451566115 0.0208986894064 9.79650280147 0.141230586854 0.926171845582 0.120065761888 0.483172002247 0. 0. 0.00519099356137 0.715526565594 0.0222416221031 0.134580169449 0.00972160824641 0.0897851212753 0.00130881885851 0.0166280705267 0.00142630838426 3.27162515516 0.0628333601292 0.197931476966 0.048359439559 0.0588224129141 0.00505944834557 0.00615546676895 0.00148701250206 0.266009222204 0.0152178532484 0.0375628245831 0.0051968742038 3.10505375421 0.0921325112832 0.494869259187 0.057954196026
-0. 0.10375058827 0.00895116015077 0. 0.0488589220103 3.23100578316 0.102852989537 0.0992758415717 0.00335181630037 0.0273009328923 0.00169258214181 0.0021720572221 0. 0.232980339437 0.00106980475086 0.00264157628508 0. 0.26583153922 0.000454703033684 0. 0.257433667291 15.0764556279 0.475982048683 0.612573787407 0.00127451046421 0.854042044641 0.010430565389 0. 0.00892929688638 0.951084070718 0.0305638428038 0.0291998661887 0.0103191984664 0.128858289569 0. 0. 0.065182747413 4.50215646981 0.141527513151 0.149054910944 0.00381937078567 0.113453281622 0.001544157525 0.0163706083748 0.00216907007472 0.425752972949 0.015172048448 0. 0.090884506002 3.94010288909 0.0822907479248 0.143448913247 3.94613664994
-0. 0. 0.17631552808 0. 0.541360468027 0.191544494061 12.9177085683 0.19141559287 0. 0.0077944473201 0.150455878283 0.00425317702852 0. 0.0157869881978 0.441933004077 0. 0. 0.0027451427081 0.813018154846 0.00629319249643 1.82975513433 0.614583853488 51.1610794325 0.680185321452 0.680808083455 0.482636692887 4.63806009414 0.190710087212 0.0255917056117 0.0788586973079 2.51305147376 0.0223075594435 0.00821325826844 0.0118380563154 0.387025791712 0. 0.731484041325 0.285688609037 20.8451309518 0.274016052876 0.00281011791009 0.00386208802479 0.271546419145 0.00882315670346 0.00814020975936 0.0353938170827 0.810935235854 0. 0.719888232788 0.317147489876 13.0266914958 0.209522978429 42.3850162604 9.79461368788
-0.0087248402762 0. 0. 0.0388028267706 0.0544601295802 0.167312785248 0.128592356538 2.38092749378 0. 0.0136994402801 0.00208139452493 0.0426199782934 0.00783642738883 0.0384048442744 0.00683574723219 0.0935666624087 0. 0. 0. 0.143036392756 0.145858915325 0.559774631266 0.33719131026 10.2273191348 0. 0.0102269689265 0. 0.517426541896 0.0328635291206 0.129812799345 0.0471040742776 0.610397195218 0.000429440743348 0.011649854694 0.00926334868987 0.0765859221309 0.0363917814826 0.183338074344 0.124125168139 3.20750017235 0.00108884405549 0. 0.00709815195924 0.0494190173154 0.00181848086765 0.0479824177173 0.0093094534245 0.152251675425 0.0411876400152 0.292750010335 0.0548809377424 2.76386105945 2.22257855879 10.8628930542 11.1413927804
-0.0760250538715 0.00700421836525 0.00866648194089 0.00435986152497 0.0540827397947 0. 0.00391636097676 0. 2.23283740478 0.0477354909763 0.119722467157 0.0512077291182 0.0582828087579 1.84450841094e-05 0.0212705156613 0.00347637118437 2.3444294707 0.0387767742541 0.13871448845 0.0161289290258 0.404228283439 0.00670727864772 0. 0. 42.6257611554 0.196792049636 0.929369177618 0.221868715408 0.489384967201 0.0168388452585 0.0398846300782 0.00512133729322 0.141547888798 0.01482634149 0.0254244831056 0.0210919924281 0.052656552978 0.0045449028405 0. 0.00716446340832 3.97333759429 0.0632861016144 0.142570150692 0.0496143346137 0.0894119344944 0.00143211187454 0.0202383137864 0. 7.73808578168 0.269236099363 0.714173337151 0.148482271426 2.27460367338 0.0612555216636 0.506093630745 0.0397805658951
-0.00335948534388 0.166811362037 0. 0. 0.00163245648269 0.0869115764053 0.00145131831787 0. 0.0366620864637 3.60332218814 0.0569434943281 0.162544597515 0.0101552271511 0.0862933628427 0.00997209836899 0.00614153543388 0.0143543479853 4.36503411421 0.0404557851182 0.0829539975305 0.0279204536382 0.591301367783 0.00185763764181 0.0353923010908 0.707502598715 35.0815245817 0.426555047875 2.24727598232 0. 0.78485920919 0.0292031839397 0. 0.00180239766365 0.267951329933 0. 0. 0.022120304753 0.153353668133 0.000864485448678 0.0247743262171 0.0575696359221 5.18508259902 0.0736462414271 0.260305286917 0. 0.0968691355895 0.0138850315085 0. 0.138838219983 15.4052198753 0.211229746893 0.59906033101 0.0515508895799 3.32129727819 0.27694555062 0.169235739566 3.26958964513
-0.00315205571841 0. 0.119858587196 0. 0.00965168066826 0.0035616261757 0.172854630017 0.0111622195472 0.148179057638 0.0410147698761 3.03403380457 0.0541614715481 0.000563097911286 0.00489601991308 0.0940862857026 0. 0.0217924575442 0.0129881466992 3.25778010704 0.028965386855 0.140292613723 0.0293657555445 0.484832092218 0.0345007483117 1.88077579645 0.325730094754 34.7467555829 0.561059668728 0.0149027296968 0.004157980621 0.846966791909 0. 0.00260535739846 0.00911471818673 0.243798651713 0.00180356314893 0.0271269185037 0. 0.165004321262 0. 0.256825819514 0.106302800681 4.81357755061 0.126885076615 0. 0.00848265494272 0.154125731765 0.00945871747585 0.250541358334 0.119835918567 12.7448935237 0.0835390299321 0.403266783084 0.0841562495728 7.56357418722 0.074228113326 9.80967504055 3.27871254942
-0.0103556018408 0. 0.0011816109884 0.113633952737 0.0118785975884 0.0125379387686 0.0104722121626 0.0788538391735 0.0533571273803 0.168525336551 0.0621319164848 2.95416541639 0.00242580625115 0.00146091373886 0.0100088353982 0.0663269954569 0.025369860271 0.22434540866 0.0343720715155 3.46956439231 0.0131447148201 0.0215679445196 0. 0.405073060412 0.556475593543 1.67817531836 0.545977564286 35.7061721804 0.0116939219962 0. 0.0183565441501 0.460092201302 0.00074238992399 0. 0.00579123310552 0.191431140758 0.00108942651377 0. 0.00297715155179 0.0726203290199 0.0534914770371 0.244946229554 0.115786843235 4.52310415665 0.0183960883988 0.0315494387759 0.0220921785763 0.138487740821 0.1498026314 1.20488541655 0.374457402337 13.0091599938 0.0516036232577 0.0991638339044 0.272220445341 2.92620666289 1.97016748469 12.8367518412 3.06689854949
-0.125733907422 0.00436972047946 0. 0.00353647416495 0.154469830792 0.00266701849446 0. 0.00747470692383 0.0428772107152 0. 0.00651486169726 0.0038758756817 2.12423784206 0.0396390768058 0.119676126216 0.0613113344595 0.0934530446047 0.00100486685685 0. 0.0099634245887 0.255867138922 0.00432278305936 0. 0.0033608119693 0.709920584226 0. 0. 0. 8.76488154869 0.108747954622 0.443139983406 0.108862992226 0.0592114869062 0.0021774332275 0. 0.00310486942886 0.146282632535 0. 0. 0. 0.0932659832328 0. 0.00226265698012 0.000437508156089 4.17379919929 0.0813437704349 0.132209517747 0.0702854009238 2.40862742376 0.105698824568 0.178043076253 0.112608616225 7.73500464643 0.139203650826 1.69519019403 0.0810436611991 3.09662064828 0.0385681117838 0.111269521996 0.0489347359831
-0. 0.0609872263047 0.00933842716192 0.000948328196705 0.00374889004249 0.15253027804 0. 0.00952953880298 0. 0.0572009319937 0.00837445788167 0. 0.039770266434 2.41207882465 0.0293270824384 0.0921186610183 0.0023267112147 0.166351748457 0. 0. 0.00216144889003 0.575616954777 0. 0.0148745203406 0.0015650455934 0.679423704369 0. 0.00801061566315 0.145315119018 10.0943879764 0.149402556355 0.412657654327 0.0098602040256 0.0757051733271 0. 0.00455281594064 0. 0.147595745939 0. 0. 0.0110837912317 0.0745131511445 0. 0. 0.0561028712269 4.3424873055 0.0450383438033 0.159410591003 0.0585146883274 2.37207001639 0.0359509499726 0.111435198427 0.139595758963 10.3724187684 0.454590596885 0.57005580893 0.0887282266365 3.33992114556 0.0553897405699 0.22588766036 2.97958638551
-0.00884501661763 0.00822019802007 0.0567978754604 0.00153576505523 0.0229617810989 0. 0.413469077511 0. 0. 0.00113601739474 0.044920740573 0. 0.149636695726 0.0400778032714 2.29007985767 0.0437062887372 0.00940439830966 0.00173005848216 0.0763644279553 0.00198872511095 0.0318057542977 0. 0.959001128734 0.00686764151641 0. 0. 0.69893106591 0.00227248143697 0.431545896385 0.0834627522463 10.4903910182 0.146065626468 0.000137938557632 0.00373652129917 0.0823752461755 0.00739167528714 0.0129600361132 0.00022436885351 0.262261843382 0.00530115881603 0. 0. 0.140415389848 0. 0.238536586546 0.0597236814982 3.45822422879 0.0896154132005 0.0942643358202 0.0515910631369 2.61062231714 0.0494450785923 2.33496905686 0.373558427272 32.9662411021 0.412373005557 0.212265840597 0.0992654681453 3.89618387928 0.130112261982 8.22472527244 2.42902491323
-0.0340591581891 0.012593100295 0.00323337401409 0.0685872694336 0.0105214233326 0.0112649491742 0. 0.139366554692 0.00843066624747 0. 0. 0.04777707531 0.0625981591408 0.106881090187 0.0405634111512 1.64631472157 0.00949918338782 0. 0.000604291454891 0.114526662756 0.00372564611188 0.0921689564017 0.00746205552917 0.200492727878 0. 0.000282518921569 0.00466192088992 0.57052517656 0.101107481918 0.229025687261 0.137716530929 6.54507791785 0. 0. 0.00460225123511 0.0532545275311 0.00269316586069 0. 0. 0.107055482973 0. 0.000186005327605 0.0156408180693 0.0835639144202 0.0562034194714 0.152712853513 0.0782557471793 2.78045654664 0.124962081181 0.143982562493 0.0473902723691 1.60216771614 0.0746132290942 0.308205816866 0.464655090752 4.89934528676 0.0455440791486 0.127170079697 0.0816795449481 2.41190068084 1.8126811407 6.5182404037 2.72920933193
-
-0.0357983654718 0.0146634321466 0.0209916853044 0.0241608300459 0.0196605104347 0.0113786862615 0.0029009138093 0.0163015785126 0.0225609755057 0.0145991965297 0.0181825729424 0.0164781957079 0.0186856678405 0.0130405682814 0.0179309987722 0.0240968720195 0.0181775551111 0.0146957289426 0.0210180199751 0.0178777837456 0.0179375335248 0.014026410045 0.00304930001685 0.0181980546371 0.00237235102112 0.00247910724881 0.00304553476624 0.00292174613484 0.0129216428963 0.016886060241 0.0212194293029 0.021001239545 0.0207025677211 0.0101079314077 0.0168739180256 0.0130368421188 0.0145312058205 0.0117191223335 0.00248094305692 0.0145761834505 0.0160538354021 0.0117605522361 0.0140380390381 0.0114567437712 0.0112780796487 0.0101486396189 0.0148519084459 0.0147005486842 0.0206773071958 0.0111337585868 0.012890738691 0.0187059909187 0.0197741432688 0.0160489156219 0.00237751747496 0.0226108300737 0.0197730187728 0.0145713864549 0.0179588059761 0.0198394530312 0.0208205335746 0.0208303362555 0.0183984258157 0.0360132307673
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
-
diff --git a/PhyloCSF_Parameters/7yeast.nh b/PhyloCSF_Parameters/7yeast.nh
deleted file mode 100644
index 8dda6a9..0000000
--- a/PhyloCSF_Parameters/7yeast.nh
+++ /dev/null
@@ -1 +0,0 @@
-((((((Scer:.0836,Spar:.0617):.0432,Smik:.1154):.0165,Skud:.1731):.0275,Sbay:.1594):.0770,Scas:.1099):.0550,Sklu:.2034);
diff --git a/PhyloCSF_Parameters/7yeast_coding.ECM b/PhyloCSF_Parameters/7yeast_coding.ECM
deleted file mode 100644
index adaa933..0000000
--- a/PhyloCSF_Parameters/7yeast_coding.ECM
+++ /dev/null
@@ -1,71 +0,0 @@
-0.581210
-15.563110 0.478004
-0.632709 21.431688 0.529454
-0.749020 0.077211 0.197225 0.159506
-0.095275 1.032016 0.010836 0.389958 15.753929
-0.134920 0.099137 1.110098 0.146316 49.318435 21.193136
-0.093855 0.266767 0.000000 0.915935 15.814609 32.905174 15.876484
-2.687463 0.062497 0.556006 0.147354 0.612457 0.000000 0.000000 0.021614
-0.409508 5.014965 0.399427 1.883728 0.428255 3.005682 0.000000 1.242239 0.517978
-1.739711 0.418899 5.309414 0.122260 0.072084 0.161638 1.648589 0.000000 40.487998 1.275128
-0.257829 0.843298 0.212030 3.434994 0.000000 0.875068 0.313143 2.308739 0.331741 46.143335 0.863468
-0.308499 0.034663 0.222327 0.000000 1.647203 0.530892 0.391866 0.522821 0.277582 0.000000 0.306026 0.000000
-0.008095 0.697456 0.022813 0.000000 0.191011 1.071397 0.000000 0.411128 0.000000 0.549492 0.082179 0.111141 11.541455
-0.104394 0.083716 0.272127 0.088265 0.432972 0.000000 2.943965 0.000000 0.054686 0.145827 0.492993 0.139564 3.147210 0.459307
-0.047091 0.000000 0.000000 0.464352 0.007182 0.380534 0.247606 0.766087 0.011549 0.100558 0.000000 0.370674 11.003782 27.760545 0.568313
-0.910273 0.334042 0.301939 0.133802 0.187701 0.000000 0.114210 0.134237 0.000000 0.153931 0.814700 0.110467 0.060661 0.000000 0.099956 0.073124
-0.262213 1.650487 0.352155 0.268885 0.080474 0.184282 0.000000 0.053395 0.000000 0.846812 0.655845 0.000000 0.000252 0.000000 0.059180 0.236031 0.855325
-0.486331 0.000000 1.122447 0.487166 0.117094 0.260023 0.338839 0.000000 0.698496 0.226905 0.000000 0.181440 0.120316 0.178966 0.134563 0.000000 32.534553 2.495203
-0.286895 0.148017 0.255525 1.196662 0.045141 0.052327 0.120422 0.130288 0.000000 0.000000 0.000000 0.482767 0.000000 0.209644 0.031002 0.000000 1.046003 58.410734 0.961689
-0.066199 0.016481 0.044313 0.000000 0.728036 0.072765 0.000000 0.024678 0.046264 0.007519 0.063470 0.000000 0.000000 0.103493 0.077039 0.081201 0.738042 0.028871 0.191031 0.000000
-0.040067 0.206127 0.015669 0.000000 0.180330 0.583841 0.077471 0.279440 0.000000 0.000000 0.068522 0.490914 0.601179 0.462959 0.000000 0.000000 0.067797 1.040454 0.031001 0.251090 20.159234
-0.052950 0.000000 0.060574 0.061778 0.000000 0.000000 2.194430 0.178304 0.077773 0.000000 0.000000 0.011175 0.000000 0.000000 0.138892 0.125348 0.147478 0.025787 1.829750 0.075639 46.887092 39.633304
-0.022091 0.000000 0.033558 0.132681 0.097633 0.262964 0.051213 0.455749 0.000000 0.408639 0.000000 0.058674 0.556299 0.000000 0.000000 0.152429 0.000039 0.230734 0.095356 0.741125 22.763060 49.492507 18.490177
-0.944127 0.000000 0.843122 0.552476 0.047695 1.070144 0.000000 0.000000 17.187125 0.757537 1.015590 0.000000 0.258196 0.000000 0.105490 0.085306 7.314215 0.000000 0.000000 0.732925 1.291685 0.623259 0.000000 0.579306
-0.229394 1.915409 0.789940 0.000000 0.135078 0.727031 0.003531 0.000000 5.794902 3.482350 1.218529 0.310979 0.039164 0.000000 0.053583 0.441751 0.591085 14.418730 0.859429 0.466483 0.057566 2.640641 0.002621 0.037862 20.618005
-1.517375 0.797452 0.000000 0.000000 0.000000 0.000000 0.752398 1.551200 2.248566 0.000000 44.061056 0.899375 0.152647 0.451626 0.029082 0.000000 0.000000 0.051836 17.017765 0.514944 0.000000 0.000000 7.166142 0.431489 150.361161 55.270133
-0.009896 0.000000 0.000000 0.639135 0.000562 0.000000 0.000000 0.141571 4.984891 0.000000 5.396914 0.829176 0.000000 0.149664 0.004566 0.000000 0.103796 0.000000 0.066265 4.116663 0.000000 0.000000 0.000000 0.690723 20.304468 98.868462 26.296639
-0.076185 0.000000 0.000000 0.286589 0.224284 0.060457 0.021870 0.000000 0.039925 0.000000 0.000000 0.162746 1.568783 0.417423 0.739826 0.137057 0.410596 0.000000 0.518875 0.234408 1.110975 0.000000 0.000000 0.439714 1.081426 0.806999 0.523769 0.000000
-0.000000 0.000000 0.067671 0.249910 0.555469 0.000000 0.000000 0.231677 0.000000 0.525589 0.297108 0.091708 1.736653 4.899255 0.412733 0.000000 0.000000 1.510406 0.717409 0.428116 1.475873 2.332245 0.000000 0.000000 0.000000 4.634631 0.442689 0.004883 12.733571
-0.059779 0.000000 0.042869 0.533397 0.183715 0.072118 0.274229 0.000000 0.000000 0.000000 0.161290 0.291983 1.034426 0.722227 1.564296 0.000000 0.000000 0.000000 2.225157 0.160754 0.523704 0.000000 0.837382 1.178229 0.000000 2.758903 2.687397 0.000000 34.614559 15.129294
-0.049996 0.317931 0.000000 0.000000 0.356306 0.000000 0.486823 0.000000 0.000000 0.306962 0.000000 0.300807 1.827523 0.000000 0.213560 2.509984 0.250805 0.405624 0.000000 0.713324 0.385827 0.000000 2.337610 0.290645 0.690732 0.000000 0.058561 1.456656 11.227375 39.457012 12.904200
-0.987910 0.207730 0.000000 0.271599 0.277918 0.164910 0.067738 0.000000 0.114197 0.213350 0.000000 0.249641 0.124566 0.146009 0.012716 0.000000 1.249151 0.462433 0.000000 0.000000 0.119174 0.083300 0.032816 0.000000 0.449821 0.291481 0.000000 0.052229 0.018576 0.061246 0.030042 0.000000
-0.155840 3.158621 0.140173 0.000000 0.009189 0.518859 0.113705 0.000000 0.000000 1.806903 0.010675 0.000000 0.007381 0.081087 0.009648 0.000000 0.404504 1.063950 0.000000 0.000000 0.000000 0.539935 0.305632 0.000000 0.216981 0.000000 0.000000 0.116171 0.216011 0.600828 0.788736 0.000000 1.292750
-0.000000 0.336075 1.441360 0.303222 0.162858 0.000000 0.448497 0.228369 0.000000 0.374496 0.641901 0.133087 0.109522 0.000000 0.103542 0.208657 0.000000 0.000000 3.747700 0.547344 0.050998 0.000000 0.252905 0.118388 0.000000 0.000000 0.892253 0.153856 0.111432 0.000000 0.019578 0.040944 20.688427 2.273031
-0.119965 0.000000 0.102133 2.261594 0.056324 0.000000 0.037167 0.311712 0.000000 0.000000 0.000000 0.853791 0.002873 0.007741 0.024273 0.049773 0.104988 0.000000 0.425768 0.487591 0.035713 0.000000 0.000000 0.184667 0.000000 0.407509 0.206089 0.000000 0.000000 0.000000 0.000000 0.263377 1.133080 23.651072 1.384351
-0.221583 0.106956 0.100740 0.083688 4.006297 0.407657 0.000000 0.449088 0.194676 0.096544 0.060718 0.000000 0.521904 0.027122 0.325806 0.000000 0.218561 0.000000 0.108089 0.000000 0.903898 0.324377 0.000000 0.318105 0.000000 0.000809 0.000000 0.049001 0.171605 1.054405 0.023873 0.337838 0.624720 0.018192 0.224498 0.038672
-0.000000 0.107133 0.132738 0.220992 0.090073 3.924319 0.178088 0.000000 0.098026 1.165314 0.000000 0.195615 0.014375 0.031834 0.018956 0.423232 0.000000 0.239858 0.148558 0.000000 0.298245 0.307821 0.000000 0.560624 0.000000 0.043917 1.143561 0.042065 0.660493 0.000000 1.175586 1.225266 0.098629 0.572943 0.000000 0.055702 16.830036
-0.125299 0.090062 0.290758 0.100231 0.000000 0.475077 8.873984 0.389810 0.006809 0.000000 0.591616 0.298536 0.449019 0.000000 0.814238 0.060188 0.090764 0.015783 0.288974 0.000000 0.000000 0.294032 3.462958 0.167758 0.000000 0.000000 1.087950 0.072984 0.034194 0.000000 0.335123 0.838866 0.129048 0.102170 1.427760 0.097373 54.926871 23.740868
-0.079728 0.193276 0.015683 0.183531 0.106547 0.000000 0.065435 2.317427 0.000000 0.245919 0.176927 0.809508 0.000000 0.465597 0.023674 0.160960 0.076264 0.000000 0.000000 0.106577 0.040440 0.540362 0.465913 0.338494 0.481099 0.223491 0.000000 0.030650 0.000000 2.319882 0.000000 0.000000 0.000000 0.069241 0.132037 0.388986 16.496601 33.395296 14.732489
-0.480661 0.303715 0.083047 0.196624 0.488275 0.000000 0.000000 0.824541 1.550415 0.000000 0.000000 0.000000 0.000000 0.355596 0.082294 0.000000 0.283191 0.096306 0.000000 0.005266 0.000000 0.376161 0.000000 0.407138 1.999530 0.482876 0.000000 0.000000 0.031756 0.138489 0.003763 0.000000 1.945803 0.005497 0.623839 0.180562 1.791773 0.626305 0.000000 0.000000
-0.017167 0.000000 0.190885 1.152310 0.012930 0.864321 0.100982 0.000000 0.421233 7.881538 0.000000 0.559986 0.037409 0.000000 0.019720 0.216379 0.000000 1.000745 0.016604 0.000000 0.290029 0.000000 0.000000 0.517306 0.652268 0.410752 0.000000 0.482156 0.008488 0.546516 0.315243 0.000000 0.000000 1.764232 0.458357 0.610885 0.219036 2.282234 0.347131 0.000000 21.233897
-0.095359 0.448136 0.390840 0.000000 0.000000 1.688249 0.985432 0.000000 0.000000 0.000000 3.532209 0.000000 0.000000 0.000000 0.153060 0.285654 0.000000 0.000000 0.431492 0.183953 0.000000 0.770997 0.225006 0.208561 0.000000 0.020922 3.887695 0.000000 0.014578 0.000000 0.029792 0.130489 0.310164 0.222473 2.579923 0.000000 0.006457 0.000000 3.987643 0.765572 58.548571 19.497275
-0.027388 0.310643 0.000000 0.095622 0.060460 0.000000 0.006577 0.203578 0.000000 0.000000 0.240123 2.403076 0.188588 0.071722 0.000000 0.000000 0.000000 0.000000 0.000000 0.175975 0.121440 0.041025 0.389425 0.000000 0.000000 0.376751 0.165425 0.218142 0.000000 0.000000 0.000000 0.071363 0.000000 0.204550 0.000000 0.580710 0.129068 0.000000 0.039864 0.729593 14.539872 31.246112 20.652534
-0.207410 0.000000 0.033833 0.141152 1.797225 0.358117 0.429069 0.000000 0.273201 0.154393 0.000000 0.000000 8.600236 0.827320 0.758821 0.292609 0.165898 0.062135 0.000000 0.000000 0.000000 0.175716 0.000000 0.573440 0.070858 0.000000 0.124088 0.000000 1.680901 1.547508 0.323719 0.621556 0.516150 0.000000 0.076676 0.014377 4.021073 0.000000 0.000000 0.303957 0.142697 0.171286 0.909555 0.000000
-0.000000 0.593534 0.108717 0.000000 0.000000 1.297648 0.000000 0.313229 0.000000 0.800027 0.000000 0.000000 0.541970 5.837924 0.000000 1.181059 0.000000 0.000000 0.254773 0.192650 0.000000 0.000000 1.170849 0.000000 0.159523 0.000000 0.000000 0.246581 0.884189 2.232994 1.683233 0.000000 0.214697 0.229985 0.000000 0.108241 0.214938 2.331261 0.096801 0.207652 0.000000 0.240941 0.412811 0.009712 14.297408
-0.090486 0.165946 0.068338 0.000000 0.792196 0.000000 2.444380 0.000000 0.000000 0.000000 0.423463 0.070000 2.438833 0.000000 2.577749 0.568614 0.022860 0.000000 0.204827 0.016758 0.000000 0.596930 0.327958 0.214064 0.010888 0.111986 0.000000 0.000000 0.069180 0.293073 1.723185 1.120367 0.088987 0.000000 0.697477 0.000000 0.000000 0.285306 6.784114 0.000000 0.547546 0.000000 0.000000 0.036953 40.639291 21.481324
-0.034290 0.000000 0.013382 0.307393 0.000000 0.292293 0.000000 0.969271 0.000000 0.000000 0.031346 0.442067 0.483278 1.356857 0.000000 4.146653 0.066357 0.199970 0.000000 0.000000 0.378033 0.000000 0.000000 0.000000 0.000000 0.545784 0.127831 0.000000 0.000000 0.000000 0.000000 1.214617 0.000000 0.110261 0.331540 0.177800 0.175719 0.228170 0.237924 1.373525 0.185112 0.088704 0.000000 0.102844 14.663966 33.108782 16.892095
-0.886628 0.646899 0.515932 0.247176 0.083186 0.000000 0.000000 0.000000 0.063306 0.554063 0.000000 0.003250 0.650818 0.349594 0.027112 0.000000 6.981227 0.000000 0.000000 0.137770 0.766745 0.000000 0.000000 0.000000 5.302647 0.000000 0.029797 0.000000 0.000000 0.057130 0.000000 0.015138 1.441951 0.303182 0.000000 0.000000 0.239458 0.210965 0.163587 0.000000 0.606056 0.211722 0.097119 0.000000 0.489901 0.397413 0.236327 0.000000
-0.084336 0.498741 0.000000 0.000000 0.034532 0.120610 0.021158 0.034849 0.015844 0.379120 0.000000 0.000000 0.051024 0.000000 0.031396 0.059221 0.084293 3.513888 0.152216 0.000000 0.000000 0.061043 0.040112 0.000000 0.000000 1.410304 0.129854 0.000000 0.000000 0.028949 0.001850 0.214896 0.001822 0.336081 0.072220 0.000000 0.043623 0.059941 0.032237 0.045128 0.000000 0.210611 0.000000 0.000000 0.013692 0.000000 0.057039 0.078064 0.587740
-0.960921 0.250810 0.474287 0.692960 0.000000 0.000000 0.034693 0.000000 0.000000 0.172164 1.269599 0.548721 0.200360 0.000000 0.111537 0.230672 0.000000 0.965801 14.234842 0.140443 0.000000 0.000000 1.841766 0.000000 2.459291 1.785422 10.091001 0.000000 1.583833 0.000000 1.218662 0.000000 0.000000 0.000000 2.888922 0.138947 0.161138 0.000000 0.276271 0.136482 0.499417 0.000000 0.699368 0.000000 0.500526 0.000000 0.329900 0.186302 486.412169 2.684468
-0.000000 0.000000 0.034368 0.492827 0.025758 0.018903 0.055829 0.093677 0.000000 0.000000 0.040647 0.238821 0.003243 0.071543 0.032339 0.039721 0.109106 0.000000 0.116193 2.380201 0.000000 0.047225 0.000000 0.059261 0.273288 0.000000 0.034783 0.446094 0.356646 0.247371 0.052196 0.000000 0.041847 0.000000 0.002442 0.244748 0.027902 0.066161 0.058467 0.040985 0.044615 0.000000 0.045401 0.060115 0.043970 0.103019 0.024720 0.015502 2.245816 37.140983 1.783312
-0.174660 0.105661 0.120582 0.150751 2.654171 0.316747 0.239080 0.220325 0.030904 0.557200 0.000000 0.226196 0.000000 0.116552 0.162299 0.000000 0.245453 0.088307 0.191545 0.031558 3.285822 0.000000 0.000000 0.055485 1.232935 0.297499 0.000000 0.000000 0.724705 0.488099 0.381352 0.647326 0.138114 0.000000 0.102226 0.071339 2.546651 0.148625 0.456219 0.299769 0.000000 0.272685 0.000000 0.158932 0.120549 0.232446 0.000000 0.239668 2.633689 0.000000 0.838252 0.102140
-0.076290 0.222235 0.091728 0.126827 0.435155 2.568649 0.112151 0.216897 0.000000 0.922295 0.247360 1.059574 0.196550 0.000000 0.027697 0.204131 0.000000 0.065786 0.279558 0.234001 0.143670 6.273089 0.000000 0.000000 0.000000 0.180281 0.000000 0.143620 0.000000 4.435553 0.000000 0.000000 0.075017 0.480922 0.000000 0.000000 0.503215 4.046132 0.234913 0.000000 0.396891 0.000000 0.387623 0.194181 0.527405 0.000000 0.039654 0.220256 0.229124 0.420790 0.000000 0.014856 12.802339
-0.112591 0.170737 0.152960 0.118820 0.409862 0.023975 4.040695 0.434860 0.000000 0.137047 0.210743 0.563215 0.000000 0.000000 0.280330 0.111136 0.076451 0.042725 0.328045 0.139056 0.000000 0.203348 8.116849 0.000000 0.000000 0.000000 2.227129 0.000000 0.000000 0.728749 0.000000 0.844170 0.087893 0.165974 0.176141 0.000000 0.654636 0.540798 4.066529 0.016221 0.000000 0.000000 0.240944 0.206063 0.000000 0.306564 0.039927 0.134277 0.412406 0.104584 3.983463 0.000000 42.416576 19.141427
-0.075938 0.161257 0.080334 0.179790 0.221106 0.308403 0.449379 1.633883 0.032948 1.017172 0.000000 0.879498 0.304811 0.212739 0.000000 0.000000 0.088776 0.352034 0.000000 0.200678 0.000000 0.000000 0.930661 3.330835 0.000000 0.284515 0.000000 0.186103 0.478359 0.000000 1.095536 0.593863 0.016012 0.000000 0.106686 0.234584 0.486522 0.000000 0.586732 2.194112 0.208192 0.648705 0.175287 0.000000 0.067774 0.263861 0.353851 0.000000 0.032511 0.005846 0.303390 0.421322 13.025586 29.255618 13.712447
-0.423497 0.150552 0.000000 0.361415 0.000000 0.000000 0.000000 0.000000 1.671338 0.662016 1.770083 0.747868 0.478512 0.000000 0.121256 0.159343 0.000000 0.006066 4.940797 0.000000 0.594209 0.000000 1.341997 0.046355 13.055068 2.249021 2.828416 1.182330 1.540525 0.427894 0.759690 0.000000 0.216479 0.000000 0.982736 0.000000 0.452749 0.000000 0.191647 0.028696 3.153440 0.002316 1.034944 0.120343 0.247372 0.000000 0.000000 0.353709 423.207339 0.558197 209.336485 0.000000 3.322661 0.224165 1.624617 0.668449
-0.167846 0.593887 0.000000 0.000000 0.033474 0.379160 0.111165 0.000000 0.000000 2.734169 0.414991 0.264326 0.081819 0.626054 0.040304 0.000000 0.046298 0.000000 0.221687 0.810484 0.000000 0.194011 0.218109 0.082335 0.193604 7.605495 0.000000 0.000000 0.000000 0.025548 0.000000 0.587455 0.000000 0.433385 0.889536 0.000000 0.198213 0.440281 0.046882 0.086429 0.000000 1.155222 0.348591 0.065344 0.000000 0.817450 0.208139 0.000000 0.000000 2.954758 1.420488 0.000000 0.202105 1.914725 0.429550 0.273775 6.909055
-0.015444 0.000965 0.029316 0.002769 0.026030 0.017431 0.058191 0.004839 0.000000 0.041495 0.216275 0.016229 0.048090 0.021558 0.059608 0.015619 0.004252 0.085617 0.099629 0.025858 0.017249 0.008373 0.072950 0.000000 0.118416 0.050120 3.265562 0.000000 0.043810 0.081384 0.135791 0.003276 0.000900 0.007199 0.027115 0.008059 0.022075 0.003495 0.073267 0.000000 0.046231 0.011252 0.409717 0.000000 0.041895 0.004284 0.048473 0.009314 0.000000 0.180511 3.575284 0.193517 0.058504 0.000000 0.423116 0.000000 7.963153 0.516820
-0.000000 0.000000 0.077798 0.272073 0.058593 0.001869 0.085667 0.175545 0.000000 0.000000 0.000000 1.126982 0.000000 0.000000 0.045010 0.251098 0.090385 0.658032 0.000000 0.000000 0.025499 0.066118 0.000000 0.121227 0.063344 0.000000 0.361418 1.744951 0.161152 0.545267 0.188062 0.086206 0.219463 0.000000 0.000000 0.172792 0.110211 0.116180 0.165967 0.286618 0.185170 0.184486 0.000000 0.319763 0.170665 0.000000 0.034537 0.363201 0.330882 0.000000 0.000000 1.537824 0.079165 0.126285 0.054285 0.958372 4.001877 98.188238 0.241872
-0.057473 0.262884 0.005060 0.000000 0.085291 0.031113 0.000000 0.130545 0.039827 0.124990 0.051355 0.000000 1.143533 0.000000 0.560616 0.438764 0.181176 0.000000 0.000000 0.021100 0.000000 1.297757 0.851549 0.000000 0.301899 0.000000 0.000000 0.346638 29.700775 7.007735 10.452363 5.270753 0.000000 0.000000 0.108007 0.235866 0.079923 0.000000 0.000000 0.327583 0.059397 0.000000 0.033672 0.046509 0.978196 0.000000 0.175446 0.511700 1.202017 0.000000 0.905227 0.218817 1.207795 1.004379 0.139326 0.000000 1.949425 0.162242 0.064332 0.107138
-0.000000 0.000000 0.077123 0.105725 0.000000 0.228748 0.004437 0.000000 0.051380 0.000000 0.000000 0.046525 0.000000 0.693290 0.140976 0.000000 0.165638 0.000000 0.000000 0.213329 0.000000 0.448879 0.179594 0.037935 0.213165 0.000000 0.000000 0.159334 1.148017 5.554200 0.667162 0.000000 0.000000 0.000000 0.020986 0.103900 0.000000 0.528857 0.057361 0.000000 0.028700 0.072115 0.044128 0.051650 0.000000 1.043061 0.027150 0.000000 1.266404 1.181732 0.000000 0.972926 0.000000 1.059611 0.000000 0.050903 0.000000 0.436223 0.153078 0.183917 0.677572
-0.000000 0.136851 0.071342 0.000000 0.000000 0.110783 0.136471 0.081232 0.033349 0.130757 0.000000 0.000000 0.528313 0.070096 1.137683 0.070841 0.085511 0.266065 0.000000 0.000000 0.000000 0.000000 0.000000 0.066063 0.072512 0.116559 0.229946 0.000000 6.158381 5.774936 25.210182 7.048552 0.043426 0.057664 0.000000 0.000000 0.000000 0.000000 0.056143 0.163533 0.020904 0.076903 0.051841 0.000000 0.000000 0.000000 0.826724 0.231042 0.977674 0.367270 0.260490 0.000000 0.000000 0.127730 1.868945 0.022373 0.159692 0.269767 0.254645 0.034510 19.970821 0.000000
-0.052141 0.102223 0.000000 0.000000 0.001868 0.000000 0.010455 0.155385 0.016960 0.075331 0.061180 0.000000 0.155947 0.000000 0.174958 0.499488 0.000000 0.299579 0.335970 0.000000 0.037930 0.000000 0.000000 0.296135 0.000000 0.487602 0.211727 0.000000 0.000000 0.000000 0.000000 3.126326 0.004730 0.166950 0.000000 0.000000 0.030902 0.000000 0.000000 0.237758 0.033598 0.062251 0.024403 0.052678 0.122858 0.000000 0.044946 0.582508 0.000000 1.033681 1.250157 1.407673 0.000000 0.000000 0.036481 0.736912 0.997027 0.382341 0.145731 0.278208 0.221501 27.533240 1.044282
-
-0.042558 0.024513 0.030138 0.036293 0.017995 0.012479 0.008171 0.020108 0.020893 0.010055 0.009439 0.014649 0.018597 0.016947 0.020770 0.030135 0.026648 0.007776 0.012271 0.013887 0.017633 0.006954 0.005409 0.013514 0.003213 0.002707 0.001910 0.006327 0.013506 0.005776 0.010752 0.012711 0.045143 0.020107 0.019335 0.037538 0.016269 0.012098 0.006217 0.020106 0.011230 0.009807 0.006088 0.022349 0.012260 0.011228 0.010804 0.021456 0.001050 0.014490 0.000519 0.019166 0.019118 0.014150 0.008827 0.023470 0.000684 0.005011 0.010397 0.008147 0.026476 0.018304 0.026556 0.026866
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
diff --git a/PhyloCSF_Parameters/7yeast_noncoding.ECM b/PhyloCSF_Parameters/7yeast_noncoding.ECM
deleted file mode 100644
index 742619b..0000000
--- a/PhyloCSF_Parameters/7yeast_noncoding.ECM
+++ /dev/null
@@ -1,71 +0,0 @@
-2.324407
-5.962122 3.040942
-2.256750 8.559818 2.532988
-2.208606 0.338020 0.569290 0.223004
-0.194704 3.381941 0.361955 0.548933 4.271863
-0.458150 0.292858 3.323939 0.164416 12.506413 4.242540
-0.169551 0.717897 0.259557 2.615209 3.866647 12.050782 3.559946
-5.973296 0.649046 2.021627 0.561768 3.049419 0.355052 0.681852 0.174647
-0.461336 11.709968 0.635177 1.265431 0.247099 4.311997 0.257091 0.719617 3.036520
-0.982077 0.637142 10.269136 0.470801 0.457233 0.205056 3.944384 0.180281 11.505158 3.394517
-0.386140 1.860537 0.686900 8.797010 0.218806 0.720942 0.159702 3.906770 2.873188 11.782237 2.868772
-1.687118 0.141238 0.363387 0.215444 7.441212 0.379155 1.419727 0.413761 2.274873 0.190507 0.417736 0.133822
-0.299153 2.811613 0.158702 0.440753 0.603727 12.776732 0.642330 2.120747 0.225787 3.042437 0.205748 0.650356 2.050079
-0.391130 0.122774 2.861442 0.204874 1.996865 0.505968 13.289501 0.556748 0.710216 0.207778 3.556385 0.311511 6.473629 2.343011
-0.181757 0.418659 0.169061 3.211784 0.381006 1.249844 0.516703 8.797010 0.169081 0.440641 0.161571 2.615209 2.245018 7.961551 2.513706
-2.151990 0.134365 0.491035 0.207198 0.344995 0.020501 0.088779 0.000000 0.569979 0.094390 0.177883 0.070105 0.201108 0.004930 0.019463 0.026898
-0.190323 3.825897 0.264889 0.387180 0.000000 0.447622 0.000267 0.073626 0.055905 0.644423 0.053499 0.145995 0.010824 0.180006 0.016375 0.032724 3.329486
-0.448221 0.309883 3.067708 0.154420 0.103292 0.000000 0.268859 0.000880 0.235131 0.000000 0.675979 0.093081 0.000000 0.021493 0.238278 0.000000 12.730795 4.707491
-0.127873 0.432397 0.204286 2.513706 0.008358 0.046201 0.000000 0.311511 0.017107 0.205212 0.056293 0.556748 0.000000 0.035734 0.000000 0.204874 3.147806 13.310792 3.312749
-0.181568 0.002177 0.064850 0.000000 2.953057 0.215776 0.562076 0.253099 0.476138 0.000000 0.000000 0.000000 0.459821 0.107577 0.065128 0.015793 3.806558 0.330231 1.027034 0.486971
-0.046002 0.181727 0.025544 0.010971 0.214639 4.726145 0.188341 0.618189 0.028326 0.335803 0.104064 0.000000 0.055231 0.662613 0.052215 0.118075 0.266652 3.812014 0.266344 0.939899 4.925549
-0.079769 0.051154 0.201256 0.000000 0.497431 0.153531 3.103795 0.151780 0.000000 0.014474 0.174257 0.000000 0.153935 0.000000 0.506560 0.056497 0.632818 0.186783 4.713201 0.087262 16.287053 5.562184
-0.000000 0.000000 0.000000 0.161571 0.158046 0.726461 0.271934 2.868772 0.302376 0.032063 0.344330 0.180281 0.000000 0.115267 0.056293 0.470801 0.239875 0.636928 0.308562 3.556385 5.411464 13.293379 3.884500
-0.438502 0.010521 0.019381 0.000000 0.181355 0.000000 0.082372 0.018379 3.799372 0.219070 0.461596 0.098140 0.093033 0.000000 0.036558 0.031271 11.889462 0.643402 2.490261 1.168067 3.705557 0.154285 0.712664 0.026706
-0.086976 0.560662 0.013895 0.106465 0.015927 0.216114 0.000000 0.028597 0.223984 3.783832 0.194473 0.485357 0.000000 0.132853 0.037948 0.000000 0.628055 14.640486 0.901107 1.565545 0.398095 3.384437 0.229982 0.629663 2.897752
-0.153908 0.023634 0.512032 0.056497 0.146588 0.000000 0.404211 0.000000 0.507959 0.167209 3.884500 0.151780 0.000000 0.000000 0.087262 0.000000 1.265981 0.732359 15.722741 0.506560 0.374262 0.352749 7.995371 0.174257 12.608393 4.796047
-0.028599 0.081084 0.093894 0.516703 0.042617 0.000000 0.066557 0.159702 0.345823 0.574329 0.271934 3.559946 0.000000 0.056190 0.000000 0.164416 0.497133 2.416779 0.666037 13.289501 0.169248 0.672368 0.404211 3.944384 4.231405 14.011435 3.103795
-0.170195 0.000000 0.004770 0.001044 0.527406 0.069575 0.000000 0.061904 0.250662 0.000000 0.005784 0.000000 2.519033 0.206246 0.506508 0.121568 3.504833 0.232716 0.560706 0.208361 12.362144 0.645175 1.145372 0.544169 3.272380 0.203660 0.624662 0.221225
-0.015586 0.263770 0.000193 0.021390 0.067747 0.710565 0.103890 0.159402 0.000000 0.423672 0.000000 0.120499 0.184056 3.319312 0.237641 0.492826 0.270518 4.623787 0.513097 0.597353 1.069439 15.615980 0.542086 2.448074 0.398072 3.737469 0.152753 0.772862 3.002685
-0.025803 0.000000 0.318242 0.000000 0.150496 0.065861 0.666037 0.093081 0.152673 0.000000 0.308562 0.000880 0.358873 0.276039 3.312749 0.154420 0.444014 0.183456 8.257091 0.238278 2.837205 0.498558 15.722741 0.675979 1.111261 0.277676 4.713201 0.268859 13.849203 4.453129
-0.000000 0.068988 0.017976 0.169061 0.036191 0.070118 0.093894 0.686900 0.000000 0.000000 0.000000 0.259557 0.199837 0.478074 0.204286 2.532988 0.234932 0.491223 0.318242 2.861442 0.442068 1.437359 0.512032 10.269136 0.215597 0.678751 0.201256 3.323939 2.920270 9.876393 3.067708
-6.066180 0.545878 1.250639 0.410996 0.538680 0.011173 0.125129 0.022686 1.888143 0.107031 0.477734 0.101776 0.472466 0.000000 0.138775 0.023892 2.727391 0.142361 0.501729 0.144271 0.285770 0.038141 0.114032 0.000000 0.660296 0.002575 0.128851 0.050622 0.099986 0.070559 0.000000 0.008867
-0.468203 11.765145 0.517703 1.149969 0.043004 0.714212 0.000000 0.142267 0.216362 2.870469 0.178801 0.393730 0.004871 0.930034 0.034381 0.099841 0.294193 3.944502 0.201500 0.533914 0.003802 0.250199 0.049017 0.061995 0.000000 0.816188 0.126163 0.114579 0.000000 0.432236 0.000000 0.000000 3.325879
-1.092821 0.611306 9.876393 0.492826 0.134467 0.108471 0.772862 0.120499 0.459028 0.163502 2.448074 0.159402 0.180545 0.042462 0.597353 0.021390 0.567990 0.235266 4.453129 0.237641 0.000000 0.088322 0.152753 0.000000 0.155879 0.015089 0.542086 0.103890 0.001578 0.107236 0.513097 0.000193 11.058420 4.596102
-0.344283 1.196335 0.478074 7.961551 0.033517 0.106160 0.056190 0.650356 0.220343 0.413226 0.115267 2.120747 0.000000 0.125243 0.035734 0.440753 0.164928 0.471084 0.276039 2.343011 0.018960 0.000000 0.000000 0.205748 0.000000 0.230805 0.000000 0.642330 0.022480 0.042462 0.021493 0.158702 2.759894 14.822309 3.319312
-0.514815 0.062248 0.120075 0.007875 11.581393 0.583265 1.923544 0.682361 0.603673 0.000000 0.222957 0.018508 1.213080 0.366791 0.318448 0.143685 0.325010 0.016418 0.042760 0.000000 3.761923 0.100322 0.986593 0.175640 0.184398 0.037337 0.042107 0.071044 0.607281 0.000000 0.241647 0.019144 2.750504 0.528912 0.744032 0.163718
-0.014902 0.717449 0.097225 0.191490 0.630737 17.119583 0.762597 1.792175 0.018091 1.005233 0.000000 0.180473 0.195637 1.854669 0.146478 0.297353 0.004545 0.201857 0.000000 0.019515 0.347305 4.815561 0.000000 0.617947 0.079491 0.389772 0.000000 0.016985 0.000000 0.783456 0.000000 0.165714 0.222612 3.545221 0.268690 0.445661 4.912857
-0.094498 0.000000 0.678751 0.000000 1.454000 0.537272 14.011435 0.485357 0.093574 0.061815 0.629663 0.028597 0.040994 0.230805 1.565545 0.106465 0.000000 0.009403 0.277676 0.037948 0.557911 0.141818 4.796047 0.194473 0.000000 0.039214 0.229982 0.000000 0.081275 0.015089 0.901107 0.013895 0.561364 0.189587 3.737469 0.132853 14.559531 4.409233
-0.069707 0.148494 0.000000 0.440641 0.646167 2.099605 0.574329 11.782237 0.027776 0.290184 0.032063 0.719617 0.050361 0.413226 0.205212 1.265431 0.000000 0.068010 0.000000 0.207778 0.237402 0.760630 0.167209 3.394517 0.031612 0.061815 0.014474 0.257091 0.107389 0.163502 0.000000 0.635177 0.277160 0.853104 0.423672 3.042437 5.386236 14.630832 3.783832
-1.069311 0.000000 0.316129 0.095453 0.424773 0.088287 0.103428 0.025947 11.354807 0.760572 2.075004 0.434427 0.328215 0.000000 0.100618 0.014867 0.424424 0.050598 0.156398 0.007582 0.144511 0.000000 0.000000 0.029353 3.681274 0.234045 1.032541 0.103750 0.263771 0.000000 0.008329 0.475651 9.699932 0.949413 2.590234 0.666111 3.114821 0.336870 0.790763 0.066661
-0.084409 1.463345 0.165714 0.297353 0.082861 1.058255 0.016985 0.180473 0.395159 14.630832 0.617947 1.792175 0.053084 0.445661 0.019515 0.191490 0.035867 0.627362 0.000000 0.146478 0.000000 0.324910 0.000000 0.000000 0.269245 4.409233 0.000000 0.762597 0.000000 0.268690 0.000000 0.097225 0.644754 16.902753 0.783456 1.854669 0.328968 4.428067 0.389772 1.005233 3.847067
-0.293672 0.095694 1.437359 0.118075 0.197102 0.000000 0.672368 0.000000 1.343693 0.760630 13.293379 0.618189 0.062743 0.000000 0.939899 0.010971 0.194953 0.172995 0.498558 0.052215 0.000000 0.167039 0.352749 0.104064 0.616539 0.141818 5.562184 0.188341 0.000000 0.088322 0.266344 0.025544 1.334178 0.603882 15.615980 0.662613 0.639705 0.324910 3.384437 0.335803 14.454682 4.815561
-0.085002 0.477770 0.070118 1.249844 0.000000 0.306148 0.000000 0.720942 1.098018 2.099605 0.726461 12.050782 0.000000 0.106160 0.046201 0.548933 0.000000 0.142205 0.065861 0.505968 0.000000 0.000000 0.000000 0.205056 0.170265 0.537272 0.153531 4.242540 0.027300 0.108471 0.000000 0.361955 0.589166 2.483203 0.710565 12.776732 0.197608 1.058255 0.216114 4.311997 4.268825 17.119583 4.726145
-0.433922 0.003863 0.091103 0.024584 1.761890 0.131150 0.717644 0.118446 0.560620 0.015130 0.100109 0.045358 8.008245 0.470856 1.419918 0.418982 0.167154 0.000000 0.043497 0.022479 0.610887 0.136082 0.140137 0.030274 0.276852 0.031150 0.000000 0.000000 3.551489 0.192400 0.615431 0.144818 2.401197 0.187603 0.554096 0.444879 10.636410 0.653142 1.726857 0.636154 2.472373 0.155034 0.632402 0.276836
-0.030716 0.468415 0.000000 0.099841 0.220392 2.483203 0.114579 0.393730 0.096474 0.853104 0.061995 0.142267 0.360878 14.822309 0.533914 1.149969 0.029624 0.122648 0.000000 0.034381 0.000000 0.603882 0.126163 0.178801 0.000000 0.189587 0.049017 0.000000 0.337383 4.596102 0.201500 0.517703 0.144571 5.499667 0.432236 0.930034 0.925138 16.902753 0.816188 2.870469 0.313563 3.545221 0.250199 0.714212 3.026253
-0.071532 0.038107 0.491223 0.032724 0.313495 0.142205 2.416779 0.145995 0.101294 0.068010 0.636928 0.073626 1.248076 0.471084 13.310792 0.387180 0.008855 0.038103 0.183456 0.016375 0.116443 0.172995 0.732359 0.053499 0.021628 0.009403 0.186783 0.000267 0.574404 0.235266 4.707491 0.264889 0.512042 0.122648 4.623787 0.180006 2.777846 0.627362 14.640486 0.644423 0.707086 0.201857 3.812014 0.447622 12.383165 3.944502
-0.028382 0.162046 0.068988 0.418659 0.078765 0.477770 0.081084 1.860537 0.097296 0.148494 0.000000 0.717897 0.385668 1.196335 0.432397 8.559818 0.000000 0.038107 0.000000 0.122774 0.000000 0.095694 0.023634 0.637142 0.000000 0.000000 0.051154 0.292858 0.201824 0.611306 0.309883 3.040942 0.222689 0.468415 0.263770 2.811613 0.559221 1.463345 0.560662 11.709968 0.257598 0.717449 0.181727 3.381941 3.269345 11.765145 3.825897
-2.089064 0.233093 0.478814 0.269245 0.195050 0.000000 0.047544 0.000000 0.432400 0.034146 0.086453 0.013423 0.194587 0.025218 0.013976 0.000000 8.134336 0.553060 1.353221 0.390192 0.536449 0.097213 0.061899 0.064969 1.364475 0.064845 0.188713 0.155485 0.393981 0.000000 0.110918 0.006106 2.281797 0.166841 0.635614 0.206970 0.206045 0.006253 0.000000 0.000000 0.512882 0.013184 0.102436 0.018054 0.185537 0.047379 0.005868 0.000000
-0.228275 3.269345 0.144818 0.418982 0.026173 0.276836 0.000000 0.045358 0.000000 0.636154 0.030274 0.118446 0.000000 0.444879 0.022479 0.024584 0.598557 12.383165 0.615431 1.419918 0.031183 0.632402 0.000000 0.100109 0.129967 1.726857 0.140137 0.717644 0.060396 0.554096 0.043497 0.091103 0.183731 3.026253 0.192400 0.470856 0.033775 0.155034 0.031150 0.015130 0.032331 0.653142 0.136082 0.131150 0.000000 0.187603 0.000000 0.003863 2.740877
-0.319599 0.201824 2.920270 0.121568 0.000000 0.027300 0.221225 0.000000 0.097230 0.107389 0.544169 0.061904 0.017887 0.022480 0.208361 0.001044 1.698169 0.574404 13.849203 0.506508 0.087418 0.000000 0.624662 0.005784 0.634432 0.081275 1.145372 0.000000 0.204326 0.001578 0.560706 0.004770 0.435176 0.337383 3.002685 0.206246 0.010500 0.000000 0.203660 0.000000 0.077766 0.000000 0.645175 0.069575 0.060396 0.000000 0.232716 0.000000 8.940934 3.551489
-0.163865 0.385668 0.199837 2.245018 0.000000 0.000000 0.000000 0.133822 0.037364 0.050361 0.000000 0.413761 0.000000 0.000000 0.000000 0.215444 0.359474 1.248076 0.358873 6.473629 0.029346 0.062743 0.000000 0.417736 0.031728 0.040994 0.153935 1.419727 0.017887 0.180545 0.000000 0.363387 0.168738 0.360878 0.184056 2.050079 0.000000 0.053084 0.000000 0.190507 0.000000 0.195637 0.055231 0.379155 0.000000 0.004871 0.010824 0.141238 2.549084 8.008245 2.519033
-0.217496 0.012716 0.012216 0.000000 2.997394 0.157543 0.543970 0.152524 0.282436 0.000000 0.000000 0.004911 0.370348 0.045159 0.102552 0.003404 0.871800 0.064755 0.083848 0.010846 12.587816 0.692645 1.639998 0.490214 0.625169 0.013799 0.092718 0.000000 1.899125 0.281827 0.543734 0.156916 0.182961 0.000000 0.070560 0.000000 3.103071 0.264927 0.480320 0.167141 0.183069 0.000000 0.003234 0.023419 0.637527 0.089945 0.100345 0.033439 2.133385 0.298441 0.548139 0.184395
-0.000000 0.257598 0.475651 0.014867 0.290482 4.268825 0.103750 0.434427 0.000000 0.066661 0.029353 0.025947 0.000000 0.666111 0.007582 0.095453 0.000000 0.707086 0.008329 0.100618 0.628368 14.454682 1.032541 2.075004 0.056886 0.790763 0.000000 0.103428 0.077766 2.590234 0.156398 0.316129 0.000000 0.313563 0.000000 0.000000 0.420242 3.847067 0.234045 0.760572 0.057675 0.336870 0.000000 0.088287 0.032331 0.949413 0.050598 0.000000 0.144212 2.472373 0.263771 0.328215 3.253683
-0.000000 0.000000 0.215597 0.031271 0.392144 0.170265 4.231405 0.098140 0.000000 0.031612 0.026706 0.018379 0.031728 0.000000 1.168067 0.000000 0.070551 0.021628 1.111261 0.036558 2.040859 0.616539 12.608393 0.461596 0.256677 0.000000 0.712664 0.082372 0.634432 0.155879 2.490261 0.019381 0.024351 0.000000 0.398072 0.000000 0.429724 0.269245 2.897752 0.219070 0.056886 0.079491 0.154285 0.000000 0.129967 0.000000 0.643402 0.010521 0.524203 0.276852 3.272380 0.093033 13.578799 3.681274
-0.005796 0.097296 0.000000 0.169081 0.171488 1.098018 0.345823 2.873188 0.038277 0.027776 0.302376 0.174647 0.037364 0.220343 0.017107 0.561768 0.025642 0.101294 0.152673 0.710216 0.497041 1.343693 0.507959 11.505158 0.000000 0.093574 0.000000 0.681852 0.097230 0.459028 0.235131 2.021627 0.000000 0.096474 0.000000 0.225787 0.248102 0.395159 0.223984 3.036520 0.000000 0.018091 0.028326 0.355052 0.000000 0.216362 0.055905 0.649046 0.154919 0.560620 0.250662 2.274873 3.246394 11.354807 3.799372
-0.419797 0.033439 0.156916 0.003404 0.101743 0.023419 0.000000 0.004911 3.246394 0.167141 0.490214 0.152524 0.184395 0.000000 0.010846 0.000000 1.754706 0.100345 0.543734 0.102552 0.597093 0.003234 0.092718 0.000000 13.578799 0.480320 1.639998 0.543970 0.548139 0.070560 0.083848 0.012216 0.647307 0.089945 0.281827 0.045159 0.180010 0.000000 0.013799 0.000000 3.253683 0.264927 0.692645 0.157543 0.298441 0.000000 0.064755 0.012716 7.777208 0.637527 1.899125 0.370348 2.663792 0.183069 0.625169 0.282436
-0.052225 0.559221 0.019144 0.143685 0.001785 0.197608 0.071044 0.018508 0.248102 5.386236 0.175640 0.682361 0.000000 0.163718 0.000000 0.007875 0.205316 2.777846 0.241647 0.318448 0.031147 0.639705 0.042107 0.222957 0.429724 14.559531 0.986593 1.923544 0.010500 0.744032 0.042760 0.120075 0.085855 0.925138 0.000000 0.366791 0.116327 0.328968 0.037337 0.000000 0.420242 4.912857 0.100322 0.583265 0.033775 0.528912 0.016418 0.062248 0.510721 10.636410 0.607281 1.213080 0.180010 3.114821 0.184398 0.603673 3.103071
-0.097865 0.000000 0.442068 0.015793 0.000000 0.000000 0.169248 0.000000 0.497041 0.237402 5.411464 0.253099 0.029346 0.018960 0.486971 0.000000 0.407388 0.116443 2.837205 0.065128 0.208501 0.000000 0.374262 0.000000 2.040859 0.557911 16.287053 0.562076 0.087418 0.000000 1.027034 0.064850 0.081318 0.000000 1.069439 0.107577 0.031147 0.000000 0.398095 0.000000 0.628368 0.347305 4.925549 0.215776 0.031183 0.003802 0.330231 0.002177 1.234860 0.610887 12.362144 0.459821 0.597093 0.144511 3.705557 0.476138 12.587816 3.761923
-0.026685 0.078765 0.036191 0.381006 0.030430 0.000000 0.042617 0.218806 0.171488 0.646167 0.158046 3.866647 0.000000 0.033517 0.008358 0.223004 0.083765 0.313495 0.150496 1.996865 0.000000 0.197102 0.146588 0.457233 0.392144 1.454000 0.497431 12.506413 0.000000 0.134467 0.103292 0.569290 0.035870 0.220392 0.067747 0.603727 0.001785 0.082861 0.015927 0.247099 0.290482 0.630737 0.214639 4.271863 0.026173 0.043004 0.000000 0.338020 0.460213 1.761890 0.527406 7.441212 0.101743 0.424773 0.181355 3.049419 2.997394 11.581393 2.953057
-0.168521 0.000000 0.006106 0.000000 0.460213 0.018054 0.155485 0.013423 0.154919 0.000000 0.064969 0.000000 2.549084 0.206970 0.390192 0.269245 0.416540 0.005868 0.110918 0.013976 1.234860 0.102436 0.188713 0.086453 0.524203 0.000000 0.061899 0.047544 8.940934 0.635614 1.353221 0.478814 0.230860 0.047379 0.000000 0.025218 0.510721 0.013184 0.064845 0.034146 0.144212 0.006253 0.097213 0.000000 2.740877 0.166841 0.553060 0.233093 2.995600 0.185537 0.393981 0.194587 7.777208 0.512882 1.364475 0.432400 2.133385 0.206045 0.536449 0.195050
-0.000000 0.222689 0.008867 0.023892 0.035870 0.589166 0.050622 0.101776 0.000000 0.277160 0.000000 0.022686 0.168738 2.759894 0.144271 0.410996 0.062013 0.512042 0.000000 0.138775 0.081318 1.334178 0.128851 0.477734 0.024351 0.561364 0.114032 0.125129 0.435176 11.058420 0.501729 1.250639 0.075276 0.144571 0.070559 0.000000 0.085855 0.644754 0.002575 0.107031 0.000000 0.222612 0.038141 0.011173 0.183731 3.325879 0.142361 0.545878 0.230860 2.401197 0.099986 0.472466 0.647307 9.699932 0.660296 1.888143 0.182961 2.750504 0.285770 0.538680 2.281797
-0.048050 0.000000 0.234932 0.026898 0.083765 0.000000 0.497133 0.070105 0.025642 0.000000 0.239875 0.000000 0.359474 0.164928 3.147806 0.207198 0.168057 0.008855 0.444014 0.019463 0.407388 0.194953 1.265981 0.177883 0.070551 0.000000 0.632818 0.088779 1.698169 0.567990 12.730795 0.491035 0.062013 0.029624 0.270518 0.004930 0.205316 0.035867 0.628055 0.094390 0.000000 0.004545 0.266652 0.020501 0.598557 0.294193 3.329486 0.134365 0.416540 0.167154 3.504833 0.201108 1.754706 0.424424 11.889462 0.569979 0.871800 0.325010 3.806558 0.344995 8.134336 2.727391
-0.017579 0.028382 0.000000 0.181757 0.026685 0.085002 0.028599 0.386140 0.005796 0.069707 0.000000 0.169551 0.163865 0.344283 0.127873 2.256750 0.048050 0.071532 0.025803 0.391130 0.097865 0.293672 0.153908 0.982077 0.000000 0.094498 0.079769 0.458150 0.319599 1.092821 0.448221 5.962122 0.000000 0.030716 0.015586 0.299153 0.052225 0.084409 0.086976 0.461336 0.000000 0.014902 0.046002 0.194704 0.228275 0.468203 0.190323 2.324407 0.168521 0.433922 0.170195 1.687118 0.419797 1.069311 0.438502 5.973296 0.217496 0.514815 0.181568 2.208606 2.089064 6.066180 2.151990
-
-0.050652 0.017255 0.021160 0.032474 0.018026 0.008973 0.008527 0.015506 0.018850 0.010325 0.010458 0.015506 0.035649 0.014782 0.017158 0.032474 0.019614 0.010055 0.009977 0.017158 0.010003 0.006173 0.005336 0.010458 0.008072 0.006082 0.005336 0.008527 0.014070 0.009981 0.009977 0.021160 0.022403 0.007536 0.009981 0.014782 0.011453 0.006492 0.006082 0.010325 0.010352 0.006492 0.006173 0.008973 0.016223 0.007536 0.010055 0.017255 0.028967 0.016223 0.014070 0.035649 0.017417 0.010352 0.008072 0.018850 0.017417 0.011453 0.010003 0.018026 0.028967 0.022403 0.019614 0.050652
-
-
-AAA AAC AAG AAT ACA ACC ACG ACT AGA AGC AGG AGT ATA ATC ATG ATT CAA CAC CAG CAT
-CCA CCC CCG CCT CGA CGC CGG CGT CTA CTC CTG CTT GAA GAC GAG GAT GCA GCC GCG GCT
-GGA GGC GGG GGT GTA GTC GTG GTT TAA TAC TAG TAT TCA TCC TCG TCT TGA TGC TGG TGT
-TTA TTC TTG TTT
diff --git a/README b/README
deleted file mode 100644
index c4b8af9..0000000
--- a/README
+++ /dev/null
@@ -1,56 +0,0 @@
- +---------------------------------------------------------------------+
- | ____ __ __ ___________ ______ |
- | / __ \/ /_ __ __/ /____ / ____/ ___// ____/ |
- | / /_/ / __ \/ / / / // __ \/ / \__ \/ /_ |
- | / ____/ / / / /_/ / // /_/ / /___ ___/ / __/ |
- | /_/ /_/ /_/\__, /_/ \____/\____//____/_/ |
- | /____/ |
- | |
- | http://compbio.mit.edu/PhyloCSF |
- +---------------------------------------------------------------------+
-
-SOURCE DISTRIBUTION
-
-Please see our web site for more information about PhyloCSF and how to use it.
-PhyloCSF is written in OCaml. This source distribution is divided into a
-library, CamlPaml, containing generic infrastructure for phylogenetic rate
-models, and a program implementing the PhyloCSF-specific models and driver
-program. With additional development, the CamlPaml library will eventually be
-released as a separate entity, but for now it is just part of this
-distribution.
-
-Here are the steps to build the source:
-
-[1] Install the OCaml package manager OPAM
-
-http://opam.ocamlpro.com/doc/Quick_Install.html
-
-This will install a minimal OCaml toolchain (if not already present on your
-system) and the OPAM package manager. Once it's installed, initialize your
-shell environment by running: eval $(opam config env)
-
-[2] Install dependencies using OPAM
-
-opam install batteries ocaml+twt gsl
-
-The gsl package may require you to separately install the GNU Scientific
-Library (GSL) from: http://www.gnu.org/software/gsl/
-On Debian/Ubuntu systems GSL is available in the 'libgsl0-dev' package, and on
-Mac OS X, 'gsl' is available in both Homebrew and MacPorts.
-
-[3] Compile PhyloCSF
-
-Now just run 'make' in this directory. This will build and install the
-CamlPaml library, then compile the PhyloCSF executable and copy it to
-this directory. You can then use the ./PhyloCSF dispatch script like the
-examples found on our website, e.g.
-
-./PhyloCSF 12flies PhyloCSF_Examples/tal-AA.fa
-
-PhyloCSF should be usable in this way by anyone on the machine/cluster with rx
-permissions; they don't have to set up OPAM or anything else. PhyloCSF can
-be started from any working directory.
-
-If you want to 'install' PhyloCSF somewhere, you must transplant PhyloCSF,
-PhyloCSF.ARCH (where e.g. ARCH=Linux.x86_64), and the PhyloCSF_Parameters
-directory to the desired location.
diff --git a/index.html b/index.html
new file mode 100644
index 0000000..bca77d7
--- /dev/null
+++ b/index.html
@@ -0,0 +1,7 @@
+
+
+
+
+
+
+
diff --git a/lib/CamlPaml/CamlPaml.mlpack b/lib/CamlPaml/CamlPaml.mlpack
deleted file mode 100644
index 5ff9a0a..0000000
--- a/lib/CamlPaml/CamlPaml.mlpack
+++ /dev/null
@@ -1,13 +0,0 @@
-Newick
-NewickParser
-NewickLexer
-T
-P
-Q
-Expr
-Fit
-PhyloModel
-PhyloLik
-PhyloEM
-Code
-Parsimony
diff --git a/lib/CamlPaml/CamlPaml.odocl b/lib/CamlPaml/CamlPaml.odocl
deleted file mode 100644
index d5fbe19..0000000
--- a/lib/CamlPaml/CamlPaml.odocl
+++ /dev/null
@@ -1,11 +0,0 @@
-Code
-Newick
-T
-Parsimony
-PhyloModel
-P
-Q
-Expr
-PhyloLik
-PhyloEM
-Fit
diff --git a/lib/CamlPaml/Code.ml b/lib/CamlPaml/Code.ml
deleted file mode 100644
index 0f77a59..0000000
--- a/lib/CamlPaml/Code.ml
+++ /dev/null
@@ -1,200 +0,0 @@
-open Printf
-open List
-
-module type S = sig
- type t
- val dim : int
- val index : t -> int
- val of_index : int -> t
- val compare : t -> t -> int
-
-module DNA = struct
- type t = char
-
- let dim = 4
-
- let compare = compare
-
- let is = function
- | 'A' | 'a'
- | 'C' | 'c'
- | 'G' | 'g'
- | 'T' | 't' -> true
- | _ -> false
-
- let index = function
- | 'A' | 'a' -> 0
- | 'C' | 'c' -> 1
- | 'G' | 'g' -> 2
- | 'T' | 't' -> 3
- | _ as nuc -> invalid_arg (sprintf "unrecognized nucleotide %c" nuc)
-
- let of_index = function
- | 0 -> 'A'
- | 1 -> 'C'
- | 2 -> 'G'
- | 3 -> 'T'
- | _ -> invalid_arg "CamlPaml.Code.DNA.of_index"
-
- let comp = function
- | 'A' -> 'T'
- | 'G' -> 'C'
- | 'C' -> 'G'
- | 'T' -> 'A'
- | 'a' -> 't'
- | 'g' -> 'c'
- | 'c' -> 'g'
- | 't' -> 'a'
- | 'N' -> 'N'
- | 'n' -> 'n'
- | '-' -> '-'
- | _ as nuc -> invalid_arg (sprintf "unrecognized nucleotide %c" nuc)
-
- let revcomp s =
- let l = String.length s
- let s' = String.create l
- for i = 0 to l-1 do
- s'.[l-i-1] <- comp s.[i]
- s'
-
-let ord a =
- let t = Hashtbl.create 16
- Array.iteri (fun i x -> Hashtbl.add t x i) a
- fun x -> Hashtbl.find t x
-
-module AA = struct
- type t = char
- let dim = 20
- let compare = compare
-
- let aa2twenty = [|
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
-
- -1; 0;-1; 1; 2; 3; 4; 5; 6; 7;-1; 8; 9;10;11;-1;
- 12;13;14;15;16;-1;17;18;-1;19;-1;-1;-1;-1;-1;-1;
-
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;
- -1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1;-1 |]
-
-
- let twenty2aa = ord aa2twenty
-
- let is c =
- let ci = Char.code c
- ci <= (Array.length aa2twenty) && aa2twenty.(ci) >= 0
-
- let index c = aa2twenty.(Char.code c)
-
- let of_index ci = Char.chr (twenty2aa ci)
-
- let blosum62_matrix = [|
- 4; 0;-2;-1; -2; 0;-2;-1; -1;-1;-1;-2; -1;-1;-1;-1; 0; 0;-3;-2;
- 0; 9;-3;-4; -2;-3;-3;-1; -3;-1;-1;-3; -3;-3;-3;-1; -1;-1;-2;-2;
- -2;-3; 6; 2; -3;-1;-1;-3; -1;-4;-3; 1; -1; 0;-2; 0; -1;-3;-4;-3;
- -1;-4; 2; 5; -3;-2; 0;-3; 1;-3;-2; 0; -1; 2; 0; 0; -1;-2;-3;-2;
-
- -2;-2;-3;-3; 6;-3;-1; 0; -3; 0; 0;-3; -4;-3;-3;-2; -2;-1; 1; 3;
- 0;-3;-1;-2; -3; 6;-2;-4; -2;-4;-3; 0; -2;-2;-2; 0; -2;-3;-2;-3;
- -2;-3;-1; 0; -1;-2; 8;-3; -1;-3;-2; 1; -2; 0; 0;-1; -2;-3;-2; 2;
- -1;-1;-3;-3; 0;-4;-3; 4; -3; 2; 1;-3; -3;-3;-3;-2; -1; 3;-3;-1;
-
- -1;-3;-1; 1; -3;-2;-1;-3; 5;-2;-1; 0; -1; 1; 2; 0; -1;-2;-3;-2;
- -1;-1;-4;-3; 0;-4;-3; 2; -2; 4; 2;-3; -3;-1;-1;-1; -1; 1;-2;-1;
- -1;-1;-3;-2; 0;-3;-2; 1; -1; 2; 5;-2; -2; 0;-1;-1; -1; 1;-1;-1;
- -2;-3; 1; 0; -3; 0; 1;-3; 0;-3;-2; 6; -2; 0; 0; 1; 0;-3;-4;-2;
-
- -1;-3;-1;-1; -4;-2;-2;-3; -1;-3;-2;-2; 7;-1;-2;-1; -1;-2;-4;-3;
- -1;-3; 0; 2; -3;-2; 0;-3; 1;-1; 0; 0; -1; 5; 1; 0; -1;-2;-2;-1;
- -1;-3;-2; 0; -3;-2; 0;-3; 2;-1;-1; 0; -2; 1; 5;-1; -1;-3;-3;-2;
- -1;-1; 0; 0; -2; 0;-1;-2; 0;-1;-1; 1; -1; 0;-1; 4; 1;-2;-3;-2;
-
- 0;-1;-1;-1; -2;-2;-2;-1; -1;-1;-1; 0; -1;-1;-1; 1; 5; 0;-2;-2;
- 0;-1;-3;-2; -1;-3;-3; 3; -2; 1; 1;-3; -2;-2;-3;-2; 0; 4;-3;-1;
- -3;-2;-4;-3; 1;-2;-2;-3; -3;-2;-1;-4; -4;-2;-3;-3; -2;-3;11; 2;
- -2;-2;-3;-2; 3;-3; 2;-1; -2;-1;-1;-2; -3;-1;-2;-2; -2;-1; 2 ;7 |]
-
- let blosum62 aa1 aa2 =
- let idx1 = aa2twenty.(Char.code aa1)
- let idx2 = aa2twenty.(Char.code aa2)
- blosum62_matrix.(20*idx1+idx2)
-
-
-module Codon64 = struct
- type t = DNA.t*DNA.t*DNA.t
- let dim = 64
- let compare = compare
-
- let is (nuc1,nuc2,nuc3) = DNA.is nuc1 && DNA.is nuc2 && DNA.is nuc3
-
- let index (nuc1,nuc2,nuc3) =
- 16 * (DNA.index nuc1) + 4 * (DNA.index nuc2) + (DNA.index nuc3)
-
- let of_index idx =
- let sixteens = idx / 16
- let fours = (idx - 16 * sixteens) / 4
- let ones = (idx - 16 * sixteens - 4 * fours)
- (DNA.of_index sixteens,
- DNA.of_index fours,
- DNA.of_index ones)
-
- let stop1 = index ('T','A','A')
- let stop2 = index ('T','A','G')
- let stop3 = index ('T','G','A')
-
- let is_stop_index ci = ci = stop1 || ci = stop2 || ci = stop3
-
- let is_stop c = is_stop_index (index c)
-
- let translation_table = [|
- 'K';'N';'K';'N';
- 'T';'T';'T';'T';
- 'R';'S';'R';'S';
- 'I';'I';'M';'I';
-
- 'Q';'H';'Q';'H';
- 'P';'P';'P';'P';
- 'R';'R';'R';'R';
- 'L';'L';'L';'L';
-
- 'E';'D';'E';'D';
- 'A';'A';'A';'A';
- 'G';'G';'G';'G';
- 'V';'V';'V';'V';
-
- '*';'Y';'*';'Y';
- 'S';'S';'S';'S';
- '*';'C';'W';'C';
- 'L';'F';'L';'F' |]
-
- let translate c = translation_table.(index c)
- let translate_index idx = translation_table.(idx)
-module Codon1 = Codon64
-
-module Codon61 = struct
- type t = DNA.t*DNA.t*DNA.t
- let dim = 61
-
- let is c = Codon1.is c && not (Codon1.is_stop c)
-
- let order = [| ('T','T','T'); ('T','T','C'); ('T','T','A'); ('T','T','G'); ('T','C','T'); ('T','C','C'); ('T','C','A'); ('T','C','G'); ('T','A','T'); ('T','A','C'); ('T','G','T'); ('T','G','C'); ('T','G','G'); ('C','T','T'); ('C','T','C'); ('C','T','A'); ('C','T','G'); ('C','C','T'); ('C','C','C'); ('C','C','A'); ('C','C','G'); ('C','A','T'); ('C','A','C'); ('C','A','A'); ('C','A','G'); ('C','G','T'); ('C','G','C'); ('C','G','A'); ('C','G','G'); ('A','T','T'); ('A','T','C'); ('A','T','A'); ('A','T','G'); ('A','C','T'); ('A','C','C'); ('A','C','A'); ('A','C','G'); ('A','A','T'); ('A','A','C'); ('A','A','A'); ('A','A','G'); ('A','G','T'); ('A','G','C'); ('A','G','A'); ('A','G','G'); ('G','T','T'); ('G','T','C'); ('G','T','A'); ('G','T','G'); ('G','C','T'); ('G','C','C'); ('G','C','A'); ('G','C','G'); ('G','A','T'); ('G','A','C'); ('G','A','A'); ('G','A','G'); ('G','G','T'); ('G','G','C'); ('G','G','A'); ('G','G','G') |]
- let lookup = ord order
-
- let index (n1,n2,n3) = lookup (Char.uppercase n1,Char.uppercase n2,Char.uppercase n3)
- let of_index idx = order.(idx)
-
- let compare c1 c2 = compare (index c1) (index c2)
-
- let translate c = Codon1.translate c
- let translate_index idx = translate (of_index idx)
-module Codon2 = Codon61
diff --git a/lib/CamlPaml/Code.mli b/lib/CamlPaml/Code.mli
deleted file mode 100644
index f390b88..0000000
--- a/lib/CamlPaml/Code.mli
+++ /dev/null
@@ -1,100 +0,0 @@
-(** abstractions for nucleotides, amino acids, and codons *)
-
-(** common signature for a code *)
-module type S = sig
- type t
-
- (** alphabet size (e.g. 4 for nucleotides, 20 for amino acids) *)
- val dim : int
-
- (** return the index of the given codeword (between 0 and dim-1) *)
- val index : t -> int
-
- (** return a codeword from its index *)
- val of_index : int -> t
-
- val compare : t -> t -> int
-
-(** 4 DNA nucleotides *)
-module DNA : sig
- type t = char
- val dim : int
- val index : t -> int
- val of_index : int -> t
- val compare : t -> t -> int
-
- val is : char -> bool
-
- val comp : t -> t
- val revcomp : string -> string
-
-(** 20 amino acids *)
-module AA : sig
- type t = char
- val dim : int
- val index : t -> int
- val of_index : int -> t
- val compare : t -> t -> int
-
- val is : char -> bool
-
- val blosum62 : t -> t -> int
-
-(** 64 codons (alphabetical, including stop codons) *)
-module Codon64 : sig
- type t = DNA.t*DNA.t*DNA.t
- val dim : int
- val index : t -> int
- val of_index : int -> t
- val compare : t -> t -> int
-
- val is : char*char*char -> bool
-
- val is_stop : t -> bool
- val is_stop_index : int -> bool
-
- val translate : t -> AA.t
- val translate_index : int -> AA.t
-
-(** @deprecated old name for Codon64 *)
-module Codon1 : sig
- type t = DNA.t*DNA.t*DNA.t
- val dim : int
- val index : t -> int
- val of_index : int -> t
- val compare : t -> t -> int
-
- val is : char*char*char -> bool
-
- val is_stop : t -> bool
- val is_stop_index : int -> bool
-
- val translate : t -> AA.t
- val translate_index : int -> AA.t
-
-
-(** 61 sense codons in a distance-based order *)
-module Codon61 : sig
- type t = DNA.t*DNA.t*DNA.t
- val dim : int
- val index : t -> int
- val of_index : int -> t
- val compare : t -> t -> int
-
- val is : char*char*char -> bool
-
- val translate : t -> AA.t
- val translate_index : int -> AA.t
-
-(** @deprecated old name for Codon61 *)
-module Codon2 : sig
- type t = DNA.t*DNA.t*DNA.t
- val dim : int
- val index : t -> int
- val of_index : int -> t
- val compare : t -> t -> int
-
- val is : char*char*char -> bool
-
- val translate : t -> AA.t
- val translate_index : int -> AA.t
diff --git a/lib/CamlPaml/Expr.ml b/lib/CamlPaml/Expr.ml
deleted file mode 100644
index 7b71316..0000000
--- a/lib/CamlPaml/Expr.ml
+++ /dev/null
@@ -1,92 +0,0 @@
-type t =
- | Val of float
- | Var of int
- | Add of t*t
- | Sub of t*t
- | Mul of t*t
- | Div of t*t
-
-let rec eval' v = function
- | Val x -> x
- | Var (k) -> v.(k)
- | Add (l,r) -> eval' v l +. eval' v r
- | Sub (l,r) -> eval' v l -. eval' v r
- | Mul (l,r) -> eval' v l *. eval' v r
- | Div (t,b) -> eval' v t /. eval' v b
-let eval e v = eval' v e
-
-let rec deriv' k = function
- | Val _ -> Val 0.
- | Var (k') when k = k' -> Val 1.
- | Var (k') -> Val 0.
- | Add (l,r) -> Add ((deriv' k l),(deriv' k r))
- | Sub (l,r) -> Sub ((deriv' k l),(deriv' k r))
- | Mul (l,r) -> Add ((Mul ((deriv' k l),r)), (Mul (l,(deriv' k r))))
- | Div (t,b) -> Div ((Sub ((Mul ((deriv' k t),b)), (Mul (t,(deriv' k b))))), (Mul (b,b)))
-let deriv e k = deriv' k e
-
-let rec fixed_point f init =
- let rslt = f init
- if rslt = init then
- rslt
- else
- fixed_point f rslt
-
-let rec simplify_step = function
- | Add (Val 0.,x) | Add (x,Val 0.)
- | Sub (x,Val 0.)
- | Mul (Val 1.,x) | Mul(x,Val 1.)
- | Div (x,Val 1.) -> simplify_step x
-
- | Sub (e,e') when e=e' -> Val 0.
- | Mul (Val 0.,x) | Mul(x,Val 0.) -> Val 0.
-
- | Div (e,e') when e=e' -> Val 1.
-
- | Add (Val l,Val r) -> Val (l +. r)
- | Sub (Val l,Val r) -> Val (l -. r)
- | Mul (Val l,Val r) -> Val (l *. r)
- | Div (Val l,Val r) -> Val (l /. r)
-
- | Add (l,r) -> Add (simplify_step l, simplify_step r)
- | Sub (l,r) -> Sub (simplify_step l, simplify_step r)
- | Mul (l,r) -> Mul (simplify_step l, simplify_step r)
- | Div (l,r) -> Div (simplify_step l, simplify_step r)
-
- | x -> x
-
-let simplify = fixed_point simplify_step
-
-let to_string ?(fmt=string_of_float) x =
- let b = Buffer.create 10
- let rec f = function
- | Val x -> Buffer.add_string b (fmt x)
- | Var k ->
- Buffer.add_char b 'v'
- Buffer.add_string b (string_of_int k)
- | Add (l,r) ->
- Buffer.add_char b '('
- f l
- Buffer.add_string b " + "
- f r
- Buffer.add_char b ')'
- | Sub (l,r) ->
- Buffer.add_char b '('
- f l
- Buffer.add_string b " - "
- f r
- Buffer.add_char b ')'
- | Mul (l,r) ->
- Buffer.add_char b '('
- f l
- Buffer.add_string b " * "
- f r
- Buffer.add_char b ')'
- | Div (l,r) ->
- Buffer.add_char b '('
- f l
- Buffer.add_string b " / "
- f r
- Buffer.add_char b ')'
- f x
- Buffer.contents b
diff --git a/lib/CamlPaml/Expr.mli b/lib/CamlPaml/Expr.mli
deleted file mode 100644
index 8cb38c1..0000000
--- a/lib/CamlPaml/Expr.mli
+++ /dev/null
@@ -1,23 +0,0 @@
-(** symbolic representation of arithmetic expressions with variables *)
-
-type t =
- | Val of float (** Constant value *)
- | Var of int (** Variable (identified by an integer) *)
- | Add of t*t (** Addition *)
- | Sub of t*t (** Subtraction *)
- | Mul of t*t (** Multiplication *)
- | Div of t*t (** Division *)
-
-(** [eval expr assignments] evaluates [expr] with respect to the given assignment of the variables (i.e. [assignments.(i)] is substituted for variable [i]) *)
-val eval : t -> float array -> float
-
-(** [deriv expr v] computes the derivative of [expr] with respect to variable [v]. *)
-val deriv : t -> int -> t
-
-(** simplify the expression by evaluating operations on constants, removing additions of 0, multiplications by 1, etc.*)
-val simplify : t -> t
-
-(** make a nice infix notation string of the expression
-@param fmt if you want to control the precision, etc. (defaults to [string_of_float])
- *)
-val to_string : ?fmt:(float->string) -> t -> string
diff --git a/lib/CamlPaml/Fit.ml b/lib/CamlPaml/Fit.ml
deleted file mode 100644
index 86a0271..0000000
--- a/lib/CamlPaml/Fit.ml
+++ /dev/null
@@ -1,124 +0,0 @@
-open List
-
-class maximizer f init lo hi =
-
- let exn = ref None
- let f' x =
- try
- 0. -. f x
- with
- | any ->
- exn := Some any
- nan
- let minimizer = Gsl.Min.make Gsl.Min.BRENT f' ~min:init ~lo:lo ~up:hi
-
- object
- method maximum () = Gsl.Min.minimum minimizer
- method interval () = Gsl.Min.interval minimizer
- method iterate () =
- Gsl.Min.iterate minimizer
- match !exn with
- | Some ex -> raise ex
- | None -> ()
-
-let make_maximizer ~f ~init ~lo ~hi = (new maximizer f init lo hi)
-
-exception Out_of_range of float
-let find_init ?(maxtries=1000) ?(logspace=false) ~f ~init ~lo ~hi () =
- if lo >= hi || (logspace && lo <= 0.) then invalid_arg "CamlPaml.Fit.find_init"
- let width = if logspace then log hi -. log lo else hi -. lo
- let flo = f lo
- let fhi = f hi
- let x = ref init
- let fx = ref (f init)
- let i = ref 0
- Random.init 0
- while !i < maxtries && (!fx <= flo || !fx <= fhi) do
- if logspace then
- x := exp (log lo +. Random.float width)
- else
- x := lo +. Random.float width
- fx := f !x
- incr i
- if !i = maxtries then
- if flo > fhi then
- x := lo
- else
- x := hi
- !x
-
-class multi_maximizer f df init =
-
- let exn = ref None
- let n = Array.length init
-
- let f' ~x =
- if !exn = None then
- try
- 0. -. f (Gsl.Vector.to_array x)
- with
- | any ->
- exn := Some any
- nan
- else
- nan
- let df' ~x ~g =
- if !exn = None then
- try
- let dfv = Gsl.Vector.of_array (df (Gsl.Vector.to_array x))
- Gsl.Vector.scale dfv (-1.)
- Gsl.Vector.set_zero g
- Gsl.Vector.add g dfv
- with
- | any -> exn := Some any
- let gsl_fdf = {
- Gsl.Fun.multim_f = f';
- Gsl.Fun.multim_df = df';
- Gsl.Fun.multim_fdf = (fun ~x ~g -> let rslt = f' ~x in (if !exn = None then (df' ~x ~g; rslt) else rslt));
- }
-
-
- let minimizer = Gsl.Multimin.Deriv.make Gsl.Multimin.Deriv.VECTOR_BFGS2 n gsl_fdf ~x:(Gsl.Vector.of_array init) ~step:1. ~tol:1e-6
-
- object
- method maximum () =
- let x = Gsl.Vector.create n
- let g = Gsl.Vector.create n
- let opt = 0. -. Gsl.Multimin.Deriv.minimum ~x:x ~g:g minimizer
- Gsl.Vector.scale g (-1.)
-
- opt, (Gsl.Vector.to_array x), (Gsl.Vector.to_array g)
- method iterate () =
- Gsl.Multimin.Deriv.iterate minimizer
- match !exn with Some ex -> raise ex | None -> ()
-
-let make_multi_maximizer ~f ~df ~init = (new multi_maximizer f df init)
-
-type domain = Real | Pos | Neg | NonPos | NonNeg | Probability
-
-let check_domain domain x =
- match domain with
- | Real when x=x -> true
- | Pos when x > 0. -> true
- | Neg when x < 0. -> true
- | NonPos when x <= 0. -> true
- | NonNeg when x >= 0. -> true
- | Probability when x >= 0. && x <= 1. -> true
- | _ -> false
-
-
-exception False
-let enforce_domain ?(rejection_value=neg_infinity) f domains =
- fun x ->
- if (Array.length x) <> Array.length domains then invalid_arg "CamlPaml.Fit.enforce_domains: length mismatch"
- try
- Array.iteri
- fun i domain -> if not (check_domain domain x.(i)) then raise False
- domains
- f x
- with
- | False -> rejection_value
-
-
-
-
diff --git a/lib/CamlPaml/Fit.mli b/lib/CamlPaml/Fit.mli
deleted file mode 100644
index ad7b2a0..0000000
--- a/lib/CamlPaml/Fit.mli
+++ /dev/null
@@ -1,54 +0,0 @@
-(** low-level routines for numerical optimization *)
-
-(** {1 Single-dimensional maximization } *)
-
-(** a [maximizer] iteratively narrows down a local maximum of a one-dimensional function [f(x)] *)
-class type maximizer = object
- (** current estimate of the locally maximizing setting, [argmax_x f(x)] *)
- method maximum : unit -> float
-
- (** current lower and upper bounds on [x] around the local maximum *)
- method interval : unit -> (float*float)
-
- (** perform the next iteration *)
- method iterate : unit -> unit
-
-(** create a [maximizer] for the function [f(x)]
-@param init initial estimate of [x]. It is required that [f(lo) < f(init) > f(hi)].
-@param lo lower bound on [x] for the search
-@param hi upper bound on [x] for the search
-*)
-val make_maximizer : f:(float -> float) -> init:float -> lo:float -> hi:float -> maximizer
-
-(** perform a random search within an interval [(lo,hi)] for a suitable initialization point for the one-dimensional maximizer, i.e. a point [x] such that [f(lo) < f(x) > f(hi)].
- @param init any initial guess between [lo] and [hi] (does not have to satisfy any other conditions, but a good guess would make this go faster)
- @param maxtries maximum number of random points to try
- @param logspace perform the random search over the interval between [lo] and [hi] in log space, with the result that the portion of the interval close to [lo] is searched more thoroughly than the portion close to [hi]. [lo] must be positive.
- @raise Out_of_range if a suitable starting point could not be found. The parameter to the exception is [lo] if [f lo > f hi], which suggests that the maximum is at a point less than [lo], or [hi] if [f hi > f lo], which suggests that the maximum is at a point greater than [hi].
- @raise Failure if a suitable starting point could not be found and [f lo = f hi] in fewer than [maxtries] attempts.
-*)
-val find_init : ?maxtries:int -> ?logspace:bool -> f:(float -> float) -> init:float -> lo:float -> hi:float -> unit -> float
-exception Out_of_range of float
-
-(** {1 Multi-dimensional gradient ascent } *)
-
-(** a multi_maximizer performs gradient ascent on a multidimensional function *)
-class type multi_maximizer = object
- (** current estimate of the maximum [f(x)], the corresponding location [x], and the gradient [df(x)] *)
- method maximum : unit -> float*(float array)*(float array)
-
- (** perform the next iteration *)
- method iterate : unit -> unit
-
-(** create a maximizer for the function [f(x)] given its gradient [df]
- @param init initial point from which to begin the gardient ascent
-*)
-val make_multi_maximizer : f:(float array -> float) -> df:(float array -> float array) -> init:(float array) -> multi_maximizer
-
-type domain = Real | Pos | Neg | NonPos | NonNeg | Probability
-
-(** [check_domain domain x] returns [true] if [x] is in [domain], false otherwise *)
-val check_domain : domain -> float -> bool
-
-(** wrap the function [f(x)] to prevent the [multi_maximizer] from searching outside of the specified domain for each element of the vector input. *)
-val enforce_domain : ?rejection_value:float -> (float array -> float) -> (domain array) -> (float array -> float)
diff --git a/lib/CamlPaml/META b/lib/CamlPaml/META
deleted file mode 100644
index caf2e42..0000000
--- a/lib/CamlPaml/META
+++ /dev/null
@@ -1,4 +0,0 @@
-requires = "unix,str,gsl"
-description = "phylogenetic analysis by maximum likelihood"
-archive(byte)="CamlPaml.cma"
-archive(native)="CamlPaml.cmxa"
diff --git a/lib/CamlPaml/Makefile b/lib/CamlPaml/Makefile
deleted file mode 100644
index 396c917..0000000
--- a/lib/CamlPaml/Makefile
+++ /dev/null
@@ -1,26 +0,0 @@
-LIBNAME = CamlPaml
-
-lib:
- ocamlbuild -use-ocamlfind ${LIBNAME}.cma ${LIBNAME}.cmxa
-
-test:
- ocamlbuild -use-ocamlfind test.native
- _build/test.native
-
-
-install: lib
- ocamlfind install ${LIBNAME} META _build/${LIBNAME}.cmi _build/${LIBNAME}.cma _build/${LIBNAME}.cmxa _build/${LIBNAME}.a
-
-uninstall:
- ocamlfind remove ${LIBNAME}
-
-reinstall:
- make uninstall
- make install
-
-clean:
- rm -f *~
- ocamlbuild -clean
-
-doc:
- ocamlbuild -use-ocamlfind ${LIBNAME}.docdir/index.html
diff --git a/lib/CamlPaml/Newick.ml b/lib/CamlPaml/Newick.ml
deleted file mode 100644
index 6fd8ca1..0000000
--- a/lib/CamlPaml/Newick.ml
+++ /dev/null
@@ -1,61 +0,0 @@
-open List
-open Printf
-
-type branch = float option
-type t = Node of (t list)*string*branch
-
-let lbl_bl lbl = function
- | Some bl -> sprintf "%s:%f" lbl bl
- | None -> lbl
-
-let rec to_string = function
- | Node ([],lbl,bl) -> lbl_bl lbl bl
- | Node (st,lbl,bl) ->
- sprintf "(%s)%s"
- String.concat "," (map to_string st)
- lbl_bl lbl bl
-
-let rec size (Node (st,_,_)) = 1 + fold_left (+) 0 (map size st)
-
-let rec leaves = function
- | Node ([],_,_) -> 1
- | Node (st,_,_) -> fold_left (+) 0 (map leaves st)
-
-let rec remove_branch_lengths (Node (st,lbl,_)) = Node (map remove_branch_lengths st,lbl,None)
-
-let rec list_keep_some f = function
- | [] -> []
- | x :: rest -> match f x with Some x -> x :: list_keep_some f rest | None -> list_keep_some f rest
-
-let maybe_add bl1 bl2 = match (bl1,bl2) with
- | (Some x,Some y) -> Some (x +. y)
- | _ -> None
-
-let rec subtree keep = function
- | (Node ([],lbl,_) as leaf) when lbl = "" || keep lbl -> Some leaf
- | Node (st,lbl,bl) when st <> [] && (lbl = "" || keep lbl) ->
- match list_keep_some (subtree keep) st with
- | [] -> None
- | (Node (sst,snm,sbl)) :: [] -> Some (Node (sst,snm,maybe_add bl sbl))
- | st -> Some (Node (st,lbl,bl))
- | _ -> None
-
-let reorder compare t =
- let rec f = function
- | Node ([],lbl,_) as leaf -> (lbl,leaf)
- | Node (subtrees,lbl,bl) ->
- let f_subtrees = sort (fun (lbl1,_) (lbl2,_) -> compare lbl1 lbl2) (map f subtrees)
- let minlbl = fst (hd f_subtrees)
- (minlbl, Node (map snd f_subtrees,lbl,bl))
- snd (f t)
-
-let rec total_length' = function
- | Node (st,_,Some bl) -> bl +. (fold_left (+.) 0. (map total_length' st))
- | _ -> invalid_arg "CamlPaml.Newick.total_length: unspecified branch length"
-
-let total_length ?(count_root=false) t =
- if count_root then
- total_length' t
- else
- match t with
- | Node (st,lbl,_) -> total_length' (Node (st,lbl,Some 0.))
diff --git a/lib/CamlPaml/Newick.mli b/lib/CamlPaml/Newick.mli
deleted file mode 100644
index 275e835..0000000
--- a/lib/CamlPaml/Newick.mli
+++ /dev/null
@@ -1,43 +0,0 @@
-(** Newick format trees
-
-The Newick format is a parenthesis notation widely used for sharing phylogenetic trees, which can be used to represent rooted and unrooted trees with multifurcating nodes. The recursive data structure here is good for import/export and manipulating the tree topology, but the array-based representation in {{:T}[T]} is much more convenient for probabilistic inference purposes (though restricted to bifurcating trees).
-
-A lexer/parser is of course included, typically used as follows:
-
-[let newick_tree = CamlPaml.NewickParser.parse CamlPaml.NewickLexer.token (Lexing.from_string str)]
-
-@see information about Newick format
-*)
-
-(** optional branch length *)
-type branch = float option
-
-(** tree data structure *)
-type t = Node of (t list)*string*branch
-
-(** compute the parenthesis representation of the tree (a semicolon is NOT appended) *)
-val to_string : t -> string
-
-(** number of nodes in the tree (including internal nodes) *)
-val size : t -> int
-
-(** number of leaves in the tree (nodes with no subtrees) *)
-val leaves : t -> int
-
-(** remove all branch lengths from the tree *)
-val remove_branch_lengths : t -> t
-
-(** [subtree keep tree] removes any nodes that have a label [x] such that [keep x = false]. If an internal node is left with no subtrees as a result of removal of stuff below it, that node is also removed. If an internal node is left with exactly one subtree, then the node is removed, the subtree is connected to the parent of the node, and the branch length of the node is added to the subtree if applicable.
-
-This function cannot be used to remove unnamed nodes except as side effects as described above.
-*)
-val subtree : (string -> bool) -> t -> t option
-
-(** [reorder cmp t] reorders leaves in the tree to be consistent with the ordering on labels defined by [cmp]. The topology of the tree is not changed, just its arbitrary left-to-right ordering. If the tree is bifurcating, all the leaves will be sorted left-to-right by their labels. In a multifurcating tree, more complicated things can happen (internal nodes are represented by their smallest leaf). The labels, if any, of internal nodes are not used.
-*)
-val reorder : (string -> string -> int) -> t -> t
-
-(** Compute the total branch length of the tree.
- @param count_root (default false) if true, include the branch length of the topmost node of the tree. If [count_root=false], this branch length is allowed to be unspecified.
- @raise Invalid_argument if the length of any branch is unspecified *)
-val total_length : ?count_root:bool -> t -> float
diff --git a/lib/CamlPaml/NewickLexer.mll b/lib/CamlPaml/NewickLexer.mll
deleted file mode 100644
index 1da7957..0000000
--- a/lib/CamlPaml/NewickLexer.mll
+++ /dev/null
@@ -1,14 +0,0 @@
-{
-open NewickParser
-}
-
-rule token = parse
- | [' ' '\t' '\r' '\n' ';'] { token lexbuf }
- | '(' { LPAREN }
- | ')' { RPAREN }
- | ',' { COMMA }
- | ':' { COLON }
- | ['0'-'9' '.']+ as lxm { BRANCHLEN(float_of_string lxm) }
- | ['A'-'Z' 'a'-'z' '0'-'9' '_' '.']+ as lxm { LABEL(lxm) }
- | ';' { SEMICOLON }
- | eof { EOF }
diff --git a/lib/CamlPaml/NewickParser.mly b/lib/CamlPaml/NewickParser.mly
deleted file mode 100644
index 1feadd7..0000000
--- a/lib/CamlPaml/NewickParser.mly
+++ /dev/null
@@ -1,25 +0,0 @@
-%token LABEL
-%token BRANCHLEN
-%token COLON LPAREN RPAREN COMMA SEMICOLON EOF
-%start parse
-%type parse
-%%
-parse:
- | node SEMICOLON { $1 }
- | node EOF { $1 }
-;
-node:
- | label { Newick.Node ([],fst $1,snd $1) }
- | LPAREN subtrees RPAREN label { Newick.Node ($2,fst $4,snd $4) }
- | LPAREN subtrees RPAREN { Newick.Node ($2,"",None) }
-;
-label:
- | LABEL { ($1,None) }
- | LABEL COLON BRANCHLEN { ($1,Some $3) }
- | COLON BRANCHLEN { ("",Some $2) }
-;
-subtrees:
- | node COMMA subtrees { $1 :: $3 }
- | node { [$1] }
-;
-%%
diff --git a/lib/CamlPaml/P.ml b/lib/CamlPaml/P.ml
deleted file mode 100644
index bdc839d..0000000
--- a/lib/CamlPaml/P.ml
+++ /dev/null
@@ -1,18 +0,0 @@
-open Printf
-
-type matrix = Gsl.Matrix.matrix
-
-let validate ?(tol=1e-6) p =
- let (n,n') = Gsl.Matrix.dims p
-
- if n <> n' then invalid_arg "CamlPaml.P.validate: non-square matrix"
- if n < 2 then invalid_arg "CamlPaml.P.validate: trivial matrix"
-
- for i = 0 to n-1 do
- let pi = Gsl.Matrix.row p i
- let rowsum = ref 0.
- for j = 0 to n-1 do
- if pi.{j} < 0. || pi.{j} > 1. then invalid_arg (sprintf "CamlPaml.P.validate: P[%d,%d] = %f" i j pi.{j})
- rowsum := !rowsum +. pi.{j}
- if abs_float (!rowsum -. 1.) > tol then
- invalid_arg (sprintf "CamlPaml.P.validate: sum(P[%d,]) = %f != 1" i !rowsum)
diff --git a/lib/CamlPaml/P.mli b/lib/CamlPaml/P.mli
deleted file mode 100644
index 1081d80..0000000
--- a/lib/CamlPaml/P.mli
+++ /dev/null
@@ -1,7 +0,0 @@
-(** substitution probability matrices (P matrices) *)
-
-type matrix = (float, Bigarray.float64_elt, Bigarray.c_layout) Bigarray.Array2.t (** [Gsl.Matrix.matrix] *)
-
-(** validate that given array is a positive square matrix in which the rows sum to 1
-@raise Invalid_argument if not*)
-val validate : ?tol:float -> matrix -> unit
diff --git a/lib/CamlPaml/Parsimony.ml b/lib/CamlPaml/Parsimony.ml
deleted file mode 100644
index d7aa671..0000000
--- a/lib/CamlPaml/Parsimony.ml
+++ /dev/null
@@ -1,49 +0,0 @@
-open List
-let (|>) x f = f x
-
-module type S = sig
- type ty
- val infer : T.t -> ty array -> int*(ty array)
-
-module Make = functor (Ty : Set.OrderedType) -> struct
- type ty = Ty.t
- module TySet = Set.Make(Ty)
-
- let infer t lvs =
- let n = T.size t
- let nl = T.leaves t
- if (Array.length lvs) <> nl then
- invalid_arg "Parsimony.infer: wrong number of leaves in input"
- let sets = Array.make n TySet.empty
- let counts = Array.make n []
- let subs = ref 0
- for i = 0 to n-1 do
- if i < nl then
- sets.(i) <- TySet.singleton lvs.(i)
- counts.(i) <- [(lvs.(i),1)]
- else
- let lc, rc = T.children t i
- assert ((lc <> (-1)) && (rc <> (-1)))
- let inter = TySet.inter sets.(lc) sets.(rc)
- if (TySet.cardinal inter) = 0 then
- sets.(i) <- TySet.union sets.(lc) sets.(rc)
- incr subs
- else
- sets.(i) <- inter
- let cts =
- TySet.elements sets.(i) |> map
- fun x -> (x,(try assoc x counts.(lc) with Not_found -> 0) +
- (try assoc x counts.(rc) with Not_found -> 0))
- counts.(i) <- cts
- let inferred = Array.make n lvs.(0)
- for i = n-1 downto 0 do
- if i < nl then
- inferred.(i) <- lvs.(i)
- else
- if (i <> T.root t) && TySet.mem inferred.(T.parent t i) sets.(i) then
- inferred.(i) <- inferred.(T.parent t i)
- else
- (* assert ((i = T.root t) || (inferred.(T.parent t i) <> "")) *)
- (* TODO prefer synonymous subs? *)
- inferred.(i) <- fst (hd (sort (fun (_,ct1) (_,ct2) -> compare ct2 ct1) counts.(i)))
- !subs, inferred
diff --git a/lib/CamlPaml/Parsimony.mli b/lib/CamlPaml/Parsimony.mli
deleted file mode 100644
index 5c5dcb8..0000000
--- a/lib/CamlPaml/Parsimony.mli
+++ /dev/null
@@ -1,13 +0,0 @@
-(** inference of ancestral states based on the maximum parsimony heuristic *)
-
-(** output signature of Parsimony functor *)
-module type S = sig
- (** arbitrary user-defined character type. perhaps a nucleotide, or an amino acid*)
- type ty
-
- (** Infer ancestral states given the tree and the characters observed at the leaves. When several parsimonious assignments to an ancestral node are possible, the algorithm chooses the assignment matching a plurality of the leaves in the subtree under that node. If there is still a tie, then it is chosen according to the order of the character type.
- @return [n,states] where [n] is the minimum number of substitutions required to explain the observed leaves, and [states] is the inferred character at each node in the tree.
- *)
- val infer : T.t -> ty array -> int*(ty array)
-
-module Make : functor (Ty : Set.OrderedType) -> S with type ty = Ty.t
diff --git a/lib/CamlPaml/PhyloEM.ml b/lib/CamlPaml/PhyloEM.ml
deleted file mode 100644
index 081caaf..0000000
--- a/lib/CamlPaml/PhyloEM.ml
+++ /dev/null
@@ -1,182 +0,0 @@
-open List
-open Printf
-let (|>) x f = f x
-
-module PM = PhyloModel
-
-type sufficient_statistics = float array array array
-
-let new_sufficient_statistics m =
- let n = Q.Diag.dim (PM.q m 0)
- let t0 = PM.tree m
- Array.init (T.size t0 - 1) (fun _ -> Array.make_matrix n n 0.)
-
-let collect_sufficient_statistics ?workspace m leaves ss =
- let inter = PM.prepare_lik ?workspace m leaves
- let lik = PhyloLik.likelihood inter
- let t = PM.tree m
- for i = 0 to T.root t - 1 do
- PhyloLik.add_branch_posteriors inter i ss.(i)
- lik
-
-let clean_sufficient_statistics ?(tol=1e-6) ss =
- ss |> Array.iteri
- fun br ssbr ->
- ssbr |> Array.iteri
- fun a row ->
- row |> Array.iteri
- fun b ssab ->
- if ssab < tol then
- row.(b) <- 0.
-
-let branch_ell m ss br =
- let n = Q.Diag.dim (PM.q m 0)
- let tot = ref 0.
-
- let ssbr = ss.(br)
- let pbr = PM.p m br
-
- for k = 0 to n-1 do
- let pbrk = Gsl.Matrix.row pbr k
- let ssbrk = ssbr.(k)
- for l = 0 to n-1 do
- let ssbrkl = ssbrk.(l)
- if ssbrkl > 0. then
- tot := !tot +. ssbrkl *. log pbrk.{l}
-
- !tot
-
-let branches_ell m ss =
- let t = PM.tree m
- let nbr = T.size t - 1
- let tot = ref 0.
- for br = 0 to nbr-1 do
- tot := !tot +. branch_ell m ss br
- !tot
-
-let prior_ell m ss =
- let n = Q.Diag.dim (PM.q m 0)
- let tot = ref 0.
-
- let tree = PM.tree m
-
- let rp = PM.prior m
- let rlc,_ = T.children tree (T.root tree)
- for k = 0 to n-1 do
- let ss_root_k = Array.fold_left (+.) 0. ss.(rlc).(k)
- if ss_root_k > 0. then
- (* root sequence prior *)
- tot := !tot +. ss_root_k *. (log rp.(k))
- !tot
-
-
-let ell m ss = prior_ell m ss +. branches_ell m ss
-
-(* for consistency it would be nice to do this dbranch. only downside is computation of dQ_dxi would be repeated *)
-let d_ell_dQ_dxi inst ss i =
- let m = PM.P14n.model inst
- let p14n = PM.P14n.p14n inst
- let q_settings = PM.P14n.q_settings inst
-
- let tot = ref 0.
-
- let n = Q.Diag.dim (PM.q m 0)
- let tree = PM.tree m
- let nbr = T.size tree - 1
-
- let previous = ref []
-
- for br = 0 to nbr-1 do
- let any = ref false
- let dQ_dxi =
- try
- let access ar i = if Array.length ar = 1 then ar.(0) else ar.(i)
- let (_,_,last_dQ_dxi,last_any) =
- find
- function
- | (last_q_p14n,last_scale_p14n,last_dQ_dxi,last_any) when last_q_p14n == (access p14n.PM.P14n.q_p14ns br) && last_scale_p14n == (access p14n.PM.P14n.q_scale_p14ns br) -> true
- | _ -> false
- !previous
- any := last_any
- last_dQ_dxi
- with
- | Not_found ->
- let scale = Expr.eval p14n.PM.P14n.q_scale_p14ns.(br) q_settings
- let scale2 = scale *. scale
- let dscale_dxi = Expr.eval (Expr.deriv p14n.PM.P14n.q_scale_p14ns.(br) i) q_settings
- let dQ_dxi =
- p14n.PM.P14n.q_p14ns.(br) |> Array.map
- Array.map
- fun expr ->
- let qij = Expr.eval expr q_settings
- let dqij_dxi = Expr.eval (Expr.deriv expr i) q_settings
- (* Doing the quotient rule numerically. We could do it all symbolically
- with Expr.deriv, but then we'd be recomputing scale & dscale for
- each entry, and those often depend on all the entries in the matrix! *)
- let rslt = (dqij_dxi *. scale -. qij *. dscale_dxi) /. scale2
- if rslt <> 0. then any := true
- rslt
- previous := (p14n.PM.P14n.q_p14ns.(br),p14n.PM.P14n.q_scale_p14ns.(br),dQ_dxi,!any) :: !previous
- dQ_dxi
- if !any then
- let ssbr = ss.(br)
- let t = T.branch tree br
- let dPt_dxi = Q.Diag.dPt_dQ_dx ~q:(PM.q m br) ~t:t ~dQ_dx:dQ_dxi
- let p = PM.p m br
-
- for a = 0 to n-1 do
- let ssbra = ssbr.(a)
- let dPt_dxi_a = dPt_dxi.(a)
- let pa = Gsl.Matrix.row p a
- for b = 0 to n-1 do
- let ssbrab = ssbra.(b)
- if ssbrab > 0. then
- tot := !tot +. ssbrab *. dPt_dxi_a.(b) /. pa.{b}
- !tot
-
-let d_ell_dQ_dx inst ss =
- Array.init (Array.length (PM.P14n.p14n inst).PM.P14n.q_domains) (d_ell_dQ_dxi inst ss)
-
-let d_ell_dbranch inst br ss =
- let m = PM.P14n.model inst
- let p14n = PM.P14n.p14n inst
- let tree_settings = PM.P14n.tree_settings inst
- let np = Array.length (PM.P14n.p14n inst).PM.P14n.tree_domains
-
- (* precompute d(ELL)/dt *)
- let tree_dELL_dt =
- let n = Q.Diag.dim (PM.q m 0)
- let tree = PM.tree m
- let q = PM.q m br
-
- let dPt_dt = Q.Diag.dPt_dt ~q:q ~t:(T.branch tree br)
- let p = PM.p m br
- let tot = ref 0.
- let ssbr = ss.(br)
- for a = 0 to n-1 do
- let ssbra = ssbr.(a)
- let dPt_dt_a = dPt_dt.(a)
- let pa = Gsl.Matrix.row p a
- for b = 0 to n-1 do
- let ssbrab = ssbra.(b)
- if ssbrab > 0. then
- tot := !tot +. ssbra.(b) *. dPt_dt_a.(b) /. pa.{b}
- !tot
-
- Array.init np
- fun i ->
- (* dt/dx on this branch*)
- let dt_dxi = Expr.eval (Expr.deriv p14n.PM.P14n.tree_p14n.(br) i) tree_settings
- (* d(ELL)/dx = d(ELL)/dt dt/dx *)
- tree_dELL_dt *. dt_dxi
-
-let d_ell_dtree inst ss =
- let nbr = T.size (PM.P14n.p14n inst).PM.P14n.tree_shape - 1
- let np = Array.length (PM.P14n.p14n inst).PM.P14n.tree_domains
-
- let rslt = Array.make np 0.
- for br = 0 to nbr-1 do
- let rsltbr = d_ell_dbranch inst br ss
- for i = 0 to np-1 do
- rslt.(i) <- rslt.(i) +. rsltbr.(i)
- rslt
diff --git a/lib/CamlPaml/PhyloEM.mli b/lib/CamlPaml/PhyloEM.mli
deleted file mode 100644
index f343d76..0000000
--- a/lib/CamlPaml/PhyloEM.mli
+++ /dev/null
@@ -1,50 +0,0 @@
-(** supporting functions for estimating the parameters of phylogenetic models by
-expectation-maximization (EM) *)
-
-(** {1 E-step} *)
-
-(** sufficient statistics for the E-step, composed of estimates of how many times each
-character-character substitution occurred on each branch of the tree (summed over all sites) *)
-type sufficient_statistics = float array array array
-
-val new_sufficient_statistics : PhyloModel.t -> sufficient_statistics
-
-(** compute the E-step statistics for one site, given the leaves (as would be given to
-{{:PhyloModel}PhyloModel.prepare_lik}). Update the given [sufficient_statistics] and return the
-probability of the leaves under the model. This should be called for each site to collect the
-statistics for the whole alignment. *)
-val collect_sufficient_statistics : ?workspace:PhyloLik.workspace -> PhyloModel.t -> PhyloLik.leaf array -> sufficient_statistics -> float
-
-(** any entry in the sufficient statistics less than [tol] is set to zero. useful if e.g. planning
-to compress the sufficient statistics for transport between compute nodes *)
-val clean_sufficient_statistics : ?tol:float -> sufficient_statistics -> unit
-
-(** {1 M-step} *)
-
-(** expected log-likelihood of the model, where the expectation is over the soft assignment of the
-ancestral characters represented by the sufficient statistics of the E-step. (objective function of
-the M-step, sometimes called the Q function) *)
-val ell : PhyloModel.t -> sufficient_statistics -> float
-
-(** compute the portion of the ell arising from the prior over the ancestral sequence *)
-val prior_ell : PhyloModel.t -> sufficient_statistics -> float
-
-(** compute the portion of the ell arising from the substitution process *)
-val branches_ell : PhyloModel.t -> sufficient_statistics -> float
-
-(** compute the portion of the ell arising from the substitutions on a specific branch*)
-val branch_ell : PhyloModel.t -> sufficient_statistics -> int -> float
-
-(** compute the gradient of the ell with respect to the variables in the model's rate matrix p14n,
-based on their symbolic expressions *)
-val d_ell_dQ_dx : PhyloModel.P14n.instance -> sufficient_statistics -> float array
-
-(** compute the partial derivative with respect to one specific rate matrix variable only *)
-val d_ell_dQ_dxi : PhyloModel.P14n.instance -> sufficient_statistics -> int -> float
-
-(** compute the gradient with respect to the variables in the model's p14n for branch lengths, based
-on their symbolic expressions*)
-val d_ell_dtree : PhyloModel.P14n.instance -> sufficient_statistics -> float array
-
-(** compute the derivative with respect to one specific branch length variable only *)
-val d_ell_dbranch : PhyloModel.P14n.instance -> int -> sufficient_statistics -> float array
diff --git a/lib/CamlPaml/PhyloLik.ml b/lib/CamlPaml/PhyloLik.ml
deleted file mode 100644
index b1c12e1..0000000
--- a/lib/CamlPaml/PhyloLik.ml
+++ /dev/null
@@ -1,181 +0,0 @@
-open List
-open Printf
-
-module Int = struct
- type t = int
- let compare = compare
-module IntSet = Set.Make(Int)
-
-type leaf = [`Certain of int | `Distribution of float array | `Marginalize]
-
-let raw_leaf (k,i) = Gsl.Vector.of_array (Array.init k (fun j -> if i = j then 1. else 0.))
-let raw_marg k = Gsl.Vector.of_array (Array.make k 1.)
-let hashcons_raw_leaf = Tools.weakly_memoize raw_leaf
-let hashcons_raw_marg = Tools.weakly_memoize raw_marg
-
-let get_leaf k leaf = match leaf with
- | `Certain i -> hashcons_raw_leaf (k,i)
- | `Distribution ar -> Gsl.Vector.of_array ar
- | `Marginalize -> hashcons_raw_marg k
-
-type workspace = {
- mutable generation : int;
- data : Gsl.Matrix.matrix
-}
-
-type intermediate = {
- tree : T.t;
- pms : Gsl.Matrix.matrix array;
- leaves : leaf array;
-
- workspace : workspace;
- my_generation : int;
-
- alpha : Gsl.Matrix.matrix; (** actually a sub-matrix of workspace.data *)
- mutable z : float;
- mutable have_alpha : bool;
- beta : Gsl.Matrix.matrix; (** actually a sub-matrix of workspace.data *)
- mutable have_beta : bool;
-}
-
-let new_workspace tree dim =
- let rows = 2 * (T.size tree) - (T.leaves tree)
- { generation = min_int; data = Gsl.Matrix.create rows dim }
-
-let empty = [||]
-let prepare ?workspace tree pms prior leaves =
- let k = Array.length prior
- let n = T.size tree
- let nl = T.leaves tree
-
- if nl <> Array.length leaves then invalid_arg "CamlPaml.Infer.prepare: length(leaves) != leaves(t)"
- if Array.length pms < n-1 then invalid_arg "CamlPaml.Infer.prepare: not enough P matrices"
-
- let workspace = match workspace with Some x -> x | None -> new_workspace tree k
- workspace.generation <- (if workspace.generation = max_int then min_int else workspace.generation+1)
-
- let rows,cols = Gsl.Matrix.dims workspace.data
- if rows < (2*n-nl) || cols <> k then invalid_arg "CamlPaml.Infer.prepare: inappropriate workspace dimensions"
- let alpha = Bigarray.Array2.sub_left workspace.data 0 (n-nl)
- let beta = Bigarray.Array2.sub_left workspace.data (n-nl) n
-
- for a = 0 to k-1 do beta.{n-1,a} <- prior.(a)
-
- { tree = tree; pms = pms; leaves = leaves; workspace = workspace; my_generation = workspace.generation;
- alpha = alpha; z = nan; have_alpha = false; beta = beta; have_beta = false }
-
-(* Inside algo (aka Felsenstein algo.) *)
-let alpha_get x br =
- let k = snd (Gsl.Matrix.dims x.alpha)
- let nl = T.leaves x.tree
- if br < nl then get_leaf k x.leaves.(br) else Gsl.Matrix.row x.alpha (br-nl)
-
-let ensure_alpha x =
- if not x.have_alpha then
- let n = T.size x.tree
- let nl = T.leaves x.tree
- let k = snd (Gsl.Matrix.dims x.alpha)
- for i = nl to n-1 do
- let (lc,rc) = T.children x.tree i
- assert (lc >= 0 && rc >= 0)
- assert (lc < i && rc < i)
- let ls = x.pms.(lc)
- let rs = x.pms.(rc)
- let alc = alpha_get x lc
- let arc = alpha_get x rc
-
- for a = 0 to k-1 do
- let lsa = Gsl.Matrix.row ls a
- let rsa = Gsl.Matrix.row rs a
- x.alpha.{i-nl,a} <- (Gsl.Blas.dot lsa alc) *. (Gsl.Blas.dot rsa arc)
-
- x.z <- Gsl.Blas.dot (alpha_get x (n-1)) (Gsl.Matrix.row x.beta (n-1))
- x.have_alpha <- true
-
-(* Outside algo *)
-let ensure_beta x =
- ensure_alpha x
- if not x.have_beta then
- let k = snd (Gsl.Matrix.dims x.beta)
- let inter = Gsl.Vector.create k
- let ps_colb = Gsl.Vector.create k
- for i = (T.root x.tree)-1 downto 0 do
- let p = T.parent x.tree i
- assert (p > i)
- let s = T.sibling x.tree i
- let ps = x.pms.(i)
- let ss = x.pms.(s)
- let bp = Gsl.Matrix.row x.beta p
- let xas = alpha_get x s
-
- for a = 0 to k-1 do
- inter.{a} <- bp.{a} *. (Gsl.Blas.dot (Gsl.Matrix.row ss a) xas)
-
- for b = 0 to k-1 do
- for a = 0 to k-1 do
- (* idea: instead of this loop it'd probably be a little faster
- to transpose ps *)
- Bigarray.Array1.unsafe_set ps_colb a (Bigarray.Array2.unsafe_get ps a b)
- x.beta.{i,b} <- Gsl.Blas.dot inter ps_colb
- x.have_beta <- true
-
-let likelihood x =
- if x.workspace.generation <> x.my_generation then failwith "CamlPaml.PhyloLik.likelihood: invalidated workspace"
- ensure_alpha x
- x.z
-
-let node_posterior inferred i =
- if inferred.workspace.generation <> inferred.my_generation then failwith "CamlPaml.PhyloLik.node_posterior: invalidated workspace"
- ensure_alpha inferred
- let k = snd (Gsl.Matrix.dims inferred.alpha)
- if inferred.z = 0. then (* the data were impossible by the model *)
- Array.make k 0.
- else if i < T.leaves inferred.tree then (* leaf: usually certain *)
- Gsl.Vector.to_array (alpha_get inferred i)
- else
- (* calculate the betas (except for the root, whose betas get prefilled in prepare) *)
- if i <> T.root inferred.tree then ensure_beta inferred
- Array.init k (fun x -> (alpha_get inferred i).{x} *. inferred.beta.{i,x} /. inferred.z)
-
-let add_branch_posteriors ?(weight=1.0) inferred branch ecounts =
- if inferred.workspace.generation <> inferred.my_generation then failwith "CamlPaml.PhyloLik.add_branch_posterior: invalidated workspace"
- ensure_beta inferred
- let k = snd (Gsl.Matrix.dims inferred.alpha)
-
- if Array.length ecounts <> k then invalid_arg "CamlPaml.Infer.add_branch_posteriors: wrong matrix dimension"
- if branch < 0 || branch >= (T.root inferred.tree) then invalid_arg "CamlPaml.Infer.add_branch_posteriors: invalid branch"
-
- let z = inferred.z
- if z > 0. then
- let tree = inferred.tree
- let sm = inferred.pms.(branch)
- let p = T.parent tree branch
- let sib = T.sibling tree branch
-
- let bp = Gsl.Matrix.row inferred.beta p
- let ab = alpha_get inferred branch
-
- let xas = alpha_get inferred sib
- let sms = inferred.pms.(sib)
-
- for a = 0 to k-1 do
- let bpa = bp.{a}
- if bpa > 0. then
- let sma = Gsl.Matrix.row sm a
- let smsa = Gsl.Matrix.row sms a
-
- let bpa_sibtot = bpa *. (Gsl.Blas.dot smsa xas)
-
- let ecountsa = ecounts.(a)
- if Array.length ecountsa <> k then invalid_arg "CamlPaml.Infer.add_branch_posteriors: wrong matrix dimension"
-
- for b = 0 to k-1 do
- let pr = bpa_sibtot *. sma.{b} *. ab.{b} /. z
- ecountsa.(b) <- ecountsa.(b) +. weight *. pr
-
-let branch_posteriors inferred branch =
- let k = snd (Gsl.Matrix.dims inferred.alpha)
- let a = Array.make_matrix k k 0.
- add_branch_posteriors inferred branch a
- a
-
diff --git a/lib/CamlPaml/PhyloLik.mli b/lib/CamlPaml/PhyloLik.mli
deleted file mode 100644
index 88e62a5..0000000
--- a/lib/CamlPaml/PhyloLik.mli
+++ /dev/null
@@ -1,35 +0,0 @@
-(** core phylogenetic likelihood calculations
-
-These should usually be accessed through the higher-level {{:PhyloModel}[PhyloModel]} abstractions. *)
-
-(** Specifying a leaf (extant) character. Usually the extant character is known with certainty; in this case, use [`Certain] with the index of the character, e.g. [`Certain (Code.Codon61.index ('A','T','G'))]. Alternatively, you can specify an arbitrary probability distribution over extant characters. Lastly, you can specify to marginalize a leaf out of the likelihood calculations entirely. *)
-type leaf = [`Certain of int | `Distribution of float array | `Marginalize]
-
-type workspace
-
-(** The calculations use a workspace of [((2 * T.size tree - T.leaves tree) * k)] [float]s where [k] is the alphabet size. As a performance optimization, you can create a workspace with [new_workspace tree k] and use it across multiple calls to [prepare]; otherwise, it will allocate automatically. *)
-val new_workspace : T.t -> int -> workspace
-
-type intermediate
-
-(** [prepare tree p_matrices root_prior leaves] initializes the likelihood calculations, given:
-- [tree] the phylogenetic tree
-- [p_matrices.(i)] is the substitution matrix for the branch leading {e to} node [i] {e from} its parent.
-- [root_prior] the prior probability distribution over characters at the root.
-- [leaves] is an array of [leaf]s (see above), the appropriate number for the tree
-- [workspace] is an appropriately sized workspace; one will be allocated if not given.
-@return an abstract value from which various information about ancestral states can be extracted (see below). The time-consuming calculations are not actually performed until needed. If using a shared workspace, be sure to get all the results you need before the next call to [prepare].
-*)
-val prepare : ?workspace:workspace -> T.t -> P.matrix array -> float array -> leaf array -> intermediate
-
-(** calculate the probability of the leaves under the substitution model *)
-val likelihood : intermediate -> float
-
-(** compute the posterior probability distribution over characters at the specified node. *)
-val node_posterior : intermediate -> int -> float array
-
-(** [branch_posteriors intermediate k] computes the posterior probability of each possible substitution on the specified branch [k]. That is, entry [(i,j)] of the returned matrix is [P(parent(k) = i && k = j | Leaves)] *)
-val branch_posteriors : intermediate -> int -> float array array
-
-(** add branch posteriors to the appropriate entries in the given matrix. (useful for summing over many sites) *)
-val add_branch_posteriors : ?weight:float -> intermediate -> int -> float array array -> unit
diff --git a/lib/CamlPaml/PhyloModel.ml b/lib/CamlPaml/PhyloModel.ml
deleted file mode 100644
index 30f3e55..0000000
--- a/lib/CamlPaml/PhyloModel.ml
+++ /dev/null
@@ -1,156 +0,0 @@
-open List
-open Printf
-let (|>) x f = f x
-
-type t = {
- tree : T.t;
- qms : Q.Diag.t array;
- pms : P.matrix array;
- prior : float array option
-}
-
-let make ?prior t qms =
- let qms = if Array.length qms = 1 then Array.make (T.size t - 1) qms.(0) else Array.copy qms
- if Array.length qms <> T.size t - 1 then invalid_arg "CamlPaml.PhyloModel.make"
- for i = 0 to T.root t - 1 do
- if Q.Diag.dim qms.(i) <> Q.Diag.dim qms.(0) || T.branch t i < 0. then invalid_arg "CamlPaml.PhyloModel.make"
- let pms = Array.init (T.size t - 1) (fun br -> Q.Diag.to_Pt qms.(br) (T.branch t br))
- let prior = match prior with
- | Some pr ->
- if Array.length pr <> Q.Diag.dim qms.(0) then invalid_arg "CamlPaml.PhyloModel.make"
- Some (Array.copy pr)
- | None ->
- if not (Q.Diag.reversible qms.(snd (T.children t (T.root t)))) then invalid_arg "CamlPaml.PhyloModel.make"
- None
- { tree = T.copy t; qms; pms; prior }
-
-let tree { tree } = T.copy tree
-let q { qms } br = qms.(br)
-let p { pms } br = pms.(br) (* Array.map Array.copy pms.(br) *)
-let prior { tree; qms; prior } = match prior with
- | Some pr -> Array.copy pr
- | None -> Q.Diag.equilibrium qms.(snd (T.children tree (T.root tree))) (* q was verified reversible in [make], above*)
-
-let prepare_lik ?workspace m leaves = PhyloLik.prepare ?workspace m.tree m.pms (prior m) leaves
-
-let checksum = 1., 1e-6
-
-let simulate m =
- let branch_choosers = m.pms |> Array.map (fun pm -> (Array.map (Tools.random_chooser ~checksum:checksum) (Gsl.Matrix.to_arrays pm)))
- let root_chooser = Tools.random_chooser ~checksum:checksum (prior m)
- fun ?root ?a () ->
- let t = m.tree
- let a = match a with
- | Some a -> a
- | None -> Array.make (T.size t) (-1)
-
- a.(T.root t) <- (match root with
- | None -> root_chooser ()
- | Some ch when ch >= 0 && ch < Q.Diag.dim m.qms.(0) -> ch
- | _ -> invalid_arg "CamlPaml.PhyloModel.simulate (root)")
- for i = T.root t - 1 downto 0 do
- let p = a.(T.parent t i)
- a.(i) <- branch_choosers.(i).(p) ()
- a
-
-module P14n = struct
- type q_p14n = Expr.t array array
-
- type model_p14n = {
- q_p14ns : q_p14n array;
- q_scale_p14ns : Expr.t array;
- q_domains : Fit.domain array;
-
- tree_shape : T.t;
- tree_p14n : Expr.t array;
- tree_domains : Fit.domain array
- }
-
- type instance = {
- model : t;
- p14n : model_p14n;
- q_settings : float array;
- tree_settings : float array
- }
-
- let fill_q_diagonal q =
- let n = Array.length q
- for i = 0 to n-1 do
- if Array.length q.(i) <> n then invalid_arg "CamlPaml.PhyloModel.P14n.fill_q_diagonal"
- let tot = ref (Expr.Val 0.)
- for j = 0 to n-1 do
- if i <> j then
- tot := Expr.Add (q.(i).(j), !tot)
- q.(i).(i) <- Expr.simplify (Expr.Sub (Expr.Val 0., !tot))
-
- let instantiate_tree shape exprs domains settings =
- Array.iteri (fun i domain -> if not (Fit.check_domain domain settings.(i)) then invalid_arg ("CamlPaml.P14n.instantiate_tree: domain violation on variable " ^ (string_of_int i))) domains
-
- let tree = T.copy shape
- for br = 0 to T.root tree - 1 do
- T.put_branch tree br (Expr.eval exprs.(br) settings)
- tree
-
- let instantiate_q exprs scale_expr domains settings =
- Array.iteri (fun i domain -> if not (Fit.check_domain domain settings.(i)) then invalid_arg ("CamlPaml.P14n.instantiate_q: domain violation on variable " ^ (string_of_int i))) domains
-
- let scale = Expr.eval scale_expr settings
-
- if scale <= 0. then
- failwith "CamlPaml.P14n.instantiate_q: Q scale evaluated to a non-positive value"
-
- let qm = exprs |> Array.map (Array.map (fun expr -> Expr.eval expr settings /. scale))
-
- let q = Q.Diag.of_Q qm
-
- q
-
- let instantiate_qs p14ns scale_p14ns domains settings =
- if Array.length p14ns <> Array.length scale_p14ns then invalid_arg ("CamlPaml.P14n.instantiate: different numbers of rate matrix and scale p14ns")
- let previous = ref [] (* memoized results from previous branches...I'm assuming the number of independent rate matrix parameterizations to be sublinear in the size of the tree, otherwise this memoization is quadratic... *)
- Array.init (Array.length p14ns)
- fun br ->
- try
- let (_,_,q) =
- find
- function
- | (q_p14n,scale_p14n,q) when q_p14n == p14ns.(br) && scale_p14n == scale_p14ns.(br) -> true
- | _ -> false
- !previous
- q
- with
- | Not_found ->
- let q = instantiate_q p14ns.(br) scale_p14ns.(br) domains settings
- previous := (p14ns.(br),scale_p14ns.(br),q) :: !previous
- q
-
- let instantiate ?prior p14n ~q_settings ~tree_settings =
- let qms = instantiate_qs p14n.q_p14ns p14n.q_scale_p14ns p14n.q_domains q_settings
- let tree = instantiate_tree p14n.tree_shape p14n.tree_p14n p14n.tree_domains tree_settings
- { model = make ?prior tree qms; p14n = p14n; q_settings = Array.copy q_settings; tree_settings = Array.copy tree_settings }
-
- let update ?prior ?q_settings ?tree_settings inst =
- let pms_changed = ref false
- let newq = match q_settings with
- | Some q_settings ->
- pms_changed := true
- instantiate_qs inst.p14n.q_p14ns inst.p14n.q_scale_p14ns inst.p14n.q_domains q_settings
- | None -> inst.model.qms
- let newtree = match tree_settings with
- | Some tree_settings ->
- pms_changed := true
- instantiate_tree inst.p14n.tree_shape inst.p14n.tree_p14n inst.p14n.tree_domains tree_settings
- | None -> inst.model.tree
- let model =
- if !pms_changed then make ?prior newtree newq
- else { inst.model with prior = prior }
- { inst with model = model;
- q_settings = (match q_settings with Some set -> Array.copy set | None -> inst.q_settings);
- tree_settings = (match tree_settings with Some set -> Array.copy set | None -> inst.tree_settings) }
-
- let model { model = model } = model
- let p14n { p14n = p14n } = p14n
- let q_settings { q_settings = q_settings } = Array.copy q_settings
- let tree_settings { tree_settings = tree_settings } = Array.copy tree_settings
-
-
diff --git a/lib/CamlPaml/PhyloModel.mli b/lib/CamlPaml/PhyloModel.mli
deleted file mode 100644
index 7c184a3..0000000
--- a/lib/CamlPaml/PhyloModel.mli
+++ /dev/null
@@ -1,88 +0,0 @@
-(** unified representation for statistical phylogenetic models, in which the substitution process is a continuous-time Markov process on the phylogeny *)
-
-(** {1 Fully parameterized models}
-
-A 'fully parameterized' model has all of its parameters (each entry of the rate matrix, all branch lengths, etc.) specified as [float]s.
-*)
-
-type t
-
-(** [make tree rate_matrices] creates a new model given the tree and rate matrices for each branch (except the branch leading to the root, i.e. [Array.length rate_matrices = T.size tree - 1]).
-
-For the common case of a homogeneous substitution process, there is just one {{:Q} Q matrix} shared throughout the tree. Each entry of [rate_matrices] can therefore just reference the same [Q.Diag.t] value, or, as a special case, you can pass an array of length 1. More generally, even when giving a full array, you would usually want fewer actual independent rate matrices.
-
-@param prior The prior distribution over characters at the root (common ancestor). Defaults to the equilibrium frequencies of [rate_matrices.(Array.length rate_matrices - 1)], the rate matrix on the branch leading to the right child of the root (raises [Invalid_argument] if it's not reversible) *)
-val make : ?prior:(float array) -> T.t -> Q.Diag.t array -> t
-
-val tree : t -> T.t
-val q : t -> int -> Q.Diag.t (** retrieve the {{:Q}Q matrix} for a specific branch *)
-val p : t -> int -> P.matrix (** retrieve the {{:P}P matrix} for a specific branch *)
-val prior : t -> float array
-
-(** Simulate evolution according to the model. First, a root character is chosen according to the prior. Then, character substitutions are performed down the tree from the root according to the substitution probabilities determined by the rate matrices and branch lengths.
-@param root (optional) a specific character to place at the root; chosen from the prior if not specified.
-@param a (optional) a preallocated array of length at least [T.size (tree model)], which will be overwritten and returned, to save memory allocation.
-@return the assignment of characters to each node in the tree, in the order of the tree nodes (leaves first)
-*)
-val simulate : t -> (?root:int -> ?a:(int array) -> unit -> int array)
-
-(** Prepare likelihood calculations for the given configuration of extant characters (leaves).
-
-@param workspace (optional) a preallocated workspace for {{:PhyloLik}PhyloLik.prepare}
-
-@return {{:PhyloLik}PhyloLik.intermediate} values, from which additional information can be extracted.
-*)
-val prepare_lik : ?workspace:PhyloLik.workspace -> t -> PhyloLik.leaf array -> PhyloLik.intermediate
-
-
-(** {1 Symbolic parameterizations}
-
-In symbolic parameterizations (p14ns), parameters are specified using symbolic variables.
-*)
-
-module P14n : sig
- type q_p14n = Expr.t array array (** a symbolic expression for each entry of the rate matrix *)
-
- (** p14n of a model *)
- type model_p14n = {
- q_p14ns : q_p14n array; (** the rate matrix parameterization for each branch of the tree. As with [make], the array can be length 1 to specify a homogeneous process (the same rate matrix on all branches). *)
- q_scale_p14ns : Expr.t array; (** a positive scale factor, by which each entry of each rate matrix is divided. Again, can be length 1 for homogeneous processes. *)
- q_domains : Fit.domain array; (** the domains of all the variables used in the rate matrix p14ns. For example, if [q_domains.(2) = Fit.Pos], then the domain of each occurrence of [(Expr.Var 2)] in the rate matrix p14ns is positive reals. *)
-
- tree_shape : T.t; (** the tree topology (branch length settings are ignored) *)
- tree_p14n : Expr.t array; (** a symbolic expression for each branch length ([tree_exprs.(i)] specifies the length of the branch leading to node [i] from its parent) *)
- tree_domains : Fit.domain array (** the domains of all the variables used in the branch length p14ns. Note, variables are NOT shared between rate matrix and tree p14ns. For example [(Expr.Var 3)] in [q_p14n] does not refer to the same variable as [(Expr.Var 3)] in [tree_p14n].*)
-
- }
-
- (** convenience function, sets each [Q.(i).(i)] to minus the sum of all [Q.(i).(j)] for [j <> i]. The resulting expression will have [O(n)] terms, so if you know a more compact way to compute this entry, it would be better to specify it explicitly.*)
- val fill_q_diagonal : q_p14n -> unit
-
- (** in an instance of a p14n we have settings for the variables, thus determining a fully parameterized model *)
- type instance
-
- (** instantiate the model by giving settings for all the variables in its p14n. If prior is not provided, it is determined as in [PhyloModel.make], above. *)
- val instantiate : ?prior:(float array) -> model_p14n -> q_settings:(float array) -> tree_settings:(float array) -> instance
-
- val model : instance -> t
- val p14n : instance -> model_p14n
- val q_settings : instance -> float array
- val tree_settings : instance -> float array
-
- (** return a copy of the instance with a subset of the settings replaced (possibly reusing computed information in the original instance that is not affected by the changed parameters)
-
- When [prior] is not provided, the prior distribution for the updated model
- is determined as follows. If the prior of the provided instance (or any of
- its 'ancestral' instances) had been explicitly set in [instantiate], the
- updated model will have the same previously set prior. If the provided
- instance's prior was instead determined based on rate matrix equilibrium
- frequencies (i.e. no prior was provided to [instantiate]), the new
- instance's prior will be determined based on the rate matrix equilibrium
- frequencies in the new model; thus, if [q_settings] changes as a result of
- the update, the prior may also change.
- *)
- val update : ?prior:(float array) -> ?q_settings:(float array) -> ?tree_settings:(float array) -> instance -> instance
-
-
-
-
diff --git a/lib/CamlPaml/Q.ml b/lib/CamlPaml/Q.ml
deleted file mode 100644
index b2c8f7e..0000000
--- a/lib/CamlPaml/Q.ml
+++ /dev/null
@@ -1,339 +0,0 @@
-open Printf
-
-type matrix = float array array
-
-let validate ?(tol=1e-6) q =
- let n = Array.length q
-
- if n < 2 then invalid_arg "CamlPaml.Q.validate: trivial matrix"
-
- Array.iteri
- fun i qi ->
- if Array.length qi <> n then invalid_arg "CamlPaml.Q.validate: non-square matrix"
- let rowsum = ref 0.
- for j = 0 to n-1 do
- if i <> j && qi.(j) < 0. then invalid_arg (sprintf "CamlPaml.Q.validate: Q[%d,%d] = %.2e < 0" i j qi.(j))
- rowsum := !rowsum +. qi.(j)
- if abs_float !rowsum > tol then invalid_arg (sprintf "CamlPaml.Q.validate: sum(Q[%d,]) = %.2e != 0" i !rowsum)
- q
-
-let check_real ?(tol=1e-6) ({ Complex.re = re; Complex.im = im } as z) = im = 0. || (abs_float im) *. 1000. < (Complex.norm z) || (abs_float re < tol && abs_float im < tol)
-
-let real_of_complex ?(tol=1e-6) z =
- if not (check_real ~tol:tol z) then
- failwith (sprintf "CamlPaml.Q.real_of_complex %g+%gi" z.Complex.re z.Complex.im)
- z.Complex.re
-
-let m_of_cm cm = Gsl.Matrix.of_arrays (Array.map (Array.map real_of_complex) (Gsl.Matrix_complex.to_arrays cm))
-
-let cm_of_m m = Gsl.Matrix_complex.of_arrays (Array.map (Array.map (fun re -> { Complex.re = re; im = 0. })) (Gsl.Matrix.to_arrays m))
-
-let v_of_cv cv = Gsl.Vector.of_array (Array.map real_of_complex (Gsl.Vector_complex.to_array cv))
-
-let gemm ?c a b =
- let m,n = Gsl.Matrix.dims a
- let n',p = Gsl.Matrix.dims b
- if n <> n' then invalid_arg "CamlPaml.Q.gemm: incompatible dimensions"
- let c = match c with
- | Some c -> c
- | None -> Gsl.Matrix.create m p
- Gsl.Blas.gemm ~ta:Gsl.Blas.NoTrans ~tb:Gsl.Blas.NoTrans ~alpha:1. ~a:a ~b:b ~beta:0. ~c:c
- c
-
-let zgemm ?c a b =
- let m,n = Gsl.Matrix_complex.dims a
- let n',p = Gsl.Matrix_complex.dims b
- if n <> n' then invalid_arg "CamlPaml.Q.zgemm: incompatible dimensions"
- let c = match c with
- | Some c -> c
- | None -> Gsl.Matrix_complex.create m p
- Gsl.Blas.Complex.gemm ~ta:Gsl.Blas.NoTrans ~tb:Gsl.Blas.NoTrans ~alpha:Complex.one ~a:a ~b:b ~beta:Complex.zero ~c:c
- c
-
-let diagm ?c d a =
- let m = Gsl.Vector.length d
- let (n,p) = Gsl.Matrix.dims a
- if m <> n then invalid_arg "CamlPaml.Q.diagm: incompatible dimensions"
- let c = match c with
- | Some c -> c
- | None -> Gsl.Matrix.create m p
-
- for i = 0 to m-1 do
- let d_i = d.{i}
- for j = 0 to p-1 do
- Bigarray.Array2.unsafe_set c i j (Bigarray.Array2.unsafe_get a i j *. d_i)
-
- c
-
-let zdiagm ?c d a =
- let m = Gsl.Vector_complex.length d
- let (n,p) = Gsl.Matrix_complex.dims a
- if m <> n then invalid_arg "CamlPaml.Q.diagm: incompatible dimensions"
- let c = match c with
- | Some c -> c
- | None -> Gsl.Matrix_complex.create m p
-
- for i = 0 to m-1 do
- let d_i = d.{i}
- for j = 0 to p-1 do
- Bigarray.Array2.unsafe_set c i j (Complex.mul (Bigarray.Array2.unsafe_get a i j) d_i)
-
- c
-
-let zinvm m =
- let n,n' = Gsl.Matrix_complex.dims m
- if n <> n' then invalid_arg "CamlPaml.Q.zinvm: non-square matrix"
- let p = Gsl.Permut.make n
- let lu = Gsl.Vectmat.cmat_convert (`CM (Gsl.Matrix_complex.copy m))
- ignore (Gsl.Linalg.complex_LU_decomp lu p)
- let m' = Gsl.Vectmat.cmat_convert (`CM (Gsl.Matrix_complex.create n n))
- Gsl.Linalg.complex_LU_invert lu p m'
- match m' with
- | `CM x -> x
- | _ -> assert false
-
-module Diag = struct
- (* diagonalized Q = S*L*S'
- These are real for reversible models, complex for non-reversible models. *)
- type eig_r = {
- r_s : Gsl.Matrix.matrix; (* S = right eigenvectors (in the columns) *)
- r_s' : Gsl.Matrix.matrix; (* S' = left eigenvectors (in the rows) *)
- r_l : Gsl.Vector.vector (* diag(L) = eigenvalues *)
- }
- type eig_nr = {
- nr_s : Gsl.Matrix_complex.matrix; (* S = right eigenvectors (in the columns) *)
- nr_s' : Gsl.Matrix_complex.matrix; (* S' = left eigenvectors (in the rows) *)
- nr_l : Gsl.Vector_complex.vector; (* diag(L) = eigenvalues *)
- }
- type t = {
- q : Gsl.Matrix.matrix; (* Q *)
- eig : [`r of eig_r | `nr of eig_nr];
- pi : Gsl.Vector.vector;
- mutable have_pi : bool;
-
- mutable memoized_to_Pt : (float -> Gsl.Matrix.matrix) option;
-
- mutable tol : float;
- }
-
- let dim q =
- let (n,n') = Gsl.Matrix.dims q.q
- assert (n = n')
- n
-
- let of_Q ?(tol=1e-6) ?(force_complex=false) qm =
- let qm = Gsl.Matrix.of_arrays qm
- let l, s = Gsl.Eigen.nonsymmv ~protect:true (`M qm)
- let s' = zinvm s
-
- let rev = ref true
- let n = Gsl.Vector_complex.length l
- for i = 0 to n-1 do if not (check_real ~tol l.{i}) then rev := false
-
- let eig =
- if !rev && not force_complex then
- `r { r_s = m_of_cm s; r_s' = m_of_cm s'; r_l = v_of_cv l }
- else
- `nr { nr_s = s; nr_s' = s'; nr_l = l }
-
- { q = qm; eig;
- pi = Gsl.Vector.create (fst (Gsl.Matrix.dims qm)); have_pi = false;
- memoized_to_Pt = None; tol = tol }
-
- let to_Q q = Gsl.Matrix.to_arrays q.q
-
- let reversible = function
- | { eig = `r _ } -> true
- | { eig = `nr { nr_l }; tol } ->
- let rev = ref true
- let n = Gsl.Vector_complex.length nr_l
- for i = 0 to n-1 do if not (check_real ~tol:tol nr_l.{i}) then rev := false
- !rev
-
- let equilibrium q =
- if not q.have_pi then
- let eig = match q.eig with
- | `r eig -> eig
- | `nr { nr_s; nr_s'; nr_l } when reversible q -> { r_s = m_of_cm nr_s; r_s' = m_of_cm nr_s'; r_l = v_of_cv nr_l }
- | _ -> failwith "CamlPaml.Q.equilibrium: non-reversible model"
- let n = Gsl.Vector.length eig.r_l
- let min_L = ref infinity
- let min_Lp = ref (-1)
- for i = 0 to n-1 do
- let mag_i = abs_float eig.r_l.{i}
- if mag_i < !min_L then
- min_L := mag_i
- min_Lp := i
- assert (!min_Lp >= 0)
- if (abs_float !min_L) > q.tol then
- failwith (sprintf "CamlPaml.Q.equilibrium: smallest-magnitude eigenvalue %e is unacceptably large; check rate matrix validity or increase tol" !min_L)
- let lev = Gsl.Matrix.row eig.r_s' !min_Lp
- let mass = ref 0.
- for i = 0 to n-1 do
- mass := !mass +. lev.{i}
- for i = 0 to n-1 do
- q.pi.{i} <- lev.{i} /. !mass
- q.have_pi <- true
- Gsl.Vector.to_array q.pi
-
- (** normalize to unity mean rate of replacement
- let normalize ?tol q =
- let n = Gsl.Vector_complex.length q.l
- let pi = equilibrium ?tol q
- let tot = ref 0.
- for i = 0 to n-1 do
- tot := !tot +. (-1.) *. pi.(i) *. q.q.{i,i}
- let nq = Gsl.Matrix.copy q.q
- Gsl.Matrix.scale q.q (1. /. !tot)
- let nl = Gsl.Vector_complex.copy q.l
- for i = 0 to n-1 do
- nl.{i} <- Complex.div nl.{i} { Complex.re = !tot; im = 0. }
- { q with q = nq; l = nl } *)
-
- let scale q x =
- if x <= 0. then invalid_arg "CamlPaml.Q.scale: nonpositive scale factor"
- let xq = Gsl.Matrix.copy q.q
- Gsl.Matrix.scale xq x
- let xeig = match q.eig with
- | `r { r_s; r_s'; r_l } ->
- let xl = Gsl.Vector.copy r_l
- for i = 0 to (Gsl.Vector.length xl) - 1 do
- xl.{i} <- xl.{i} *. x
- `r { r_s; r_s'; r_l = xl }
- | `nr { nr_s; nr_s'; nr_l } ->
- let xl = Gsl.Vector_complex.copy nr_l
- let cx = { Complex.re = x; im = 0. }
- for i = 0 to (Gsl.Vector_complex.length xl) - 1 do
- xl.{i} <- Complex.mul xl.{i} cx
- `nr { nr_s; nr_s'; nr_l = xl }
- { q with q = xq; eig = xeig; memoized_to_Pt = None }
-
- let real_to_Pt q t =
- if t < 0. then invalid_arg "CamlPaml.Q.to_Pt"
- let sm = match q.eig with
- | `r { r_s; r_s'; r_l } ->
- let expLt = Gsl.Vector.copy r_l
- for i = 0 to Gsl.Vector.length expLt - 1 do
- expLt.{i} <- exp (t *. expLt.{i})
- gemm r_s (diagm expLt r_s')
- | `nr { nr_s; nr_s'; nr_l } ->
- let ct = { Complex.re = t; im = 0. }
- let expLt = Gsl.Vector_complex.copy nr_l
- for i = 0 to Gsl.Vector_complex.length expLt - 1 do
- expLt.{i} <- Complex.exp (Complex.mul ct expLt.{i})
- m_of_cm (zgemm nr_s (zdiagm expLt nr_s'))
-
- let n,_ = Gsl.Matrix.dims sm
- for i = 0 to n-1 do
- let tot = ref 0.
- let smii = ref 1.
-
- for j = 0 to n-1 do
- tot := !tot +. sm.{i,j}
-
- if sm.{i,j} < 0. then
- if abs_float sm.{i,j} > q.tol then
- failwith (sprintf "CamlPaml.Q.substition_matrix: expm(%.2e*Q)[%d,%d] = %e < 0" t i j sm.{i,j})
- else
- sm.{i,j} <- 0.
-
- if i <> j then
- smii := !smii -. sm.{i,j}
-
- if abs_float (!tot -. 1.) > q.tol then
- failwith (sprintf "CamlPaml.Q.substitution matrix: sum(expm(%.2e*Q)[%d,] = %e > 1" t i !tot)
- assert (!smii <= 1. && !smii > 0.)
-
- sm.{i,i} <- !smii
-
- sm
-
- let rec to_Pt q t =
- match q.memoized_to_Pt with
- | Some f -> f t
- | None ->
- q.memoized_to_Pt <- Some (Tools.weakly_memoize (real_to_Pt q))
- to_Pt q t
-
- let to_Pt_gc q = q.memoized_to_Pt <- None
-
- let dPt_dt ~q ~t = match q.eig with
- | `r _ -> failwith "not implemented"
- | `nr { nr_s; nr_s'; nr_l } ->
- let n,_ = Gsl.Matrix.dims q.q
- let (( * ),(+),(/)) = Complex.mul, Complex.add, Complex.div
- let exp= Complex.exp
- let s, l, s' = nr_s, nr_l, nr_s'
- let ct = { Complex.re = t; Complex.im = 0. }
- Array.init n
- fun a ->
- Array.init n
- fun b ->
- let x = ref Complex.zero
- for c = 0 to n-1 do
- x := !x + (s.{a,c} * l.{c} * (exp (l.{c} * ct)) * s'.{c,b})
- real_of_complex !x
-
- (* TODO in richly parameterized models, dQ_dx is likely to be sparse. *)
- let dPt_dQ_dx ~q ~t ~dQ_dx = match q.eig with
- | `r _ -> failwith "not implemented"
- | `nr { nr_s; nr_s'; nr_l } ->
- let n,_ = Gsl.Matrix.dims q.q
- let dQt_dx = cm_of_m (Gsl.Matrix.of_arrays dQ_dx)
-
- if Gsl.Matrix_complex.dims dQt_dx <> Gsl.Matrix.dims q.q then
- invalid_arg "CamlPaml.Q.dP_dx: wrong dimension of dQ_dx"
-
- let ct = { Complex.re = t; Complex.im = 0. }
- let exp = Complex.exp
- let (( * ),(-),(/)) = Complex.mul, Complex.sub, Complex.div
-
- (* combos 1,3 or 2 (alone) -- 1,3 matches P&S? *)
- Gsl.Matrix_complex.scale dQt_dx ct (* 1 *)
-
- let f = Gsl.Matrix_complex.create n n
- for i = 0 to pred n do
- for j = 0 to pred n do
- if nr_l.{i} = nr_l.{j} then
- f.{i,j} <- exp (nr_l.{i} * ct) (* * ct *) (* 2 *)
- else
- f.{i,j} <- (exp (nr_l.{i} * ct) - exp (nr_l.{j} * ct)) / ((nr_l.{i} - nr_l.{j}) * ct (* 3 *))
-
- (* ehh not being too gentle with the allocator/GC here *)
- Gsl.Matrix_complex.mul_elements f (zgemm nr_s' (zgemm dQt_dx nr_s))
- Gsl.Matrix.to_arrays (m_of_cm (zgemm nr_s (zgemm f nr_s')))
-
-let logm (m:Gsl.Matrix.matrix) =
- let n,n' = Gsl.Matrix.dims m
- if n <> n' then invalid_arg "CamlPaml.Q.logm: non-square matrix"
- let l, s = Gsl.Eigen.nonsymmv ~protect:true (`M m)
- let s' = zinvm s
- for i = 0 to n-1 do
- l.{i} <- Complex.log l.{i}
-
- m_of_cm (zgemm s (zdiagm l s'))
-
-(* Correction of a square matrix with zero row-sums but potentially negative off-diagonal entries into a valid rate matrix. As suggested by Israel, Rosenthal & Wei (2001) *)
-let irw2001 rawq =
- let n,n' = Gsl.Matrix.dims rawq
- assert (n = n')
- for i = 0 to n-1 do
- let g_i = ref (abs_float rawq.{i,i})
- let b_i = ref 0.
- for j = 0 to n-1 do
- if i <> j then
- if rawq.{i,j} >= 0. then
- g_i := !g_i +. rawq.{i,j}
- else
- b_i := !b_i -. rawq.{i,j}
- for j = 0 to n-1 do
- let rawqij = rawq.{i,j}
- if i <> j && rawqij < 0. then
- rawq.{i,j} <- 0.
- else if !g_i > 0. then
- rawq.{i,j} <- rawqij -. !b_i *. (abs_float rawqij) /. !g_i
- rawq
-
-let of_P ?tol m =
- P.validate ?tol m
- Gsl.Matrix.to_arrays (irw2001 (logm m))
diff --git a/lib/CamlPaml/Q.mli b/lib/CamlPaml/Q.mli
deleted file mode 100644
index 4274228..0000000
--- a/lib/CamlPaml/Q.mli
+++ /dev/null
@@ -1,62 +0,0 @@
-(** rate matrices for continuous-time Markov models (Q matrices) *)
-
-type matrix = float array array
-
-(** validate that the given array is a square matrix in which all off-diagonal entries are
-nonnegative and rows sum to 0.
-@raise Invalid_argument if not
-*)
-
-val validate : ?tol:float -> matrix -> unit
-
-(** diagonalized representation of a rate matrix, from which various useful information can be
-extracted *)
-module Diag : sig
- type t
-
- (** Diagonalize the rate matrix. The rate matrix needs not be reversible (the internal
- representation can use complex arithmetic).
-
- @param force_complex force internal use of complex arithmetic, even if the rate matrix
- is reversible. *)
- val of_Q : ?tol:float -> ?force_complex:bool -> matrix -> t
- val to_Q : t -> matrix
-
- (** return [n] for an [n-by-n] matrix *)
- val dim : t -> int
-
- (** determine if the rate matrix is reversible (<=> the eigenvalues are real) *)
- val reversible : t -> bool
-
- (** for reversible matrices, compute the equilibrium frequencies. The behavior is undefined if
- the rate matrix is not reversible. *)
- val equilibrium : t -> float array
-
- (** multiply all the rates by a positive scale factor *)
- val scale : t -> float -> t
-
- (** compute the substitution matrix for running the Markov process for time [t] ([=exp(Qt)]).
- The implementation uses "weak memoization" to cache the results for specific values of [t],
- memory/GC allowing. *)
- val to_Pt : t -> float -> P.matrix
-
- (** compute the derivative of each entry of [exp(Qt)] with respect to [t]. *)
- val dPt_dt : q:t -> t:float -> float array array
-
- (** compute the derivative of each entry of [exp(Qt)] with respect to some parameter [x]
- @param dQ_dx the derivative of each entry of [Q] with respect to [x]
- *)
- val dPt_dQ_dx : q:t -> t:float -> dQ_dx:(float array array) -> float array array
-
- (** clear the cached values of P(t). This is a hack needed to marshal a [Q.Diag.t] (eliminates
- closures from the data structure) *)
- val to_Pt_gc : t -> unit
-
-(** Given a {{:P}P matrix} [P], compute a rate matrix [Q] such that [exp(Q)] is approximately equal
-to [P].
-
-This procedure first computes the matrix logarithm [log(P)], which may or may not be a valid rate
-matrix. The matrix log is then adjusted to ensure that a valid rate matrix [Q] results, using a
-method suggested by Israel, Rosenthal & Wei (2001). This is why [exp(Q)] is only {e approximately}
-equal to [P]. Note that, in any case, the resulting [Q] matrix is {e not} necessarily reversible. *)
-val of_P : ?tol:float -> P.matrix -> matrix
diff --git a/lib/CamlPaml/T.ml b/lib/CamlPaml/T.ml
deleted file mode 100644
index d17bf6c..0000000
--- a/lib/CamlPaml/T.ml
+++ /dev/null
@@ -1,128 +0,0 @@
-open List
-
-type t = {
- labels : string array;
- parents : int array;
- children : (int*int) array;
- siblings : int array;
- branches : float array
-}
-
-let infer_siblings parents children =
- let n = Array.length parents
- Array.init n
- fun i ->
- if i < (n-1) then
- let p = parents.(i)
- assert (p >= 0 && p < n)
- let (l,r) = children.(p)
- if l == i then
- r
- else if r == i then
- l
- else
- assert false
- else
- (-1)
-
-let copy t = { t with labels = Array.copy t.labels; branches = Array.copy t.branches }
-let size t = Array.length t.parents
-let root t = (size t)-1
-let leaves t = ((size t) + 1)/2
-let is_leaf t i = i >= 0 && i < leaves t
-let parent t i = if i < 0 || i >= root t then invalid_arg "CamlPaml.T.parent" else t.parents.(i)
-let children t i = if i < leaves t || i > root t then invalid_arg "CamlPaml.T.children" else t.children.(i)
-let sibling t i = if i < 0 || i >= root t then invalid_arg "CamlPaml.T.sibling" else t.siblings.(i)
-let branch t i = t.branches.(i)
-let put_branch t i b = t.branches.(i) <- b
-let label t i = t.labels.(i)
-let put_label t i tag = t.labels.(i) <- tag
-
-exception False
-let congruent ?(tol=1e-6) ~labels ~branches t1 t2 =
- if (size t1 <> size t2) then
- false
- else
- try
- for i = 0 to size t1 - 1 do
- if i < root t1 && parent t1 i <> parent t2 i then raise False
- assert (i = root t1 || sibling t1 i = sibling t2 i)
- assert (i < leaves t1 || children t1 i = children t2 i)
- if labels && label t1 i <> label t2 i then raise False
- if branches && abs_float (branch t1 i -. branch t2 i) > tol then raise False
- true
- with
- | False -> false
-
-let of_newick ?(default_branch=nan) nt =
- let bitch () = invalid_arg "CamlPaml.T.of_newick: input is not a rooted, bifurcating tree"
- let n = Newick.size nt
- if n < 3 || (n mod 2 = 0) then bitch ()
-
- let labels = Array.make n ""
- let parents = Array.make n (-1)
- let children = Array.make n (-1,-1)
- let branches = Array.make n default_branch
-
-
- let rec find_leaves = function
- | (Newick.Node ([],_,_)) as leaf -> [leaf]
- | Newick.Node (l :: r :: [],lbl,bl) -> find_leaves l @ find_leaves r
- | _ -> bitch ()
- let leaves = Array.of_list (find_leaves nt)
- let nl = Array.length leaves
- assert (nl = (n+1)/2)
-
- let which_leaf leaf =
- let j = ref 0
- try
- while not (leaves.(!j) == leaf) do
- incr j
- with
- | Invalid_argument _ -> assert false
- !j
-
- let fresh_i =
- let i = ref (nl-1)
- fun () ->
- incr i
- !i
-
- let rec fill = function
- | (Newick.Node ([],lbl,bl)) as leaf ->
- let i = which_leaf leaf
- labels.(i) <- lbl
- branches.(i) <- match bl with Some x -> x | None -> default_branch
- i
- | Newick.Node (l :: r :: [],lbl,bl) ->
- let lc = fill l
- let rc = fill r
- let i = fresh_i ()
- labels.(i) <- lbl
- branches.(i) <- match bl with Some x -> x | None -> default_branch
- parents.(lc) <- i
- parents.(rc) <- i
- children.(i) <- (lc,rc)
- i
- | _ -> bitch ()
-
- let root = fill nt
- assert (root = n-1)
-
- { labels = labels; parents = parents; branches = branches; children = children; siblings = infer_siblings parents children }
-
-let to_newick ?(branches=false) t =
- let branch i =
- if branches then
- match classify_float t.branches.(i) with
- | FP_infinite | FP_nan -> None
- | _ -> Some t.branches.(i)
- else
- None
- let rec cons i =
- if is_leaf t i then
- Newick.Node ([],t.labels.(i),branch i)
- else
- let l,r = t.children.(i)
- Newick.Node ([cons l; cons r],t.labels.(i),branch i)
- cons (root t)
diff --git a/lib/CamlPaml/T.mli b/lib/CamlPaml/T.mli
deleted file mode 100644
index f98f37e..0000000
--- a/lib/CamlPaml/T.mli
+++ /dev/null
@@ -1,40 +0,0 @@
-(** array-based representation of rooted bifurcating phylogenetic trees
-
-For a tree with [n] leaves, the [2n-1] nodes are indexed such that iterating [0] to [2n-2] performs a botom-up traversal of the tree; indices [0] through [n-1] are the leaves and index [2n-2] is the root. By iterating in order, when you visit node [i] you are guaranteed to have visited its children already. Conversely, by iterating in reverse order, when you visit a node, you have already visited its parent. The data structure can be imported from or exported to a rooted {{:Newick}Newick} tree.*)
-
-type t
-
-val copy : t -> t
-val size : t -> int (** total number of nodes in the tree (incl. internal nodes *)
-
-val leaves : t -> int (** number of leaves *)
-val is_leaf : t -> int -> bool (** is node [i] a leaf? (equivalent to [i < (leaves t)]) *)
-val root : t -> int (** index of the root ([= 2*(leaves t)-2 = (size t)-1])*)
-
-(** parent of the given node
-@raise Invalid_argument if the root is given *)
-val parent : t -> int -> int
-
-(** returns the "left" and "right" child of the internal node
-@raise Invalid_argument if the specified node is a leaf *)
-val children : t -> int -> int*int
-
-(** return the other child of the parent of the given node.
-@raise Invalid_argument if the root is given
-*)
-val sibling : t -> int -> int
-
-val branch : t -> int -> float (** branch length*)
-val put_branch : t -> int -> float -> unit
-
-val label : t -> int -> string
-val put_label : t -> int -> string -> unit
-
-(**
-@param branch_tol Greatest allowable difference between branch lengths. Default 0, and can be set to infinity to ignore branch lengths.
-*)
-val congruent : ?tol:float -> labels:bool -> branches:bool -> t -> t -> bool
-
-(** The conversion will only succeed for rooted, bifurcating Newick trees.*)
-val of_newick : ?default_branch:float -> Newick.t -> t
-val to_newick : ?branches:bool -> t -> Newick.t
diff --git a/lib/CamlPaml/Tools.ml b/lib/CamlPaml/Tools.ml
deleted file mode 100644
index 3177d80..0000000
--- a/lib/CamlPaml/Tools.ml
+++ /dev/null
@@ -1,42 +0,0 @@
-open Printf
-open List
-
-let weakly_memoize f =
- let tbl = Hashtbl.create 32
- fun x ->
- try
- match Weak.get (Hashtbl.find tbl x) 0 with
- | None ->
- Hashtbl.remove tbl x
- raise Not_found
- | Some y -> y
- with
- | Not_found ->
- let y = f x
- let box = Weak.create 1
- Weak.set box 0 (Some y)
- Hashtbl.replace tbl x box
- Gc.finalise (fun _ -> Hashtbl.remove tbl x) y
- y
-
-let random_chooser ?checksum weights =
- let n = Array.length weights
- let cum = Array.copy weights
- for i = 1 to n-1 do
- cum.(i) <- cum.(i-1) +. cum.(i)
- let z = cum.(n-1)
- match checksum with
- | Some (sum,tol) when abs_float (z -. sum) > tol -> invalid_arg (sprintf "random_chooser checksum |%f - %f| > %f" z sum tol)
- | _ -> ()
- (* binary search for i s.t. cum.(i-1) < x <= cum.(i) *)
- let rec bs x lo hi =
- assert (lo <= hi)
- let mid = (lo+hi)/2
- if x > cum.(mid) then
- bs x (mid+1) hi
- else if (mid = 0 || x > cum.(mid-1)) then
- mid
- else
- bs x lo (mid-1)
- fun () -> bs (Random.float z) 0 n
-
diff --git a/lib/CamlPaml/_tags b/lib/CamlPaml/_tags
deleted file mode 100644
index bd02507..0000000
--- a/lib/CamlPaml/_tags
+++ /dev/null
@@ -1,7 +0,0 @@
-<**/*.ml> or <**/*.mli>: ocaml, debug, package(gsl), pp(ocaml+twt)
-<**/NewickLexer.*>: -pp(ocaml+twt)
-<**/NewickParser.*>: -pp(ocaml+twt)
-<**/*.cmx>: for-pack(CamlPaml)
-: -for-pack(CamlPaml)
-: package(oUnit)
-: package(gsl), package(oUnit)
diff --git a/lib/CamlPaml/test.ml b/lib/CamlPaml/test.ml
deleted file mode 100644
index 69dcfc5..0000000
--- a/lib/CamlPaml/test.ml
+++ /dev/null
@@ -1,105 +0,0 @@
-open OUnit
-open Printf
-
-let fs = sprintf "%.4f"
-
-let assert_equal_vector ?msg ?epsilon = assert_equal ~cmp:(fun ar1 ar2 -> List.for_all (fun (x,y) -> cmp_float ?epsilon x y) (List.combine (Array.to_list ar1) (Array.to_list ar2))) ~printer:(fun ar -> String.concat " " (Array.to_list (Array.map fs ar))) ?msg
-
-module TestInfer = struct
- let nt = NewickParser.parse NewickLexer.token (Lexing.from_string "(A,(B,C))")
- let t = T.of_newick nt
-
- let sm0 = Gsl.Matrix.of_arrays [| [| 0.8; 0.2; |]; [| 0.25; 0.75 |] |]
- let sm1 = Gsl.Matrix.of_arrays [| [| 0.9; 0.1; |]; [| 0.85; 0.15 |] |]
- let sms = [| sm0; sm1; sm1; sm1 |]
- let prior = [| 0.6; 0.4 |]
-
- let ( + ) = ( +. )
- let ( * ) = ( *. )
- let ( / ) = ( /. )
-
- let case lvs () =
- let alf i = [| if lvs.(i) = 0 then 1. else 0.; if lvs.(i) = 1 then 1. else 0. |]
- let a0 = alf 0
- let a1 = alf 1
- let a2 = alf 2
- let a3 = [| (sm1.{0,0} * a1.(0) + sm1.{0,1} * a1.(1)) * (sm1.{0,0} * a2.(0) + sm1.{0,1} * a2.(1));
- (sm1.{1,0} * a1.(0) + sm1.{1,1} * a1.(1)) * (sm1.{1,0} * a2.(0) + sm1.{1,1} * a2.(1)) |]
- let a4 = [| (sm0.{0,0} * a0.(0) + sm0.{0,1} * a0.(1)) * (sm1.{0,0} * a3.(0) + sm1.{0,1} * a3.(1));
- (sm0.{1,0} * a0.(0) + sm0.{1,1} * a0.(1)) * (sm1.{1,0} * a3.(0) + sm1.{1,1} * a3.(1)) |]
- let z = prior.(0) * a4.(0) + prior.(1) * a4.(1)
-
- let inter = PhyloLik.prepare t sms prior (Array.map (fun x -> `Certain x) lvs)
- assert_equal ~cmp:(cmp_float ~epsilon:0.001) ~printer:fs ~msg:"likelihood" z (PhyloLik.likelihood inter)
-
- let b4 = prior
- let b3 = [| (b4.(0) * sm0.{0,0} * a0.(0) + b4.(0) * sm0.{0,1} * a0.(1)) * sm1.{0,0} +
- (b4.(1) * sm0.{1,0} * a0.(0) + b4.(1) * sm0.{1,1} * a0.(1)) * sm1.{1,0};
- (b4.(0) * sm0.{0,0} * a0.(0) + b4.(0) * sm0.{0,1} * a0.(1)) * sm1.{0,1} +
- (b4.(1) * sm0.{1,0} * a0.(0) + b4.(1) * sm0.{1,1} * a0.(1)) * sm1.{1,1}
- |]
-
- assert_equal_vector ~msg:"posterior(root)" ~epsilon:0.001 [| b4.(0) * a4.(0) / z; b4.(1) * a4.(1) / z |] (PhyloLik.node_posterior inter 4)
- assert_equal_vector ~msg:"posterior(internal)" ~epsilon:0.001 [| b3.(0) * a3.(0) / z; b3.(1) * a3.(1) / z |] (PhyloLik.node_posterior inter 3)
-
-
- let tests = "PhyloLik" >::: [ "000" >:: case [| 0; 0; 0 |];
- "001" >:: case [| 0; 0; 1 |];
- "010" >:: case [| 0; 1; 0 |];
- "011" >:: case [| 0; 1; 1 |];
- "100" >:: case [| 1; 0; 0 |];
- "101" >:: case [| 1; 0; 1 |];
- "110" >:: case [| 1; 1; 0 |];
- "111" >:: case [| 1; 1; 1 |];
- ]
-
-module BeagleTests = struct
- (* ports of examples found in the BEAGLE source: http://code.google.com/p/beagle-lib/source/browse/ *)
-
- module TinyTest = struct
- let human = "AGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGGAGCTTAAACCCCCTTATTTCTACTAGGACTATGAGAATCGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTATACCCTTCCCGTACTAAGAAATTTAGGTTAAATACAGACCAAGAGCCTTCAAAGCCCTCAGTAAGTTG-CAATACTTAATTTCTGTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTCTAGACCAATGGGACTTAAACCCACAAACACTTAGTTAACAGCTAAGCACCCTAATCAAC-TGGCTTCAATCTAAAGCCCCGGCAGG-TTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAA-TCACCTCGGAGCTTGGTAAAAAGAGGCCTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCA-CTCAGCCATTTTACCACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGGCCTCCATGACTTTTTCAAAAGGTATTAGAAAAACCATTTCATAACTTTGTCAAAGTTAAATTATAGGCT-AAATCCTATATATCTTA-CACTGTAAAGCTAACTTAGCATTAACCTTTTAAGTTAAAGATTAAGAGAACCAACACCTCTTTACAGTGA"
- let chimp = "AGAAATATGTCTGATAAAAGAATTACTTTGATAGAGTAAATAATAGGAGTTCAAATCCCCTTATTTCTACTAGGACTATAAGAATCGAACTCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTATCACACCCCATCCTAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTTACACCCTTCCCGTACTAAGAAATTTAGGTTAAGCACAGACCAAGAGCCTTCAAAGCCCTCAGCAAGTTA-CAATACTTAATTTCTGTAAGGACTGCAAAACCCCACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTCTAGATTAATGGGACTTAAACCCACAAACATTTAGTTAACAGCTAAACACCCTAATCAAC-TGGCTTCAATCTAAAGCCCCGGCAGG-TTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAA-TCACCTCAGAGCTTGGTAAAAAGAGGCTTAACCCCTGTCTTTAGATTTACAGTCCAATGCTTCA-CTCAGCCATTTTACCACAAAAAAGGAAGGAATCGAACCCCCTAAAGCTGGTTTCAAGCCAACCCCATGACCTCCATGACTTTTTCAAAAGATATTAGAAAAACTATTTCATAACTTTGTCAAAGTTAAATTACAGGTT-AACCCCCGTATATCTTA-CACTGTAAAGCTAACCTAGCATTAACCTTTTAAGTTAAAGATTAAGAGGACCGACACCTCTTTACAGTGA"
- let gorilla = "AGAAATATGTCTGATAAAAGAGTTACTTTGATAGAGTAAATAATAGAGGTTTAAACCCCCTTATTTCTACTAGGACTATGAGAATTGAACCCATCCCTGAGAATCCAAAATTCTCCGTGCCACCTGTCACACCCCATCCTAAGTAAGGTCAGCTAAATAAGCTATCGGGCCCATACCCCGAAAATGTTGGTCACATCCTTCCCGTACTAAGAAATTTAGGTTAAACATAGACCAAGAGCCTTCAAAGCCCTTAGTAAGTTA-CAACACTTAATTTCTGTAAGGACTGCAAAACCCTACTCTGCATCAACTGAACGCAAATCAGCCACTTTAATTAAGCTAAGCCCTTCTAGATCAATGGGACTCAAACCCACAAACATTTAGTTAACAGCTAAACACCCTAGTCAAC-TGGCTTCAATCTAAAGCCCCGGCAGG-TTTGAAGCTGCTTCTTCGAATTTGCAATTCAATATGAAAT-TCACCTCGGAGCTTGGTAAAAAGAGGCCCAGCCTCTGTCTTTAGATTTACAGTCCAATGCCTTA-CTCAGCCATTTTACCACAAAAAAGGAAGGAATCGAACCCCCCAAAGCTGGTTTCAAGCCAACCCCATGACCTTCATGACTTTTTCAAAAGATATTAGAAAAACTATTTCATAACTTTGTCAAGGTTAAATTACGGGTT-AAACCCCGTATATCTTA-CACTGTAAAGCTAACCTAGCGTTAACCTTTTAAGTTAAAGATTAAGAGTATCGGCACCTCTTTGCAGTGA"
- let t = T.of_newick (NewickParser.parse NewickLexer.token (Lexing.from_string "((human:0.1,chimp:0.1):0.1,gorilla:0.2);"))
- let q =
- Q.Diag.scale
- Q.Diag.of_Q [| [| (-3.); 1.; 1.; 1.; |];
- [| 1.; (-3.); 1.; 1.; |];
- [| 1.; 1.; (-3.); 1.; |];
- [| 1.; 1.; 1.; (-3.); |] |]
- (1. /. 3.)
-
- let qdiagtests = "Q.Diag" >::: [TestCase (fun () -> assert_bool "Q.Diag.reversible" (Q.Diag.reversible q));
- TestCase (fun () -> assert_equal_vector ~msg:"Q.Diag.equilibrium" (Q.Diag.equilibrium q) [| 0.25; 0.25; 0.25; 0.25 |])]
-
- let likelihood which_q () =
- let m = PhyloModel.make t [| which_q |]
- let ll = ref 0.
- for i = 0 to String.length human - 1 do
- let lf = Array.map (fun ch -> if Code.DNA.is ch then `Certain (Code.DNA.index ch) else `Marginalize) [| human.[i]; chimp.[i]; gorilla.[i] |]
- ll := !ll +. log (PhyloLik.likelihood (PhyloModel.prepare_lik m lf))
- assert_equal ~cmp:(cmp_float ~epsilon:0.001) ~printer:string_of_float ~msg:"mismatch" (-1574.63623) !ll
-
- let qc =
- Q.Diag.scale
- Q.Diag.of_Q ~force_complex:true [|
- [| (-3.); 1.; 1.; 1.; |];
- [| 1.; (-3.); 1.; 1.; |];
- [| 1.; 1.; (-3.); 1.; |];
- [| 1.; 1.; 1.; (-3.); |]
- |]
- (1. /. 3.)
-
- let qcdiagtests = "Q.Diag (complex)" >::: [
- TestCase (fun () -> assert_bool "Q.Diag.reversible" (Q.Diag.reversible qc));
- TestCase (fun () -> assert_equal_vector ~msg:"Q.Diag.equilibrium" (Q.Diag.equilibrium qc) [| 0.25; 0.25; 0.25; 0.25 |])
- ]
-
- let tests = "TinyTest" >::: [ qdiagtests; "likelihood" >:: likelihood q;
- qcdiagtests; "likelihood (complex)" >:: likelihood qc ]
-
- let tests = "BeagleTest" >::: [ TinyTest.tests ]
-
-let all_tests = TestList [TestInfer.tests; BeagleTests.tests]
-
-ignore (run_test_tt_main all_tests)
diff --git a/orf_mode_fig.640.png b/orf_mode_fig.640.png
new file mode 100644
index 0000000..3d281ec
Binary files /dev/null and b/orf_mode_fig.640.png differ
diff --git a/src/ECM.ml b/src/ECM.ml
deleted file mode 100644
index ed43383..0000000
--- a/src/ECM.ml
+++ /dev/null
@@ -1,72 +0,0 @@
-(*
-Reads empirical codon model (ECM) parameters in the format provided in the supplemental material of:
-
-Kosiol C, Holmes I and Goldman N. An Empirical Codon Model for Protein Sequence Evolution. Mol. Biol. Evol. 2007 24(7):1464-1479; doi:10.1093/molbev/msm064
-
-However, note that Kosiol et al. presented a 61x61 model while PhyloCSF uses a 64x64 model (including stop codons)
-*)
-
-open Batteries
-open Printf
-open CamlPaml
-open Expr
-
-module PM = PhyloModel
-module Codon = Code.Codon64
-
-let re_sp = Str.regexp " "
-let import_parameters fn_ecm =
- let lines = Array.of_enum (File.lines_of fn_ecm)
- let raw_sij =
- Array.map
- fun line ->
- Array.of_list
- List.map Option.get
- List.map
- fun s ->
- let s = String.trim s
- if s <> "" then Some (float_of_string s) else None
- Str.split re_sp line
- Array.sub lines 0 (Codon.dim - 1)
- let sij =
- Array.init Codon.dim
- fun i ->
- Array.init Codon.dim
- fun j ->
- if i = 0 && j = 0 then
- 0.
- else if i > j then
- raw_sij.(i-1).(j)
- else if i < j then
- raw_sij.(j-1).(i)
- else
- 0.
-
- if String.trim lines.(Codon.dim - 1) <> "" then failwith "ECM.import_parameters"
-
- let ecm_freqs =
- Array.of_list
- List.map Option.get
- List.map
- fun s ->
- let s = String.trim s
- if s <> "" then Some (float_of_string s) else None
- Str.split re_sp lines.(Codon.dim)
-
- let codons =
- Array.of_list
- List.map Option.get
- List.map
- fun s ->
- let s = String.trim s
- if s <> "" then
- assert (String.length s = 3)
- Some s
- else
- None
- List.flatten (List.map (fun i -> Str.split re_sp lines.(i)) (List.map ((+) Codon.dim) [3; 4; 5; 6]))
-
- if Array.length codons <> Codon.dim then failwith "ECM.import_parameters: incorrect codon order"
- codons |> Array.iteri (fun i s -> if Codon.index (s.[0],s.[1],s.[2]) <> i then failwith "ECM.import_parameters: incorrect codon order")
-
- sij, ecm_freqs
diff --git a/src/ForkNo.ml b/src/ForkNo.ml
deleted file mode 100644
index 4aa2d1e..0000000
--- a/src/ForkNo.ml
+++ /dev/null
@@ -1,3 +0,0 @@
-let can_fork = false
-
-let map ?procs f lst = List.map f lst
diff --git a/src/ForkYes.ml b/src/ForkYes.ml
deleted file mode 100644
index e6d645e..0000000
--- a/src/ForkYes.ml
+++ /dev/null
@@ -1,8 +0,0 @@
-open Batteries
-
-let can_fork = true
-
-let map ?(procs=1) f lst =
- if procs=1 || List.length lst = 1 then List.map f lst
- else
- ForkWork.map_list ~maxprocs:procs f lst
diff --git a/src/Makefile b/src/Makefile
deleted file mode 100644
index 7ab37f8..0000000
--- a/src/Makefile
+++ /dev/null
@@ -1,25 +0,0 @@
-OCAMLBUILDFLAGS=
-ifdef FORKWORK
-OCAMLBUILDFLAGS=-tag "package(forkwork)"
-endif
-
-all:
- rm -f ForkMaybe.ml
-ifdef FORKWORK
- ln -s ForkYes.ml ForkMaybe.ml
-else
- ln -s ForkNo.ml ForkMaybe.ml
-endif
- ocamlbuild -use-ocamlfind $(OCAMLBUILDFLAGS) PhyloCSF.native
-
-test: testexe
- ./test.native -verbose
-
-testexe: all
- ocamlbuild -use-ocamlfind $(OCAMLBUILDFLAGS) testSim.native test.native
-
-clean:
- rm -f *~
- ocamlbuild -clean
-
-.PHONY: all test testexe clean
diff --git a/src/OmegaModel.ml b/src/OmegaModel.ml
deleted file mode 100644
index 71646e5..0000000
--- a/src/OmegaModel.ml
+++ /dev/null
@@ -1,219 +0,0 @@
-(** omega (dN/dS) test, similar to using PAML to test for omega<1, but with a few of our own touches *)
-
-open Batteries
-open Printf
-
-open CamlPaml
-open Expr
-
-module PM = PhyloModel
-module Codon = Code.Codon64
-
-(*
-rate matrix variables:
-0 = kappa, transition/transversion factor
-1 = omega, dN/dS ratio
-2 = sigma, stop codon frequency factor
-3,4,5 freq of A, G. and C relative to freq of T in codon position 1
-6,7,8 " in codon position 2
-9,10,11 " in codon position 3
-*)
-let kappa = Var 0
-let omega = Var 1
-let sigma = Var 2
-let pi_exprs =
- let sc (n1,n2,n3) =
- let i1 = Code.DNA.index n1
- let i2 = Code.DNA.index n2
- let i3 = Code.DNA.index n3
-
- let f1 = Div ((if i1=3 then Val 1.0 else (Var (3+i1))),
- (Add(Var 3,(Add(Var 4,(Add(Var 5,Val 1.0)))))))
- let f2 = Div ((if i2=3 then Val 1.0 else (Var (6+i2))),
- (Add(Var 6,(Add(Var 7,(Add(Var 8,Val 1.0)))))))
- let f3 = Div ((if i3=3 then Val 1.0 else (Var (9+i3))),
- (Add(Var 9,(Add(Var 10,(Add(Var 11,Val 1.0)))))))
- Mul (f1,Mul(f2,f3))
- let denom = Sub(Val 1.0,
- Mul(Sub(Val 1.0, sigma),
- Add(sc ('T','A','A'),Add(sc ('T','A','G'),sc ('T','G','A')))))
- Array.init Codon.dim (fun i -> Div (sc (Codon.of_index i),denom))
-
-let q_p14n =
- let sq =
- Array.init Codon.dim
- fun i ->
- let aai = Codon.translate_index i
- let ((i1,i2,i3) as iii) = Codon.of_index i
- Array.init Codon.dim
- fun j ->
- let open List
- let ((j1,j2,j3) as jjj) = Codon.of_index j
- let diffs = filter (fun (a,b) -> a <> b) [(i1,j1); (i2,j2); (i3,j3)]
-
- if length diffs = 1 then
- let aaj = Codon.translate_index j
- let transition = match hd diffs with
- | 'A','G'
- | 'G','A'
- | 'C','T'
- | 'T','C' -> true
- | _ -> false
-
- let kappa_part = if transition then kappa else Val 1.
- let omega_part =
- if not (Codon.is_stop iii || Codon.is_stop jjj) && aai <> aaj then
- omega
- else
- Val 1.
-
- simplify (Mul (pi_exprs.(j),Mul(kappa_part,omega_part)))
- else
- Val 0.
- PM.P14n.fill_q_diagonal sq
- sq
-
-let q_scale =
- let factor = ref (Val 0.)
- for i = 0 to Codon.dim - 1 do
- factor := Sub (!factor,Mul(pi_exprs.(i),q_p14n.(i).(i)))
- simplify !factor
-
-(* Construct branch length parameterizations (all branches scaled by a variable scale factor) *)
-let make_tree_p14n tree_shape =
- Array.init (T.size tree_shape - 1) (fun br -> Mul (Var 0,Val (T.branch tree_shape br)))
-
-(* Complete parameterization for the model *)
-let make_p14n tree_shape =
- { PM.P14n.q_p14ns = [| q_p14n |];
- q_scale_p14ns = [| q_scale |];
- q_domains = Array.make 12 Fit.NonNeg;
- tree_shape = T.copy tree_shape;
- tree_p14n = make_tree_p14n tree_shape;
- tree_domains = [| Fit.Pos |]; }
-
-let new_instance ?(kappa=1.0) ?(omega=1.0) ?(sigma=1.0) ?(tree_scale=1.0) tree_shape =
- let p14n = make_p14n tree_shape
- let q_settings = Array.concat [ [| kappa; omega; sigma |]; (Array.make 9 1.0) ]
- let tree_settings = [| tree_scale |]
- PM.P14n.instantiate p14n ~q_settings:q_settings ~tree_settings:tree_settings
-
-(* update the rate matrix f3x4 parameters based on the alignment leaves*)
-let update_f3x4 inst leaves =
- let counts = Array.init 3 (fun _ -> Array.make 4 1)
- leaves |> Array.iter
- fun lv ->
- lv |> Array.iter
- function
- | `Certain which_codon ->
- let n1,n2,n3 = Codon.of_index which_codon
- let inc a b = counts.(a).(b) <- counts.(a).(b) + 1
- inc 0 (Code.DNA.index n1)
- inc 1 (Code.DNA.index n2)
- inc 2 (Code.DNA.index n3)
- | _ -> ()
- let qs = PM.P14n.q_settings inst
-
- (*
- TODO: Pond et al. Correcting the Bias of Empirical Frequency Parameter Estimators in Codon
- Models. PLoS One 5:e11230 (2010).
- *)
-
- qs.(3) <- float counts.(0).(0) /. float counts.(0).(3)
- qs.(4) <- float counts.(0).(1) /. float counts.(0).(3)
- qs.(5) <- float counts.(0).(2) /. float counts.(0).(3)
-
- qs.(6) <- float counts.(1).(0) /. float counts.(1).(3)
- qs.(7) <- float counts.(1).(1) /. float counts.(1).(3)
- qs.(8) <- float counts.(1).(2) /. float counts.(1).(3)
-
- qs.(9) <- float counts.(2).(0) /. float counts.(2).(3)
- qs.(10) <- float counts.(2).(1) /. float counts.(2).(3)
- qs.(11) <- float counts.(2).(2) /. float counts.(2).(3)
-
- PM.P14n.update ~q_settings:qs inst
-
-(* Calculate log-probability of the alignment *)
-let lpr_leaves inst leaves =
- let workspace = PhyloLik.new_workspace (PM.tree (PM.P14n.model inst)) Codon.dim
- let lik = ref 0.
- leaves |> Array.iter
- fun lvs ->
- let lvslik = PhyloLik.likelihood (PM.prepare_lik ~workspace:workspace (PM.P14n.model inst) lvs)
- lik := !lik +. log lvslik
- !lik
-
-(* a little bit of regularization: half-cauchy prior distributions for rho and kappa *)
-let pi = acos (-1.0)
-let cauchy_cdf scale x = atan (x /. scale) /. pi +. 0.5
-let half_cauchy_lpdf ?(mode=0.0) ~scale x =
- if x < 0.0 || scale <= 0.0 || mode < 0.0 then invalid_arg "half_cauchy_lpdf"
- let numer = 1.0 /. (pi *. scale *. (1.0 +. ((x -. mode) /. scale) ** 2.0))
- let denom = 1.0 -. cauchy_cdf scale (0.0 -. mode)
- assert (denom > 0.0)
- log numer -. log denom
-
-let lpr_rho = half_cauchy_lpdf ~mode:1.0 ~scale:0.5 (* rho = tree_scale (as in manuscript) *)
-let lpr_kappa k = log (Gsl.Randist.gamma_pdf ~a:7.0 ~b:0.25 (k -. 1.0 +. epsilon_float))
-
-(* find MAP estimates of kappa & rho *)
-let kr_map leaves inst =
- let f_rho inst rho =
- let ts = PM.P14n.tree_settings inst
- ts.(0) <- rho
- let inst_rho = PM.P14n.update ~tree_settings:ts inst
- (lpr_rho rho +. lpr_leaves inst_rho leaves), inst_rho
- let f_kappa inst kappa =
- let qs = PM.P14n.q_settings inst
- qs.(0) <- kappa
- let inst_kappa = PM.P14n.update ~q_settings:qs inst
- (lpr_kappa kappa +. lpr_leaves inst_kappa leaves), inst_kappa
- let round inst =
- let _, (_, inst_rho) =
- PhyloCSFModel.maximize_lpr
- ~init:(PM.P14n.tree_settings inst).(0)
- ~lo:0.001
- ~hi:10.
- ~accuracy:0.01
- f_rho inst
- fst
- let _, (lpr, inst_kappa) =
- PhyloCSFModel.maximize_lpr
- ~init:(PM.P14n.q_settings inst).(0)
- ~lo:1.0
- ~hi:10.
- ~accuracy:0.01
- f_kappa inst_rho
- fst
- inst_kappa, lpr
- (* 3 rounds, cyclic coordinate ascent *)
- round (fst (round (fst (round inst))))
-
-let sf = sprintf "%.2f"
-let db x = sprintf "%.2f" (10. *. x /. log 10.)
-
-let score ?(omega_H1=0.2) ?(sigma_H1=0.01) tree_shape leaves =
- (* H0: omega=1, sigma=1, MLE(kappa), MLE(rho) *)
- let inst0, lpr_H0 = kr_map leaves (update_f3x4 (new_instance ~kappa:2.5 tree_shape) leaves)
- let qs0 = PM.P14n.q_settings inst0
- let ts0 = PM.P14n.tree_settings inst0
-
- (* H1: omega=0.2, sigma=0.01, MLE(kappa), MLE(rho) *)
- let inst1, lpr_H1 =
- let qs = PM.P14n.q_settings inst0
- qs.(1) <- omega_H1
- qs.(2) <- sigma_H1
- kr_map leaves (PM.P14n.update ~q_settings:qs inst0)
- let qs1 = PM.P14n.q_settings inst1
- let ts1 = PM.P14n.tree_settings inst1
-
- let diag = ["L(H0)", (db lpr_H0);
- "rho_H0", (sf ts0.(0)); "kappa_H0", (sf qs0.(0));
- "omega_H0", (sf qs0.(1)); "sigma_H0", (sf qs0.(2));
- "L(H1)", (db lpr_H1);
- "rho_H1", (sf ts1.(0)); "kappa_H1", (sf qs1.(0));
- "omega_H1", (sf qs1.(1)); "sigma_H1", (sf qs1.(2)) ]
-
- { PhyloCSFModel.score = (10. *. (lpr_H1 -. lpr_H0) /. log 10.);
- anc_comp_score = nan;
- diagnostics = diag }
diff --git a/src/PhyloCSF.ml b/src/PhyloCSF.ml
deleted file mode 100644
index b8d4270..0000000
--- a/src/PhyloCSF.ml
+++ /dev/null
@@ -1,491 +0,0 @@
-(* Wish list: PHYLIP alignment format *)
-
-open Batteries
-open Extlib.OptParse
-open Printf
-open CamlPaml
-
-Gsl.Error.init ()
-
-module SMap = Map.Make(struct type t = string let compare = compare end)
-module SSet = Set.Make(struct type t = string let compare = compare end)
-module Codon = CamlPaml.Code.Codon64
-type strategy = PhyloCSF of [`MaxLik | `FixedLik] | OmegaTest | Nop
-type reading_frame = One | Three | Six
-type orf_mode = AsIs | ATGStop | StopStop | StopStop3 | ToFirstStop | FromLastStop | ToOrFromStop
-
-let opt_parser = OptParser.make ~usage:"%prog parameter_set [file1 file2 ...]\ninput will be read from stdin if no filenames are given." ()
-let opt ?group ?h ?hide ?s ?short_names ?l ?long_names x = OptParser.add opt_parser ?group ?help:h ?hide ?short_name:s ?long_name:l x; x
-
-let strategy = (opt ~l:"strategy" ~h:"evaluation strategy (default mle)"
- (Opt.value_option "mle|fixed|omega" (Some (PhyloCSF `MaxLik))
- (fun s ->
- match String.lowercase s with
- | "mle" -> PhyloCSF `MaxLik
- | "fixed" -> PhyloCSF `FixedLik
- | "omega" -> OmegaTest
- | "nop" -> Nop
- | x -> invalid_arg x)
- (fun _ s -> sprintf "invalid strategy %s" s)))
-
-let group = OptParser.add_group opt_parser "input interpretation"
-let filenames = opt ~group ~l:"files" ~h:"input list(s) of alignment filenames instead of individual alignment(s)" (StdOpt.store_true ())
-let remove_ref_gaps = opt ~group ~l:"removeRefGaps" ~h:"automatically remove any alignment columns that are gapped in the reference sequence (nucleotide columns are removed individually; be careful about reading frame). By default, it is an error for the reference sequence to contain gaps" (StdOpt.store_true ())
-let allow_ref_gaps = opt ~hide:true ~group ~l:"allowRefGaps" ~h:"allow the reference sequence to contain gaps (each group of three nucleotide columns in the consensus alignment is treated as a codon site; be careful about reading frame)" (StdOpt.store_true ())
-let desired_species = opt ~group ~l:"species" ~h:"hint that only this subset of species will be used in any of the alignments; this does not change the calculation mathematically, but can speed it up" (StdOpt.str_option ~metavar:"Species1,Species2,..." ())
-
-let group = OptParser.add_group opt_parser "searching mulitple reading frames and ORFs"
-let reading_frame = opt ~group ~l:"frames" ~s:'f' ~h:"how many reading frames to search (default 1)" (Opt.value_option "1|3|6" (Some One) (function "1" -> One | "3" -> Three | "6" -> Six | x -> invalid_arg x) (fun _ s -> sprintf "invalid reading frame %s" s))
-let orf_mode = opt ~group ~l:"orf" ~h:"search for ORFs (default AsIs)" (Opt.value_option "AsIs|ATGStop|StopStop|StopStop3|ToFirstStop|FromLastStop|ToOrFromStop" (Some AsIs) (fun s -> match String.lowercase s with "asis" -> AsIs | "atgstop" -> ATGStop | "stopstop" -> StopStop | "stopstop3" -> StopStop3 | "tofirststop" -> ToFirstStop | "fromlaststop" -> FromLastStop | "toorfromstop" -> ToOrFromStop| x -> invalid_arg x) (fun _ s -> sprintf "invalid ORF search mode %s"s))
-let min_codons = opt ~group ~l:"minCodons" ~h:"minimum ORF length for searching over ORFs (default 25 codons)" (StdOpt.int_option ~default:25 ())
-let print_orfs = opt ~group ~l:"allScores" ~h:"report scores of all regions evaluated, not just the max" (StdOpt.store_true ())
-let procs = opt ~group ~s:'p' ~h:"search frames/ORFs using up to p parallel subprocesses" (StdOpt.int_option ~default: 1 ())
-
-let group = OptParser.add_group opt_parser "output control"
-let print_bls = opt ~group ~l:"bls" ~h:"include alignment branch length score (BLS) for the reported region in output" (StdOpt.store_true ())
-let print_anc_comp_score = opt ~group ~l:"ancComp" ~h:"include ancestral sequence composition score in output" (StdOpt.store_true ())
-let print_dna = opt ~group ~l:"dna" ~h:"include DNA sequence in output, the part of the reference (first) sequence whose score is reported" (StdOpt.store_true ())
-let print_aa = opt ~group ~l:"aa" ~h:"include amino acid translation in output" (StdOpt.store_true ())
-let debug = opt ~l:"debug" ~group ~h:"print extra information about parameters and errors" (StdOpt.store_true ())
-
-let cmd = OptParser.parse_argv opt_parser
-
-if List.length cmd < 1 then
- OptParser.usage opt_parser ()
- exit (-1)
-
-let paramset = List.hd cmd
-let fns_input = List.tl cmd
-
-if Opt.get orf_mode <> AsIs && Opt.get allow_ref_gaps then
- eprintf "--allowRefGaps should not be used with --orf\n"
- OptParser.usage opt_parser ()
- exit (-1)
-
-if Opt.get orf_mode <> AsIs && Opt.get reading_frame = One then
- eprintf "Warning: --orf with --frames=1; are you sure you don't want to search for ORFs in three or six frames?\n"
- flush stderr
-
-if Opt.get procs > 1 && not ForkMaybe.can_fork then
- eprintf "Warning: ignoring -p, recompile PhyloCSF with: make FORKWORK=1\n"
- flush stderr
-
-(*
-if Opt.get procs > 1 && Opt.get orf_mode = AsIs && Opt.get reading_frame = One then
- eprintf "Warning: -p isn't useful without --orf and/or --frames\n"
- flush stderr
-*)
-
-if Opt.get debug then Printexc.record_backtrace true
-
-(******************************************************************************)
-
-let input_mfa lines =
- try
- let rec seq sofar =
- let buf = match sofar with ((_,buf) :: _) -> buf | _ -> assert false
- if not (Enum.is_empty lines) then
- let line = String.trim (Option.get (peek lines))
- if String.length line = 0 then
- seq sofar
- else if line.[0] <> '>' then
- Buffer.add_string buf line
- junk lines
- seq sofar
- else
- hdr sofar
- else
- let enum = List.rev sofar |> Array.of_list
- let species = Array.map fst enum
- let seqs = Array.map (fun (_,buf) -> Buffer.contents buf) enum
- let seqlen = String.length seqs.(0)
- if seqlen = 0 || exists ((=) "") (Array.enum species) || exists (fun s -> String.length s <> seqlen) (Array.enum seqs) then
- failwith "empty species name or sequence, or sequence length mismatch"
- species, seqs
- and hdr sofar =
- let line = Option.get (get lines)
- if String.length line = 0 then
- hdr sofar
- else if line.[0] <> '>' then
- failwith "bad header"
- else
- let hdr = String.lchop line
- let sp = String.trim (try String.left hdr (String.index hdr '|') with Not_found -> hdr)
- seq ((sp,Buffer.create 256) :: sofar)
- hdr []
- with
- | Failure msg -> failwith ("invalid MFA alignment: " ^ msg)
- | exn -> failwith ("invalid MFA alignment: " ^ (Printexc.to_string exn))
-
-(******************************************************************************)
-
-let maybe_remove_ref_gaps (species,aln) =
- if Opt.get remove_ref_gaps then
- let bufs = Array.map (fun _ -> Buffer.create 256) aln
- let refseq = aln.(0)
- for j = 0 to String.length refseq - 1 do
- if refseq.[j] <> '-' then
- for i = 0 to Array.length aln - 1 do
- Buffer.add_char bufs.(i) aln.(i).[j]
- species, (Array.map Buffer.contents bufs)
- else
- species, aln
-
-let find_orfs ?(ofs=0) dna =
- let atg = Opt.get orf_mode = ATGStop
- let codon pos = Char.uppercase dna.[pos], Char.uppercase dna.[pos+1], Char.uppercase dna.[pos+2]
- let is_start pos = match codon pos with 'A','T','G' -> true | _ -> false
- let is_stop pos = match codon pos with 'T','A','A' | 'T','A','G' | 'T','G','A' -> true | _ -> false
-
- let len = String.length dna
- let orfs = ref []
- let starts = ref []
-
- for codon_lo = ofs to len-3 do
- if (codon_lo-ofs) mod 3 = 0 then
- let codon_hi = codon_lo+2
- if (not atg && !starts = [] && not (is_stop codon_lo)) || (atg && is_start codon_lo) then starts := codon_lo :: !starts
- if codon_hi+3 < len && is_stop (codon_hi+1) then
- !starts |> List.iter
- fun start ->
- if codon_hi>start+2 then
- assert ((start-ofs) mod 3 = 0)
- assert ((codon_hi-start+1) mod 3 = 0)
- orfs := (start,codon_hi) :: !orfs
- starts := []
-
- if not atg then
- (* add stuff that goes off the end of the alignment *)
- !starts |> List.iter
- fun start ->
- let rem = len-start
- orfs := (start,start+(rem/3)*3-1) :: !orfs
-
- if Opt.get orf_mode = StopStop3 then
- (* look at shorter sub-ORFs of each stop-stop ORF *)
- let all_suborfs =
- !orfs |> List.map
- fun (lo,hi) ->
- let suborfs = ref [lo,hi]
- let codons = (hi-lo+1)/3
- let lo2 = lo+(codons/3)*3
- if lo2 > lo then suborfs := (lo2,hi) :: !suborfs
- let lo3 = lo+(2*codons/3)*3
- if lo3 > lo2 && lo3 > lo then suborfs := (lo3,hi) :: !suborfs
- !suborfs
- orfs := List.flatten all_suborfs
-
- if Opt.get orf_mode = ToFirstStop && !orfs <> [] then
- let ((firstorflo,_) as firstorf) = List.hd (List.rev !orfs)
- orfs := if firstorflo = ofs then [firstorf] else []
-
- if Opt.get orf_mode = FromLastStop && !orfs <> [] then
- let ((_,lastorfhi) as lastorf) = List.hd !orfs
- orfs := if len - lastorfhi <= 3 then [lastorf] else []
-
- if Opt.get orf_mode = ToOrFromStop && !orfs <> [] then
- let ((firstorflo,_) as firstorf) = List.hd (List.rev !orfs)
- let ((_,lastorfhi) as lastorf) = List.hd !orfs
- orfs := if firstorflo = ofs then [firstorf] else []
- orfs := if len - lastorfhi <= 3 && firstorf <> lastorf then lastorf :: !orfs else !orfs
-
- !orfs |> List.rev |> List.filter
- fun (lo,hi) ->
- assert ((hi-lo+1) mod 3 = 0)
- assert ((lo-ofs) mod 3 = 0)
- (hi-lo+1)/3 >= Opt.get min_codons
-
-let candidate_regions dna rcdna =
- if Opt.get orf_mode = AsIs then
- let hi = String.length dna - 1
- [ [false,0,hi];
- (if Opt.get reading_frame <> One then
- [ (false,1,hi); (false,2,hi) ] else []);
- (if Opt.get reading_frame = Six then
- [ (true,0,hi); (true,1,hi); (true,2,hi) ] else []) ] |> List.flatten
- else
- let aoeu a = List.map (fun (b,c) -> a,b,c)
- let all_orfs = ref [aoeu false (find_orfs ~ofs:0 dna)]
- if Opt.get reading_frame <> One then
- all_orfs := aoeu false (find_orfs ~ofs:1 dna) :: !all_orfs
- all_orfs := aoeu false (find_orfs ~ofs:2 dna) :: !all_orfs
- if Opt.get reading_frame = Six then
- let rcdna = Code.DNA.revcomp dna
- all_orfs := aoeu true (find_orfs ~ofs:0 rcdna) :: !all_orfs
- all_orfs := aoeu true (find_orfs ~ofs:1 rcdna) :: !all_orfs
- all_orfs := aoeu true (find_orfs ~ofs:2 rcdna) :: !all_orfs
- List.rev !all_orfs |> List.flatten
-
-let pleaves ?(lo=0) ?hi t leaf_ord aln =
- let hi = match hi with Some x -> x | None -> String.length aln.(0) - 1
-
- (* construct enumeration of leaf probability vectors *)
- let rec enum starting_pos =
- let pos = ref starting_pos
- let next () =
- if !pos+2 > hi then raise Enum.No_more_elements
- let lvs =
- Array.init (T.leaves t)
- fun t_row ->
- match leaf_ord.(t_row) with
- | None -> `Marginalize
- | Some aln_row ->
- let n1 = aln.(aln_row).[!pos]
- let n2 = aln.(aln_row).[!pos+1]
- let n3 = aln.(aln_row).[!pos+2]
- let codon = n1, n2, n3
- if not (Codon.is codon) then
- `Marginalize
- else
- `Certain (Codon.index codon)
- pos := !pos + 3
- lvs
- let count () = (hi - !pos + 1)/3
- let clone () = enum !pos
- Enum.make ~next:next ~count:count ~clone:clone
- enum lo
-
-(******************************************************************************)
-
-(* based on the Newick tree, compute the average branch length score for each alignment column in
-the interval [lo,hi] *)
-let bls nt aln which_row lo hi =
- assert (hi >= lo)
- let pres = function '-' | '.' | 'N' -> false | _ -> true
- let bl_total = ref 0.
- for i = lo to hi do
- let subtree =
- Newick.subtree
- fun sp -> try pres aln.(SMap.find sp which_row).[i] with Not_found -> false
- nt
- bl_total := !bl_total +. Option.map_default Newick.total_length 0. subtree
- !bl_total /. (Newick.total_length nt *. float (hi-lo+1))
-
-(******************************************************************************)
-
-let u2t = function 'u' -> 't' | 'U' -> 'T' | x -> x
-let fn2id fn = if fn = "" then "(STDIN)" else fn
-let translate dna =
- let aalen = String.length dna / 3
- let pp = String.create aalen
- for i = 0 to aalen - 1 do
- let codon = dna.[3*i], dna.[3*i+1], dna.[3*i+2]
- if Codon.is codon then
- let aa = Codon.translate codon
- pp.[i] <- aa
- else
- pp.[i] <- '?'
- pp
-
-let process_alignment (nt,t,evaluator) fn =
- try
- (* load alignment from file *)
- let lines = if fn = "" then IO.lines_of stdin else File.lines_of fn
- let (species,aln) = maybe_remove_ref_gaps (input_mfa lines)
- let aln = Array.map (String.map u2t) aln
-
- (* sanity checks *)
- if not (Opt.get allow_ref_gaps) && aln.(0) |> String.enum |> exists ((=) '-') then
- failwith "the reference sequence (first alignment row) must be ungapped"
- let rc_aln = Array.map Code.DNA.revcomp aln (* will check that everything is valid nucleotide or gap. *)
-
- (* determine how the alignment rows correspond to the tree leaves *)
- let t_species = (0 -- (T.leaves t - 1)) /@ T.label t |> fold (fun set sp -> SSet.add sp set) SSet.empty
- let aln_species = Array.fold_right SSet.add species SSet.empty
- let wtf = SSet.diff aln_species t_species
- if SSet.cardinal wtf > 0 then failwith ("parameters not available for species: " ^ (String.join " " (SSet.elements wtf)))
- let which_row = Array.fold_lefti (fun m i sp -> SMap.add sp i m) SMap.empty species
- let leaf_ord = Array.init (T.leaves t) (fun i -> try Some (SMap.find (T.label t i) which_row) with Not_found -> None)
-
- (* generate list of candidate regions within the alignment *)
- let rgns = candidate_regions aln.(0) rc_aln.(0)
-
- let rgns =
- if Opt.get procs > 1 && ForkMaybe.can_fork then
- (* If parallelizing, sort regions longest-to-shortest
- in order to optimize utilization *)
- List.sort (fun (_,lo1,hi1) (_,lo2,hi2) -> (hi2-lo2) - (hi1-lo1)) rgns
- else rgns
-
- try
- if rgns = [] then
- assert (Opt.get orf_mode <> AsIs)
- failwith "no sufficiently long ORFs found"
-
- (* evaluate each candidate region, perhaps in parallel *)
- let rgns_scores =
- rgns |> ForkMaybe.map ~procs:(Opt.get procs)
- fun (rc,lo,hi) ->
- try
- let aln_leaves = Array.of_enum (pleaves ~lo:lo ~hi:hi t leaf_ord (if rc then rc_aln else aln))
- let rslt = evaluator aln_leaves
- `Res (rslt,rc,lo,hi)
- with
- | exn ->
- (* problem evaluating an individual region within the
- alignment: register complaint, but don't die, as
- maybe some other region will succeed. *)
- let msg =
- sprintf "%s\texception\t%d\t%d%s\t%s"
- fn2id fn
- lo
- hi
- if Opt.get reading_frame = Six then (if rc then "\t-" else "\t+") else ""
- Printexc.to_string exn
- if Opt.get debug then
- `Exn [| msg; Printexc.get_backtrace () |]
- else
- `Exn [| msg |]
-
- let rgns_scores =
- rgns_scores |> List.filter_map
- function
- | `Res x -> Some x
- | `Exn [| msg |] -> print_endline msg; flush stdout; None
- | `Exn [| msg; bt |] ->
- print_endline msg; flush stdout
- prerr_endline bt; flush stderr
- None
- | _ -> assert false
-
- if rgns_scores = [] then failwith "no regions successfully evaluated"
-
- let report_score ty (rslt,rc,lo,hi) =
- printf "%s\t%s\t%.4f" (fn2id fn) ty rslt.PhyloCSFModel.score
- if Opt.get reading_frame <> One || Opt.get orf_mode <> AsIs then
- printf "\t%d\t%d" lo hi
- if Opt.get reading_frame = Six then
- printf "\t%c" (if rc then '-' else '+')
- if Opt.get print_bls then
- let rgn_bls = bls nt (if rc then rc_aln else aln) which_row lo hi
- printf "\t%.4f" rgn_bls
- if Opt.get print_anc_comp_score then
- printf "\t%.4f" rslt.PhyloCSFModel.anc_comp_score
- let refdna = String.sub (if rc then rc_aln.(0) else aln.(0)) lo (hi-lo+1)
- if Opt.get print_dna then
- printf "\t%s" refdna
- if Opt.get print_aa then
- printf "\t%s" (translate refdna)
- if Opt.get debug then
- printf "\t#"
- foreach (List.enum rslt.PhyloCSFModel.diagnostics) (fun (k,v) -> printf " %s=%s" k v)
- printf "\n"
-
- if Opt.get print_orfs then
- rgns_scores |> List.iter (report_score "orf_score(decibans)")
- List.reduce max rgns_scores |> report_score (if Opt.get orf_mode <> AsIs || Opt.get reading_frame <> One then "max_score(decibans)" else "score(decibans)")
- with
- | ((Assert_failure _) as exn) -> raise exn
- (* move on to the next alignment: convergence problems, no ORFs found, etc. *)
- | exn -> printf "%s\tfailure\t%s\n" (fn2id fn) (Printexc.to_string exn)
- with (* stop everything: file not found, improperly formatted alignment, etc. *)
- | exn ->
- printf "%s\tabort\t%s\n" (fn2id fn) (Printexc.to_string exn)
- if Opt.get debug then
- flush stdout
- eprintf "%s" (Printexc.get_backtrace ())
- flush stderr
- exit (-1)
- flush stdout
-
-(******************************************************************************)
-
-(* parse a keyvalue\n file format *)
-let parse_kv lines =
- let f kv line =
- let line = String.strip line
- if String.length line = 0 || line.[0] = '#' then
- kv
- else
- try
- let (k,v) = String.split line "\t"
- Map.add k v kv
- with Not_found -> Map.add line "" kv
- fold f Map.empty lines
-
-let initialize_strategy () =
- let paramfile ?(required=true) suffix =
- let fn =
- if (try ignore (String.index paramset '/'); false with Not_found -> true) then
- try
- let base = Sys.getenv "PHYLOCSF_BASE"
- if not (Sys.file_exists base && Sys.is_directory base) then
- raise Not_found
- Filename.concat (Filename.concat base "PhyloCSF_Parameters") (paramset ^ suffix)
- with
- | _ -> failwith "PHYLOCSF_BASE environment variable must be set to the root directory of the source or executable distribution"
- else
- (* paramset is a relative or absolute path *)
- paramset ^ suffix
- if required && not (Sys.file_exists fn) then failwith (sprintf "could not find required parameter file %s" fn)
- fn
-
- let fn_tree = paramfile ".nh"
- let nt = File.with_file_in fn_tree (fun input -> NewickParser.parse NewickLexer.token (Lexing.from_input input))
-
- let desired_species = if Opt.is_set desired_species then String.nsplit (Opt.get desired_species) "," |> List.fold_left (flip SSet.add) SSet.empty else SSet.empty
- let snt =
- if desired_species = SSet.empty then
- nt
- else
- match Newick.subtree (flip SSet.mem desired_species) nt with
- | Some snt when Newick.leaves snt > 1 -> snt
- | _ -> failwith "specify at least two available --species"
-
- let t = T.of_newick snt
-
- let evaluator =
- match Opt.get strategy with
- | PhyloCSF substrategy ->
- let fn_ecm_c = paramfile "_coding.ECM"
- let fn_ecm_nc = paramfile "_noncoding.ECM"
-
- let s1, pi1 = ECM.import_parameters fn_ecm_c
- let s2, pi2 = ECM.import_parameters fn_ecm_nc
- let model = PhyloCSFModel.make s1 pi1 s2 pi2 t
-
- fun leaves ->
- PhyloCSFModel.score
- match substrategy with `MaxLik -> PhyloCSFModel.MaxLik | `FixedLik -> PhyloCSFModel.FixedLik
- model
- leaves
- | OmegaTest ->
- let fn_config = paramfile ~required:false "_omega"
-
- let omega_H1, sigma_H1 =
- if Sys.file_exists fn_config then
- try
- let kv = parse_kv (File.lines_of fn_config)
- Some (float_of_string (Map.find "omega_H1" kv)), Some (float_of_string (Map.find "sigma_H1" kv))
- with
- | exn -> failwith (sprintf "configuration file %s exists but does not specify valid omega_H1 and sigma_H1 values" fn_config)
- else
- None, None
-
- fun leaves -> (OmegaModel.score ?omega_H1 ?sigma_H1 t leaves)
- | Nop -> fun leaves -> { PhyloCSFModel.score = 0.0; anc_comp_score = 0.0; diagnostics = [] }
- snt, t, evaluator
-
-let main () =
- let strategy = initialize_strategy ()
-
- let fns_alignments =
- if Opt.get filenames then
- if fns_input = [] then
- if Unix.isatty Unix.stdin then
- printf "Input alignment filename(s) then EOF (Ctrl+D): "
- flush stdout
- IO.lines_of stdin
- else
- (List.enum fns_input) /@ File.lines_of |> Enum.concat
- else if fns_input = [] then
- if Unix.isatty Unix.stdin then
- printf "Input alignment then EOF (Ctrl+D):\n"
- flush stdout
- Enum.singleton ""
- else
- List.enum fns_input
-
- foreach fns_alignments (process_alignment strategy)
-
-main ()
diff --git a/src/PhyloCSFModel.ml b/src/PhyloCSFModel.ml
deleted file mode 100644
index f33a7de..0000000
--- a/src/PhyloCSFModel.ml
+++ /dev/null
@@ -1,148 +0,0 @@
-open Batteries
-open Printf
-open CamlPaml
-open CamlPaml.Expr
-
-module PM = CamlPaml.PhyloModel
-module Codon = CamlPaml.Code.Codon64
-
-(* Construct rate matrix parameterization from symmetric exchangeability matrix s*)
-let pivar i = Var i
-let make_q_p14n s =
- let sq =
- Array.init Codon.dim
- fun i ->
- let si = s.(i)
- Array.init Codon.dim
- fun j ->
- if i = j then
- Val 0.
- else
- Mul (Val si.(j),pivar j) (* q[i,j] = s[i,j] * pi[j] *)
- PM.P14n.fill_q_diagonal sq
- sq
-let qscale sq =
- let factor = ref (Val 0.)
- for i = 0 to Codon.dim - 1 do
- let sqii = sq.(i).(i)
- if sqii <> Val 0. then
- factor := Sub (!factor,Mul(pivar i,sq.(i).(i)))
- simplify !factor
-
-(* Construct branch length parameterizations (all branches scaled by a variable scale factor) *)
-let make_tree_p14n tree_shape = Array.init (T.size tree_shape - 1) (fun br -> Mul (Var 0,Val (T.branch tree_shape br)))
-
-(* Complete parameterization for either of the codon models (coding or non-coding *)
-let make_p14n s tree_shape =
- let tree_exprs = make_tree_p14n tree_shape
- let q_exprs = make_q_p14n s
-
- { PM.P14n.q_p14ns = [| q_exprs |]; q_scale_p14ns = [| qscale q_exprs |]; q_domains = [||];
- tree_shape = (T.copy tree_shape); tree_p14n = tree_exprs; tree_domains = [|Fit.Pos|] }
-
-(* dot product... *)
-let dot v1 v2 =
- if (Array.length v1 <> Array.length v2) then invalid_arg "dot"
- let tot = ref 0.
- for i = 0 to Array.length v1 - 1 do
- tot := !tot +. v1.(i) *. v2.(i)
- !tot
-
-(* Instantiate a codon model *)
-let new_instance ?(tree_scale=1.) s pi tree_shape =
- let p14n = make_p14n s tree_shape
- let q_settings = Array.copy pi
- let tree_settings = [| tree_scale |]
- PM.P14n.instantiate p14n ~prior:pi ~q_settings:q_settings ~tree_settings:tree_settings
-
-type lpr_leaves = {
- lpr_leaves : float;
- elpr_anc : float;
- inst : PM.P14n.instance
-}
-
-(* Calculate log-probability of the alignment
- Simultaneously, calculate expected log-probability of the ancestral sequence
-*)
-let lpr_leaves inst leaves t =
- let ts = PM.P14n.tree_settings inst
- ts.(0) <- t
- let inst = PM.P14n.update ~tree_settings:ts inst
- let workspace = PhyloLik.new_workspace (PM.tree (PM.P14n.model inst)) Codon.dim
- let lpr = ref 0.
-
- let anc_lprior = Array.map log (PM.prior (PM.P14n.model inst))
- let elpr_anc = ref 0.
- leaves |> Array.iter
- fun lvs ->
- let info = PM.prepare_lik ~workspace:workspace (PM.P14n.model inst) lvs
- lpr := !lpr +. log (PhyloLik.likelihood info)
- let pr_root = PhyloLik.node_posterior info (T.root (PM.tree (PM.P14n.model inst)))
- elpr_anc := !elpr_anc +. dot pr_root anc_lprior
- { lpr_leaves = !lpr; elpr_anc = !elpr_anc; inst }
-
-let maximize_lpr ?(init=1.) ?(lo=1e-2) ?(hi=10.) ?(accuracy=0.01) f g =
- let good_init = Fit.find_init ~maxtries:250 ~logspace:true ~init:init ~lo:lo ~hi:hi ~f:(fun x -> g (f x)) ()
- if lo < good_init && good_init < hi then
- let maximizer = Fit.make_maximizer ~f:(fun x -> g (f x)) ~lo:lo ~hi:hi ~init:good_init
-
- let go = ref true
- while !go do
- maximizer#iterate ()
- let x = maximizer#maximum ()
- let lb,ub = maximizer#interval ()
- go := ((ub -. lb) /. x) > accuracy
-
- let x = maximizer#maximum ()
- x, f x
- else
- good_init, f good_init
-
-(* Complete PhyloCSF model, with coding and non-coding ECMs *)
-type model = {
- coding_model : PM.P14n.instance;
- noncoding_model : PM.P14n.instance;
-}
-
-let make s1 pi1 s2 pi2 tree_shape =
- let coding_model = new_instance s1 pi1 tree_shape
- let noncoding_model = new_instance s2 pi2 tree_shape
- { coding_model = coding_model; noncoding_model = noncoding_model }
-
-let sf = sprintf "%.2f"
-let db x = (10. *. x /. log 10.)
-let dbs x = sprintf "%.2f" (db x)
-
-type score = {
- score : float;
- anc_comp_score : float;
- diagnostics: (string*string) list;
-}
-
-let llr_FixedLik t model leaves =
- let { lpr_leaves = lpr_c; elpr_anc = elpr_anc_c } = lpr_leaves model.coding_model leaves t
- let { lpr_leaves = lpr_n; elpr_anc = elpr_anc_n} = lpr_leaves model.noncoding_model leaves t
- let diag = ["rho",(sf t); "L(C)",(dbs lpr_c);"L(NC)",(dbs lpr_n)]
- { score = db (lpr_c -. lpr_n);
- anc_comp_score = db (elpr_anc_c -. elpr_anc_n);
- diagnostics = diag }
-
-let llr_MaxLik ?init model leaves =
- let rho_c, { lpr_leaves = lpr_c; elpr_anc = elpr_anc_c } = maximize_lpr ?init (lpr_leaves model.coding_model leaves) (fun { lpr_leaves } -> lpr_leaves)
- let rho_n, { lpr_leaves = lpr_n; elpr_anc = elpr_anc_n } = maximize_lpr ?init (lpr_leaves model.noncoding_model leaves) (fun { lpr_leaves } -> lpr_leaves)
- let diag = (match init with Some w0 -> ["rho_0", (sf w0)] | None -> []) @ [ "rho_C",(sf rho_c); "rho_N", (sf rho_n); "L(C)", (dbs lpr_c); "L(NC)", (dbs lpr_n)]
- { score = db (lpr_c -. lpr_n);
- anc_comp_score = db (elpr_anc_c -. elpr_anc_n);
- diagnostics = diag }
-
-type strategy =
- | FixedLik
- | MaxLik
-
-let score strategy model leaves =
- let compute_score = match strategy with
- | FixedLik -> llr_FixedLik 1.
- | MaxLik -> llr_MaxLik ~init:1.
- compute_score model leaves
-
-
diff --git a/src/_tags b/src/_tags
deleted file mode 100644
index f0b6757..0000000
--- a/src/_tags
+++ /dev/null
@@ -1,4 +0,0 @@
-<**/*.ml> or <**/*.mli>: pp(ocaml+twt)
- or : package(should), package(oUnit), package(str)
-true: debug, package(batteries), package(CamlPaml)
-
diff --git a/src/test.ml b/src/test.ml
deleted file mode 100644
index d5b744b..0000000
--- a/src/test.ml
+++ /dev/null
@@ -1,107 +0,0 @@
-open Batteries
-open Printf
-open OUnit
-open Should
-
-let dn_here = Filename.dirname Sys.argv.(0)
-
-let fn_PhyloCSF = Filename.concat dn_here "PhyloCSF.native"
-
-let slow () = skip_if (try ignore (Sys.getenv "SKIP_SLOW"); true with Not_found -> false) "SKIP_SLOW"
-
-(* test results on the three bundled example alignments *)
-
-let run_PhyloCSF species params =
- let params =
- if ForkMaybe.can_fork then params ^ " -p 8"
- else params
- let cmd = sprintf "%s %s %s" fn_PhyloCSF (Filename.concat dn_here ("../PhyloCSF_Parameters/" ^ species)) params
-
- let phylocsf_in = Unix.open_process_in ~cleanup:true cmd
-
- let phylocsf_answer = input_line phylocsf_in
- match Unix.close_process_in phylocsf_in with
- | Unix.WEXITED 0 -> String.nsplit phylocsf_answer "\t"
- | _ -> raise Exit
-
-let talAA () =
- let ans = run_PhyloCSF "12flies" "../PhyloCSF_Examples/tal-AA.fa --ancComp"
- print_endline (String.join "\t" ans)
- List.nth ans 1 $hould # equal "score(decibans)"
- float_of_string (List.nth ans 2) $hould # be # within (297.62,297.63)
- float_of_string (List.nth ans 3) $hould # be # within (48.25,48.26)
-
-let aldh2_ex5_out () =
- let ans = run_PhyloCSF "29mammals" "../PhyloCSF_Examples/ALDH2.exon5.fa --ancComp"
- print_endline (String.join "\t" ans)
- List.nth ans 1 $hould # equal "score(decibans)"
- float_of_string (List.nth ans 2) $hould # be # within (-178.93,-178.92)
- float_of_string (List.nth ans 3) $hould # be # within (-38.29,-38.28)
-
-let aldh2_ex5_in () =
- let abbreviate = (try ignore (Sys.getenv "SKIP_SLOW"); true with Not_found -> false)
- let ans = run_PhyloCSF "29mammals" ("../PhyloCSF_Examples/ALDH2.exon5.fa --frames=" ^ (if abbreviate then "3" else "6"))
- print_endline (String.join "\t" ans)
- List.nth ans 1 $hould # equal "max_score(decibans)"
- float_of_string (List.nth ans 2) $hould # be # within (218.26,218.27)
- int_of_string (List.nth ans 3) $hould # equal 1
- int_of_string (List.nth ans 4) $hould # equal 111
- if not abbreviate then List.nth ans 5 $hould # equal "+"
-
-let aldh2_mRNA () =
- slow ()
- let ans = run_PhyloCSF "29mammals" "../PhyloCSF_Examples/Aldh2.mRNA.fa --orf=ATGStop --frames=3 --removeRefGaps --aa"
- print_endline (String.join "\t" ans)
- List.nth ans 1 $hould # equal "max_score(decibans)"
- float_of_string (List.nth ans 2) $hould # be # within (2013.92,2013.93)
- int_of_string (List.nth ans 3) $hould # equal 343
- int_of_string (List.nth ans 4) $hould # equal 1899
- string (List.nth ans 5) $hould # be # matching (Str.regexp "^MLRAALTTVRRGPRLSRLLSAAA.*")
-
-let example_tests = "examples" >::: [
- "tal-AA" >:: talAA;
- "ALDH2 ex5 out-of-frame" >:: aldh2_ex5_out;
- "ALDH2 ex5 in-frame" >:: aldh2_ex5_in;
- "Aldh2 mRNA" >:: aldh2_mRNA
- ]
-
-(* simulations
- FIXME: currently there is no verification of the results except that PhyloCSF
- successfully exits; you have to eyeball the test stdout. *)
-
-let fn_testSim = Filename.concat dn_here "testSim.native"
-
-let check cmd = match Sys.command cmd with
- | 0 -> ()
- | c when (c=130 || c=255) -> exit c (* ctrl-C *)
- | c -> failwith (sprintf "Child process exit code %d" c)
-
-let sim_AsIs_fixed () =
- check (sprintf "%s --maxUTR=0 --constantFrame --constantStrand 12flies ' --strategy=fixed'" fn_testSim)
-
-let sim_AsIs_mle () =
- slow ()
- check (sprintf "%s --maxUTR=0 --constantFrame --constantStrand 12flies ' --strategy=mle'" fn_testSim)
-
-let sim_ATGStop_fixed () =
- check (sprintf "%s 12flies ' --orf=ATGStop --frames=6 --strategy=fixed'" fn_testSim)
-
-let sim_ATGStop_mle () =
- slow ()
- check (sprintf "%s 12flies ' --orf=ATGStop --frames=6 --strategy=mle'" fn_testSim)
-
-
-let sim_tests = "simulations" >::: [
- "AsIs_fixed" >:: sim_AsIs_fixed;
- "AsIs_mle" >:: sim_AsIs_mle;
- "ATGStop_fixed" >:: sim_ATGStop_fixed;
- "ATGStop_mle" >:: sim_ATGStop_mle
- ]
-
-let all_tests =
- "PhyloCSF" >::: [
- sim_tests;
- example_tests
- ]
-
-run_test_tt_main all_tests
diff --git a/src/testSim.ml b/src/testSim.ml
deleted file mode 100644
index 55ed0e0..0000000
--- a/src/testSim.ml
+++ /dev/null
@@ -1,161 +0,0 @@
-(* Test harness for PhyloCSF executable...feeds it simulated alignments of
- 5'UTR+ORF+3'UTR, to make sure we can recover the ORF. *)
-
-open Batteries
-open Extlib.OptParse
-open Printf
-open CamlPaml
-
-Gsl.Error.init ()
-Random.init 42
-
-let dn_here = Filename.dirname Sys.argv.(0)
-
-module Codon = CamlPaml.Code.Codon64
-
-let opt_parser = OptParser.make ~usage:"%prog 12flies \" --frames=6 --orf=ATGStop --strategy=fixed\"" ()
-let opt ?group ?h ?hide ?s ?short_names ?l ?long_names x = OptParser.add opt_parser ?group ?help:h ?hide ?short_name:s ?long_name:l x; x
-
-let n = opt ~s:'n' (StdOpt.int_option ~default:5 ())
-let min_utr = opt ~l:"minUTR" (StdOpt.int_option ~default:10 ())
-let max_utr = opt ~l:"maxUTR" (StdOpt.int_option ~default:50 ())
-let min_cds = opt ~l:"minCDS" (StdOpt.int_option ~default:40 ())
-let max_cds = opt ~l:"maxCDS" (StdOpt.int_option ~default:200 ())
-let randomize_frame = opt ~l:"constantFrame" (StdOpt.store_false ())
-let randomize_strand = opt ~l:"constantStrand" (StdOpt.store_false ())
-
-let cmd = OptParser.parse_argv opt_parser
-
-if List.length cmd < 2 then
- OptParser.usage opt_parser ()
- exit (-1)
-
-let fp_params = Filename.concat (Filename.concat dn_here "../PhyloCSF_Parameters") (List.nth cmd 0)
-let fn_exe = (Filename.concat dn_here "PhyloCSF.native") ^ " " ^ (List.nth cmd 1)
-
-(******************************************************************************)
-
-let load_parameters () =
- let fn_tree = fp_params ^ ".nh"
- let fn_ecm_c = fp_params ^ "_coding.ECM"
- let fn_ecm_nc = fp_params ^ "_noncoding.ECM"
- if not (List.for_all Sys.file_exists [fn_tree; fn_ecm_c; fn_ecm_nc]) then
- failwith (sprintf "Could not find required parameter files prefixed by %s\n" fp_params)
-
- let nt = File.with_file_in fn_tree (fun input -> NewickParser.parse NewickLexer.token (Lexing.from_input input))
- let t = T.of_newick nt
- let s1, pi1 = ECM.import_parameters fn_ecm_c
- let s2, pi2 = ECM.import_parameters fn_ecm_nc
- let model = PhyloCSFModel.make s1 pi1 s2 pi2 t
- nt, t, model
-
-let alignment_column_producer model_instance =
- let m = PhyloModel.P14n.model model_instance
- let rec next () =
- let leaves = PhyloModel.simulate m ()
- if Codon.is_stop (Codon.of_index leaves.(0)) then
- next ()
- else
- Array.init (T.leaves (PhyloModel.tree m))
- fun i ->
- let which_codon = leaves.(i)
- let n1,n2,n3 = Codon.of_index which_codon
- String.of_list [n1; n2; n3]
- let rec enum () = Enum.make ~next:next ~count:(fun () -> raise Enum.Infinite_enum) ~clone:(fun () -> enum ())
- enum ()
-
-let full_alignment_columns { PhyloCSFModel.coding_model = coding_model; noncoding_model = noncoding_model } =
- let leaves = T.leaves (PhyloModel.tree (PhyloModel.P14n.model coding_model))
-
- let sites5' = if Opt.get max_utr > 0 then (Opt.get min_utr) + (Random.int (Opt.get max_utr - Opt.get min_utr)) else 0
- let sites3' = if Opt.get max_utr > 0 then (Opt.get min_utr) + (Random.int (Opt.get max_utr - Opt.get min_utr)) else 0
- let sitesCDS = if Opt.get max_cds > 0 then (Opt.get min_cds) + (Random.int (Opt.get max_cds - Opt.get min_cds)) else 0
-
- let utr_producer = alignment_column_producer noncoding_model
- let cds_producer = alignment_column_producer coding_model
-
- let site1 =
- if Opt.get max_utr = 0 then
- None
- else
- let site = Option.get (get utr_producer)
- if Opt.get randomize_frame then
- let trim = Random.int 3
- site |> Array.iteri (fun i s -> site.(i) <- String.sub s 0 trim)
- Some site
-
- let atg = Array.make leaves "ATG"
- let stop = Array.init leaves (fun _ -> match Random.int 3 with 0 -> "TAA" | 1 -> "TAG" | 2 -> "TGA" | _ -> assert false)
-
- let orf_lo = (match site1 with Some site -> String.length site.(0) | None -> 0) + (sites5' * 3)
- let orf_hi = orf_lo + 2 + (sitesCDS * 3)
- printf "\t%d\t%d" orf_lo orf_hi
-
- Enum.concat (List.enum [ (match site1 with Some site -> Enum.singleton site | None -> Enum.empty ());
- Enum.take sites5' utr_producer;
- Enum.singleton atg;
- Enum.take sitesCDS cds_producer;
- Enum.singleton stop;
- Enum.take sites3' utr_producer ])
-
-let stringify_alignment_columns cols =
- let col0 = Option.get (Enum.peek cols)
- let rows = Array.length col0
- let bufs = Array.init rows (fun _ -> Buffer.create 1000)
- cols |> iter
- fun col ->
- for i = 0 to rows-1 do
- Buffer.add_string bufs.(i) col.(i)
- Array.map Buffer.contents bufs
-
-let maybe_revcomp seqs =
- if Opt.get randomize_strand && Random.bool () then
- printf "\t-"
- Array.map Code.DNA.revcomp seqs
- else
- printf "\t+"
- seqs
-
-let mfa headers seqs =
- assert (Array.length headers = Array.length seqs)
- let buf = Buffer.create 1000
- Array.iter2
- fun header seq ->
- Buffer.add_string buf (sprintf ">%s\n" header)
- Buffer.add_string buf seq
- Buffer.add_char buf '\n'
- headers
- seqs
- Buffer.contents buf
-
-let run_phylocsf aln =
- let cmd = sprintf "%s %s%s" fn_exe fp_params (if ForkMaybe.can_fork then " -p 8" else "")
-
- let phylocsf_in, phylocsf_out = Unix.open_process ~cleanup:true cmd
- output_string phylocsf_out aln
- close_out phylocsf_out
-
- let phylocsf_answer = input_line phylocsf_in
- match Unix.close_process (phylocsf_in,phylocsf_out) with
- | Unix.WEXITED 0 -> String.nsplit phylocsf_answer "\t"
- | Unix.WEXITED c -> exit c
- | _ -> raise Exit
-
-let main () =
- let _, t, model = load_parameters ()
-
- let headers = Array.init (T.leaves t) (T.label t)
-
- for i = 1 to Opt.get n do
- printf "\ttruth\t\t\t\t"
- let aln = mfa headers (maybe_revcomp (stringify_alignment_columns (full_alignment_columns model)))
- printf "\n"
- flush stdout
- flush stderr
-
- let phylocsf_result = run_phylocsf aln
- printf "%s\n" (String.join "\t" phylocsf_result)
- printf "\n"
- flush stdout
-
-main ()