Permalink
Switch branches/tags
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
78 lines (50 sloc) 1.89 KB

rna-pdb-tools

.. argparse::
   :ref: rna_pdb_tools.rna_pdb_tools.get_parser
   :prog: rna_pdb_toolsx.py

get RNAPuzzle ready

.. autoclass:: rna_pdb_tools.rna_pdb_tools_lib.RNAStructure
   :members: get_rnapuzzle_ready

get sequence

Example:

$ rna_pdb_toolsx.py --get_seq 5_solution_1.pdb
> 5_solution_1.pdb A:1-576
CAUCCGGUAUCCCAAGACAAUCUCGGGUUGGGUUGGGAAGUAUCAUGGCUAAUCACCAUGAUGCAAUCGGGUUGAACACUUAAUUGGGUUAAAACGGUGGGGGACGAUCCCGUAACAUCCGUCCUAACGGCGACAGACUGCACGGCCCUGCCUCAGGUGUGUCCAAUGAACAGUCGUUCCGAAAGGAAG
.. autoclass:: rna_pdb_tools.rna_pdb_tools_lib.RNAStructure
   :members: get_seq

fetch

Example:

$ rna_pdb_toolsx.py --fetch 1xjr
downloading...1xjr ok
.. autofunction:: rna_pdb_tools.rna_pdb_tools_lib.fetch

fetch Biological Assembly

Example:

$ rna_pdb_toolsx.py --fetch_ba 1xjr
downloading...1xjr_ba.pdb ok

or over a list of pdb ids in a text file:

$ cat data/pdb_ids.txt
1y26
1fir

$ while read p; do rna_pdb_toolsx.py --fetch_ba $p; done < data/pdb_ids.txt
downloading...1y26_ba.pdb ok
downloading...1fir_ba.pdb ok

$ ls *.pdb
1fir_ba.pdb 1y26_ba.pdb
.. autofunction:: rna_pdb_tools.rna_pdb_tools_lib.fetch_ba

delete

Examples:

$ for i in *pdb; do rna_pdb_toolsx.py --delete A:46-56 $i > ../rpr_rm_loop/$i ; done

go over all files in the current directory, remove a fragment of chain A, residues between 46-56 (including them) and save outputs to in the folder rpr_rm_loops.

edit

.. autofunction:: rna_pdb_tools.rna_pdb_tools_lib.edit_pdb

the library

.. automodule:: rna_pdb_tools.rna_pdb_tools_lib
 :members: