Skip to content
Permalink
Branch: master
Find file Copy path
Find file Copy path
Fetching contributors…
Cannot retrieve contributors at this time
113 lines (74 sloc) 2.79 KB

RNA PDB Tools

rna_pdb_toolsx

.. argparse::
   :ref: rna_tools.rna_pdb_toolsx.get_parser
   :prog: rna_pdb_toolsx.py

get RNAPuzzle ready

.. autoclass:: rna_tools.rna_tools_lib.RNAStructure
   :members: get_rnapuzzle_ready

get sequence

Example:

$ rna_pdb_toolsx.py --get-seq 5_solution_1.pdb
> 5_solution_1.pdb A:1-576
CAUCCGGUAUCCCAAGACAAUCUCGGGUUGGGUUGGGAAGUAUCAUGGCUAAUCACCAUGAUGCAAUCGGGUUGAACACUUAAUUGGGUUAAAACGGUGGGGGACGAUCCCGUAACAUCCGUCCUAACGGCGACAGACUGCACGGCCCUGCCUCAGGUGUGUCCAAUGAACAGUCGUUCCGAAAGGAAG
.. autoclass:: rna_tools.rna_tools_lib.RNAStructure
   :members: get_seq

fetch

Example:

$ rna_pdb_toolsx.py --fetch 1xjr
downloading...1xjr ok
.. autofunction:: rna_tools.rna_tools_lib.fetch

fetch Biological Assembly

Example:

$ rna_pdb_toolsx.py --fetch-ba 1xjr
downloading...1xjr_ba.pdb ok

or over a list of pdb ids in a text file:

$ cat data/pdb_ids.txt
1y26
1fir

$ while read p; do rna_pdb_toolsx.py --fetch-ba $p; done < data/pdb_ids.txt
downloading...1y26_ba.pdb ok
downloading...1fir_ba.pdb ok

$ ls *.pdb
1fir_ba.pdb 1y26_ba.pdb
.. autofunction:: rna_tools.rna_tools_lib.fetch_ba

delete

Examples:

$ for i in *pdb; do rna_pdb_toolsx.py --delete A:46-56 $i > ../rpr_rm_loop/$i ; done

go over all files in the current directory, remove a fragment of chain A, residues between 46-56 (including them) and save outputs to in the folder rpr_rm_loops.

edit

.. autofunction:: rna_tools.rna_tools_lib.edit_pdb

the library

.. automodule:: rna_tools.rna_tools_lib
 :members:


PDB Edit Bfactor/Occupancy

.. argparse::
   :ref: rna_tools.tools.rna_pdb_edit_occupancy_bfactor.rna_pdb_edit_occupancy_bfactor.get_parser
   :prog: rna_pdb_edit_occupancy_bfactor.py

.. autofunction:: rna_tools.tools.rna_pdb_edit_occupancy_bfactor.rna_pdb_edit_occupancy_bfactor.edit_occupancy_of_pdb

Add chain to a file

.. automodule:: rna_tools.tools.misc.rna_add_chain
   :members:
   :undoc-members:

.. argparse::
   :ref: rna_tools.tools.misc.rna_add_chain.get_parser
   :prog: rna_add_chain

Measure distance between atoms

.. argparse::
   :ref: rna_tools.tools.pdbs_measure_atom_dists.pdbs_measure_atom_dists.get_parser
   :prog: pdbs_measure_atom_dists

.. automodule:: rna_tools.tools.pdbs_measure_atom_dists.pdbs_measure_atom_dists
   :members:
   :undoc-members:
You can’t perform that action at this time.