-----------------------------------------------
NOVOPlasty: The Organelle Assembler
Version 4.3.1
Author: Nicolas Dierckxsens, (c) 2015-2020
-----------------------------------------------


Input parameters from the configuration file:   *** Verify if everything is correct ***

Project:
----------------------
Project name          = mito_1_375
Type                  = mito
Genome range          = 15000-18000
K-mer                 = 33
Max memory            = 64
Extended log          = 1
Save assembled reads  = yes
Seed Input            = NC_008434.1_Vv_complete_mitogenome16813bp.fasta
Extend seed directly  = no
Reference sequence    = 
Variance detection    = 
Chloroplast sequence  = 

Dataset 1:
----------------------
Read Length           = 151
Insert size           = 350
Platform              = illumina
Single/Paired         = PE
Combined reads        = 
Forward reads         = /mnt/scratch/c1845371/whole_genome/data/375_R1.fastq.gz
Reverse reads         = /mnt/scratch/c1845371/whole_genome/data/375_R2.fastq.gz
Store Hash            = 

Heteroplasmy:
-----------------------
Heteroplasmy          = 
HP exclude list       = 
PCR-free              = 

Optional:
----------------------
Insert size auto      = yes
Use Quality Scores    = 
Output path           = /mnt/scratch/c1845371/whole_genome/mitochondrial_genome/mito_12/

Subsampled fraction: 24.14 %
Forward reads without pair: 13259
Reverse reads without pair: 5025

Retrieve Seed...

Initial read retrieved successfully: TCTTACACCCGCCAGATCTTGCTGTCTATCTATAGATATCATTTCCTTGATATTTTATTTTTTACCGCCTCTATAGTTCGCACCAACAAAGCCAAAAACAAAAGTTAATGTAGCTTAATTAGTAAAGCAAGGCACTGAAAATGCCAAGATG

Start Assembly...


------------Assembly 1 finished: Contigs are automatically merged in Merged_contigs file------------

Contig 01                  : 16521 bp
Contig 02                  : 349 bp
Contig 03                  : 992 bp
Contig 04                  : 385 bp
Contig 05                  : 881 bp

Total contigs              : 5
Largest contig             : 16521 bp
Smallest contig            : 349 bp
Average insert size        : 337 bp


-----------------------------------------Input data metrics-----------------------------------------

Total reads                : 105400318
Aligned reads              : 455762
Assembled reads            : 418834
Organelle genome %         : 0.43 %
Average organelle coverage : 4176

-----------------------------------------------------------------------------------------------------