Skip to content

HTTPS clone URL

Subversion checkout URL

You can clone with HTTPS or Subversion.

Download ZIP
Python module for reading .ab1 trace files
Python
branch: master

This branch is 106 commits behind bow:master

Fetching latest commit…

Cannot retrieve the latest commit at this time

Failed to load latest commit information.
tests
.gitignore
README.rst
abifpy.py
demo.py

README.rst

ABIFPY

Python module for reading .ab1 trace files

abifpy is a python module that extracts sequence and various other data from Applied Biosystem's, Inc. format (ABIF) file. The module was written based on the official spec released by Applied Biosystems.

Methods and Atrributes

The module provides the following methods and attributes:

seq()
Returns a string of nucleotide sequence from the trace file.
seqrecord()
Returns a SeqRecord object of the trace file (if Biopython is installed).
qual([char=True])
Returns a list of ascii characters of phred quality values (offset 33) if char=False, the phred quality values is returned instead.
trim(sequence[, cutoff=0.05])
Trims the sequence using Richard Mott's algorithm (used in phred) with the probability cutoff of 0.05, can be used for trimming quality values returned by qual() as well.
get_data(key)
Returns a metadata stored in the file, accepts keys from data (see below). This is a half-cooked method, not yet capable of extracting the entire file metadata.
write([out_file="", qual=0])
Writes a fasta (qual=0), qual (qual=1), or fastq (qual=1) file from the trace file. Default output is tracefile.fa.
TAGS
Dictionary for determining which metadata are extracted.
meta
Dictionary that contains the file metadata. The keys are values of TAGS, except for id which is the trace file name. Default keys are sampleid (sample ID), well (sample well), and instrument (sequencing machine model).
data
Dictionary of tags with values of data directory contents. Keys are tag name and tag number, concatenated. Use get_data() to decode values in data.

Usage

$ python
>>> import abifpy
>>> yummy = abifpy.Trace('tracefile.ab1')

Or if you want to perform base trimming directly:

>>> yummy = abifpy.Trace('tracefile.ab1', trimming=True)

Sequencing results can be accessed as string or as a Biopython SeqRecord object:

>>> yummy.seq()
'GCCAAGGTGCAGACTTCCATCT'
>>> yummy.seqrecord()
SeqRecord(seq=Seq('GCCAAGGTGCAGACTTCCATCT', Alphabet()), id='tracefile1', name='', description='tracefile1 seq', dbxrefs=[])

If trimming was not performed when instantiating, you can still do it afterwards:

>>> yummy.trim(yummy.seq())

The quality values itself can be trimmed as well:

>>> yummy.trim(yummy.qual())

Viewing the trace file metadata is easy:

>>> yummy.meta['sampleid']
'TOPO_clone1_F'
>>> yummy.meta['well']
'B6'
>>> yummy.meta['instrument']
'3730xl'

Metadata not contained in meta can be viewed using get_dir() with one of the keys in data as the argument, e.g.:

>>> yummy.get_dir('GTyp1')
'POP7'

Be warned that this method is half-cooked. Sometimes it returns the value you want, other times it returns None. For more info on the meaning of these tags and the file metadata, consult the official spec.

Installation

Just add the abifpy directory to your $PYTHONPATH (in .bashrc to make it persistent).

License

abifpy is licensed under the MIT License.

Copyright (c) 2011 by Wibowo Arindrarto

Permission is hereby granted, free of charge, to any person obtaining a copy of this software and associated documentation files (the "Software"), to deal in the Software without restriction, including without limitation the rights to use, copy, modify, merge, publish, distribute, sublicense, and/or sell copies of the Software, and to permit persons to whom the Software is furnished to do so, subject to the following conditions:

The above copyright notice and this permission notice shall be included in all copies or substantial portions of the Software.

THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE SOFTWARE.

Something went wrong with that request. Please try again.