Skip to content
New issue

Have a question about this project? Sign up for a free GitHub account to open an issue and contact its maintainers and the community.

By clicking “Sign up for GitHub”, you agree to our terms of service and privacy statement. We’ll occasionally send you account related emails.

Already on GitHub? Sign in to your account

Jump to bottom

Alignment with LOVD - Complex Variant Handling #328

Open
Peter-J-Freeman opened this issue Jan 7, 2022 · 5 comments
Open

Alignment with LOVD - Complex Variant Handling #328

Peter-J-Freeman opened this issue Jan 7, 2022 · 5 comments
Assignees
@RSWilson1 @rklocke @AishKW @rachaelaye
Milestone
2.0.1

Comments

@Peter-J-Freeman
Copy link
Collaborator

Peter-J-Freeman commented Jan 7, 2022 •
edited

Is your feature request related to a problem? Please describe.
Currently VariantValidator does not handle several complex variant types that the LOVD syntax checker can. These include, but are not limited to

  • Fuzzy ends (i.e. position = ?)
  • Uncertain position (i.e. position = (x_y) or (x_?)
  • Expanded repeat syntaxes
  • Insertions in the format referenceSequence:type.Range (including conversions - however, @leicray @ifokkema, conversions are now dropped????)

Describe the solution you'd like
We need to at least be able to validate these variants syntactically. If possible, convert them into a simple form and return the syntactically correct variant description plus an updated Core description for use in publication and guidance about "supplementary secondary descriptions (i.e. particularly for expanded repeats where the core description ought to be a del or a dup, supplemented by an expanded repeat description)

Additional context
The current dev version of VV produces the following when provided with a truth set from @loeswerkman

# Metadata: variantvalidator_version: 1.0.5.dev228+gee3fee4.d20211116, variantvalidator_hgvs_version: 2.0.1.dev2+g58fc52a, vvta_version: vvta_2021_2, vvseqrepo_db: VV_SR_2021_2/master, vvdb_version: vvdb_2021_4
Input	Warnings	Select transcript	HGVS_transcript	HGVS_intronic_chr_context	HGVS_intronic_rsg_context	HGVS_RefSeqGene	HGVS_LRG	HGVS_LRG_transcript	HGVS_Predicted_Protein	HGVS_Genomic_GRCh37	GRCh37_CHR	GRCh37_POS	GRCh37_ID	GRCh37_REF	GRCh37_ALT	HGVS_Genomic_GRCh38	GRCh38_CHR	GRCh38_POS	GRCh38_ID	GRCh38_REF	GRCh38_ALT	Gene_Symbol	HGNC_Gene_ID	Transcript_description	Alt_genomic_loci
ENSG00000198947.15:g.1del	Unable to map ENSG00000198947.15 to an equivalent RefSeq transcript	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
ENST00000357033.8:c.1del	Unable to map ENST00000357033.4 to an equivalent RefSeq transcript	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.	LRG_199:g.: char 11: end of input	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.((123_234))del(50)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.((123_234)_(345_456)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.((1_2insA)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.((1_5)ins(50))	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.((1_5)insN[(50_60)])	LRG_199:g.((1_5)insN[(50_60)]): char 11: expected one of ?, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(100_200)_(400_500)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(100_200)_500del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(100_200)del50	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(10_?)_(?_5)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(123_234)_(345_456))del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(1_10)_20insA	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(1_10)insA	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(1_100)ACT[20]A	LRG_199:g.(1_100)ACT[20]A: char 20: expected the character =	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(1_100)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(1_100)del(30)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(1_100)del50	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(1_100)delA	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(1_100)inv(30)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(1_2)insA	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(1_2insN[(50_60)])	LRG_199:g.(1_2insN[(50_60)]): char 14: expected one of ), or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(5_1)_10dup	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(5_?)_(?_10)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(5_?)_(?_10)del(3)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(5_?)_(?_?)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(5_?)_10del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(5_?)_?del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(7_5)_1dup	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(?_5)_(10_?)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(?_5)_(?_?)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(?_5)_10del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(?_5)_?del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(?_?)_(10_?)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(?_?)_(?_10)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(?_?)_(?_?)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(?_?)_10del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.(?_?)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.*123dup	LRG_199:g.*123dup: char 10: expected one of (, ?, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.*1_*2del	LRG_199:g.*1_*2del: char 10: expected one of (, ?, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.-123dup	LRG_199:g.-123dup: char 10: expected one of (, ?, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.100_(400_500)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.100_200con400_500	Gene conversions currently unsupported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123-5dup	LRG_199:g.123-5dup: char 13: expected one of =, _, con, copy, del, dup, ins, inv, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123000-125000dup	LRG_199:g.123000-125000dup: char 16: expected one of =, _, con, copy, del, dup, ins, inv, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123=	LRG_199:g.123= automapped to equivalent RefSeq record NG_012232.1:g.123=|NG_012232.1:g.123A= automapped to genome position NC_000023.11:g.33344487T=|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123=	LRG_199:g.123= automapped to equivalent RefSeq record NG_012232.1:g.123=|NG_012232.1:g.123A= automapped to genome position NC_000023.11:g.33344487T=|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.123A=	LRG_199:g.123A=	None	None	NC_000023.10:g.33362604=	X	33362604	.	T	T	NC_000023.11:g.33344487=	X	33344487	.	T	T	None	None	None	None
LRG_199:g.123=//A>G	LRG_199:g.123=//A>G: char 14: expected EOF	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123=/A>G	LRG_199:g.123=/A>G: char 14: expected EOF	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123A=	LRG_199:g.123A= automapped to equivalent RefSeq record NG_012232.1:g.123A=|NG_012232.1:g.123A= automapped to genome position NC_000023.11:g.33344487T=|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123A=	LRG_199:g.123A= automapped to equivalent RefSeq record NG_012232.1:g.123A=|NG_012232.1:g.123A= automapped to genome position NC_000023.11:g.33344487T=|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.123A=	LRG_199:g.123A=	None	None	NC_000023.10:g.33362604=	X	33362604	.	T	T	NC_000023.11:g.33344487=	X	33344487	.	T	T	None	None	None	None
LRG_199:g.123A>C	LRG_199:g.123A>C automapped to equivalent RefSeq record NG_012232.1:g.123A>C|NG_012232.1:g.123A>C automapped to genome position NC_000023.11:g.33344487T>G|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123A>C	LRG_199:g.123A>C automapped to equivalent RefSeq record NG_012232.1:g.123A>C|NG_012232.1:g.123A>C automapped to genome position NC_000023.11:g.33344487T>G|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.123A>C	LRG_199:g.123A>C	None	None	NC_000023.10:g.33362604T>G	X	33362604	.	T	G	NC_000023.11:g.33344487T>G	X	33344487	.	T	G	None	None	None	None
LRG_199:g.123A>Ciets	LRG_199:g.123A>Ciets: char 16: expected EOF	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123A>GC	Failed to fetch LRG_199 from SeqRepo (/Users/Shared/seqrepo_dumps/VV_SR_2021_2/master) (Alias LRG_199 (namespace: None))|LRG_199:g.123A>GC automapped to LRG_199:g.123_123delAinsGC	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123_124A>C	LRG_199:g.123_124A>C automapped to equivalent RefSeq record NG_012232.1:g.123_124A>C|NG_012232.1:g.123_124A>C: Variant reference (A) does not agree with reference sequence (AA)	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123_124AT>GC	Failed to fetch LRG_199 from SeqRepo (/Users/Shared/seqrepo_dumps/VV_SR_2021_2/master) (Alias LRG_199 (namespace: None))|LRG_199:g.123_124AT>GC automapped to LRG_199:g.123_124delATinsGC	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123_125dupACG	Removing redundant reference bases from variant description|LRG_199:g.123_125dupACG automapped to equivalent RefSeq record NG_012232.1:g.123_125dupACG|NG_012232.1:g.123_125dupACG: Variant reference (ACG) does not agree with reference sequence (AAA)	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123_170dup	LRG_199:g.123_170dup automapped to equivalent RefSeq record NG_012232.1:g.123_170dup|NG_012232.1:g.123_170dupAAACAAATTCAACAGTACATCAAAAGGATTATATACCATGATCAGGTG automapped to genome position NC_000023.11:g.33344440_33344487dupCACCTGATCATGGTATATAATCCTTTTGATGTACTGTTGAATTTGTTT|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123_170dup	LRG_199:g.123_170dup automapped to equivalent RefSeq record NG_012232.1:g.123_170dup|NG_012232.1:g.123_170dupAAACAAATTCAACAGTACATCAAAAGGATTATATACCATGATCAGGTG automapped to genome position NC_000023.11:g.33344440_33344487dupCACCTGATCATGGTATATAATCCTTTTGATGTACTGTTGAATTTGTTT|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.123_170dup	LRG_199:g.123_170dup	None	None	NC_000023.10:g.33362557_33362604dup	X	33362556	.	C	CCACCTGATCATGGTATATAATCCTTTTGATGTACTGTTGAATTTGTTT	NC_000023.11:g.33344440_33344487dup	X	33344439	.	C	CCACCTGATCATGGTATATAATCCTTTTGATGTACTGTTGAATTTGTTT	None	None	None	None
LRG_199:g.123a>g	LRG_199:g.123A>G automapped to equivalent RefSeq record NG_012232.1:g.123A>G|NG_012232.1:g.123A>G automapped to genome position NC_000023.11:g.33344487T>C|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123a>g	LRG_199:g.123A>G automapped to equivalent RefSeq record NG_012232.1:g.123A>G|NG_012232.1:g.123A>G automapped to genome position NC_000023.11:g.33344487T>C|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.123A>G	LRG_199:g.123A>G	None	None	NC_000023.10:g.33362604T>C	X	33362604	.	T	C	NC_000023.11:g.33344487T>C	X	33344487	.	T	C	None	None	None	None
LRG_199:g.123conNC_000001.10:100_200	Gene conversions currently unsupported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123del	LRG_199:g.123del automapped to equivalent RefSeq record NG_012232.1:g.123del|NG_012232.1:g.123delA automapped to genome position NC_000023.11:g.33344488delT|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123del	LRG_199:g.123del automapped to equivalent RefSeq record NG_012232.1:g.123del|NG_012232.1:g.123delA automapped to genome position NC_000023.11:g.33344488delT|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.125del	LRG_199:g.125del	None	None	NC_000023.10:g.33362605del	X	33362601	.	GT	G	NC_000023.11:g.33344488del	X	33344484	.	GT	G	None	None	None	None
LRG_199:g.123dup	LRG_199:g.123dup automapped to equivalent RefSeq record NG_012232.1:g.123dup|NG_012232.1:g.123dupA automapped to genome position NC_000023.11:g.33344488dupT|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123dup	LRG_199:g.123dup automapped to equivalent RefSeq record NG_012232.1:g.123dup|NG_012232.1:g.123dupA automapped to genome position NC_000023.11:g.33344488dupT|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.125dup	LRG_199:g.125dup	None	None	NC_000023.10:g.33362605dup	X	33362601	.	G	GT	NC_000023.11:g.33344488dup	X	33344484	.	G	GT	None	None	None	None
LRG_199:g.123insAUG	LRG_199:g.123insAUG: char 18: expected EOF	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123insactg	LRG_199:g.123insACTG automapped to equivalent RefSeq record NG_012232.1:g.123insACTG|insertion length must be 1	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123lom	LRG_199:g.123lom: char 13: expected one of =, _, con, copy, del, dup, ins, inv, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123	LRG_199:g.123: char 14: end of input	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
bsrC	Variant description bsrC is not in an accepted format	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123	LRG_199:g.123: char 14: end of input	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
gom	Variant description gom is not in an accepted format	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123	LRG_199:g.123: char 14: end of input	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
lom	Variant description lom is not in an accepted format	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123	LRG_199:g.123: char 14: end of input	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
met=	Variant description met= is not in an accepted format	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.123	LRG_199:g.123: char 14: end of input	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
None	Variant description  is not in an accepted format	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
bsrC	Variant description bsrC is not in an accepted format	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.140712592-140712592C>T	LRG_199:g.140712592-140712592C>T: char 19: expected one of =, _, con, copy, del, dup, ins, inv, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1ACT[20]	LRG_199:g.1ACT[20]: char 14: expected the character =	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1ACT[20]A	LRG_199:g.1ACT[20]A: char 14: expected the character =	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1AC[20]	LRG_199:g.1AC[20]: char 13: expected the character =	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_(7_5)dup	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_10insA	LRG_199:g.1_10insA automapped to equivalent RefSeq record NG_012232.1:g.1_10insA|insertion length must be 1	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_1del	LRG_199:g.1del automapped to equivalent RefSeq record NG_012232.1:g.1del|NG_012232.1:g.1delC automapped to genome position NC_000023.11:g.33344609delG|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_1del	LRG_199:g.1del automapped to equivalent RefSeq record NG_012232.1:g.1del|NG_012232.1:g.1delC automapped to genome position NC_000023.11:g.33344609delG|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.1del	LRG_199:g.1del	None	None	NC_000023.10:g.33362726del	X	33362725	.	TG	T	NC_000023.11:g.33344609del	X	33344608	.	TG	T	None	None	None	None
LRG_199:g.1_1insA	LRG_199:g.1insA automapped to equivalent RefSeq record NG_012232.1:g.1insA|insertion length must be 1	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins	LRG_199:g.1_2ins: char 17: end of input	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins(50)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins(5_10)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins340	LRG_199:g.1_2ins340: char 16: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins5_10	LRG_199:g.1_2ins5_10: char 16: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2insA	LRG_199:g.1_2insA automapped to equivalent RefSeq record NG_012232.1:g.1_2insA|NG_012232.1:g.1_2insA automapped to genome position NC_000023.11:g.33344608dupT|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2insA	LRG_199:g.1_2insA automapped to equivalent RefSeq record NG_012232.1:g.1_2insA|NG_012232.1:g.1_2insA automapped to genome position NC_000023.11:g.33344608dupT|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.2dup	LRG_199:g.2dup	None	None	NC_000023.10:g.33362725dup	X	33362724	.	A	AT	NC_000023.11:g.33344608dup	X	33344607	.	A	AT	None	None	None	None
LRG_199:g.1_2insN	LRG_199:g.1_2insN automapped to equivalent RefSeq record NG_012232.1:g.1_2insN|NG_012232.1:g.1_2insN automapped to genome position NC_000023.11:g.33344608_33344609insN|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2insN	LRG_199:g.1_2insN automapped to equivalent RefSeq record NG_012232.1:g.1_2insN|NG_012232.1:g.1_2insN automapped to genome position NC_000023.11:g.33344608_33344609insN|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.1_2insN	LRG_199:g.1_2insN	None	None	NC_000023.10:g.33362725_33362726insN	X	33362725	.	T	TN	NC_000023.11:g.33344608_33344609insN	X	33344608	.	T	TN	None	None	None	None
LRG_199:g.1_2insNC123456.1:g.1_10	LRG_199:g.1_2insNC123456.1g.1_10: char 19: expected EOF	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2insN[10]	LRG_199:g.1_2insN[10]: char 18: expected EOF	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins[123	LRG_199:g.1_2ins[123: char 16: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins[1_2;A]	LRG_199:g.1_2ins[1_2;A]: char 16: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins[ACT;(20)]	LRG_199:g.1_2ins[ACT;(20)]: char 16: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins[A[20];TGAAG[35];N[10]]	LRG_199:g.1_2ins[A[20];TGAAG[35];N[10]]: char 16: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins[A]	LRG_199:g.1_2ins[A]: char 16: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins[NC_123456.1:g.1_10;A;123_125;TGCG]	LRG_199:g.1_2ins[NC_123456.1g.1_10;A;123_125;TGCG]: char 16: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_2ins[NC_123456.1:g.1_10]	LRG_199:g.1_2ins[NC_123456.1g.1_10]: char 16: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_300del	LRG_199:g.1_300del automapped to equivalent RefSeq record NG_012232.1:g.1_300del|NG_012232.1:g.1_300del automapped to genome position NC_000023.11:g.33344311_33344610del|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_300del	LRG_199:g.1_300del automapped to equivalent RefSeq record NG_012232.1:g.1_300del|NG_012232.1:g.1_300del automapped to genome position NC_000023.11:g.33344311_33344610del|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	NC_000023.10:g.33362428_33362727del	X	33362426	.	AACTTTTTCAAATGGTTTTTTCTGCATCTATTAAGATGGTCATGTGGTTCTTGTCTTTTACTCCGTTTATGTGATATATCACATTGATTGATTTGCATGCCATACCAACCTTGCATCTTGGAGATAAATCCCACCTGATCATGGTATATAATCCTTTTGATGTACTGTTGAATTTGTTTTGCTAGTATTTTATTGAGGATTTTTGGATCTATACACATCAGAGTTACCCTCCTGTAGTGTTCTTTTATTGTGGTATCTTTGCCTGGCTTTGGTGCCAGTGTGATTCTGGCTTCATAAAATG	A	NC_000023.11:g.33344311_33344610del	X	33344309	.	AACTTTTTCAAATGGTTTTTTCTGCATCTATTAAGATGGTCATGTGGTTCTTGTCTTTTACTCCGTTTATGTGATATATCACATTGATTGATTTGCATGCCATACCAACCTTGCATCTTGGAGATAAATCCCACCTGATCATGGTATATAATCCTTTTGATGTACTGTTGAATTTGTTTTGCTAGTATTTTATTGAGGATTTTTGGATCTATACACATCAGAGTTACCCTCCTGTAGTGTTCTTTTATTGTGGTATCTTTGCCTGGCTTTGGTGCCAGTGTGATTCTGGCTTCATAAAATG	A	None	None	None	None
LRG_199:g.1_5delinsACT	LRG_199:g.1_5delinsACT automapped to equivalent RefSeq record NG_012232.1:g.1_5delinsACT|NG_012232.1:g.1_5delinsACT automapped to genome position NC_000023.11:g.33344606_33344609delinsGT|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_5delinsACT	LRG_199:g.1_5delinsACT automapped to equivalent RefSeq record NG_012232.1:g.1_5delinsACT|NG_012232.1:g.1_5delinsACT automapped to genome position NC_000023.11:g.33344606_33344609delinsGT|Removing redundant reference bases from variant description|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.1_4delinsAC	LRG_199:g.1_4delinsAC	None	None	NC_000023.10:g.33362723_33362726delinsGT	X	33362723	.	AATG	GT	NC_000023.11:g.33344606_33344609delinsGT	X	33344606	.	AATG	GT	None	None	None	None
LRG_199:g.1_?del	Fuzzy/unknown variant end position in submitted variant description	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_cendel	LRG_199:g.1_cendel: char 12: expected one of ?, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1_qterdel	LRG_199:g.1_qterdel: char 12: expected one of ?, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1delA	Removing redundant reference bases from variant description|LRG_199:g.1delA automapped to equivalent RefSeq record NG_012232.1:g.1delA|NG_012232.1:g.1delA: Variant reference (A) does not agree with reference sequence (C)	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1delinsA	LRG_199:g.1delinsA automapped to equivalent RefSeq record NG_012232.1:g.1delinsA|NG_012232.1:g.1C>A automapped to genome position NC_000023.11:g.33344609G>T|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1delinsA	LRG_199:g.1delinsA automapped to equivalent RefSeq record NG_012232.1:g.1delinsA|NG_012232.1:g.1C>A automapped to genome position NC_000023.11:g.33344609G>T|No transcripts found that fully overlap the described variation in the genomic sequence	None	None	None	None	NG_012232.1:g.1C>A	LRG_199:g.1C>A	None	None	NC_000023.10:g.33362726G>T	X	33362726	.	G	T	NC_000023.11:g.33344609G>T	X	33344609	.	G	T	None	None	None	None
LRG_199:g.1insA	LRG_199:g.1insA automapped to equivalent RefSeq record NG_012232.1:g.1insA|insertion length must be 1	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.1inv(30)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.2_1del	Interval end position 1 < interval start position 2	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.2_1dup	Interval end position 1 < interval start position 2	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.5_(10_?)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.5_(?_10)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.5_(?_?)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.=	LRG_199:g.=: char 10: expected one of (, ?, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.?_(10_?)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.?_(?_10)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.?_100del	Fuzzy/unknown variant start position in submitted variant description	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.?_?del	Fuzzy/unknown variant start and end positions in submitted variant description	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.?del	Fuzzy/unknown variant start and end positions in submitted variant description	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199:g.pter_1000000del	LRG_199:g.pter_1000000del: char 10: expected one of (, ?, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:	NM_004006.2:c.: char 15: end of input	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:(123delA)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:(123dup)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:(c.(123_125)insA)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:.123dup	NM_004006.2:c..123dup: char 14: expected one of (, *, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:123-5dup	The entered coordinates do not agree with the intron/exon boundaries for the selected transcript|A more recent version of the selected reference sequence NM_004006.2 is available (NM_004006.3): NM_004006.3:c.118dup MUST be fully validated prior to use in reports: select_variants=NM_004006.3:c.118dup	RefSeq	NM_004006.2:c.118dup	None	None	NG_012232.1:g.494814dup	LRG_199:g.494814dup	LRG_199t1:c.118dup	NP_003997.1:p.(Leu40ProfsTer4)	NC_000023.10:g.32867914dup	X	32867912	.	A	AG	NC_000023.11:g.32849797dup	X	32849795	.	A	AG	DMD	HGNC:2928	Homo sapiens dystrophin (DMD), transcript variant Dp427m, mRNA	None
LRG_199t1:123dup	A more recent version of the selected reference sequence NM_004006.2 is available (NM_004006.3): NM_004006.3:c.123dup MUST be fully validated prior to use in reports: select_variants=NM_004006.3:c.123dup	RefSeq	NM_004006.2:c.123dup	None	None	NG_012232.1:g.494819dup	LRG_199:g.494819dup	LRG_199t1:c.123dup	NP_003997.1:p.(Ser42GlnfsTer2)	NC_000023.10:g.32867908dup	X	32867907	.	T	TG	NC_000023.11:g.32849791dup	X	32849790	.	T	TG	DMD	HGNC:2928	Homo sapiens dystrophin (DMD), transcript variant Dp427m, mRNA	None
LRG_199t1:c.(10+1_?)_(?_5-1)del	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.(123_124TG=)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.(1_100)del(20)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.(1_2)insA	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.10000000+10000000000_10000001-10000000000del	LRG_199t1:c.10000000+10000000000_10000001-10000000000del automapped to equivalent RefSeq record NM_004006.2:c.10000000+10000000000_10000001-10000000000del|Required information for NM_004006.2 is missing from the Universal Transcript Archive|Query gene2transcripts with search term NM_004006 for available transcripts	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.123-5_123-10del	LRG_199t1:c.123-5_123-10del automapped to equivalent RefSeq record NM_004006.2:c.123-5_123-10del|base start position must be <= end position: Did you mean NM_004006.2:c.123-10_123-5del?	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.123?	LRG_199t1:c.123?: char 15: expected one of =, _, con, copy, del, dup, ins, inv, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.123T=	LRG_199t1:c.123T= automapped to equivalent RefSeq record NM_004006.2:c.123T=|NM_004006.2:c.123T=: Variant reference (T) does not agree with reference sequence (C)	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.123_124TG=	LRG_199t1:c.123_124TG= automapped to equivalent RefSeq record NM_004006.2:c.123_124TG=|NM_004006.2:c.123_124TG=: Variant reference (TG) does not agree with reference sequence (CA)	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.123delA	Removing redundant reference bases from variant description|LRG_199t1:c.123delA automapped to equivalent RefSeq record NM_004006.2:c.123delA|NM_004006.2:c.123delA: Variant reference (A) does not agree with reference sequence (C)	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.123dup	LRG_199t1:c.123dup automapped to equivalent RefSeq record NM_004006.2:c.123dup|A more recent version of the selected reference sequence NM_004006.2 is available (NM_004006.3): NM_004006.3:c.123dup MUST be fully validated prior to use in reports: select_variants=NM_004006.3:c.123dup	RefSeq	NM_004006.2:c.123dup	None	None	NG_012232.1:g.494819dup	LRG_199:g.494819dup	LRG_199t1:c.123dup	NP_003997.1:p.(Ser42GlnfsTer2)	NC_000023.10:g.32867908dup	X	32867907	.	T	TG	NC_000023.11:g.32849791dup	X	32849790	.	T	TG	DMD	HGNC:2928	Homo sapiens dystrophin (DMD), transcript variant Dp427m, mRNA	None
LRG_199t1:c.123—5del	Submitted variant description contains an invalid character(s) [—] at position(s) [16]: Please remove this character and re-submit: A useful search function for Unicode characters can be found at https://unicode-search.net/	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1ACT[20]	LRG_199t1:c.1ACT[20]: char 16: expected the character =	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1AC[20]	LRG_199t1:c.1AC[20]: char 15: expected the character =	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_100del(10)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_100insA	LRG_199t1:c.1_100insA automapped to equivalent RefSeq record NM_004006.2:c.1_100insA|insertion length must be 1	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_10insA	LRG_199t1:c.1_10insA automapped to equivalent RefSeq record NM_004006.2:c.1_10insA|insertion length must be 1	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_20insBLA	LRG_199t1:c.1_20insBLA: char 21: expected EOF	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_2A>G	LRG_199t1:c.1_2A>G automapped to equivalent RefSeq record NM_004006.2:c.1_2A>G|NM_004006.2:c.1_2A>G: Variant reference (A) does not agree with reference sequence (AT)	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_2ins	LRG_199t1:c.1_2ins: char 19: end of input	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_2ins(20)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_2ins(20_50)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_2ins(A)	Uncertain positions are not currently supported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_2ins[A]	LRG_199t1:c.1_2ins[A]: char 18: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1_2ins[N]	LRG_199t1:c.1_2ins[N]: char 18: Syntax error	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.1insA	LRG_199t1:c.1insA automapped to equivalent RefSeq record NM_004006.2:c.1insA|insertion length must be 1	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.5+1_5-1dup	LRG_199t1:c.5+1_5-1dup automapped to equivalent RefSeq record NM_004006.2:c.5+1_5-1dup|base start position must be <= end position: Did you mean NM_004006.2:c.5-1_5+1dup?	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.?	LRG_199t1:c.?: char 12: expected one of (, *, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:c.–123del	Submitted variant description contains an invalid character(s) [–] at position(s) [13]: Please remove this character and re-submit: A useful search function for Unicode characters can be found at https://unicode-search.net/	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:g.123_234conaaa	Gene conversions currently unsupported	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:n.123dup	LRG_199t1:n.123dup automapped to equivalent RefSeq record NM_004006.2:n.123dup|Coding transcript reference sequence input as non-coding transcript (n.) reference sequence. Did you mean NM_004006.2:c.123dup?	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:n.1del	LRG_199t1:n.1del automapped to equivalent RefSeq record NM_004006.2:n.1del|Coding transcript reference sequence input as non-coding transcript (n.) reference sequence. Did you mean NM_004006.2:c.1del?	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
LRG_199t1:n.5-2::10-3	LRG_199t1:n.5-210-3: char 17: expected one of =, _, con, copy, del, dup, ins, inv, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
NC_012920.1:m.123+4_124-20dup	NC_012920.1:m.123+4_124-20dup: char 17: expected one of =, _, con, copy, del, dup, ins, inv, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
NC_012920.1:m.123-5dup	NC_012920.1:m.123-5dup: char 17: expected one of =, _, con, copy, del, dup, ins, inv, or a digit	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
NC_012920.1:m.123dup	None	None	None	None	None	None	None	None	None	NC_012920.1:m.123dup	M	122	.	C	CA	NC_012920.1:m.123dup	M	122	.	C	CA	None	None	Homo sapiens mitochondrion, complete genome	None
NM_004006.2:c.1del	A more recent version of the selected reference sequence NM_004006.2 is available (NM_004006.3): NM_004006.3:c.1del MUST be fully validated prior to use in reports: select_variants=NM_004006.3:c.1del	RefSeq	NM_004006.2:c.1del	None	None	NG_012232.1:g.133298del	LRG_199:g.133298del	LRG_199t1:c.1del	NP_003997.1:p.(Met1?)	NC_000023.10:g.33229432del	X	33229428	.	AT	A	NC_000023.11:g.33211315del	X	33211311	.	AT	A	DMD	HGNC:2928	Homo sapiens dystrophin (DMD), transcript variant Dp427m, mRNA	None
NM_004006.2:n.1del	Coding transcript reference sequence input as non-coding transcript (n.) reference sequence. Did you mean NM_004006.2:c.1del?	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None
NR_015380.1:n.1del	VariantValidator cannot recover information for transcript NR_015380.1 because it is not available in the Universal Transcript Archive	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None	None

For reference, the input file was

ENSG00000198947.15:g.1del
ENST00000357033.8:c.1del
LRG_199:g.
LRG_199:g.((123_234))del(50)
LRG_199:g.((123_234)_(345_456)del
LRG_199:g.((1_2insA)
LRG_199:g.((1_5)ins(50))
LRG_199:g.((1_5)insN[(50_60)])
LRG_199:g.(100_200)_(400_500)del
LRG_199:g.(100_200)_500del
LRG_199:g.(100_200)del50
LRG_199:g.(10_?)_(?_5)del
LRG_199:g.(123_234)_(345_456))del
LRG_199:g.(1_10)_20insA
LRG_199:g.(1_10)insA
LRG_199:g.(1_100)ACT[20]A
LRG_199:g.(1_100)del
LRG_199:g.(1_100)del(30)
LRG_199:g.(1_100)del50
LRG_199:g.(1_100)delA
LRG_199:g.(1_100)inv(30)
LRG_199:g.(1_2)insA
LRG_199:g.(1_2insN[(50_60)])
LRG_199:g.(5_1)_10dup
LRG_199:g.(5_?)_(?_10)del
LRG_199:g.(5_?)_(?_10)del(3)
LRG_199:g.(5_?)_(?_?)del
LRG_199:g.(5_?)_10del
LRG_199:g.(5_?)_?del
LRG_199:g.(7_5)_1dup
LRG_199:g.(?_5)_(10_?)del
LRG_199:g.(?_5)_(?_?)del
LRG_199:g.(?_5)_10del
LRG_199:g.(?_5)_?del
LRG_199:g.(?_?)_(10_?)del
LRG_199:g.(?_?)_(?_10)del
LRG_199:g.(?_?)_(?_?)del
LRG_199:g.(?_?)_10del
LRG_199:g.(?_?)del
LRG_199:g.*123dup
LRG_199:g.*1_*2del
LRG_199:g.-123dup
LRG_199:g.100_(400_500)del
LRG_199:g.100_200con400_500
LRG_199:g.123-5dup
LRG_199:g.123000-125000dup
LRG_199:g.123=
LRG_199:g.123=//A>G
LRG_199:g.123=/A>G
LRG_199:g.123A=
LRG_199:g.123A>C
LRG_199:g.123A>Ciets
LRG_199:g.123A>GC
LRG_199:g.123_124A>C
LRG_199:g.123_124AT>GC
LRG_199:g.123_125dupACG
LRG_199:g.123_170dup
LRG_199:g.123a>g
LRG_199:g.123conNC_000001.10:100_200
LRG_199:g.123del
LRG_199:g.123dup
LRG_199:g.123insAUG
LRG_199:g.123insactg
LRG_199:g.123lom
LRG_199:g.123|bsrC
LRG_199:g.123|gom
LRG_199:g.123|lom
LRG_199:g.123|met=
LRG_199:g.123||bsrC
LRG_199:g.140712592-140712592C>T
LRG_199:g.1ACT[20]
LRG_199:g.1ACT[20]A
LRG_199:g.1AC[20]
LRG_199:g.1_(7_5)dup
LRG_199:g.1_10insA
LRG_199:g.1_1del
LRG_199:g.1_1insA
LRG_199:g.1_2ins
LRG_199:g.1_2ins(50)
LRG_199:g.1_2ins(5_10)
LRG_199:g.1_2ins340
LRG_199:g.1_2ins5_10
LRG_199:g.1_2insA
LRG_199:g.1_2insN
LRG_199:g.1_2insNC123456.1:g.1_10
LRG_199:g.1_2insN[10]
LRG_199:g.1_2ins[123
LRG_199:g.1_2ins[1_2;A]
LRG_199:g.1_2ins[ACT;(20)]
LRG_199:g.1_2ins[A[20];TGAAG[35];N[10]]
LRG_199:g.1_2ins[A]
LRG_199:g.1_2ins[NC_123456.1:g.1_10;A;123_125;TGCG]
LRG_199:g.1_2ins[NC_123456.1:g.1_10]
LRG_199:g.1_300del
LRG_199:g.1_5delinsACT
LRG_199:g.1_?del
LRG_199:g.1_cendel
LRG_199:g.1_qterdel
LRG_199:g.1delA
LRG_199:g.1delinsA
LRG_199:g.1insA
LRG_199:g.1inv(30)
LRG_199:g.2_1del
LRG_199:g.2_1dup
LRG_199:g.5_(10_?)del
LRG_199:g.5_(?_10)del
LRG_199:g.5_(?_?)del
LRG_199:g.=
LRG_199:g.?_(10_?)del
LRG_199:g.?_(?_10)del
LRG_199:g.?_100del
LRG_199:g.?_?del
LRG_199:g.?del
LRG_199:g.pter_1000000del
LRG_199t1:
LRG_199t1:(123delA)
LRG_199t1:(123dup)
LRG_199t1:(c.(123_125)insA)
LRG_199t1:.123dup
LRG_199t1:123-5dup
LRG_199t1:123dup
LRG_199t1:c.(10+1_?)_(?_5-1)del
LRG_199t1:c.(123_124TG=)
LRG_199t1:c.(1_100)del(20)
LRG_199t1:c.(1_2)insA
LRG_199t1:c.10000000+10000000000_10000001-10000000000del
LRG_199t1:c.123-5_123-10del
LRG_199t1:c.123?
LRG_199t1:c.123T=
LRG_199t1:c.123_124TG=
LRG_199t1:c.123delA
LRG_199t1:c.123dup
LRG_199t1:c.123—5del
LRG_199t1:c.1ACT[20]
LRG_199t1:c.1AC[20]
LRG_199t1:c.1_100del(10)
LRG_199t1:c.1_100insA
LRG_199t1:c.1_10insA
LRG_199t1:c.1_20insBLA
LRG_199t1:c.1_2A>G
LRG_199t1:c.1_2ins
LRG_199t1:c.1_2ins(20)
LRG_199t1:c.1_2ins(20_50)
LRG_199t1:c.1_2ins(A)
LRG_199t1:c.1_2ins[A]
LRG_199t1:c.1_2ins[N]
LRG_199t1:c.1insA
LRG_199t1:c.5+1_5-1dup
LRG_199t1:c.?
LRG_199t1:c.–123del
LRG_199t1:g.123_234conaaa
LRG_199t1:n.123dup
LRG_199t1:n.1del
LRG_199t1:n.5-2::10-3
NC_012920.1:m.123+4_124-20dup
NC_012920.1:m.123-5dup
NC_012920.1:m.123dup
NM_004006.2:c.1del
NM_004006.2:n.1del
NR_015380.1:n.1del
@Peter-J-Freeman Peter-J-Freeman added this to the 2.0.1 milestone Jan 7, 2022
Peter-J-Freeman pushed a commit that referenced this issue Jan 7, 2022
Templating for issue #328 Alignment with LOVD - Complex Variant Handling
562bf79
@i3hsInnovation
Copy link

i3hsInnovation commented Jan 10, 2022 •
edited

@rklocke and @RSWilson1 , you will need to perform a git pull to get the updates I pushed last week.

From @PeteCausey-Freeman

@Peter-J-Freeman
Copy link
Collaborator Author

Peter-J-Freeman commented Jan 14, 2022 •
edited

Copy of LOVD result_v1.xlsx
Hi, V1 of the LOVD set here, with the comment

Please note that we do have four false negatives, which you will find in rows 98, 99, 115, and 155. These are valid HGVS descriptions, but we have chosen not to support them in our tool yet for time management reasons.

@rklocke @RSWilson1, we can work through these but concentrate on the sub-categories you want to cover for now.

@leicray, it might be worth you working through these. I will too then we can get together and compare notes

@ifokkema ifokkema mentioned this issue Jan 14, 2022
Closed
This was referenced Jan 20, 2022
Closed
Closed
Closed
Closed
@ifokkema
Copy link
Collaborator

Hi Pete,
I'm still behind with many things, but I just wanted to double-check something and I tried a few variants. I can't reproduce the warnings that you mention.

  • LRG_199:g.(?_5)_10del.
    According to your schema, this should return "Uncertain positions are not currently supported". In my test, I got an HTTP500 using the LOVD endpoint. I decided to then use an NC:
  • NC_000023.10:g.(?_5)_10del
    Now I got "char 20: expected one of '=', 'con', 'copy', 'del', 'dup', 'ins', or 'inv'".
    Another variation:
  • NC_000023.10:g.(?_5)del
    Returns an even more cryptic "'<' not supported between instances of 'NoneType' and 'int'".

Is this all caused by differences between the endpoints? Ideally, all endpoints would use the same syntax validation, I suppose?

@Peter-J-Freeman
Copy link
Collaborator Author

We will look into this as part of this issue.
Effectively, these errors are not to be trusted because the variant types in question are not even supported so VV is making sense of what it currently knows and needs training. The errors for these variants will be absolute nonsense currently!

@ifokkema ifokkema mentioned this issue Jan 27, 2022
Open
11 tasks
@Peter-J-Freeman
Copy link
Collaborator Author

Peter-J-Freeman commented Jan 27, 2022 •
edited

Another type of variant which will be easy to support
#206

loss / gain of methylation

Examples in this paper https://clinicalepigeneticsjournal.biomedcentral.com/articles/10.1186/s13148-018-0460-9

This was referenced Jan 31, 2022
Open
Open
@ifokkema ifokkema mentioned this issue Dec 11, 2023
Open
Sign up for free to join this conversation on GitHub. Already have an account? Sign in to comment
Assignees

@RSWilson1 RSWilson1

@rklocke rklocke

@AishKW AishKW

@rachaelaye rachaelaye

Labels
None yet
Projects
None yet
Milestone
2.0.1
Development

No branches or pull requests
7 participants
@ifokkema @Peter-J-Freeman @RSWilson1 @i3hsInnovation @rklocke @AishKW @rachaelaye